>emb|AL121586.31|HSDJ477O4 Human DNA sequence from clone RP3-477O4 on chromosome 20 Contains a novel
gene, the GDF5 gene for growth differentiation factor 5,
the CEP2 gene for centrosomal protein 2, two novel genes, a
pseudogene similar to sialyltransferase proteins, the
C20orf173 gene for chromosome 20 open reading frame 173,
the SDBCAG84 gene for serologically defined breast cancer
antigen 84, the RPL36P4 locus for ribosomal protein L36
pseudogene 4, the 3' end of the FER1L4 gene for fer-1-like
4 (C. elegans) and three CpG islands, complete sequence
Length = 151903
Score = 42.1 bits (21), Expect = 1.8
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 46 tgaaggcagggttggggaagg 66
|||||||||||||||||||||
Sbjct: 132040 tgaaggcagggttggggaagg 132060
>emb|AL670399.4| Mouse DNA sequence from clone RP23-263M10 on chromosome 11 Contains the
3' end of the Atp2a3 gene for ubiquitous Ca++ transporting
ATPase, the P2rx1 and P2rx5 genes for purinergic receptor
P2X ligand-gated ion channel 1 and 5, 111 novel genes, the
Camkk1 gene for calcium/calmodulin-dependent protein kinase
kinase 1 alpha, the Itgae gene for epithelial-associated
integrin alpha E, the Gsg2 gene for germ cell-specific gene
2 protein, the gene for a novel protein similar to human
tax interacting protein 1, the Ctns gene for nephropathic
cystinosis protein and five CpG islands, complete sequence
Length = 224037
Score = 40.1 bits (20), Expect = 7.1
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 427 tgctttggcaagtgaccttg 446
||||||||||||||||||||
Sbjct: 216591 tgctttggcaagtgaccttg 216610
>dbj|AP000354.1| Homo sapiens genomic DNA, chromosome 22q11.2, clone KB1674E1
Length = 164756
Score = 40.1 bits (20), Expect = 7.1
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 258 tggcaggggcagatgctgaa 277
||||||||||||||||||||
Sbjct: 91959 tggcaggggcagatgctgaa 91940
Database: nt
Posted date: May 29, 2006 11:10 AM
Number of letters in database: 3,984,495,279
Number of sequences in database: 917,343
Database: /shigen/export/home/twatanab/db/nt/nt.01
Posted date: May 29, 2006 11:16 AM
Number of letters in database: 3,988,174,986
Number of sequences in database: 835,257
Database: /shigen/export/home/twatanab/db/nt/nt.02
Posted date: May 29, 2006 11:21 AM
Number of letters in database: 3,991,246,324
Number of sequences in database: 771,481
Database: /shigen/export/home/twatanab/db/nt/nt.03
Posted date: May 29, 2006 11:27 AM
Number of letters in database: 3,990,718,311
Number of sequences in database: 977,174
Database: /shigen/export/home/twatanab/db/nt/nt.04
Posted date: May 29, 2006 11:29 AM
Number of letters in database: 1,278,410,368
Number of sequences in database: 400,813
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,978,664
Number of Sequences: 3902068
Number of extensions: 3978664
Number of successful extensions: 71494
Number of sequences better than 10.0: 38
Number of HSP's better than 10.0 without gapping: 38
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 71362
Number of HSP's gapped (non-prelim): 119
length of query: 523
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 500
effective length of database: 17,143,297,704
effective search space: 8571648852000
effective search space used: 8571648852000
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)