ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags31o13
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1emb|AL512324.14| Human DNA sequence from clone RP11-432I13 on ch... 42 1.8
2emb|AJ250458.1|GGA250458 Gallus gallus zw10 gene (partial), cd3g... 42 1.8
3gb|AC008321.7| Drosophila melanogaster, chromosome 2L, region 23... 42 1.8
4gb|AC084511.1|CBRG17D06 Caenorhabditis briggsae cosmid G17D06, c... 42 1.8
5gb|AE003580.3| Drosophila melanogaster chromosome 2L, section 11... 42 1.8
6gb|AC158554.6| Mus musculus chromosome 15, clone RP23-353O17, co... 40 7.2
7gb|AC166258.12| Mus musculus BAC RP23-353G9 (Roswell Park Cance... 40 7.2
8gb|AF529222.1| Mus musculus Na-I related cotransporter mRNA, com... 40 7.2
9gb|AC123071.3| Mus musculus BAC clone RP23-70P8 from chromosome ... 40 7.2
10gb|AC133604.3| Mus musculus BAC clone RP23-416F12 from chromosom... 40 7.2
11gb|AC125172.4| Mus musculus BAC clone RP24-492I4 from chromosome... 40 7.2
12gb|AC073958.4| Homo sapiens BAC clone RP11-533L22 from 7, comple... 40 7.2
13gb|AC145092.1| Pan troglodytes BAC clone RP43-12J7 from 7, compl... 40 7.2
14gb|AC137839.19| Medicago truncatula clone mth2-34j11, complete s... 40 7.2
15gb|AC147483.13| Medicago truncatula clone mth2-22o7, complete se... 40 7.2
16emb|Z84487.2|HS346O6 Human DNA sequence from clone RP3-346O6 on ... 40 7.2
17emb|AL365215.23| Human DNA sequence from clone RP11-416D8 on chr... 40 7.2
18gb|AY964639.1| Mus musculus solute carrier family 5 member 12 (S... 40 7.2
19gb|AC160015.2| Mus musculus BAC clone RP23-433E2 from chromosome... 40 7.2
20ref|NM_001003915.1| Mus musculus solute carrier family 5 (sodium... 40 7.2
21gb|AC148241.21| Medicago truncatula clone mth2-14m21, complete s... 40 7.2
22dbj|AK144004.1| Mus musculus adult male kidney cDNA, RIKEN full-... 40 7.2
23gb|AC090985.6| Homo sapiens chromosome 15, clone RP11-763K15, co... 40 7.2
24gb|AC093019.2| Homo sapiens chromosome 1 clone RP4-714D9, comple... 40 7.2
25gb|CP000237.1| Neorickettsia sennetsu strain Miyayama, complete ... 40 7.2
26gb|AC134860.4| Mus musculus BAC clone RP23-388A16 from chromosom... 40 7.2
27dbj|AK085582.1| Mus musculus 0 day neonate kidney cDNA, RIKEN fu... 40 7.2
28dbj|AK085356.1| Mus musculus 0 day neonate kidney cDNA, RIKEN fu... 40 7.2
29emb|CR376760.1| Pan troglodytes chromosome X BAC PTB-056G20, com... 40 7.2
30emb|BX537121.4| Zebrafish DNA sequence from clone CH211-196P24 i... 40 7.2
31gb|AC103882.5| Homo sapiens BAC clone RP11-733G6 from 2, complet... 40 7.2
32gb|AC131754.3| Homo sapiens BAC clone RP11-335E9 from 2, complet... 40 7.2
33gb|AC016689.4| Homo sapiens BAC clone RP11-81H20 from 2, complet... 40 7.2
34gb|AC116162.5| Homo sapiens chromosome 15, clone RP11-268L17, co... 40 7.2
35emb|BX005257.9| Mouse DNA sequence from clone RP24-331J23 on chr... 40 7.2
36emb|CT025626.11| Mouse DNA sequence from clone RP24-141G14 on ch... 40 7.2
37emb|BX001018.11| Zebrafish DNA sequence from clone DKEY-11D22, c... 40 7.2
38emb|CT025676.10| Mouse DNA sequence from clone RP24-372B7 on chr... 40 7.2
39gb|AC151054.2| Mus musculus BAC clone RP23-147K16 from 13, compl... 40 7.2 
>emb|AL512324.14| Human DNA sequence from clone RP11-432I13 on chromosome 10 Contains the
             3' end of a breast cancer antigen (NY-BR-1) pseudogene,
             the 3' end of a novel gene, a pseudogene similar to part
             of cubilin (intrinsic factor-cobalamin receptor, CUBN), a
             seven transmembrane helix receptor (FLJ31393) pseudogene,
             the OR13A1 gene for olfactory receptor family 13 subfamily
             A member 1 and two CpG islands, complete sequence
          Length = 168473

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 287   tttctgttgacatgtcttcac 307
             |||||||||||||||||||||
Sbjct: 36681 tttctgttgacatgtcttcac 36661
to top
>emb|AJ250458.1|GGA250458 Gallus gallus zw10 gene (partial), cd3g/d gene, cd3e gene and eva gene
          Length = 16029

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 45    gttgtggatgattgctgtgat 65
             |||||||||||||||||||||
Sbjct: 13988 gttgtggatgattgctgtgat 14008
to top
>gb|AC008321.7| Drosophila melanogaster, chromosome 2L, region 23D-23F, BAC clone
             BACR11E09, complete sequence
          Length = 169931

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 462   agaagatatcgaagttggcat 482
             |||||||||||||||||||||
Sbjct: 46057 agaagatatcgaagttggcat 46037
to top
>gb|AC084511.1|CBRG17D06 Caenorhabditis briggsae cosmid G17D06, complete sequence
          Length = 46394

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 184   cctgatgtcttgggatctgttgtgg 208
             |||||| ||||||||||||||||||
Sbjct: 14862 cctgatatcttgggatctgttgtgg 14886
to top
>gb|AE003580.3| Drosophila melanogaster chromosome 2L, section 11 of 83 of the complete
             sequence
          Length = 286920

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 462   agaagatatcgaagttggcat 482
             |||||||||||||||||||||
Sbjct: 70719 agaagatatcgaagttggcat 70739
to top
>gb|AC158554.6| Mus musculus chromosome 15, clone RP23-353O17, complete sequence
          Length = 192019

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 25     agaggacaaacataaatgaa 44
              ||||||||||||||||||||
Sbjct: 107783 agaggacaaacataaatgaa 107802
to top
>gb|AC166258.12| Mus musculus  BAC RP23-353G9 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 216565

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 237    gcattctttagaaagaaaca 256
              ||||||||||||||||||||
Sbjct: 107785 gcattctttagaaagaaaca 107766
to top
>gb|AF529222.1| Mus musculus Na-I related cotransporter mRNA, complete cds
          Length = 3536

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 23   ttagaggacaaacataaatg 42
            ||||||||||||||||||||
Sbjct: 2617 ttagaggacaaacataaatg 2636
to top
>gb|AC123071.3| Mus musculus BAC clone RP23-70P8 from chromosome 13, complete sequence
          Length = 252384

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 287    tttctgttgacatgtcttca 306
              ||||||||||||||||||||
Sbjct: 188429 tttctgttgacatgtcttca 188448
to top
>gb|AC133604.3| Mus musculus BAC clone RP23-416F12 from chromosome 8, complete sequence
          Length = 221603

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 508    aaaatcaatgatggtgagca 527
              ||||||||||||||||||||
Sbjct: 155519 aaaatcaatgatggtgagca 155538
to top
>gb|AC125172.4| Mus musculus BAC clone RP24-492I4 from chromosome 14, complete sequence
          Length = 179789

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 219    agaaatgaatacttctgagc 238
              ||||||||||||||||||||
Sbjct: 100543 agaaatgaatacttctgagc 100562
to top
>gb|AC073958.4| Homo sapiens BAC clone RP11-533L22 from 7, complete sequence
          Length = 168991

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 208   gctggtgatatagaaatgaa 227
             ||||||||||||||||||||
Sbjct: 59094 gctggtgatatagaaatgaa 59075
to top
>gb|AC145092.1| Pan troglodytes BAC clone RP43-12J7 from 7, complete sequence
          Length = 78607

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 208   gctggtgatatagaaatgaa 227
             ||||||||||||||||||||
Sbjct: 78051 gctggtgatatagaaatgaa 78070
to top
>gb|AC137839.19| Medicago truncatula clone mth2-34j11, complete sequence
          Length = 145073

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 217    atagaaatgaatacttctga 236
              ||||||||||||||||||||
Sbjct: 140570 atagaaatgaatacttctga 140551
to top
>gb|AC147483.13| Medicago truncatula clone mth2-22o7, complete sequence
          Length = 142205

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 217  atagaaatgaatacttctga 236
            ||||||||||||||||||||
Sbjct: 1640 atagaaatgaatacttctga 1659
to top
>emb|Z84487.2|HS346O6 Human DNA sequence from clone RP3-346O6 on chromosome Xq21 Contains the
              5' end of the ATRX gene for alpha thalassemia/mental
              retardation syndrome X-linked (RAD54 homolog, S.
              cerevisiae), a fatty acid binding protein 9 , testis
              (FABP9) pseudogene and two CpG islands, complete sequence
          Length = 135982

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 510    aatcaatgatggtgagcagc 529
              ||||||||||||||||||||
Sbjct: 111585 aatcaatgatggtgagcagc 111604
to top
>emb|AL365215.23| Human DNA sequence from clone RP11-416D8 on chromosome 10 Contains the
             5' end of the RSU1 gene for Ras suppressor protein 1, the
             3' end of the CUBN gene for cubilin (intrinsic
             factor-cobalamin receptor) and a CpG island, complete
             sequence
          Length = 184703

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   tttctgttgacatgtcttca 306
             ||||||||||||||||||||
Sbjct: 69013 tttctgttgacatgtcttca 68994
to top
>gb|AY964639.1| Mus musculus solute carrier family 5 member 12 (Slc5a12) mRNA,
            complete cds
          Length = 3235

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 23   ttagaggacaaacataaatg 42
            ||||||||||||||||||||
Sbjct: 2300 ttagaggacaaacataaatg 2319
to top
>gb|AC160015.2| Mus musculus BAC clone RP23-433E2 from chromosome 9, complete sequence
          Length = 209970

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 23    ttagaggacaaacataaatg 42
             ||||||||||||||||||||
Sbjct: 83997 ttagaggacaaacataaatg 83978
to top
>ref|NM_001003915.1| Mus musculus solute carrier family 5 (sodium/glucose cotransporter),
            member 12 (Slc5a12), mRNA
          Length = 3536

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 23   ttagaggacaaacataaatg 42
            ||||||||||||||||||||
Sbjct: 2617 ttagaggacaaacataaatg 2636
to top
>gb|AC148241.21| Medicago truncatula clone mth2-14m21, complete sequence
          Length = 119208

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 217   atagaaatgaatacttctga 236
             ||||||||||||||||||||
Sbjct: 96414 atagaaatgaatacttctga 96433
to top
>dbj|AK144004.1| Mus musculus adult male kidney cDNA, RIKEN full-length enriched
            library, clone:F530015M05 product:weakly similar to
            Weakly similar to sodium/IODIDE cotransporter [Mus
            musculus], full insert sequence
          Length = 3117

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 23   ttagaggacaaacataaatg 42
            ||||||||||||||||||||
Sbjct: 2530 ttagaggacaaacataaatg 2549
to top
>gb|AC090985.6| Homo sapiens chromosome 15, clone RP11-763K15, complete sequence
          Length = 186078

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 238    cattctttagaaagaaacat 257
              ||||||||||||||||||||
Sbjct: 140876 cattctttagaaagaaacat 140895
to top
>gb|AC093019.2| Homo sapiens chromosome 1 clone RP4-714D9, complete sequence
          Length = 116911

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 175    tgtgatcttcctgatgtctt 194
              ||||||||||||||||||||
Sbjct: 110824 tgtgatcttcctgatgtctt 110805
to top
>gb|CP000237.1| Neorickettsia sennetsu strain Miyayama, complete genome
          Length = 859006

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 442    tctgtggatctcgaggtagaagaa 465
              |||| |||||||||||||||||||
Sbjct: 531052 tctgaggatctcgaggtagaagaa 531075
to top
>gb|AC134860.4| Mus musculus BAC clone RP23-388A16 from chromosome 13, complete sequence
          Length = 206634

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 287    tttctgttgacatgtcttca 306
              ||||||||||||||||||||
Sbjct: 136272 tttctgttgacatgtcttca 136253
to top
>dbj|AK085582.1| Mus musculus 0 day neonate kidney cDNA, RIKEN full-length enriched
           library, clone:D630044A17 product:unclassifiable, full
           insert sequence
          Length = 1577

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 23  ttagaggacaaacataaatg 42
           ||||||||||||||||||||
Sbjct: 648 ttagaggacaaacataaatg 667
to top
>dbj|AK085356.1| Mus musculus 0 day neonate kidney cDNA, RIKEN full-length enriched
            library, clone:D630015G19 product:hypothetical
            Sodium:solute symporter family containing protein, full
            insert sequence
          Length = 3521

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 23   ttagaggacaaacataaatg 42
            ||||||||||||||||||||
Sbjct: 2592 ttagaggacaaacataaatg 2611
to top
>emb|CR376760.1| Pan troglodytes chromosome X BAC PTB-056G20, complete sequence
          Length = 142982

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 510   aatcaatgatggtgagcagc 529
             ||||||||||||||||||||
Sbjct: 98889 aatcaatgatggtgagcagc 98908
to top
>emb|BX537121.4| Zebrafish DNA sequence from clone CH211-196P24 in linkage group 3,
             complete sequence
          Length = 184845

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 200   ctgttgtggctggtgatata 219
             ||||||||||||||||||||
Sbjct: 18110 ctgttgtggctggtgatata 18129
to top
>gb|AC103882.5| Homo sapiens BAC clone RP11-733G6 from 2, complete sequence
          Length = 159249

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 tgtgatttgaacaatgatat 335
           ||||||||||||||||||||
Sbjct: 182 tgtgatttgaacaatgatat 201
to top
>gb|AC131754.3| Homo sapiens BAC clone RP11-335E9 from 2, complete sequence
          Length = 112520

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 316    tgtgatttgaacaatgatat 335
              ||||||||||||||||||||
Sbjct: 110702 tgtgatttgaacaatgatat 110721
to top
>gb|AC016689.4| Homo sapiens BAC clone RP11-81H20 from 2, complete sequence
          Length = 134841

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 287  tttctgttgacatgtcttca 306
            ||||||||||||||||||||
Sbjct: 7726 tttctgttgacatgtcttca 7707
to top
>gb|AC116162.5| Homo sapiens chromosome 15, clone RP11-268L17, complete sequence
          Length = 160580

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 238   cattctttagaaagaaacat 257
             ||||||||||||||||||||
Sbjct: 31267 cattctttagaaagaaacat 31286
to top
>emb|BX005257.9| Mouse DNA sequence from clone RP24-331J23 on chromosome 2, complete
             sequence
          Length = 48743

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 23    ttagaggacaaacataaatg 42
             ||||||||||||||||||||
Sbjct: 13712 ttagaggacaaacataaatg 13731
to top
>emb|CT025626.11| Mouse DNA sequence from clone RP24-141G14 on chromosome 14, complete
              sequence
          Length = 201441

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 219    agaaatgaatacttctgagc 238
              ||||||||||||||||||||
Sbjct: 107241 agaaatgaatacttctgagc 107222
to top
>emb|BX001018.11| Zebrafish DNA sequence from clone DKEY-11D22, complete sequence
          Length = 206937

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 240   ttctttagaaagaaacattg 259
             ||||||||||||||||||||
Sbjct: 63747 ttctttagaaagaaacattg 63728
to top
>emb|CT025676.10| Mouse DNA sequence from clone RP24-372B7 on chromosome 9, complete
             sequence
          Length = 174177

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 23    ttagaggacaaacataaatg 42
             ||||||||||||||||||||
Sbjct: 36405 ttagaggacaaacataaatg 36424
to top
>gb|AC151054.2| Mus musculus BAC clone RP23-147K16 from 13, complete sequence
          Length = 220038

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 287    tttctgttgacatgtcttca 306
              ||||||||||||||||||||
Sbjct: 121753 tttctgttgacatgtcttca 121734


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,276,002
Number of Sequences: 3902068
Number of extensions: 5276002
Number of successful extensions: 87054
Number of sequences better than 10.0: 39
Number of HSP's better than 10.0 without gapping: 39
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 86976
Number of HSP's gapped (non-prelim): 78
length of query: 533
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 510
effective length of database: 17,143,297,704
effective search space: 8743081829040
effective search space used: 8743081829040
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top