ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags32c03
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|X60343.1|HVGADPH H.vulgare GADPH mRNA for glycolytic glycera... 692 0.0
2gb|AF273738.1|AF273738 Triticum aestivum glyceraldehyde-3-phosph... 601 e-169
3gb|BT016387.1| Zea mays clone Contig220 mRNA sequence 418 e-114
4gb|BT017186.1| Zea mays clone EL01N0370B09.c mRNA sequence 418 e-114
5gb|U45855.1|ZMU45855 Zea mays glyceraldehyde-3-phosphate dehydro... 418 e-114
6gb|AY109359.1| Zea mays CL2022_2 mRNA sequence 410 e-111
7ref|XM_479895.1| Oryza sativa (japonica cultivar-group), mRNA 406 e-110
8ref|XM_507107.1| PREDICTED Oryza sativa (japonica cultivar-group... 406 e-110
9dbj|AK103777.1| Oryza sativa (japonica cultivar-group) cDNA clon... 406 e-110
10dbj|AK100159.1| Oryza sativa (japonica cultivar-group) cDNA clon... 406 e-110
11dbj|AK071097.1| Oryza sativa (japonica cultivar-group) cDNA clon... 406 e-110
12gb|U31676.1|OSU31676 Oryza sativa clone glyceraldehyde-3-phospha... 406 e-110
13gb|BT016419.1| Zea mays clone Contig252 mRNA sequence 391 e-105
14emb|X07156.1|ZMCGAPDH Maize mRNA for cytosolic GAPDH (GapC) glyc... 391 e-105
15gb|BT024142.1| Zea mays clone EL01N0441H10 mRNA sequence 391 e-105
16gb|AY109397.1| Zea mays CL2022_1 mRNA sequence 353 3e-94
17gb|BT018263.1| Zea mays clone EL01T0202D09.c mRNA sequence 307 1e-80
18ref|XM_472949.1| Oryza sativa (japonica cultivar-group), predic... 250 3e-63
19dbj|AK064960.1| Oryza sativa (japonica cultivar-group) cDNA clon... 250 3e-63
20gb|AY349291.1| Hordeum vulgare subsp. spontaneum NPGS PI 420916 ... 234 2e-58
21gb|AY857765.1| Triticum monococcum glyceraldehyde-3-phosphate de... 230 3e-57
22ref|NM_111283.2| Arabidopsis thaliana GAPC (GLYCERALDEHYDE-3-PHO... 226 4e-56
23gb|AY349297.1| Hordeum vulgare subsp. spontaneum NPGS PI 560559 ... 226 4e-56
24gb|AY349296.1| Hordeum vulgare subsp. spontaneum NPGS PI 559556 ... 226 4e-56
25gb|AY349294.1| Hordeum vulgare subsp. spontaneum NPGS PI 531853 ... 226 4e-56
26gb|AY349293.1| Hordeum vulgare subsp. spontaneum NPGS PI 531851 ... 226 4e-56
27gb|AY349289.1| Hordeum vulgare subsp. spontaneum NPGS PI 420911 ... 226 4e-56
28gb|AY349287.1| Hordeum vulgare subsp. spontaneum NPGS PI 406276 ... 226 4e-56
29gb|AY349286.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 ... 226 4e-56
30gb|AY349285.1| Hordeum vulgare subsp. spontaneum NPGS PI 401370 ... 226 4e-56
31gb|AY349284.1| Hordeum vulgare subsp. spontaneum NPGS PI 366446 ... 226 4e-56
32gb|AY349281.1| Hordeum vulgare subsp. spontaneum NPGS PI 293409 ... 226 4e-56
33gb|AY349280.1| Hordeum vulgare subsp. spontaneum NPGS PI 293402 ... 226 4e-56
34gb|AY349279.1| Hordeum vulgare subsp. spontaneum NPGS PI 268242 ... 226 4e-56
35gb|AY349278.1| Hordeum vulgare subsp. spontaneum NPGS PI 254894 ... 226 4e-56
36gb|AY349277.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 ... 226 4e-56
37gb|AY349275.1| Hordeum vulgare subsp. spontaneum NPGS PI 220523 ... 226 4e-56
38gb|AY349274.1| Hordeum vulgare subsp. spontaneum NPGS PI 219796 ... 226 4e-56
39gb|AY349273.1| Hordeum vulgare subsp. spontaneum NPGS PI 212306 ... 226 4e-56
40gb|AY349272.1| Hordeum vulgare subsp. spontaneum NPGS PI 212305 ... 226 4e-56
41gb|AY140084.1| Arabidopsis thaliana unknown protein mRNA, comple... 226 4e-56
42gb|AY060521.1| Arabidopsis thaliana AT3g04120/T6K12_26 mRNA, com... 226 4e-56
43gb|AY052267.1| Arabidopsis thaliana AT3g04120/T6K12_26 mRNA, com... 226 4e-56
44gb|AY087651.1| Arabidopsis thaliana clone 37355 mRNA, complete s... 226 4e-56
45gb|M64116.1|ATHGAPAC Arabidopsis thaliana glyceraldehyde-3-phosp... 226 4e-56
46gb|BT016420.1| Zea mays clone Contig253 mRNA sequence 222 7e-55
47gb|U45857.1|ZMU45857 Zea mays glyceraldehyde-3-phosphate dehydro... 222 7e-55
48gb|AY349295.1| Hordeum vulgare subsp. spontaneum NPGS PI 531957 ... 218 1e-53
49gb|AY349292.1| Hordeum vulgare subsp. spontaneum NPGS PI 466460 ... 218 1e-53
50gb|AY349290.1| Hordeum vulgare subsp. spontaneum NPGS PI 420913 ... 218 1e-53
51gb|AY349288.1| Hordeum vulgare subsp. spontaneum NPGS PI 420911 ... 218 1e-53
52gb|AY349283.1| Hordeum vulgare subsp. spontaneum NPGS PI 296926 ... 218 1e-53
53gb|AY349282.1| Hordeum vulgare subsp. spontaneum NPGS PI 293411 ... 218 1e-53
54gb|AY349276.1| Hordeum vulgare subsp. spontaneum NPGS PI 236388 ... 218 1e-53
55gb|DQ318775.1| Lilium longiflorum glyceraldehyde-3-phosphate deh... 206 4e-50
56gb|BT016360.1| Zea mays clone Contig193 mRNA sequence 196 4e-47
57gb|U45856.1|ZMU45856 Zea mays glyceraldehyde-3-phosphate dehydro... 196 4e-47
58gb|AY821550.1| Musa acuminata glyceraldehyde-3-phosphate dehydro... 194 1e-46
59ref|XM_506852.1| PREDICTED Oryza sativa (japonica cultivar-group... 194 1e-46
60ref|XM_466582.1| Oryza sativa (japonica cultivar-group), mRNA 194 1e-46
61dbj|AK099086.1| Oryza sativa (japonica cultivar-group) cDNA clon... 194 1e-46
62dbj|AK062215.1| Oryza sativa (japonica cultivar-group) cDNA clon... 194 1e-46
63emb|X04301.1|SAGAPDHR Mustard mRNA for cytosolic glyceraldehyde-... 190 2e-45
64ref|NM_101214.2| Arabidopsis thaliana NAD binding / glyceraldehy... 176 4e-41
65gb|AY090275.1| Arabidopsis thaliana At1g13440/F13B4_8 mRNA, comp... 176 4e-41
66gb|AF410271.1|AF410271 Arabidopsis thaliana At1g13440/F13B4_8 mR... 176 4e-41
67gb|AY049259.1| Arabidopsis thaliana At1g13440/F13B4_8 mRNA, comp... 176 4e-41
68dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 163 5e-37
69dbj|AP003886.3| Oryza sativa (japonica cultivar-group) genomic D... 163 5e-37
70dbj|AP004166.3| Oryza sativa (japonica cultivar-group) genomic D... 163 5e-37
71emb|X15596.1|ZMGPC1 Maize Gpc1 gene for glyceraldehyde-3-phospha... 149 8e-33
72emb|X73151.1|ZMGAPC2 Z.mays GapC2 gene 147 3e-32
73gb|U45858.1|ZMU45858 Zea mays glyceraldehyde-3-phosphate dehydro... 147 3e-32
74emb|AL606998.3|OSJN00125 Oryza sativa genomic DNA, chromosome 4,... 141 2e-30
75dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 141 2e-30
76emb|AL627350.3| Oryza sativa genomic DNA, chromosome 4, BAC clon... 141 2e-30
77emb|X60347.1|MLGADPH M.liliiflora GADPH mRNA for glycolytic glyc... 139 8e-30
78dbj|D21280.1|RICAD18 Oryza sativa AD18 mRNA for glyceraldehyde-3... 137 3e-29
79gb|M36650.1|BLYGAPDH Barley glyceraldehyde-3-phosphate dehydroge... 127 3e-26
80emb|X75597.1|ANDAP3DH A.nummularia mRNA for glyceraldehyde-3-pho... 125 1e-25
81gb|J05223.1|CIPNADGAPD M.crystallinum glyceraldehyde-3-phosphate... 125 1e-25
82gb|M29956.1|CIPGPDNAD Common ice plant (M.crystallinum) NAD-glyc... 125 1e-25
83gb|U02886.1|ANGAPDH Atriplex nummularia glyceraldehyde-3-phospha... 125 1e-25
84emb|X60346.1|PHGADPHR P.hybrida GADPH mRNA for glycolytic glycer... 123 5e-25
85emb|X73152.1|ZMGAPC4 Z.mays GapC4 gene 109 7e-21
86gb|U45859.1|ZMU45859 Zea mays glyceraldehyde-3-phosphate dehydro... 109 7e-21
87dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 107 3e-20
88dbj|AP005385.3| Oryza sativa (japonica cultivar-group) genomic D... 107 3e-20
89gb|DQ267444.1| Elaeis guineensis glyceraldehyde 3-phosphate dehy... 107 3e-20
90emb|AJ133422.1|NTA133422 Nicotiana tabacum mRNA for glyceraldehy... 105 1e-19
91gb|DQ355800.1| Glycine max glyceraldehyde-3-phosphate dehydrogen... 100 7e-18
92emb|AJ246011.1|CAN246011 Capsicum annuum mRNA for partial glycer... 98 3e-17
93gb|AC016829.7|ATAC016829 Arabidopsis thaliana chromosome III BAC... 86 1e-13
94gb|M64119.1|ATHGAPCA Arabidopsis thaliana cytosolic glyceraldehy... 86 1e-13
95gb|BT012693.1| Lycopersicon esculentum clone 113563F, mRNA sequence 84 4e-13
96gb|U96623.1|SLU96623 Selaginella lepidophylla glyceraldehyde-3-p... 84 4e-13
97gb|U97257.1|LEU97257 Lycopersicon esculentum glyceraldehyde 3-ph... 84 4e-13
98gb|DQ252489.1| Solanum tuberosum clone 056C03 glyceraldehyde 3-p... 84 4e-13
99gb|DQ173770.1| Populus maximowiczii x Populus nigra glyceraldehy... 82 2e-12
100gb|M14419.1|TOBGAPC Tobacco (N.tabacum) GapC mRNA encoding cytos... 82 2e-12
101dbj|AB164359.1| Periploca sepium PsGAPDH mRNA for D-glyceraldehy... 78 2e-11
102gb|AF527779.1| Solanum tuberosum glyceraldehyde 3-phosphate dehy... 76 1e-10
103gb|DQ241857.1| Solanum tuberosum clone 014E02 glyceraldehyde 3-p... 76 1e-10
104gb|DQ268845.1| Solanum tuberosum clone 147E07 glyceraldehyde 3-p... 76 1e-10
105emb|X60344.1|PHGADPH P.hortense GADPH mRNA for glycolytic glycer... 74 4e-10
106gb|AC011810.8|AC011810 Arabidopsis thaliana chromosome I BAC T6J... 74 4e-10
107gb|AC027134.4|AC027134 Arabidopsis thaliana chromosome I BAC F13... 74 4e-10
108emb|CT573421.5| M.truncatula DNA sequence from clone MTH2-27B10 ... 74 4e-10
109dbj|AB110609.1| Lycopersicon esculentum GAPDH gene for glycerald... 74 4e-10
110ref|XM_450090.1| Oryza sativa (japonica cultivar-group), mRNA 72 1e-09
111ref|XM_501515.1| Yarrowia lipolytica CLIB122, YALI0C06369g predi... 72 1e-09
112dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 72 1e-09
113dbj|AP005746.3| Oryza sativa (japonica cultivar-group) genomic D... 72 1e-09
114dbj|AK066284.1| Oryza sativa (japonica cultivar-group) cDNA clon... 72 1e-09
115emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB1... 72 1e-09
116gb|AY491512.2| Daucus carota glyceraldehyde 3-phosphate dehydrog... 70 6e-09
117gb|L13432.1|MZEGAPDB Zea mays GAPC2 glyceraldehyde-3-phosphate d... 70 6e-09
118ref|XR_003569.1| PREDICTED: Mus musculus similar to Glyceraldehy... 68 2e-08
119gb|AY436595.1| Anas platyrhynchos glyceraldehyde-3-phosphate deh... 68 2e-08
120gb|AC161826.5| Mus musculus 6 BAC RP23-411G8 (Roswell Park Cance... 68 2e-08
121dbj|AB164360.1| Periploca sepium PsGAPDH gene for D-glyceraldehy... 68 2e-08
122gb|U17005.1|STU17005 Solanum tuberosum glyceraldehyde 3-phosphat... 68 2e-08
123gb|L07500.1|PEAGAPCI Pea glyceraldehyde-3-phosphate dehydrogenas... 66 9e-08
124emb|AJ938036.1| Lupinus albus mRNA for glyceraldehyde-3-phosphat... 64 4e-07
125gb|AY292378.1| Phytophthora palmivora glyceraldehyde-3-phosphate... 62 1e-06
126gb|AY654895.1| Spermophilus citellus glyceraldehyde-3-phosphate ... 62 1e-06
127gb|AF232729.2|AF232729 Marmota monax glyceraldehyde 3-phosphate ... 62 1e-06
128gb|AC116758.11| Mus musculus chromosome 8, clone RP23-383A10, co... 60 6e-06
129gb|AC115877.13| Mus musculus chromosome 15, clone RP24-358H21, c... 60 6e-06
130gb|AC114585.19| Mus musculus chromosome 14, clone RP23-296J16, c... 60 6e-06
131gb|AC166162.6| Mus musculus BAC clone RP23-436K10 from chromosom... 60 6e-06
132gb|BC085275.1| Mus musculus similar to glyceraldehyde-3-phosphat... 60 6e-06
133gb|BC085274.1| Mus musculus similar to glyceraldehyde-3-phosphat... 60 6e-06
134gb|BC085315.1| Mus musculus similar to glyceraldehyde-3-phosphat... 60 6e-06
135gb|BC083080.1| Mus musculus glyceraldehyde-3-phosphate dehydroge... 60 6e-06
136gb|BC083149.1| Mus musculus glyceraldehyde-3-phosphate dehydroge... 60 6e-06
137gb|BC083079.1| Mus musculus glyceraldehyde-3-phosphate dehydroge... 60 6e-06
138gb|BC083065.1| Mus musculus glyceraldehyde-3-phosphate dehydroge... 60 6e-06
139gb|AC166075.2| Mus musculus BAC clone RP23-143L15 from chromosom... 60 6e-06
140gb|AC163335.6| Mus musculus chromosome 7, clone RP24-149G13, com... 60 6e-06
141gb|BC082592.1| Mus musculus similar to glyceraldehyde-3-phosphat... 60 6e-06
142gb|AC102196.7| Mus musculus chromosome 3, clone RP24-445M20, com... 60 6e-06
143gb|AY066007.1| Meriones unguiculatus glyceraldehyde-3-phosphate ... 60 6e-06
144ref|NG_005470.2| Mus musculus glyceraldehyde-3-phosphate dehydro... 60 6e-06
145ref|NG_005467.2| Mus musculus glyceraldehyde-3-phosphate dehydro... 60 6e-06
146ref|NG_005469.2| Mus musculus glyceraldehyde-3-phosphate dehydro... 60 6e-06
147ref|NG_005233.2| Mus musculus glyceraldehyde-3-phosphate dehydro... 60 6e-06
148gb|AC124377.4| Mus musculus BAC clone RP24-396N12 from chromosom... 60 6e-06
149ref|NM_008084.1| Mus musculus similar to glyceraldehyde-3-phosph... 60 6e-06
150gb|AC124113.9| Mus musculus chromosome 5, clone RP24-354P12, com... 60 6e-06
151gb|AC167201.6| Mus musculus 10 BAC RP23-402J11 (Roswell Park Can... 60 6e-06
152gb|AC164428.4| Mus musculus BAC clone RP24-150D18 from chromosom... 60 6e-06
153gb|AC121279.7| Mus musculus chromosome 3, clone RP23-4F17, compl... 60 6e-06
154ref|XR_003802.1| PREDICTED: Mus musculus similar to Glyceraldehy... 60 6e-06
155ref|XM_484732.3| PREDICTED: Mus musculus similar to Glyceraldehy... 60 6e-06
156ref|XM_973383.1| PREDICTED: Mus musculus similar to Glyceraldehy... 60 6e-06
157ref|XM_982955.1| PREDICTED: Mus musculus similar to Glyceraldehy... 60 6e-06
158ref|XR_003790.1| PREDICTED: Mus musculus similar to Glyceraldehy... 60 6e-06
159ref|XM_484436.4| PREDICTED: Mus musculus similar to Glyceraldehy... 60 6e-06
160ref|XM_904634.2| PREDICTED: Mus musculus similar to Glyceraldehy... 60 6e-06
161ref|XR_004746.1| PREDICTED: Mus musculus similar to Glyceraldehy... 60 6e-06
162ref|XR_002153.1| PREDICTED: Mus musculus similar to Glyceraldehy... 60 6e-06
163ref|XM_987944.1| PREDICTED: Mus musculus similar to Glyceraldehy... 60 6e-06
164ref|XR_003390.1| PREDICTED: Mus musculus similar to Glyceraldehy... 60 6e-06
165ref|XR_001931.1| PREDICTED: Mus musculus similar to Glyceraldehy... 60 6e-06
166gb|AC102352.9| Mus musculus chromosome 14, clone RP23-30H7, comp... 60 6e-06
167ref|XM_620532.3| PREDICTED: Mus musculus similar to Glyceraldehy... 60 6e-06
168ref|XR_002367.1| PREDICTED: Mus musculus similar to Glyceraldehy... 60 6e-06
169ref|XM_906931.2| PREDICTED: Mus musculus similar to Glyceraldehy... 60 6e-06
170gb|AC147142.2| Mus musculus BAC clone RP24-391G7 from chromosome... 60 6e-06
171ref|XR_003202.1| PREDICTED: Mus musculus similar to Glyceraldehy... 60 6e-06
172gb|AC146611.2| Mus musculus BAC clone RP23-57A17 from chromosome... 60 6e-06
173gb|AY363102.1|AY363102S1 Mus musculus diadenosine triphosphate h... 60 6e-06
174gb|AC115124.6| Mus musculus BAC clone RP24-349M22 from chromosom... 60 6e-06
175gb|AC130841.4| Mus musculus BAC clone RP24-445L16 from chromosom... 60 6e-06
176gb|AC132391.3| Mus musculus BAC clone RP23-454N21 from chromosom... 60 6e-06
177gb|AC124581.4| Mus musculus BAC clone RP23-116E3 from chromosome... 60 6e-06
178gb|AC121959.3| Mus musculus BAC clone RP24-247N18 from chromosom... 60 6e-06
179gb|AC122039.4| Mus musculus BAC clone RP24-432H3 from chromosome... 60 6e-06
180gb|AC125177.4| Mus musculus BAC clone RP23-315H8 from chromosome... 60 6e-06
181gb|AC124773.4| Mus musculus BAC clone RP23-49B23 from 3, complet... 60 6e-06
182gb|AC114004.5| Mus musculus BAC clone RP23-174P2 from 7, complet... 60 6e-06
183gb|AC118474.10| Mus musculus chromosome 8, clone RP23-288O12, co... 60 6e-06
184gb|AC102494.6| Mus musculus chromosome 7, clone RP24-565J5, comp... 60 6e-06
185gb|AC161456.3| Mus musculus BAC clone RP23-190H11 from chromosom... 60 6e-06
186gb|AY364464.1| Phaeosphaeria nodorum isolate S-82-13 glyceraldeh... 60 6e-06
187gb|AY364463.1| Phaeosphaeria avenaria f. sp. triticae isolate Sa... 60 6e-06
188gb|AY364462.1| Phaeosphaeria nodorum isolate 9074 glyceraldehyde... 60 6e-06
189gb|AY364461.1| Phaeosphaeria nodorum isolate S74-20A glyceraldeh... 60 6e-06
190gb|AY364459.1| Phaeosphaeria avenaria f. sp. avenaria strain ATC... 60 6e-06
191gb|AY364458.1| Stagonospora sp. Sn48-1 glyceraldehyde 3-phosphat... 60 6e-06
192gb|AY364456.1| Phaeosphaeria avenaria f. sp. triticae isolate S8... 60 6e-06
193gb|BC098095.1| Mus musculus glyceraldehyde-3-phosphate dehydroge... 60 6e-06
194gb|AC160632.5| Mus musculus chromosome 8, clone RP24-319F9, comp... 60 6e-06
195emb|X60345.1|RAGADPHR R.acer GADPH mRNA for glycolytic glycerald... 60 6e-06
196gb|AC163619.2| Mus musculus BAC clone RP24-164P4 from chromosome... 60 6e-06
197emb|AL607064.16| Mouse DNA sequence from clone RP23-314K19 on ch... 60 6e-06
198emb|AL935328.14| Mouse DNA sequence from clone RP23-227C11 on ch... 60 6e-06
199emb|AL662926.19| Mouse DNA sequence from clone RP23-403O15 on ch... 60 6e-06
200emb|AL807395.8| Mouse DNA sequence from clone RP23-81P12 on chro... 60 6e-06
201gb|BC095932.1| Mus musculus glyceraldehyde-3-phosphate dehydroge... 60 6e-06
202gb|AC158345.8| Mus musculus chromosome 7, clone RP23-271M19, com... 60 6e-06
203gb|BC092252.1| Mus musculus similar to glyceraldehyde-3-phosphat... 60 6e-06
204dbj|AK140794.1| Mus musculus 16 days embryo head cDNA, RIKEN ful... 60 6e-06
205dbj|AK146435.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-... 60 6e-06
206ref|NM_001001303.1| Mus musculus glyceraldehyde-3-phosphate dehy... 60 6e-06
207dbj|AK147969.1| Mus musculus melanocyte cDNA, RIKEN full-length ... 60 6e-06
208dbj|AK147891.1| Mus musculus melanocyte cDNA, RIKEN full-length ... 60 6e-06
209dbj|AK160399.1| Mus musculus adult male cerebellum cDNA, RIKEN f... 60 6e-06
210dbj|AK147738.1| Mus musculus melanocyte cDNA, RIKEN full-length ... 60 6e-06
211dbj|AK164415.1| Mus musculus 12 days embryo eyeball cDNA, RIKEN ... 60 6e-06
212gb|DQ383974.1| Ascochyta sp. Georgia16 glyceraldehyde-3-phosphat... 60 6e-06
213gb|DQ383972.1| Ascochyta sp. Georgia3 glyceraldehyde-3-phosphate... 60 6e-06
214gb|DQ383971.1| Ascochyta sp. Georgia2 glyceraldehyde-3-phosphate... 60 6e-06
215gb|DQ383970.1| Ascochyta fabae f. sp. viciae strain AV11 glycera... 60 6e-06
216gb|DQ383969.1| Ascochyta sp. AV8 glyceraldehyde-3-phosphate dehy... 60 6e-06
217gb|DQ383968.1| Ascochyta sp. AV1 glyceraldehyde-3-phosphate dehy... 60 6e-06
218gb|DQ383967.1| Ascochyta sp. Georgia12 glyceraldehyde-3-phosphat... 60 6e-06
219gb|DQ383966.1| Ascochyta sp. Georgia6 glyceraldehyde-3-phosphate... 60 6e-06
220gb|DQ383965.1| Ascochyta pisi strain AP5 glyceraldehyde-3-phosph... 60 6e-06
221gb|DQ383964.1| Ascochyta pisi strain AP4 glyceraldehyde-3-phosph... 60 6e-06
222gb|DQ383963.1| Ascochyta pisi strain AP1 glyceraldehyde-3-phosph... 60 6e-06
223gb|DQ383962.1| Didymella lentis strain AL11 glyceraldehyde-3-pho... 60 6e-06
224gb|DQ383961.1| Didymella lentis strain AL1 glyceraldehyde-3-phos... 60 6e-06
225gb|DQ383960.1| Didymella fabae strain AF8 glyceraldehyde-3-phosp... 60 6e-06
226gb|DQ383959.1| Didymella fabae strain AF1 glyceraldehyde-3-phosp... 60 6e-06
227dbj|AK169742.1| Mus musculus 2 days neonate thymus thymic cells ... 60 6e-06
228gb|AC117588.11| Mus musculus chromosome 15, clone RP23-177B8, co... 60 6e-06
229dbj|AK168217.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length... 60 6e-06
230gb|BC093508.1| Mus musculus similar to glyceraldehyde-3-phosphat... 60 6e-06
231dbj|AK013857.1| Mus musculus 12 days embryo head cDNA, RIKEN ful... 60 6e-06
232gb|AC157651.3| Mus musculus BAC clone RP24-363O21 from chromosom... 60 6e-06
233dbj|AK081405.1| Mus musculus 16 days embryo head cDNA, RIKEN ful... 60 6e-06
234dbj|AK002273.1| Mus musculus adult male kidney cDNA, RIKEN full-... 60 6e-06
235gb|AF162137.2|AF162137 Mus musculus WNT-2 gene, partial cds; put... 60 6e-06
236gb|BC096440.1| Mus musculus glyceraldehyde-3-phosphate dehydroge... 60 6e-06
237gb|BC061210.1| Mus musculus RIKEN cDNA 3000002C10 gene, mRNA (cD... 60 6e-06
238dbj|AK082178.1| Mus musculus 0 day neonate cerebellum cDNA, RIKE... 60 6e-06
239gb|AC153557.8| Mus musculus 10 BAC RP23-203H20 (Roswell Park Can... 60 6e-06
240gb|BC094037.1| Mus musculus glyceraldehyde-3-phosphate dehydroge... 60 6e-06
241gb|AC156283.6| Mus musculus 6 BAC RP24-327I4 (Roswell Park Cance... 60 6e-06
242dbj|AB070217.1| Meriones unguiculatus GAPD mRNA for Glyceraldehy... 60 6e-06
243gb|AC150660.4| Mus musculus BAC clone RP23-41F9 from chromosome ... 60 6e-06
244gb|BC092294.1| Mus musculus similar to glyceraldehyde-3-phosphat... 60 6e-06
245gb|BC092264.1| Mus musculus similar to glyceraldehyde-3-phosphat... 60 6e-06
246gb|BC092267.1| Mus musculus similar to glyceraldehyde-3-phosphat... 60 6e-06
247ref|NR_002890.1| Mus musculus glyceraldehyde-3-phosphate dehydro... 60 6e-06
248dbj|AK198590.1| Mus musculus cDNA, clone:Y1G0128J17, strand:plus... 60 6e-06
249dbj|AK188366.1| Mus musculus cDNA, clone:Y0G0144O14, strand:plus... 60 6e-06
250gb|BC092063.1| Mus musculus cDNA clone IMAGE:4195104 60 6e-06
251emb|AL805956.22| Mouse DNA sequence from clone RP23-239F1 on chr... 60 6e-06
252gb|BC091768.1| Mus musculus similar to glyceraldehyde-3-phosphat... 60 6e-06
253emb|BX649512.4| Mouse DNA sequence from clone RP24-87G15 on chro... 60 6e-06
254emb|AL845336.9| Mouse DNA sequence from clone RP23-391P24 on chr... 60 6e-06
255dbj|AK103261.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 6e-06
256ref|NG_005468.1| Mus musculus glyceraldehyde-3-phosphate dehydro... 60 6e-06
257dbj|AK069457.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 6e-06
258dbj|AB040445.1| Meriones unguiculatus GAPDH mRNA for glyceraldeh... 60 6e-06
259gb|BC110311.1| Mus musculus similar to glyceraldehyde-3-phosphat... 60 6e-06
260emb|CT009534.18| Mouse DNA sequence from clone RP23-106A16 on ch... 60 6e-06
261gb|AC102493.8| Mus musculus chromosome 8, clone RP24-546F2, comp... 60 6e-06
262emb|AL831714.14| Mouse DNA sequence from clone RP23-311D24 on ch... 60 6e-06
263gb|AC164560.3| Mus musculus BAC clone RP23-192D6 from chromosome... 60 6e-06
264gb|AC158396.2| Mus musculus BAC clone RP23-255D19 from chromosom... 60 6e-06
265gb|AC148327.3| Mus musculus BAC clone RP24-322E6 from 5, complet... 60 6e-06
266gb|AC150744.2| Mus musculus BAC clone RP24-98O8 from 7, complete... 60 6e-06
267gb|BC020407.1| Mus musculus glyceraldehyde-3-phosphate dehydroge... 60 6e-06
268gb|BC023196.1| Mus musculus glyceraldehyde-3-phosphate dehydroge... 60 6e-06
269ref|NM_001001978.1| Mus musculus similar to glyceraldehyde-3-pho... 60 6e-06
270gb|BC096590.1| Mus musculus similar to glyceraldehyde-3-phosphat... 60 6e-06
271gb|AC134867.3| Mus musculus BAC clone RP23-18L24 from 10, comple... 60 6e-06
272gb|AC134918.5| Mus musculus BAC clone RP23-71G16 from 3, complet... 60 6e-06
273gb|AC148983.2| Mus musculus BAC clone RP23-189G7 from 18, comple... 60 6e-06
274gb|AC134337.3| Mus musculus BAC clone RP23-252I24 from 8, comple... 60 6e-06
275gb|AC137555.4| Mus musculus BAC clone RP23-445B17 from 1, comple... 60 6e-06
276emb|AL929179.6| Mouse DNA sequence from clone RP23-428M4 on chro... 60 6e-06
277gb|AC109165.11| Mus musculus chromosome 5, clone RP23-30B3, comp... 60 6e-06
278gb|AC164643.4| Mus musculus BAC clone RP23-254F23 from chromosom... 60 6e-06
279gb|AC171241.2| Mus musculus BAC clone RP23-94E5 from chromosome ... 60 6e-06
280emb|AL772328.13| Mouse DNA sequence from clone RP23-270A19 on ch... 60 6e-06
281emb|AL808132.5| Mouse DNA sequence from clone RP23-125A12 on chr... 60 6e-06
282emb|AL732526.8| Mouse DNA sequence from clone RP23-338O4 on chro... 60 6e-06
283gb|M32599.1|MUSGAPDH Mouse glyceraldehyde-3-phosphate dehydrogen... 60 6e-06
284gb|AC159709.8| Mus musculus 10 BAC RP23-136O17 (Roswell Park Can... 60 6e-06
285ref|XM_676218.1| Aspergillus nidulans FGSC A4 hypothetical prote... 58 2e-05
286gb|AY345228.1| Panax ginseng glyceraldehyde-3-phosphate dehydrog... 58 2e-05
287emb|X59517.1|AMGADPH A.majus GADPH mRNA for glycolytic glycerald... 58 2e-05
288gb|M81724.1|SCOGLYC Schizophyllum commune glyceraldehyde-3-phosp... 58 2e-05
289gb|M81754.1|PHAGLYC Phanerochaete chrysosporium glyceraldehyde-3... 58 2e-05
290dbj|AB177405.1| Oncorhynchus tshawytscha GAPDH mRNA for glyceral... 58 2e-05
291gb|AF081393.1|AF081393 Curvularia gudauskasii DAOM 165085 glycer... 58 2e-05
292gb|M33539.1|EMEGPDAA A.nidulans glyceraldehyde-3-phosphate dehyd... 58 2e-05
293gb|M19694.1|EMEGPDA A.nidulans gpdA gene encoding glyceraldehyde... 58 2e-05
294dbj|D14518.1|TRRGLYDE1 Trichoderma koningii mRNA for glyceraldeh... 58 2e-05
295gb|AY533686.1| Talaromyces wortmannii isolate W35 glyceraldehyde... 56 9e-05
296gb|AY650282.1| Cervus elaphus glyceraldehyde-3-phosphate dehydro... 56 9e-05
297ref|XM_753545.1| Ustilago maydis 521 glyceraldehyde 3-phosphate ... 56 9e-05
298gb|AF030943.1| Ovis aries glyceraldehyde 3-phosphate dehydrogena... 56 9e-05
299emb|X07879.1|UMGAPD Ustilaga maydis gene for glyceraldehyde-3-ph... 56 9e-05
300emb|AL607000.3|OSJN00132 Oryza sativa genomic DNA, chromosome 4,... 56 9e-05
301emb|AJ431207.1|CHI431207 Capra hircus partial mRNA for glycerald... 56 9e-05
302dbj|AB237762.1| Microdochium nivale GPD gene for glyceraldehyde ... 56 9e-05
303gb|AF272837.1|AF272837 Ovis aries glyceraldehyde-3-phosphate deh... 56 9e-05
304gb|U94718.1|OAU94718 Ovis aries glyceraldehyde-3-phosphate dehyd... 56 9e-05
305gb|AY562407.1| Alternaria tagetica strain BMP 0179 glyceraldehyd... 56 9e-05
306gb|AF035421.1|AF035421 Ovis aries glyceraldehyde 3-phosphate deh... 56 9e-05
307ref|XM_529173.1| PREDICTED: Pan troglodytes similar to Glycerald... 54 3e-04
308gb|AF297874.1| Coriolopsis gallica glyceraldehyde-3-phosphate de... 54 3e-04
309gb|AY551074.1| Drosophila buzzatii glyceraldehyde-3-phosphate de... 54 3e-04
310ref|XR_003710.1| PREDICTED: Mus musculus similar to Glyceraldehy... 54 3e-04
311ref|XR_001858.1| PREDICTED: Mus musculus similar to Glyceraldehy... 54 3e-04
312ref|XR_004487.1| PREDICTED: Mus musculus similar to Glyceraldehy... 54 3e-04
313ref|XR_001586.1| PREDICTED: Mus musculus similar to Glyceraldehy... 54 3e-04
314ref|XR_001552.1| PREDICTED: Mus musculus similar to Glyceraldehy... 54 3e-04
315ref|XM_844513.1| PREDICTED: Canis familiaris similar to glyceral... 54 3e-04
316ref|XR_002755.1| PREDICTED: Mus musculus similar to glyceraldehy... 54 3e-04
317ref|XR_001750.1| PREDICTED: Mus musculus similar to glyceraldehy... 54 3e-04
318gb|L26924.1|GBIGLYADEH Ginkgo biloba glyceraldehyde-phosphate de... 54 3e-04
319ref|XM_847439.1| PREDICTED: Canis familiaris similar to glyceral... 54 3e-04
320gb|AC100149.12| Mus musculus chromosome 10, clone RP23-43F3, com... 54 3e-04
321emb|AL732579.5| Human DNA sequence from clone RP11-274K13 on chr... 54 3e-04
322ref|XM_969088.1| PREDICTED: Tribolium castaneum similar to Glyce... 54 3e-04
323emb|Z19086.1|CCGLYDEHA C.coturnix encoding glyceraldehydephospha... 54 3e-04
324emb|AJ512345.1|ODA512345 Ochromonas danica partial gapC gene for... 54 3e-04
325gb|AC161592.2| Mus musculus BAC clone RP24-252H17 from chromosom... 54 3e-04
326dbj|AB194120.1| Zelkova serrata DNA, satellite marker: bczs336b 54 3e-04
327dbj|AK135747.1| Mus musculus in vitro fertilized eggs cDNA, RIKE... 54 3e-04
328gb|AF157626.1|AF157626 Equus caballus glyceraldehyde-3-phosphate... 54 3e-04
329gb|AY608675.1| Phaeodactylum tricornutum mitochondrial glycerald... 54 3e-04
330gb|AC131737.3| Mus musculus BAC clone RP23-106E9 from 7, complet... 54 3e-04
331gb|AC110195.14| Mus musculus chromosome 3, clone RP24-291L17, co... 52 0.001
332gb|AY578058.1| Petromyzon marinus clone PmGAPDH glyceraldehyde 3... 52 0.001
333gb|AC136455.3| Mus musculus BAC clone RP24-481H2 from chromosome... 52 0.001
334gb|AC135080.2| Mus musculus BAC clone RP24-369P14 from chromosom... 52 0.001
335gb|AC140286.3| Mus musculus BAC clone RP24-573E14 from chromosom... 52 0.001
336gb|AY393882.1| Metschnikowia lochheadii strain UWO(PS)00-133.2 g... 52 0.001
337gb|AC166827.2| Mus musculus BAC clone RP23-359M9 from chromosome... 52 0.001
338gb|AC142167.4| Mus musculus BAC clone RP24-117F4 from chromosome... 52 0.001
339ref|XM_848221.1| PREDICTED: Canis familiaris similar to glyceral... 52 0.001
340ref|XM_844961.1| PREDICTED: Canis familiaris similar to Glyceral... 52 0.001
341ref|XM_847161.1| PREDICTED: Canis familiaris similar to glyceral... 52 0.001
342ref|XR_003992.1| PREDICTED: Mus musculus similar to Glyceraldehy... 52 0.001
343ref|XM_980907.1| PREDICTED: Mus musculus similar to Glyceraldehy... 52 0.001
344ref|XR_002080.1| PREDICTED: Mus musculus similar to Glyceraldehy... 52 0.001
345ref|XR_002602.1| PREDICTED: Mus musculus similar to Glyceraldehy... 52 0.001
346ref|XR_001896.1| PREDICTED: Mus musculus similar to Glyceraldehy... 52 0.001
347ref|XM_848225.1| PREDICTED: Canis familiaris similar to glyceral... 52 0.001
348ref|XM_990888.1| PREDICTED: Mus musculus similar to Glyceraldehy... 52 0.001
349ref|XM_914987.2| PREDICTED: Mus musculus similar to Glyceraldehy... 52 0.001
350ref|XM_985296.1| PREDICTED: Mus musculus similar to Glyceraldehy... 52 0.001
351ref|XM_888028.2| PREDICTED: Mus musculus similar to Glyceraldehy... 52 0.001
352ref|XR_005133.1| PREDICTED: Mus musculus similar to Glyceraldehy... 52 0.001
353ref|XM_973946.1| PREDICTED: Mus musculus similar to glyceraldehy... 52 0.001
354gb|AC115705.13| Mus musculus chromosome 3, clone RP23-390C13, co... 52 0.001
355ref|XM_848580.1| PREDICTED: Canis familiaris similar to Glyceral... 52 0.001
356ref|XR_003452.1| PREDICTED: Mus musculus hypothetical protein LO... 52 0.001
357ref|XR_002396.1| PREDICTED: Mus musculus similar to Glyceraldehy... 52 0.001
358ref|XR_001773.1| PREDICTED: Mus musculus similar to Glyceraldehy... 52 0.001
359ref|XR_004958.1| PREDICTED: Mus musculus similar to Glyceraldehy... 52 0.001
360ref|XR_003524.1| PREDICTED: Mus musculus similar to Glyceraldehy... 52 0.001
361ref|XR_002692.1| PREDICTED: Mus musculus similar to Glyceraldehy... 52 0.001
362ref|XR_004536.1| PREDICTED: Mus musculus similar to Glyceraldehy... 52 0.001
363ref|XM_534639.2| PREDICTED: Canis familiaris similar to glyceral... 52 0.001
364ref|XR_001547.1| PREDICTED: Mus musculus similar to Glyceraldehy... 52 0.001
365ref|XM_843669.1| PREDICTED: Canis familiaris similar to glyceral... 52 0.001
366ref|XM_849886.1| PREDICTED: Canis familiaris similar to Glyceral... 52 0.001
367ref|XM_850001.1| PREDICTED: Canis familiaris similar to Glyceral... 52 0.001
368ref|XM_847275.1| PREDICTED: Canis familiaris similar to Glyceral... 52 0.001
369gb|AC131742.2| Mus musculus BAC clone RP23-67I3 from chromosome ... 52 0.001
370gb|AC111096.15| Mus musculus chromosome 3, clone RP23-174B18, co... 52 0.001
371gb|BC024703.1| Mus musculus RIKEN cDNA 3000002C10 gene, mRNA (cD... 52 0.001
372gb|AC124197.4| Mus musculus BAC clone RP23-298C4 from 15, comple... 52 0.001
373ref|XM_845196.1| PREDICTED: Canis familiaris similar to glyceral... 52 0.001
374ref|XM_846906.1| PREDICTED: Canis familiaris similar to glyceral... 52 0.001
375gb|AC107864.10| Mus musculus chromosome 10, clone RP23-388A14, c... 52 0.001
376ref|XM_845010.1| PREDICTED: Canis familiaris similar to Glyceral... 52 0.001
377ref|XM_844548.1| PREDICTED: Canis familiaris similar to Glyceral... 52 0.001
378ref|XM_843321.1| PREDICTED: Canis familiaris similar to glyceral... 52 0.001
379ref|XM_843569.1| PREDICTED: Canis familiaris similar to Glyceral... 52 0.001
380ref|XM_844344.1| PREDICTED: Canis familiaris similar to Glyceral... 52 0.001
381gb|AC163496.4| Mus musculus chromosome 1, clone RP24-325M15, com... 52 0.001
382gb|AY364460.1| Phaeosphaeria nodorum isolate Sn37-1 glyceraldehy... 52 0.001
383gb|AC161506.4| Mus musculus chromosome 3, clone RP24-210J6, comp... 52 0.001
384emb|X85332.1|SPRNAGPD1 S.pombe mRNA for glyceraldehyde-3-phosph... 52 0.001
385emb|X78307.1|CPHGPD C.plantagineum Hochst mRNA for glyceraldehyd... 52 0.001
386emb|X58718.1|CLGPDG C.lunata gpd gene for glyceraldehyde-3-phosp... 52 0.001
387emb|X01578.1|GGGAPDH1 Gallus gallus partial mRNA homologous to g... 52 0.001
388emb|V00407.1|GGGAPD Gallus gallus mRNA encoding glyceraldehyde-3... 52 0.001
389emb|AL645910.8| Mouse DNA sequence from clone RP23-173M6 on chro... 52 0.001
390emb|AL023796.1|SPBC32F12 S.pombe chromosome II cosmid c32F12 52 0.001
391emb|AJ271155.1|SNO271155 Stagonospora nodorum GDP1 gene for glyc... 52 0.001
392emb|BX571885.7| Mouse DNA sequence from clone RP23-17O21 on chro... 52 0.001
393gb|DQ107520.1| Anabas testudineus glyceraldehyde-3-phosphate deh... 52 0.001
394gb|AC091683.53| Mus musculus strain C57BL/6J clone rp23-155l11 m... 52 0.001
395dbj|AK142723.1| Mus musculus 16 days neonate heart cDNA, RIKEN f... 52 0.001
396gb|AY004839.1| Pyrenophora bromi strain DAOM 127414 glyceraldehy... 52 0.001
397gb|AY004838.1| Pyrenophora tritici-repentis strain DAOM 107224 g... 52 0.001
398gb|AY004836.1| Drechslera dictyoides strain DAOM 63666 glycerald... 52 0.001
399gb|AY004835.1| Drechslera andersenii strain CBS 258.80 glycerald... 52 0.001
400gb|AY004834.1| Drechslera catenaria strain CBS 191.29 glyceralde... 52 0.001
401gb|AY004833.1| Drechslera catenaria strain DAOM 63665A glycerald... 52 0.001
402gb|AY004828.1| Drechslera avenae strain CBS 279.31 glyceraldehyd... 52 0.001
403gb|AY004827.1| Drechslera avenae strain CBS 189.29 glyceraldehyd... 52 0.001
404dbj|AK144690.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-... 52 0.001
405dbj|AK160753.1| Mus musculus 13 days embryo head cDNA, RIKEN ful... 52 0.001
406gb|DQ383973.1| Ascochyta sp. Georgia11 glyceraldehyde-3-phosphat... 52 0.001
407gb|AC155331.5| Mus musculus 6 BAC RP24-189G6 (Roswell Park Cance... 52 0.001
408gb|AF047874.1|AF047874 Gallus gallus glyceraldehyde-3-phosphate ... 52 0.001
409gb|AC116574.6| Mus musculus BAC clone RP23-234F20 from chromosom... 52 0.001
410ref|NM_001022073.1| Schizosaccharomyces pombe 972h- hypothetical... 52 0.001
411gb|AC158682.8| Mus musculus 6 BAC RP23-342D13 (Roswell Park Canc... 52 0.001
412emb|AL954370.3| Mouse DNA sequence from clone RP23-180P4 on chro... 52 0.001
413gb|AC129935.8| Mus musculus chromosome 15, clone RP23-269P8, com... 52 0.001
414gb|AY219884.1| Anguilla anguilla glyceraldehyde-3-phosphate dehy... 52 0.001
415ref|NM_001003142.1| Canis familiaris glyceraldehyde-3-phosphate ... 52 0.001
416ref|NM_204305.1| Gallus gallus glyceraldehyde-3-phosphate dehydr... 52 0.001
417gb|AC124356.4| Mus musculus BAC clone RP24-484D12 from chromosom... 52 0.001
418gb|AF246461.1|AF246461 Mastigamoeba balamuthi glyceraldehyde-3-p... 52 0.001
419gb|AF246460.1|AF246460 Mastigamoeba balamuthi glyceraldehyde-3-p... 52 0.001
420emb|AL929407.16| Mouse DNA sequence from clone RP23-99C16 on chr... 52 0.001
421gb|AC153961.2| Mus musculus 10 BAC RP24-330I16 (Roswell Park Can... 52 0.001
422dbj|AK108644.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.001
423emb|CT573000.9| Mouse DNA sequence from clone RP24-326F11 on chr... 52 0.001
424gb|AF081415.1|AF081415 Cochliobolus hawaiiensis Alcorn 7612(b)-7... 52 0.001
425gb|AF081411.1|AF081411 Cochliobolus lunatus UAMH 4378 glyceralde... 52 0.001
426gb|AF081410.1|AF081410 Cochliobolus nisikadoi CBS 192.29 glycera... 52 0.001
427gb|AF081409.1|AF081409 Bipolaris australis Turgeon 77139 glycera... 52 0.001
428gb|AF081408.1|AF081408 Cochliobolus australiensis Alcorn 8320b g... 52 0.001
429gb|AF081406.1|AF081406 Bipolaris indica BRIP17439 glyceraldehyde... 52 0.001
430gb|AF081403.1|AF081403 Cochliobolus cymbopogonis Alcorn 88109-1 ... 52 0.001
431gb|AF081394.1|AF081394 Cochliobolus lunatus UAMH 1349 glyceralde... 52 0.001
432gb|AF081378.1|AF081378 Cochliobolus hawaiiensis Alcorn 7612(b)-6... 52 0.001
433gb|AF081377.1|AF081377 Cochliobolus ellisii Alcorn 81154-1 glyce... 52 0.001
434gb|AF081376.1|AF081376 Cochliobolus dactyloctenii Alcorn 7938-9 ... 52 0.001
435gb|AF081371.1|AF081371 Pyrenophora chaetomioides DAOM 208989 gly... 52 0.001
436gb|AF081370.1|AF081370 Pyrenophora tritici-repentis DAOM 208990 ... 52 0.001
437gb|AF091136.1|AF091136 Canis familiaris glyceraldehyde-3-phospha... 52 0.001
438gb|AC120412.12| Mus musculus chromosome 5, clone RP24-447P14, co... 52 0.001
439gb|AC091272.12| Mus musculus chromosome 1, clone RP23-74B7, comp... 52 0.001
440gb|AC125070.4| Mus musculus BAC clone RP23-443A7 from 13, comple... 52 0.001
441emb|AL672180.11| Mouse DNA sequence from clone RP23-419G22 on ch... 52 0.001
442gb|AC116708.19| Mus musculus chromosome 1, clone RP23-70F22, com... 52 0.001
443emb|AL513352.12| Mouse DNA sequence from clone RP23-180L12 on ch... 52 0.001
444gb|J00850.1|CHKGAPDHC chicken gapdh(glyceraldehyde-3-phosphate d... 52 0.001
445gb|K01458.1|CHKGAPDHA Chicken GAPDH (glyceraldehyde-3-phosphate ... 52 0.001
446gb|M11213.1|CHKGADPHE Chicken glyceraldehyde-3-phosphate dehydro... 52 0.001
447gb|AC158921.17| Mus musculus chromosome 15, clone RP23-120K5, co... 52 0.001
448dbj|AB075021.1| Anguilla japonica GAPDH mRNA for glyceraldehyde-... 52 0.001
449dbj|AB038240.1| Canis familiaris GAPDH mRNA for glyceraldehyde-3... 52 0.001
450gb|AC165304.8| Mus musculus chromosome 1, clone RP23-138D5, comp... 50 0.005
451ref|XR_003138.1| PREDICTED: Mus musculus similar to Glyceraldehy... 50 0.005
452ref|XR_001914.1| PREDICTED: Mus musculus similar to Glyceraldehy... 50 0.005
453ref|XR_005121.1| PREDICTED: Mus musculus similar to Glyceraldehy... 50 0.005
454gb|AY364457.1| Phaeosphaeria avenaria f. sp. triticae strain ATC... 50 0.005
455emb|X72381.1|PPGAPC1 P.patens gapC1 mRNA 50 0.005
456emb|BX068467.1|CNS09OZR Single read from an extremity of a full-... 50 0.005
457emb|BX066162.1|CNS09N7Q Single read from an extremity of a full-... 50 0.005
458emb|BX057309.1|CNS09GDT Single read from an extremity of a full-... 50 0.005
459emb|BX034622.1|CNS08YVM Single read from an extremity of a full-... 50 0.005
460emb|BX032633.1|CNS08XCD Single read from an extremity of a full-... 50 0.005
461emb|BX032235.1|CNS08X1B Single read from an extremity of a full-... 50 0.005
462emb|Y08366.1|PRGPDGENE Xanthophyllomyces dendrorhous gpd gene 50 0.005
463emb|AJ133016.1|NPA133016 Neurospora pannonica gpd gene (partial)... 50 0.005
464gb|AY004826.1| Pyrenophora semeniperda strain DAOM 213153 glycer... 50 0.005
465gb|AC175202.2| Sporobolomyces roseus clone JGIBAIF-37E14, comple... 50 0.005
466gb|AF388936.1|AF388936 Gelasinospora sp. FGSC 8239 glyceraldehyd... 50 0.005
467gb|AF388934.1|AF388934 Gelasinospora cerealis glyceraldehyde 3-p... 50 0.005
468gb|DQ383979.1| Phoma pinodella strain PMP4 glyceraldehyde-3-phos... 50 0.005
469gb|DQ383978.1| Phoma pinodella strain PMP3 glyceraldehyde-3-phos... 50 0.005
470gb|DQ383977.1| Ascochyta pinodes strain MP19 glyceraldehyde-3-ph... 50 0.005
471gb|AC163694.2| Mus musculus BAC clone RP24-80O2 from chromosome ... 50 0.005
472gb|AY818545.1| Cenococcum geophilum isolate 3-4-2 glyceraldehyde... 50 0.005
473gb|AY818543.1| Cenococcum geophilum isolate 1-14-5 glyceraldehyd... 50 0.005
474gb|AY818542.1| Cenococcum geophilum isolate 3-19-1 glyceraldehyd... 50 0.005
475gb|AY818539.1| Cenococcum geophilum isolate 2-6-7 glyceraldehyde... 50 0.005
476gb|AY818537.1| Cenococcum geophilum isolate 1-6-4 glyceraldehyde... 50 0.005
477gb|AY818536.1| Cenococcum geophilum isolate 1-7-11 glyceraldehyd... 50 0.005
478gb|AY818535.1| Cenococcum geophilum isolate 3-6-1 glyceraldehyde... 50 0.005
479gb|AY818532.1| Cenococcum geophilum isolate 1-2-1 glyceraldehyde... 50 0.005
480gb|AY818528.1| Cenococcum geophilum isolate 3-11-1 glyceraldehyd... 50 0.005
481gb|AY818527.1| Cenococcum geophilum isolate 1-5-4 glyceraldehyde... 50 0.005
482gb|AY818524.1| Cenococcum geophilum isolate 1-17-4 glyceraldehyd... 50 0.005
483gb|AY818523.1| Cenococcum geophilum isolate 3-2-3 glyceraldehyde... 50 0.005
484gb|AY818520.1| Cenococcum geophilum isolate 2-9-3 glyceraldehyde... 50 0.005
485gb|AY818516.1| Cenococcum geophilum isolate 1-6-2 glyceraldehyde... 50 0.005
486gb|AY818514.1| Cenococcum geophilum isolate 3-2-5 glyceraldehyde... 50 0.005
487gb|AY818512.1| Cenococcum geophilum isolate 1-7-7 glyceraldehyde... 50 0.005
488gb|AY818508.1| Cenococcum geophilum isolate 2-9-1 glyceraldehyde... 50 0.005
489gb|AY818506.1| Cenococcum geophilum isolate 1-11-1 glyceraldehyd... 50 0.005
490gb|AY818505.1| Cenococcum geophilum isolate 1-1-2 glyceraldehyde... 50 0.005
491gb|AY818503.1| Cenococcum geophilum isolate 2-13-2 glyceraldehyd... 50 0.005
492gb|AY818501.1| Cenococcum geophilum isolate 1-14-2 glyceraldehyd... 50 0.005
493gb|AY818500.1| Cenococcum geophilum isolate 3-8-3 glyceraldehyde... 50 0.005
494gb|AY818498.1| Cenococcum geophilum isolate 2-11-1 glyceraldehyd... 50 0.005
495gb|AY818495.1| Cenococcum geophilum isolate 1-14-6 glyceraldehyd... 50 0.005
496gb|AY818494.1| Cenococcum geophilum isolate 1-5-5 glyceraldehyde... 50 0.005
497gb|AY818491.1| Cenococcum geophilum isolate 2-12-1 glyceraldehyd... 50 0.005
498gb|AY818490.1| Cenococcum geophilum isolate 3-5-1 glyceraldehyde... 50 0.005
499gb|AY818488.1| Cenococcum geophilum isolate 1-16-2 glyceraldehyd... 50 0.005
500gb|AY818481.1| Cenococcum geophilum isolate 1-1-3 glyceraldehyde... 50 0.005

>emb|X60343.1|HVGADPH H.vulgare GADPH mRNA for glycolytic glyceraldehyde-3-phosphate
           dehydrogenase
          Length = 1365

 Score =  692 bits (349), Expect = 0.0
 Identities = 355/357 (99%)
 Strand = Plus / Plus

                                                                       
Query: 37  ccatctcgcgtcgcggcgtcagttccactccttcgccatgggcaagattaagatcggaat 96
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 8   ccatctcgcgtcgcggcgtcagttccactccttcgccatgggcaagattaagatcggaat 67

                                                                       
Query: 97  caacggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgt 156
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 68  caacggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgt 127

                                                                       
Query: 157 cgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatgacgtacatgttcaa 216
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 128 cgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatgacgtacatgttcaa 187

                                                                       
Query: 217 gtacgacacagttcacggccattggaagcacagtgacatcaagctcaaagacgacaagac 276
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 188 gtacgacacagttcacggccattggaagcacagtgacatcaagctcaaagacgacaagac 247

                                                                       
Query: 277 gctgctcttcggcgagaagccagttactgtctttggcgtcaggaaccctgaggagatccc 336
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 248 gctgctcttcggcgagaagccagttactgtctttggcgtcaggaaccctgaggagatccc 307

                                                                    
Query: 337 gtggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcactgacaa 393
           |||||||||||| |||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 308 gtggggtgaggctggtgctgattacgttgtggaatccaccggtgtcttcactgacaa 364



to top

>gb|AF273738.1|AF273738 Triticum aestivum glyceraldehyde-3-phosphate dehydrogenase-like
           mRNA, complete sequence
          Length = 770

 Score =  601 bits (303), Expect = e-169
 Identities = 364/383 (95%), Gaps = 1/383 (0%)
 Strand = Plus / Plus

                                                                       
Query: 11  cccgtccccagcgaacctccccaccaccatctcgcgtcgcggcgtcagttccactccttc 70
           |||||||||||| |||||||| | | || ||||||||||||||| |||||||||||| ||
Sbjct: 8   cccgtccccagccaacctccc-atctccgtctcgcgtcgcggcggcagttccactccctc 66

                                                                       
Query: 71  gccatgggcaagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtcgcc 130
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 67  gccatgggcaagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtcgcc 126

                                                                       
Query: 131 agggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcacc 190
           ||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 127 agggtagccctccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcacc 186

                                                                       
Query: 191 accgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagcacagt 250
           |||||||||||||| |||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 187 accgagtacatgacctacatgttcaagtacgacaccgttcacggccactggaagcacagt 246

                                                                       
Query: 251 gacatcaagctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtcttt 310
           |||||||||||||| ||||||||||| |||||||| ||||||||||||||||| ||||| 
Sbjct: 247 gacatcaagctcaaggacgacaagactctgctctttggcgagaagccagttaccgtcttc 306

                                                                       
Query: 311 ggcgtcaggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggag 370
           |||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||
Sbjct: 307 ggcgtcaggaaccctgaggagatcccgtggggtgaggctggtgccgattacgttgtggag 366

                                  
Query: 371 tccaccggtgtcttcactgacaa 393
           |||||||||||||||||||||||
Sbjct: 367 tccaccggtgtcttcactgacaa 389



to top

>gb|BT016387.1| Zea mays clone Contig220 mRNA sequence
          Length = 1571

 Score =  418 bits (211), Expect = e-114
 Identities = 295/323 (91%)
 Strand = Plus / Plus

                                                                       
Query: 71  gccatgggcaagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtcgcc 130
           |||||||||||||| |||||||||||||||||||||||||||||||| |||||||| |||
Sbjct: 224 gccatgggcaagatcaagatcggaatcaacggtttcggaaggatcggcaggctcgtggcc 283

                                                                       
Query: 131 agggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcacc 190
           |||||||| || |||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 284 agggtcgccctgcagagcgaggatgtcgagctcgtcgccgtcaacgaccccttcatcacc 343

                                                                       
Query: 191 accgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagcacagt 250
           || || |||||||| |||||||||||||||||||| || |||||||| ||||||||||| 
Sbjct: 344 acggattacatgacctacatgttcaagtacgacaccgtgcacggccaatggaagcacagc 403

                                                                       
Query: 251 gacatcaagctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtcttt 310
           |||||||  ||||| |||  ||||||||| ||||||||||||||||| || || ||||||
Sbjct: 404 gacatcaccctcaaggactccaagacgcttctcttcggcgagaagccggtcaccgtcttt 463

                                                                       
Query: 311 ggcgtcaggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggag 370
           ||| |||||||||| ||||||||||||||||||||||| |||||||| || || ||||||
Sbjct: 464 ggcatcaggaaccccgaggagatcccgtggggtgaggctggtgctgagtatgtcgtggag 523

                                  
Query: 371 tccaccggtgtcttcactgacaa 393
           |||||||||||||||||||||||
Sbjct: 524 tccaccggtgtcttcactgacaa 546



to top

>gb|BT017186.1| Zea mays clone EL01N0370B09.c mRNA sequence
          Length = 1377

 Score =  418 bits (211), Expect = e-114
 Identities = 295/323 (91%)
 Strand = Plus / Plus

                                                                       
Query: 71  gccatgggcaagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtcgcc 130
           |||||||||||||| |||||||||||||||||||||||||||||||| |||||||| |||
Sbjct: 50  gccatgggcaagatcaagatcggaatcaacggtttcggaaggatcggcaggctcgtggcc 109

                                                                       
Query: 131 agggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcacc 190
           |||||||| || |||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 110 agggtcgccctgcagagcgaggatgtcgagctcgtcgccgtcaacgaccccttcatcacc 169

                                                                       
Query: 191 accgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagcacagt 250
           || || |||||||| |||||||||||||||||||| || |||||||| ||||||||||| 
Sbjct: 170 acggattacatgacctacatgttcaagtacgacaccgtgcacggccaatggaagcacagc 229

                                                                       
Query: 251 gacatcaagctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtcttt 310
           |||||||  ||||| |||  ||||||||| ||||||||||||||||| || || ||||||
Sbjct: 230 gacatcaccctcaaggactccaagacgcttctcttcggcgagaagccggtcaccgtcttt 289

                                                                       
Query: 311 ggcgtcaggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggag 370
           ||| |||||||||| ||||||||||||||||||||||| |||||||| || || ||||||
Sbjct: 290 ggcatcaggaaccccgaggagatcccgtggggtgaggctggtgctgagtatgtcgtggag 349

                                  
Query: 371 tccaccggtgtcttcactgacaa 393
           |||||||||||||||||||||||
Sbjct: 350 tccaccggtgtcttcactgacaa 372



to top

>gb|U45855.1|ZMU45855 Zea mays glyceraldehyde-3-phosphate dehydrogenase GAPC2 (gpc2)
           mRNA, complete cds
          Length = 1307

 Score =  418 bits (211), Expect = e-114
 Identities = 295/323 (91%)
 Strand = Plus / Plus

                                                                       
Query: 71  gccatgggcaagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtcgcc 130
           |||||||||||||| |||||||||||||||||||||||||||||||| |||||||| |||
Sbjct: 64  gccatgggcaagatcaagatcggaatcaacggtttcggaaggatcggcaggctcgtggcc 123

                                                                       
Query: 131 agggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcacc 190
           |||||||| || |||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 124 agggtcgccctgcagagcgaggatgtcgagctcgtcgccgtcaacgaccccttcatcacc 183

                                                                       
Query: 191 accgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagcacagt 250
           || || ||||||||||||||||||||||||||||| || |||||||| ||||||||||| 
Sbjct: 184 acggattacatgacgtacatgttcaagtacgacaccgtgcacggccaatggaagcacagc 243

                                                                       
Query: 251 gacatcaagctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtcttt 310
           ||||||   ||||| |||  ||||||||| ||||||||||||||||| || || ||||||
Sbjct: 244 gacatcgccctcaaggactccaagacgcttctcttcggcgagaagccggtcaccgtcttt 303

                                                                       
Query: 311 ggcgtcaggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggag 370
           ||| |||||||||| ||||||||||||||||||||||| |||||||| || || ||||||
Sbjct: 304 ggcatcaggaaccccgaggagatcccgtggggtgaggctggtgctgagtatgtcgtggag 363

                                  
Query: 371 tccaccggtgtcttcactgacaa 393
           |||||||||||||||||||||||
Sbjct: 364 tccaccggtgtcttcactgacaa 386



to top

>gb|AY109359.1| Zea mays CL2022_2 mRNA sequence
          Length = 3495

 Score =  410 bits (207), Expect = e-111
 Identities = 294/323 (91%)
 Strand = Plus / Plus

                                                                        
Query: 71   gccatgggcaagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtcgcc 130
            |||||||||||||| |||||||||||||||||||||||||||||||| |||||||| |||
Sbjct: 2104 gccatgggcaagatcaagatcggaatcaacggtttcggaaggatcggcaggctcgtggcc 2163

                                                                        
Query: 131  agggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcacc 190
            |||||||| || |||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 2164 agggtcgccctgcagagcgaggatgtcgagctcgtcgccgtcaacgaccccttcatcacc 2223

                                                                        
Query: 191  accgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagcacagt 250
            || || |||||||| |||||||||||||||||||| || |||||||| ||||||||||| 
Sbjct: 2224 acggattacatgacctacatgttcaagtacgacaccgtgcacggccaatggaagcacagc 2283

                                                                        
Query: 251  gacatcaagctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtcttt 310
            ||||||   ||||| |||  ||||||||| ||||||||||||||||| || || ||||||
Sbjct: 2284 gacatcgccctcaaggactccaagacgcttctcttcggcgagaagccggtcaccgtcttt 2343

                                                                        
Query: 311  ggcgtcaggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggag 370
            ||| |||||||||| ||||||||||||||||||||||| |||||||| || || ||||||
Sbjct: 2344 ggcatcaggaaccccgaggagatcccgtggggtgaggctggtgctgagtatgtcgtggag 2403

                                   
Query: 371  tccaccggtgtcttcactgacaa 393
            |||||||||||||||||||||||
Sbjct: 2404 tccaccggtgtcttcactgacaa 2426



to top

>ref|XM_479895.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1356

 Score =  406 bits (205), Expect = e-110
 Identities = 295/325 (90%)
 Strand = Plus / Plus

                                                                       
Query: 69  tcgccatgggcaagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtcg 128
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 40  tcgccatgggcaagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtgg 99

                                                                       
Query: 129 ccagggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatca 188
           ||||||| || ||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 100 ccagggtggccctccagagcgaggatgtcgagctcgtcgccgtcaacgaccccttcatca 159

                                                                       
Query: 189 ccaccgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagcaca 248
           ||||||| |||||||| ||||||||||||||||| || || |||||||| ||||||||||
Sbjct: 160 ccaccgactacatgacctacatgttcaagtacgataccgtgcacggccaatggaagcaca 219

                                                                       
Query: 249 gtgacatcaagctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtct 308
           | ||||||||| |||| |||  |||||| |||||||| ||||||||||| || || || |
Sbjct: 220 gcgacatcaagatcaaggactccaagactctgctcttgggcgagaagccggtcaccgttt 279

                                                                       
Query: 309 ttggcgtcaggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtgg 368
           | ||| ||||||||||||| ||||| ||||||| |||||| |||||||| || || ||||
Sbjct: 280 tcggcatcaggaaccctgacgagattccgtgggctgaggctggtgctgagtatgtcgtgg 339

                                    
Query: 369 agtccaccggtgtcttcactgacaa 393
           |||||||||||||||||||||||||
Sbjct: 340 agtccaccggtgtcttcactgacaa 364



to top

>ref|XM_507107.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1163_G08.15
           mRNA
          Length = 1518

 Score =  406 bits (205), Expect = e-110
 Identities = 295/325 (90%)
 Strand = Plus / Plus

                                                                       
Query: 69  tcgccatgggcaagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtcg 128
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 73  tcgccatgggcaagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtgg 132

                                                                       
Query: 129 ccagggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatca 188
           ||||||| || ||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 133 ccagggtggccctccagagcgaggatgtcgagctcgtcgccgtcaacgaccccttcatca 192

                                                                       
Query: 189 ccaccgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagcaca 248
           ||||||| |||||||| ||||||||||||||||| || || |||||||| ||||||||||
Sbjct: 193 ccaccgactacatgacctacatgttcaagtacgataccgtgcacggccaatggaagcaca 252

                                                                       
Query: 249 gtgacatcaagctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtct 308
           | ||||||||| |||| |||  |||||| |||||||| ||||||||||| || || || |
Sbjct: 253 gcgacatcaagatcaaggactccaagactctgctcttgggcgagaagccggtcaccgttt 312

                                                                       
Query: 309 ttggcgtcaggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtgg 368
           | ||| ||||||||||||| ||||| ||||||| |||||| |||||||| || || ||||
Sbjct: 313 tcggcatcaggaaccctgacgagattccgtgggctgaggctggtgctgagtatgtcgtgg 372

                                    
Query: 369 agtccaccggtgtcttcactgacaa 393
           |||||||||||||||||||||||||
Sbjct: 373 agtccaccggtgtcttcactgacaa 397



to top

>dbj|AK103777.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033144F10, full
           insert sequence
          Length = 1356

 Score =  406 bits (205), Expect = e-110
 Identities = 295/325 (90%)
 Strand = Plus / Plus

                                                                       
Query: 69  tcgccatgggcaagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtcg 128
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 40  tcgccatgggcaagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtgg 99

                                                                       
Query: 129 ccagggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatca 188
           ||||||| || ||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 100 ccagggtggccctccagagcgaggatgtcgagctcgtcgccgtcaacgaccccttcatca 159

                                                                       
Query: 189 ccaccgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagcaca 248
           ||||||| |||||||| ||||||||||||||||| || || |||||||| ||||||||||
Sbjct: 160 ccaccgactacatgacctacatgttcaagtacgataccgtgcacggccaatggaagcaca 219

                                                                       
Query: 249 gtgacatcaagctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtct 308
           | ||||||||| |||| |||  |||||| |||||||| ||||||||||| || || || |
Sbjct: 220 gcgacatcaagatcaaggactccaagactctgctcttgggcgagaagccggtcaccgttt 279

                                                                       
Query: 309 ttggcgtcaggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtgg 368
           | ||| ||||||||||||| ||||| ||||||| |||||| |||||||| || || ||||
Sbjct: 280 tcggcatcaggaaccctgacgagattccgtgggctgaggctggtgctgagtatgtcgtgg 339

                                    
Query: 369 agtccaccggtgtcttcactgacaa 393
           |||||||||||||||||||||||||
Sbjct: 340 agtccaccggtgtcttcactgacaa 364



to top

>dbj|AK100159.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023020L08, full
           insert sequence
          Length = 1783

 Score =  406 bits (205), Expect = e-110
 Identities = 295/325 (90%)
 Strand = Plus / Plus

                                                                       
Query: 69  tcgccatgggcaagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtcg 128
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 511 tcgccatgggcaagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtgg 570

                                                                       
Query: 129 ccagggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatca 188
           ||||||| || ||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 571 ccagggtggccctccagagcgaggatgtcgagctcgtcgccgtcaacgaccccttcatca 630

                                                                       
Query: 189 ccaccgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagcaca 248
           ||||||| |||||||| ||||||||||||||||| || || |||||||| ||||||||||
Sbjct: 631 ccaccgactacatgacctacatgttcaagtacgataccgtgcacggccaatggaagcaca 690

                                                                       
Query: 249 gtgacatcaagctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtct 308
           | ||||||||| |||| |||  |||||| |||||||| ||||||||||| || || || |
Sbjct: 691 gcgacatcaagatcaaggactccaagactctgctcttgggcgagaagccggtcaccgttt 750

                                                                       
Query: 309 ttggcgtcaggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtgg 368
           | ||| ||||||||||||| ||||| ||||||| |||||| |||||||| || || ||||
Sbjct: 751 tcggcatcaggaaccctgacgagattccgtgggctgaggctggtgctgagtatgtcgtgg 810

                                    
Query: 369 agtccaccggtgtcttcactgacaa 393
           |||||||||||||||||||||||||
Sbjct: 811 agtccaccggtgtcttcactgacaa 835



to top

>dbj|AK071097.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023080G06, full
           insert sequence
          Length = 1518

 Score =  406 bits (205), Expect = e-110
 Identities = 295/325 (90%)
 Strand = Plus / Plus

                                                                       
Query: 69  tcgccatgggcaagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtcg 128
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 73  tcgccatgggcaagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtgg 132

                                                                       
Query: 129 ccagggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatca 188
           ||||||| || ||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 133 ccagggtggccctccagagcgaggatgtcgagctcgtcgccgtcaacgaccccttcatca 192

                                                                       
Query: 189 ccaccgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagcaca 248
           ||||||| |||||||| ||||||||||||||||| || || |||||||| ||||||||||
Sbjct: 193 ccaccgactacatgacctacatgttcaagtacgataccgtgcacggccaatggaagcaca 252

                                                                       
Query: 249 gtgacatcaagctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtct 308
           | ||||||||| |||| |||  |||||| |||||||| ||||||||||| || || || |
Sbjct: 253 gcgacatcaagatcaaggactccaagactctgctcttgggcgagaagccggtcaccgttt 312

                                                                       
Query: 309 ttggcgtcaggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtgg 368
           | ||| ||||||||||||| ||||| ||||||| |||||| |||||||| || || ||||
Sbjct: 313 tcggcatcaggaaccctgacgagattccgtgggctgaggctggtgctgagtatgtcgtgg 372

                                    
Query: 369 agtccaccggtgtcttcactgacaa 393
           |||||||||||||||||||||||||
Sbjct: 373 agtccaccggtgtcttcactgacaa 397



to top

>gb|U31676.1|OSU31676 Oryza sativa clone glyceraldehyde-3-phosphate dehydrogenase (Gpc)
           mRNA, complete cds
          Length = 1326

 Score =  406 bits (205), Expect = e-110
 Identities = 295/325 (90%)
 Strand = Plus / Plus

                                                                       
Query: 69  tcgccatgggcaagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtcg 128
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 24  tcgccatgggcaagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtgg 83

                                                                       
Query: 129 ccagggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatca 188
           ||||||| || ||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 84  ccagggtggccctccagagcgaggatgtcgagctcgtcgccgtcaacgaccccttcatca 143

                                                                       
Query: 189 ccaccgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagcaca 248
           ||||||| |||||||| ||||||||||||||||| || || |||||||| ||||||||||
Sbjct: 144 ccaccgactacatgacctacatgttcaagtacgataccgtgcacggccaatggaagcaca 203

                                                                       
Query: 249 gtgacatcaagctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtct 308
           | ||||||||| |||| |||  |||||| |||||||| ||||||||||| || || || |
Sbjct: 204 gcgacatcaagatcaaggactccaagactctgctcttgggcgagaagccggtcaccgttt 263

                                                                       
Query: 309 ttggcgtcaggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtgg 368
           | ||| ||||||||||||| ||||| ||||||| |||||| |||||||| || || ||||
Sbjct: 264 tcggcatcaggaaccctgacgagattccgtgggctgaggctggtgctgagtatgtcgtgg 323

                                    
Query: 369 agtccaccggtgtcttcactgacaa 393
           |||||||||||||||||||||||||
Sbjct: 324 agtccaccggtgtcttcactgacaa 348



to top

>gb|BT016419.1| Zea mays clone Contig252 mRNA sequence
          Length = 1442

 Score =  391 bits (197), Expect = e-105
 Identities = 293/325 (90%)
 Strand = Plus / Plus

                                                                       
Query: 69  tcgccatgggcaagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtcg 128
           |||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 62  tcgccatgggcaagattaagatcggaatcaacggcttcggaaggatcggcaggctcgtgg 121

                                                                       
Query: 129 ccagggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatca 188
           |||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 122 ccagggtcgccctccagagcgaggatgtcgagctcgtcgccgtcaacgaccccttcatca 181

                                                                       
Query: 189 ccaccgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagcaca 248
           |||| || |||||||| |||||||||||||||||||| || |||||||| ||||||||||
Sbjct: 182 ccacggactacatgacctacatgttcaagtacgacaccgtccacggccactggaagcaca 241

                                                                       
Query: 249 gtgacatcaagctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtct 308
           | |||||||  ||||| |||  |||||| || |||||||| || ||||| || || ||||
Sbjct: 242 gcgacatcacactcaaggactccaagacccttctcttcggtgacaagccggtcaccgtct 301

                                                                       
Query: 309 ttggcgtcaggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtgg 368
           ||||| |||||||||||||||| ||||||||||||||||| || ||||| || || ||||
Sbjct: 302 ttggcatcaggaaccctgaggaaatcccgtggggtgaggctggcgctgagtatgtcgtgg 361

                                    
Query: 369 agtccaccggtgtcttcactgacaa 393
           |||||||||| ||||||||||||||
Sbjct: 362 agtccaccggcgtcttcactgacaa 386



to top

>emb|X07156.1|ZMCGAPDH Maize mRNA for cytosolic GAPDH (GapC) glyceraldehyde-3-phosphate
           dehydrogenase
          Length = 1305

 Score =  391 bits (197), Expect = e-105
 Identities = 293/325 (90%)
 Strand = Plus / Plus

                                                                       
Query: 69  tcgccatgggcaagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtcg 128
           |||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 70  tcgccatgggcaagattaagatcggaatcaacggcttcggaaggatcggcaggctcgtgg 129

                                                                       
Query: 129 ccagggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatca 188
           |||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 130 ccagggtcgccctccagagcgaggatgtcgagctcgtcgccgtcaacgaccccttcatca 189

                                                                       
Query: 189 ccaccgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagcaca 248
           |||| || |||||||| |||||||||||||||||||| || |||||||| ||||||||||
Sbjct: 190 ccacggactacatgacctacatgttcaagtacgacaccgtccacggccactggaagcaca 249

                                                                       
Query: 249 gtgacatcaagctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtct 308
           | |||||||  ||||| |||  |||||| || |||||||| || ||||| || || ||||
Sbjct: 250 gcgacatcacactcaaggactccaagacccttctcttcggtgacaagccggtcaccgtct 309

                                                                       
Query: 309 ttggcgtcaggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtgg 368
           ||||| |||||||||||||||| ||||||||||||||||| || ||||| || || ||||
Sbjct: 310 ttggcatcaggaaccctgaggaaatcccgtggggtgaggctggcgctgagtatgtcgtgg 369

                                    
Query: 369 agtccaccggtgtcttcactgacaa 393
           |||||||||| ||||||||||||||
Sbjct: 370 agtccaccggcgtcttcactgacaa 394



to top

>gb|BT024142.1| Zea mays clone EL01N0441H10 mRNA sequence
          Length = 1302

 Score =  391 bits (197), Expect = e-105
 Identities = 293/325 (90%)
 Strand = Plus / Plus

                                                                       
Query: 69  tcgccatgggcaagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtcg 128
           |||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 71  tcgccatgggcaagattaagatcggaatcaacggcttcggaaggatcggcaggctcgtgg 130

                                                                       
Query: 129 ccagggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatca 188
           |||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 131 ccagggtcgccctccagagcgaggatgtcgagctcgtcgccgtcaacgaccccttcatca 190

                                                                       
Query: 189 ccaccgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagcaca 248
           |||| || |||||||| |||||||||||||||||||| || |||||||| ||||||||||
Sbjct: 191 ccacggactacatgacctacatgttcaagtacgacaccgtccacggccactggaagcaca 250

                                                                       
Query: 249 gtgacatcaagctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtct 308
           | |||||||  ||||| |||  |||||| || |||||||| || ||||| || || ||||
Sbjct: 251 gcgacatcacactcaaggactccaagacccttctcttcggtgacaagccggtcaccgtct 310

                                                                       
Query: 309 ttggcgtcaggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtgg 368
           ||||| |||||||||||||||| ||||||||||||||||| || ||||| || || ||||
Sbjct: 311 ttggcatcaggaaccctgaggaaatcccgtggggtgaggctggcgctgagtatgtcgtgg 370

                                    
Query: 369 agtccaccggtgtcttcactgacaa 393
           |||||||||| ||||||||||||||
Sbjct: 371 agtccaccggcgtcttcactgacaa 395



to top

>gb|AY109397.1| Zea mays CL2022_1 mRNA sequence
          Length = 2408

 Score =  353 bits (178), Expect = 3e-94
 Identities = 286/322 (88%)
 Strand = Plus / Plus

                                                                        
Query: 72   ccatgggcaagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtcgcca 131
            |||||| |||||| |||||||| ||||| || ||||| |||||||| ||||| || ||||
Sbjct: 890  ccatggccaagatcaagatcgggatcaatgggttcggcaggatcggaaggctggtggcca 949

                                                                        
Query: 132  gggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcacca 191
            |||| || || ||||||||||||||||||||||||||||| |||||||||||||||| ||
Sbjct: 950  gggtggccctgcagagcgacgatgtcgagctcgtcgccgtgaacgaccccttcatcagca 1009

                                                                        
Query: 192  ccgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagcacagtg 251
            |||| |||||||| |||||||||||||||||||| || ||||| || |||||||||||||
Sbjct: 1010 ccgactacatgacctacatgttcaagtacgacaccgtgcacggacagtggaagcacagtg 1069

                                                                        
Query: 252  acatcaagctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtctttg 311
            |||||| | | || |||  |||||| || |||||||| |||||||| ||||| |||||||
Sbjct: 1070 acatcacggtgaaggactccaagacccttctcttcggtgagaagccggttaccgtctttg 1129

                                                                        
Query: 312  gcgtcaggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagt 371
            || |||||||||||||||||||||||||||||||||| |||||||| || ||||| ||||
Sbjct: 1130 gcatcaggaaccctgaggagatcccgtggggtgaggctggtgctgagtatgttgttgagt 1189

                                  
Query: 372  ccaccggtgtcttcactgacaa 393
            ||||||||||||||||||||||
Sbjct: 1190 ccaccggtgtcttcactgacaa 1211



to top

>gb|BT018263.1| Zea mays clone EL01T0202D09.c mRNA sequence
          Length = 1302

 Score =  307 bits (155), Expect = 1e-80
 Identities = 245/275 (89%)
 Strand = Plus / Plus

                                                                       
Query: 119 aggctcgtcgccagggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgac 178
           |||||||| ||||||||||| ||||||||||| |||||||||||||||||||||||||||
Sbjct: 11  aggctcgtggccagggtcgccctccagagcgaggatgtcgagctcgtcgccgtcaacgac 70

                                                                       
Query: 179 cccttcatcaccaccgagtacatgacgtacatgttcaagtacgacacagttcacggccat 238
           |||||||||||||| || |||||||| |||||||||||||||||||| || |||||||| 
Sbjct: 71  cccttcatcaccacggactacatgacctacatgttcaagtacgacaccgtccacggccac 130

                                                                       
Query: 239 tggaagcacagtgacatcaagctcaaagacgacaagacgctgctcttcggcgagaagcca 298
           ||||||||||| |||||||  ||||| |||  |||||| || |||||||| || ||||| 
Sbjct: 131 tggaagcacagcgacatcacactcaaggactccaagacccttctcttcggtgacaagccg 190

                                                                       
Query: 299 gttactgtctttggcgtcaggaaccctgaggagatcccgtggggtgaggccggtgctgat 358
           || || ||||||||| |||||||||||||||| ||||||||||||||||| || ||||| 
Sbjct: 191 gtcaccgtctttggcatcaggaaccctgaggaaatcccgtggggtgaggctggcgctgag 250

                                              
Query: 359 tacgttgtggagtccaccggtgtcttcactgacaa 393
           || || |||||||||||||| ||||||||||||||
Sbjct: 251 tatgtcgtggagtccaccggcgtcttcactgacaa 285



to top

>ref|XM_472949.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1014

 Score =  250 bits (126), Expect = 3e-63
 Identities = 267/314 (85%)
 Strand = Plus / Plus

                                                                       
Query: 80  aagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtcgccagggtcgca 139
           |||||||||||||| ||||| || ||||| ||||||||||||||||| |||||||| || 
Sbjct: 7   aagattaagatcgggatcaatgggttcgggaggatcgggaggctcgtggccagggtggcc 66

                                                                       
Query: 140 ctccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtac 199
           || ||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 67  ctgcagagcgacgacgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgactac 126

                                                                       
Query: 200 atgacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaag 259
           ||||| |||||||||||||| ||||| || |||||||| ||||||||   |||  | |||
Sbjct: 127 atgacatacatgttcaagtatgacactgtgcacggccagtggaagcatcatgaggttaag 186

                                                                       
Query: 260 ctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 319
            | || |||  |||||| || |||||||| ||||||   || || || || |||  ||||
Sbjct: 187 gtgaaggactccaagacccttctcttcggtgagaaggaggtcaccgtgttcggctgcagg 246

                                                                       
Query: 320 aaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccaccggt 379
           ||||||||||||||||| ||||||||| | || ||||| |  |||||||||||||| |||
Sbjct: 247 aaccctgaggagatcccatggggtgagactggcgctgagtttgttgtggagtccactggt 306

                         
Query: 380 gtcttcactgacaa 393
           || |||||||||||
Sbjct: 307 gttttcactgacaa 320



to top

>dbj|AK064960.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001A14, full
           insert sequence
          Length = 1326

 Score =  250 bits (126), Expect = 3e-63
 Identities = 267/314 (85%)
 Strand = Plus / Plus

                                                                       
Query: 80  aagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtcgccagggtcgca 139
           |||||||||||||| ||||| || ||||| ||||||||||||||||| |||||||| || 
Sbjct: 90  aagattaagatcgggatcaatgggttcgggaggatcgggaggctcgtggccagggtggcc 149

                                                                       
Query: 140 ctccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtac 199
           || ||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 150 ctgcagagcgacgacgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgactac 209

                                                                       
Query: 200 atgacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaag 259
           ||||| |||||||||||||| ||||| || |||||||| ||||||||   |||  | |||
Sbjct: 210 atgacatacatgttcaagtatgacactgtgcacggccagtggaagcatcatgaggttaag 269

                                                                       
Query: 260 ctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 319
            | || |||  |||||| || |||||||| ||||||   || || || || |||  ||||
Sbjct: 270 gtgaaggactccaagacccttctcttcggtgagaaggaggtcaccgtgttcggctgcagg 329

                                                                       
Query: 320 aaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccaccggt 379
           ||||||||||||||||| ||||||||| | || ||||| |  |||||||||||||| |||
Sbjct: 330 aaccctgaggagatcccatggggtgagactggcgctgagtttgttgtggagtccactggt 389

                         
Query: 380 gtcttcactgacaa 393
           || |||||||||||
Sbjct: 390 gttttcactgacaa 403



to top

>gb|AY349291.1| Hordeum vulgare subsp. spontaneum NPGS PI 420916
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2007

 Score =  234 bits (118), Expect = 2e-58
 Identities = 118/118 (100%)
 Strand = Plus / Plus

                                                                       
Query: 202 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 261
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 400 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 459

                                                                     
Query: 262 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 319
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 460 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 517



 Score =  202 bits (102), Expect = 6e-49
 Identities = 102/102 (100%)
 Strand = Plus / Plus

                                                                       
Query: 101 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 160
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 161 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 202
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 102



 Score =  147 bits (74), Expect = 3e-32
 Identities = 77/78 (98%)
 Strand = Plus / Plus

                                                                       
Query: 316 caggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccac 375
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 593 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 652

                             
Query: 376 cggtgtcttcactgacaa 393
           ||||||||||||||||||
Sbjct: 653 cggtgtcttcactgacaa 670



to top

>gb|AY857765.1| Triticum monococcum glyceraldehyde-3-phosphate dehydrogenase (GPD1)
           mRNA, partial cds
          Length = 630

 Score =  230 bits (116), Expect = 3e-57
 Identities = 260/308 (84%)
 Strand = Plus / Plus

                                                                       
Query: 86  aagatcggaatcaacggtttcggaaggatcgggaggctcgtcgccagggtcgcactccag 145
           |||||||| ||||| ||||||||  ||||||| ||||| || |||||||| || ||||||
Sbjct: 85  aagatcggcatcaatggtttcggccggatcggcaggcttgtggccagggttgcgctccag 144

                                                                       
Query: 146 agcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatgacg 205
           |||  ||||||||||||||||||||||||||||||||||||||||||||| |||||||| 
Sbjct: 145 agccccgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgactacatgacc 204

                                                                       
Query: 206 tacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagctcaaa 265
           |||||||||||||| ||||| || || || || |||||||||  |||  | ||| | || 
Sbjct: 205 tacatgttcaagtatgacactgtccatggacagtggaagcaccatgaagttaaggtgaag 264

                                                                       
Query: 266 gacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcaggaaccct 325
           |||  |||||| || ||||| |||||||||   ||  |||| ||||||  ||||||||||
Sbjct: 265 gactccaagacccttctctttggcgagaaggaggtagctgtgtttggctgcaggaaccct 324

                                                                       
Query: 326 gaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttc 385
           ||||||||||| |||| ||  || |||||||| |||||||| |||||||||||||| |||
Sbjct: 325 gaggagatcccatgggctgctgctggtgctgagtacgttgttgagtccaccggtgttttc 384

                   
Query: 386 actgacaa 393
           ||||||||
Sbjct: 385 actgacaa 392



to top

>ref|NM_111283.2| Arabidopsis thaliana GAPC (GLYCERALDEHYDE-3-PHOSPHATE DEHYDROGENASE
           C SUBUNIT); glyceraldehyde-3-phosphate dehydrogenase
           AT3G04120 (GAPC) mRNA, complete cds
          Length = 1540

 Score =  226 bits (114), Expect = 4e-56
 Identities = 264/314 (84%)
 Strand = Plus / Plus

                                                                       
Query: 80  aagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtcgccagggtcgca 139
           ||||||| ||||||||||||||| |||||||| || ||  |  | || || || || |  
Sbjct: 137 aagattaggatcggaatcaacggattcggaagaattggtcgtttggttgctagagttgtt 196

                                                                       
Query: 140 ctccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtac 199
           |||||||| |||||||| ||||||||||| |||||||||||||||||||| || ||||||
Sbjct: 197 ctccagagggacgatgttgagctcgtcgctgtcaacgaccccttcatcactactgagtac 256

                                                                       
Query: 200 atgacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaag 259
           ||||| |||||||||||||||||||  |||||||| || ||||| |||| |||  |||||
Sbjct: 257 atgacctacatgttcaagtacgacagtgttcacggtcaatggaaacacaatgaactcaag 316

                                                                       
Query: 260 ctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 319
            |||| || || ||||| || |||||||| ||||||||||| ||||| || ||| |||||
Sbjct: 317 atcaaggatgagaagacccttctcttcggtgagaagccagtcactgttttcggcatcagg 376

                                                                       
Query: 320 aaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccaccggt 379
           ||||||||||| ||||| ||||  ||||| || ||||| |||||||| ||||| || |||
Sbjct: 377 aaccctgaggatatcccatgggccgaggctggagctgactacgttgttgagtctactggt 436

                         
Query: 380 gtcttcactgacaa 393
           ||||||||||||||
Sbjct: 437 gtcttcactgacaa 450



to top

>gb|AY349297.1| Hordeum vulgare subsp. spontaneum NPGS PI 560559
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2001

 Score =  226 bits (114), Expect = 4e-56
 Identities = 117/118 (99%)
 Strand = Plus / Plus

                                                                       
Query: 202 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 261
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 394 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 453

                                                                     
Query: 262 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 319
           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 454 caaggacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 511



 Score =  202 bits (102), Expect = 6e-49
 Identities = 102/102 (100%)
 Strand = Plus / Plus

                                                                       
Query: 101 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 160
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 161 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 202
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 102



 Score =  147 bits (74), Expect = 3e-32
 Identities = 77/78 (98%)
 Strand = Plus / Plus

                                                                       
Query: 316 caggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccac 375
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 587 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 646

                             
Query: 376 cggtgtcttcactgacaa 393
           ||||||||||||||||||
Sbjct: 647 cggtgtcttcactgacaa 664



to top

>gb|AY349296.1| Hordeum vulgare subsp. spontaneum NPGS PI 559556
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2001

 Score =  226 bits (114), Expect = 4e-56
 Identities = 117/118 (99%)
 Strand = Plus / Plus

                                                                       
Query: 202 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 261
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 394 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 453

                                                                     
Query: 262 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 319
           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 454 caaggacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 511



 Score =  202 bits (102), Expect = 6e-49
 Identities = 102/102 (100%)
 Strand = Plus / Plus

                                                                       
Query: 101 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 160
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 161 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 202
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 102



 Score =  147 bits (74), Expect = 3e-32
 Identities = 77/78 (98%)
 Strand = Plus / Plus

                                                                       
Query: 316 caggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccac 375
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 587 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 646

                             
Query: 376 cggtgtcttcactgacaa 393
           ||||||||||||||||||
Sbjct: 647 cggtgtcttcactgacaa 664



to top

>gb|AY349294.1| Hordeum vulgare subsp. spontaneum NPGS PI 531853
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2007

 Score =  226 bits (114), Expect = 4e-56
 Identities = 117/118 (99%)
 Strand = Plus / Plus

                                                                       
Query: 202 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 261
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 400 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 459

                                                                     
Query: 262 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 319
           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 460 caaggacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 517



 Score =  202 bits (102), Expect = 6e-49
 Identities = 102/102 (100%)
 Strand = Plus / Plus

                                                                       
Query: 101 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 160
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 161 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 202
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 102



 Score =  147 bits (74), Expect = 3e-32
 Identities = 77/78 (98%)
 Strand = Plus / Plus

                                                                       
Query: 316 caggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccac 375
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 593 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 652

                             
Query: 376 cggtgtcttcactgacaa 393
           ||||||||||||||||||
Sbjct: 653 cggtgtcttcactgacaa 670



to top

>gb|AY349293.1| Hordeum vulgare subsp. spontaneum NPGS PI 531851
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2001

 Score =  226 bits (114), Expect = 4e-56
 Identities = 117/118 (99%)
 Strand = Plus / Plus

                                                                       
Query: 202 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 261
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 394 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 453

                                                                     
Query: 262 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 319
           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 454 caaggacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 511



 Score =  202 bits (102), Expect = 6e-49
 Identities = 102/102 (100%)
 Strand = Plus / Plus

                                                                       
Query: 101 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 160
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 161 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 202
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 102



 Score =  147 bits (74), Expect = 3e-32
 Identities = 77/78 (98%)
 Strand = Plus / Plus

                                                                       
Query: 316 caggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccac 375
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 587 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 646

                             
Query: 376 cggtgtcttcactgacaa 393
           ||||||||||||||||||
Sbjct: 647 cggtgtcttcactgacaa 664



to top

>gb|AY349289.1| Hordeum vulgare subsp. spontaneum NPGS PI 420911
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2001

 Score =  226 bits (114), Expect = 4e-56
 Identities = 117/118 (99%)
 Strand = Plus / Plus

                                                                       
Query: 202 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 261
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 394 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 453

                                                                     
Query: 262 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 319
           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 454 caaggacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 511



 Score =  202 bits (102), Expect = 6e-49
 Identities = 102/102 (100%)
 Strand = Plus / Plus

                                                                       
Query: 101 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 160
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 161 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 202
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 102



 Score =  147 bits (74), Expect = 3e-32
 Identities = 77/78 (98%)
 Strand = Plus / Plus

                                                                       
Query: 316 caggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccac 375
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 587 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 646

                             
Query: 376 cggtgtcttcactgacaa 393
           ||||||||||||||||||
Sbjct: 647 cggtgtcttcactgacaa 664



to top

>gb|AY349287.1| Hordeum vulgare subsp. spontaneum NPGS PI 406276
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2001

 Score =  226 bits (114), Expect = 4e-56
 Identities = 117/118 (99%)
 Strand = Plus / Plus

                                                                       
Query: 202 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 261
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 394 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 453

                                                                     
Query: 262 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 319
           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 454 caaggacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 511



 Score =  202 bits (102), Expect = 6e-49
 Identities = 102/102 (100%)
 Strand = Plus / Plus

                                                                       
Query: 101 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 160
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 161 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 202
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 102



 Score =  147 bits (74), Expect = 3e-32
 Identities = 77/78 (98%)
 Strand = Plus / Plus

                                                                       
Query: 316 caggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccac 375
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 587 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 646

                             
Query: 376 cggtgtcttcactgacaa 393
           ||||||||||||||||||
Sbjct: 647 cggtgtcttcactgacaa 664



to top

>gb|AY349286.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2001

 Score =  226 bits (114), Expect = 4e-56
 Identities = 117/118 (99%)
 Strand = Plus / Plus

                                                                       
Query: 202 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 261
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 394 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 453

                                                                     
Query: 262 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 319
           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 454 caaggacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 511



 Score =  202 bits (102), Expect = 6e-49
 Identities = 102/102 (100%)
 Strand = Plus / Plus

                                                                       
Query: 101 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 160
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 161 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 202
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 102



 Score =  147 bits (74), Expect = 3e-32
 Identities = 77/78 (98%)
 Strand = Plus / Plus

                                                                       
Query: 316 caggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccac 375
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 587 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 646

                             
Query: 376 cggtgtcttcactgacaa 393
           ||||||||||||||||||
Sbjct: 647 cggtgtcttcactgacaa 664



to top

>gb|AY349285.1| Hordeum vulgare subsp. spontaneum NPGS PI 401370
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2001

 Score =  226 bits (114), Expect = 4e-56
 Identities = 117/118 (99%)
 Strand = Plus / Plus

                                                                       
Query: 202 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 261
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 394 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 453

                                                                     
Query: 262 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 319
           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 454 caaggacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 511



 Score =  202 bits (102), Expect = 6e-49
 Identities = 102/102 (100%)
 Strand = Plus / Plus

                                                                       
Query: 101 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 160
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 161 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 202
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 102



 Score =  147 bits (74), Expect = 3e-32
 Identities = 77/78 (98%)
 Strand = Plus / Plus

                                                                       
Query: 316 caggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccac 375
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 587 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 646

                             
Query: 376 cggtgtcttcactgacaa 393
           ||||||||||||||||||
Sbjct: 647 cggtgtcttcactgacaa 664



to top

>gb|AY349284.1| Hordeum vulgare subsp. spontaneum NPGS PI 366446
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2001

 Score =  226 bits (114), Expect = 4e-56
 Identities = 117/118 (99%)
 Strand = Plus / Plus

                                                                       
Query: 202 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 261
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 394 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 453

                                                                     
Query: 262 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 319
           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 454 caaggacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 511



 Score =  202 bits (102), Expect = 6e-49
 Identities = 102/102 (100%)
 Strand = Plus / Plus

                                                                       
Query: 101 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 160
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 161 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 202
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 102



 Score =  147 bits (74), Expect = 3e-32
 Identities = 77/78 (98%)
 Strand = Plus / Plus

                                                                       
Query: 316 caggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccac 375
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 587 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 646

                             
Query: 376 cggtgtcttcactgacaa 393
           ||||||||||||||||||
Sbjct: 647 cggtgtcttcactgacaa 664



to top

>gb|AY349281.1| Hordeum vulgare subsp. spontaneum NPGS PI 293409
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2001

 Score =  226 bits (114), Expect = 4e-56
 Identities = 117/118 (99%)
 Strand = Plus / Plus

                                                                       
Query: 202 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 261
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 394 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 453

                                                                     
Query: 262 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 319
           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 454 caaggacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 511



 Score =  202 bits (102), Expect = 6e-49
 Identities = 102/102 (100%)
 Strand = Plus / Plus

                                                                       
Query: 101 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 160
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 161 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 202
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 102



 Score =  147 bits (74), Expect = 3e-32
 Identities = 77/78 (98%)
 Strand = Plus / Plus

                                                                       
Query: 316 caggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccac 375
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 587 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 646

                             
Query: 376 cggtgtcttcactgacaa 393
           ||||||||||||||||||
Sbjct: 647 cggtgtcttcactgacaa 664



to top

>gb|AY349280.1| Hordeum vulgare subsp. spontaneum NPGS PI 293402
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2001

 Score =  226 bits (114), Expect = 4e-56
 Identities = 117/118 (99%)
 Strand = Plus / Plus

                                                                       
Query: 202 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 261
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 394 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 453

                                                                     
Query: 262 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 319
           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 454 caaggacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 511



 Score =  202 bits (102), Expect = 6e-49
 Identities = 102/102 (100%)
 Strand = Plus / Plus

                                                                       
Query: 101 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 160
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 161 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 202
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 102



 Score =  147 bits (74), Expect = 3e-32
 Identities = 77/78 (98%)
 Strand = Plus / Plus

                                                                       
Query: 316 caggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccac 375
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 587 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 646

                             
Query: 376 cggtgtcttcactgacaa 393
           ||||||||||||||||||
Sbjct: 647 cggtgtcttcactgacaa 664



to top

>gb|AY349279.1| Hordeum vulgare subsp. spontaneum NPGS PI 268242
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2001

 Score =  226 bits (114), Expect = 4e-56
 Identities = 117/118 (99%)
 Strand = Plus / Plus

                                                                       
Query: 202 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 261
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 394 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 453

                                                                     
Query: 262 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 319
           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 454 caaggacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 511



 Score =  202 bits (102), Expect = 6e-49
 Identities = 102/102 (100%)
 Strand = Plus / Plus

                                                                       
Query: 101 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 160
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 161 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 202
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 102



 Score =  147 bits (74), Expect = 3e-32
 Identities = 77/78 (98%)
 Strand = Plus / Plus

                                                                       
Query: 316 caggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccac 375
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 587 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 646

                             
Query: 376 cggtgtcttcactgacaa 393
           ||||||||||||||||||
Sbjct: 647 cggtgtcttcactgacaa 664



to top

>gb|AY349278.1| Hordeum vulgare subsp. spontaneum NPGS PI 254894
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2001

 Score =  226 bits (114), Expect = 4e-56
 Identities = 117/118 (99%)
 Strand = Plus / Plus

                                                                       
Query: 202 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 261
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 394 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 453

                                                                     
Query: 262 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 319
           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 454 caaggacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 511



 Score =  202 bits (102), Expect = 6e-49
 Identities = 102/102 (100%)
 Strand = Plus / Plus

                                                                       
Query: 101 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 160
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 161 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 202
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 102



 Score =  147 bits (74), Expect = 3e-32
 Identities = 77/78 (98%)
 Strand = Plus / Plus

                                                                       
Query: 316 caggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccac 375
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 587 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 646

                             
Query: 376 cggtgtcttcactgacaa 393
           ||||||||||||||||||
Sbjct: 647 cggtgtcttcactgacaa 664



to top

>gb|AY349277.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2001

 Score =  226 bits (114), Expect = 4e-56
 Identities = 117/118 (99%)
 Strand = Plus / Plus

                                                                       
Query: 202 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 261
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 394 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 453

                                                                     
Query: 262 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 319
           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 454 caaggacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 511



 Score =  202 bits (102), Expect = 6e-49
 Identities = 102/102 (100%)
 Strand = Plus / Plus

                                                                       
Query: 101 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 160
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 161 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 202
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 102



 Score =  147 bits (74), Expect = 3e-32
 Identities = 77/78 (98%)
 Strand = Plus / Plus

                                                                       
Query: 316 caggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccac 375
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 587 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 646

                             
Query: 376 cggtgtcttcactgacaa 393
           ||||||||||||||||||
Sbjct: 647 cggtgtcttcactgacaa 664



to top

>gb|AY349275.1| Hordeum vulgare subsp. spontaneum NPGS PI 220523
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2001

 Score =  226 bits (114), Expect = 4e-56
 Identities = 117/118 (99%)
 Strand = Plus / Plus

                                                                       
Query: 202 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 261
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 394 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 453

                                                                     
Query: 262 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 319
           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 454 caaggacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 511



 Score =  202 bits (102), Expect = 6e-49
 Identities = 102/102 (100%)
 Strand = Plus / Plus

                                                                       
Query: 101 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 160
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 161 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 202
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 102



 Score =  147 bits (74), Expect = 3e-32
 Identities = 77/78 (98%)
 Strand = Plus / Plus

                                                                       
Query: 316 caggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccac 375
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 587 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 646

                             
Query: 376 cggtgtcttcactgacaa 393
           ||||||||||||||||||
Sbjct: 647 cggtgtcttcactgacaa 664



to top

>gb|AY349274.1| Hordeum vulgare subsp. spontaneum NPGS PI 219796
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2001

 Score =  226 bits (114), Expect = 4e-56
 Identities = 117/118 (99%)
 Strand = Plus / Plus

                                                                       
Query: 202 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 261
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 394 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 453

                                                                     
Query: 262 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 319
           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 454 caaggacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 511



 Score =  202 bits (102), Expect = 6e-49
 Identities = 102/102 (100%)
 Strand = Plus / Plus

                                                                       
Query: 101 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 160
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 161 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 202
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 102



 Score =  147 bits (74), Expect = 3e-32
 Identities = 77/78 (98%)
 Strand = Plus / Plus

                                                                       
Query: 316 caggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccac 375
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 587 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 646

                             
Query: 376 cggtgtcttcactgacaa 393
           ||||||||||||||||||
Sbjct: 647 cggtgtcttcactgacaa 664



to top

>gb|AY349273.1| Hordeum vulgare subsp. spontaneum NPGS PI 212306
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2001

 Score =  226 bits (114), Expect = 4e-56
 Identities = 117/118 (99%)
 Strand = Plus / Plus

                                                                       
Query: 202 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 261
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 394 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 453

                                                                     
Query: 262 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 319
           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 454 caaggacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 511



 Score =  202 bits (102), Expect = 6e-49
 Identities = 102/102 (100%)
 Strand = Plus / Plus

                                                                       
Query: 101 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 160
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 161 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 202
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 102



 Score =  147 bits (74), Expect = 3e-32
 Identities = 77/78 (98%)
 Strand = Plus / Plus

                                                                       
Query: 316 caggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccac 375
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 587 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 646

                             
Query: 376 cggtgtcttcactgacaa 393
           ||||||||||||||||||
Sbjct: 647 cggtgtcttcactgacaa 664



to top

>gb|AY349272.1| Hordeum vulgare subsp. spontaneum NPGS PI 212305
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2001

 Score =  226 bits (114), Expect = 4e-56
 Identities = 117/118 (99%)
 Strand = Plus / Plus

                                                                       
Query: 202 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 261
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 394 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 453

                                                                     
Query: 262 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 319
           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 454 caaggacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 511



 Score =  202 bits (102), Expect = 6e-49
 Identities = 102/102 (100%)
 Strand = Plus / Plus

                                                                       
Query: 101 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 160
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 161 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 202
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 102



 Score =  147 bits (74), Expect = 3e-32
 Identities = 77/78 (98%)
 Strand = Plus / Plus

                                                                       
Query: 316 caggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccac 375
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 587 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 646

                             
Query: 376 cggtgtcttcactgacaa 393
           ||||||||||||||||||
Sbjct: 647 cggtgtcttcactgacaa 664



to top

>gb|AY140084.1| Arabidopsis thaliana unknown protein mRNA, complete cds
          Length = 1322

 Score =  226 bits (114), Expect = 4e-56
 Identities = 264/314 (84%)
 Strand = Plus / Plus

                                                                       
Query: 80  aagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtcgccagggtcgca 139
           ||||||| ||||||||||||||| |||||||| || ||  |  | || || || || |  
Sbjct: 91  aagattaggatcggaatcaacggattcggaagaattggtcgtttggttgctagagttgtt 150

                                                                       
Query: 140 ctccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtac 199
           |||||||| |||||||| ||||||||||| |||||||||||||||||||| || ||||||
Sbjct: 151 ctccagagggacgatgttgagctcgtcgctgtcaacgaccccttcatcactactgagtac 210

                                                                       
Query: 200 atgacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaag 259
           ||||| |||||||||||||||||||  |||||||| || ||||| |||| |||  |||||
Sbjct: 211 atgacctacatgttcaagtacgacagtgttcacggtcaatggaaacacaatgaactcaag 270

                                                                       
Query: 260 ctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 319
            |||| || || ||||| || |||||||| ||||||||||| ||||| || ||| |||||
Sbjct: 271 atcaaggatgagaagacccttctcttcggtgagaagccagtcactgttttcggcatcagg 330

                                                                       
Query: 320 aaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccaccggt 379
           ||||||||||| ||||| ||||  ||||| || ||||| |||||||| ||||| || |||
Sbjct: 331 aaccctgaggatatcccatgggccgaggctggagctgactacgttgttgagtctactggt 390

                         
Query: 380 gtcttcactgacaa 393
           ||||||||||||||
Sbjct: 391 gtcttcactgacaa 404



to top

>gb|AY060521.1| Arabidopsis thaliana AT3g04120/T6K12_26 mRNA, complete cds
          Length = 1017

 Score =  226 bits (114), Expect = 4e-56
 Identities = 264/314 (84%)
 Strand = Plus / Plus

                                                                       
Query: 80  aagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtcgccagggtcgca 139
           ||||||| ||||||||||||||| |||||||| || ||  |  | || || || || |  
Sbjct: 13  aagattaggatcggaatcaacggattcggaagaattggtcgtttggttgctagagttgtt 72

                                                                       
Query: 140 ctccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtac 199
           |||||||| |||||||| ||||||||||| |||||||||||||||||||| || ||||||
Sbjct: 73  ctccagagggacgatgttgagctcgtcgctgtcaacgaccccttcatcactactgagtac 132

                                                                       
Query: 200 atgacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaag 259
           ||||| |||||||||||||||||||  |||||||| || ||||| |||| |||  |||||
Sbjct: 133 atgacctacatgttcaagtacgacagtgttcacggtcaatggaaacacaatgaactcaag 192

                                                                       
Query: 260 ctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 319
            |||| || || ||||| || |||||||| ||||||||||| ||||| || ||| |||||
Sbjct: 193 atcaaggatgagaagacccttctcttcggtgagaagccagtcactgttttcggcatcagg 252

                                                                       
Query: 320 aaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccaccggt 379
           ||||||||||| ||||| ||||  ||||| || ||||| |||||||| ||||| || |||
Sbjct: 253 aaccctgaggatatcccatgggccgaggctggagctgactacgttgttgagtctactggt 312

                         
Query: 380 gtcttcactgacaa 393
           ||||||||||||||
Sbjct: 313 gtcttcactgacaa 326



to top

>gb|AY052267.1| Arabidopsis thaliana AT3g04120/T6K12_26 mRNA, complete cds
          Length = 1324

 Score =  226 bits (114), Expect = 4e-56
 Identities = 264/314 (84%)
 Strand = Plus / Plus

                                                                       
Query: 80  aagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtcgccagggtcgca 139
           ||||||| ||||||||||||||| |||||||| || ||  |  | || || || || |  
Sbjct: 88  aagattaggatcggaatcaacggattcggaagaattggtcgtttggttgctagagttgtt 147

                                                                       
Query: 140 ctccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtac 199
           |||||||| |||||||| ||||||||||| |||||||||||||||||||| || ||||||
Sbjct: 148 ctccagagggacgatgttgagctcgtcgctgtcaacgaccccttcatcactactgagtac 207

                                                                       
Query: 200 atgacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaag 259
           ||||| |||||||||||||||||||  |||||||| || ||||| |||| |||  |||||
Sbjct: 208 atgacctacatgttcaagtacgacagtgttcacggtcaatggaaacacaatgaactcaag 267

                                                                       
Query: 260 ctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 319
            |||| || || ||||| || |||||||| ||||||||||| ||||| || ||| |||||
Sbjct: 268 atcaaggatgagaagacccttctcttcggtgagaagccagtcactgttttcggcatcagg 327

                                                                       
Query: 320 aaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccaccggt 379
           ||||||||||| ||||| ||||  ||||| || ||||| |||||||| ||||| || |||
Sbjct: 328 aaccctgaggatatcccatgggccgaggctggagctgactacgttgttgagtctactggt 387

                         
Query: 380 gtcttcactgacaa 393
           ||||||||||||||
Sbjct: 388 gtcttcactgacaa 401



to top

>gb|AY087651.1| Arabidopsis thaliana clone 37355 mRNA, complete sequence
          Length = 1324

 Score =  226 bits (114), Expect = 4e-56
 Identities = 264/314 (84%)
 Strand = Plus / Plus

                                                                       
Query: 80  aagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtcgccagggtcgca 139
           ||||||| ||||||||||||||| |||||||| || ||  |  | || || || || |  
Sbjct: 92  aagattaggatcggaatcaacggattcggaagaattggtcgtttggttgctagagttgtt 151

                                                                       
Query: 140 ctccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtac 199
           |||||||| |||||||| ||||||||||| |||||||||||||||||||| || ||||||
Sbjct: 152 ctccagagggacgatgttgagctcgtcgctgtcaacgaccccttcatcactactgagtac 211

                                                                       
Query: 200 atgacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaag 259
           ||||| |||||||||||||||||||  |||||||| || ||||| |||| |||  |||||
Sbjct: 212 atgacctacatgttcaagtacgacagtgttcacggtcaatggaaacacaatgaactcaag 271

                                                                       
Query: 260 ctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 319
            |||| || || ||||| || |||||||| ||||||||||| ||||| || ||| |||||
Sbjct: 272 atcaaggatgagaagacccttctcttcggtgagaagccagtcactgttttcggcatcagg 331

                                                                       
Query: 320 aaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccaccggt 379
           ||||||||||| ||||| ||||  ||||| || ||||| |||||||| ||||| || |||
Sbjct: 332 aaccctgaggatatcccatgggccgaggctggagctgactacgttgttgagtctactggt 391

                         
Query: 380 gtcttcactgacaa 393
           ||||||||||||||
Sbjct: 392 gtcttcactgacaa 405



to top

>gb|M64116.1|ATHGAPAC Arabidopsis thaliana glyceraldehyde-3-phosphate dehydrogenase C
           subunit (GapC) gene, complete cds
          Length = 1295

 Score =  226 bits (114), Expect = 4e-56
 Identities = 264/314 (84%)
 Strand = Plus / Plus

                                                                       
Query: 80  aagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtcgccagggtcgca 139
           ||||||| ||||||||||||||| |||||||| || ||  |  | || || || || |  
Sbjct: 55  aagattaggatcggaatcaacggattcggaagaattggtcgtttggttgctagagttgtt 114

                                                                       
Query: 140 ctccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtac 199
           |||||||| |||||||| ||||||||||| |||||||||||||||||||| || ||||||
Sbjct: 115 ctccagagggacgatgttgagctcgtcgctgtcaacgaccccttcatcactactgagtac 174

                                                                       
Query: 200 atgacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaag 259
           ||||| |||||||||||||||||||  |||||||| || ||||| |||| |||  |||||
Sbjct: 175 atgacctacatgttcaagtacgacagtgttcacggtcaatggaaacacaatgaactcaag 234

                                                                       
Query: 260 ctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 319
            |||| || || ||||| || |||||||| ||||||||||| ||||| || ||| |||||
Sbjct: 235 atcaaggatgagaagacccttctcttcggtgagaagccagtcactgttttcggcatcagg 294

                                                                       
Query: 320 aaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccaccggt 379
           ||||||||||| ||||| ||||  ||||| || ||||| |||||||| ||||| || |||
Sbjct: 295 aaccctgaggatatcccatgggccgaggctggagctgactacgttgttgagtctactggt 354

                         
Query: 380 gtcttcactgacaa 393
           ||||||||||||||
Sbjct: 355 gtcttcactgacaa 368



to top

>gb|BT016420.1| Zea mays clone Contig253 mRNA sequence
          Length = 1831

 Score =  222 bits (112), Expect = 7e-55
 Identities = 268/320 (83%)
 Strand = Plus / Plus

                                                                       
Query: 72  ccatgggcaagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtcgcca 131
           |||||| |||||| |||||||| ||||| || ||||| |||||||| ||||| || ||||
Sbjct: 73  ccatggccaagatcaagatcgggatcaatgggttcggcaggatcggaaggctggtggcca 132

                                                                       
Query: 132 gggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcacca 191
           |||| || || ||||| ||||||||||||||||||||||| |||||||||||||||| ||
Sbjct: 133 gggtggccctgcagagtgacgatgtcgagctcgtcgccgtgaacgaccccttcatcagca 192

                                                                       
Query: 192 ccgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagcacagtg 251
           |||| |||||||| |||||||||||||||||||| || ||||| || |||||||||  ||
Sbjct: 193 ccgactacatgacctacatgttcaagtacgacactgtgcacggacagtggaagcaccatg 252

                                                                       
Query: 252 acatcaagctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtctttg 311
           |  ||||| | || |||  ||| || || ||||| || ||||||   ||| |||| ||||
Sbjct: 253 aagtcaaggtgaaggactccaaaacccttctctttggtgagaaggaggttgctgtgtttg 312

                                                                       
Query: 312 gcgtcaggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagt 371
           ||  ||||||||||||||||||||||||||||  ||  |||||||| || ||||| ||||
Sbjct: 313 gctgcaggaaccctgaggagatcccgtggggttcggttggtgctgaatatgttgttgagt 372

                               
Query: 372 ccaccggtgtcttcactgac 391
           | || ||||| |||||||||
Sbjct: 373 ctactggtgttttcactgac 392



to top

>gb|U45857.1|ZMU45857 Zea mays glyceraldehyde-3-phosphate dehydrogenase GAPC4 (gpc4)
           mRNA, complete cds
          Length = 1232

 Score =  222 bits (112), Expect = 7e-55
 Identities = 268/320 (83%)
 Strand = Plus / Plus

                                                                       
Query: 72  ccatgggcaagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtcgcca 131
           |||||| |||||| |||||||| ||||| || ||||| |||||||| ||||| || ||||
Sbjct: 8   ccatggccaagatcaagatcgggatcaatgggttcggcaggatcggaaggctggtggcca 67

                                                                       
Query: 132 gggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcacca 191
           |||| || || ||||| ||||||||||||||||||||||| |||||||||||||||| ||
Sbjct: 68  gggtggctctgcagagtgacgatgtcgagctcgtcgccgtgaacgaccccttcatcagca 127

                                                                       
Query: 192 ccgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagcacagtg 251
           |||| |||||||| |||||||||||||||||||| || ||||| || |||||||||  ||
Sbjct: 128 ccgactacatgacctacatgttcaagtacgacactgtacacggacagtggaagcaccatg 187

                                                                       
Query: 252 acatcaagctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtctttg 311
           |  ||||| | || |||  ||| || || ||||| || ||||||   ||| |||| ||||
Sbjct: 188 aagtcaaggtgaaggactccaaaacccttctctttggtgagaaggaggttgctgtgtttg 247

                                                                       
Query: 312 gcgtcaggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagt 371
           ||  ||||||||||||||||||||||||||||  ||  |||||||| || ||||| ||||
Sbjct: 248 gctgcaggaaccctgaggagatcccgtggggttcggttggtgctgaatatgttgttgagt 307

                               
Query: 372 ccaccggtgtcttcactgac 391
           | || ||||| |||||||||
Sbjct: 308 ctactggtgttttcactgac 327



to top

>gb|AY349295.1| Hordeum vulgare subsp. spontaneum NPGS PI 531957
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2002

 Score =  218 bits (110), Expect = 1e-53
 Identities = 116/118 (98%)
 Strand = Plus / Plus

                                                                       
Query: 202 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 261
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 402 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 461

                                                                     
Query: 262 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 319
           ||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 462 caaggacgacaagacgctgctctttggcgagaagccagttactgtctttggcgtcagg 519



 Score =  178 bits (90), Expect = 9e-42
 Identities = 99/102 (97%)
 Strand = Plus / Plus

                                                                       
Query: 101 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 160
           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggttttggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 161 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 202
           |||||||||||||||||||| |||||||| ||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccctttcatcacgaccgagtacatg 102



 Score =  147 bits (74), Expect = 3e-32
 Identities = 77/78 (98%)
 Strand = Plus / Plus

                                                                       
Query: 316 caggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccac 375
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 595 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 654

                             
Query: 376 cggtgtcttcactgacaa 393
           ||||||||||||||||||
Sbjct: 655 cggtgtcttcactgacaa 672



to top

>gb|AY349292.1| Hordeum vulgare subsp. spontaneum NPGS PI 466460
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2003

 Score =  218 bits (110), Expect = 1e-53
 Identities = 116/118 (98%)
 Strand = Plus / Plus

                                                                       
Query: 202 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 261
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 402 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 461

                                                                     
Query: 262 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 319
           ||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 462 caaggacgacaagacgctgctctttggcgagaagccagttactgtctttggcgtcagg 519



 Score =  178 bits (90), Expect = 9e-42
 Identities = 99/102 (97%)
 Strand = Plus / Plus

                                                                       
Query: 101 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 160
           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggttttggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 161 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 202
           |||||||||||||||||||| |||||||| ||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccctttcatcacgaccgagtacatg 102



 Score =  147 bits (74), Expect = 3e-32
 Identities = 77/78 (98%)
 Strand = Plus / Plus

                                                                       
Query: 316 caggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccac 375
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 595 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 654

                             
Query: 376 cggtgtcttcactgacaa 393
           ||||||||||||||||||
Sbjct: 655 cggtgtcttcactgacaa 672



to top

>gb|AY349290.1| Hordeum vulgare subsp. spontaneum NPGS PI 420913
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2002

 Score =  218 bits (110), Expect = 1e-53
 Identities = 116/118 (98%)
 Strand = Plus / Plus

                                                                       
Query: 202 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 261
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 402 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 461

                                                                     
Query: 262 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 319
           ||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 462 caaggacgacaagacgctgctctttggcgagaagccagttactgtctttggcgtcagg 519



 Score =  178 bits (90), Expect = 9e-42
 Identities = 99/102 (97%)
 Strand = Plus / Plus

                                                                       
Query: 101 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 160
           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggttttggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 161 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 202
           |||||||||||||||||||| |||||||| ||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccctttcatcacgaccgagtacatg 102



 Score =  147 bits (74), Expect = 3e-32
 Identities = 77/78 (98%)
 Strand = Plus / Plus

                                                                       
Query: 316 caggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccac 375
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 595 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 654

                             
Query: 376 cggtgtcttcactgacaa 393
           ||||||||||||||||||
Sbjct: 655 cggtgtcttcactgacaa 672



to top

>gb|AY349288.1| Hordeum vulgare subsp. spontaneum NPGS PI 420911
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2001

 Score =  218 bits (110), Expect = 1e-53
 Identities = 116/118 (98%)
 Strand = Plus / Plus

                                                                       
Query: 202 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 261
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 402 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 461

                                                                     
Query: 262 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 319
           ||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 462 caaggacgacaagacgctgctctttggcgagaagccagttactgtctttggcgtcagg 519



 Score =  178 bits (90), Expect = 9e-42
 Identities = 99/102 (97%)
 Strand = Plus / Plus

                                                                       
Query: 101 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 160
           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggttttggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 161 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 202
           |||||||||||||||||||| |||||||| ||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccctttcatcacgaccgagtacatg 102



 Score =  147 bits (74), Expect = 3e-32
 Identities = 77/78 (98%)
 Strand = Plus / Plus

                                                                       
Query: 316 caggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccac 375
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 595 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 654

                             
Query: 376 cggtgtcttcactgacaa 393
           ||||||||||||||||||
Sbjct: 655 cggtgtcttcactgacaa 672



to top

>gb|AY349283.1| Hordeum vulgare subsp. spontaneum NPGS PI 296926
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2002

 Score =  218 bits (110), Expect = 1e-53
 Identities = 116/118 (98%)
 Strand = Plus / Plus

                                                                       
Query: 202 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 261
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 402 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 461

                                                                     
Query: 262 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 319
           ||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 462 caaggacgacaagacgctgctctttggcgagaagccagttactgtctttggcgtcagg 519



 Score =  178 bits (90), Expect = 9e-42
 Identities = 99/102 (97%)
 Strand = Plus / Plus

                                                                       
Query: 101 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 160
           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggttttggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 161 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 202
           |||||||||||||||||||| |||||||| ||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccctttcatcacgaccgagtacatg 102



 Score =  147 bits (74), Expect = 3e-32
 Identities = 77/78 (98%)
 Strand = Plus / Plus

                                                                       
Query: 316 caggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccac 375
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 595 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 654

                             
Query: 376 cggtgtcttcactgacaa 393
           ||||||||||||||||||
Sbjct: 655 cggtgtcttcactgacaa 672



to top

>gb|AY349282.1| Hordeum vulgare subsp. spontaneum NPGS PI 293411
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2002

 Score =  218 bits (110), Expect = 1e-53
 Identities = 116/118 (98%)
 Strand = Plus / Plus

                                                                       
Query: 202 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 261
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 402 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 461

                                                                     
Query: 262 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 319
           ||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 462 caaggacgacaagacgctgctctttggcgagaagccagttactgtctttggcgtcagg 519



 Score =  178 bits (90), Expect = 9e-42
 Identities = 99/102 (97%)
 Strand = Plus / Plus

                                                                       
Query: 101 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 160
           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggttttggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 161 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 202
           |||||||||||||||||||| |||||||| ||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccctttcatcacgaccgagtacatg 102



 Score =  147 bits (74), Expect = 3e-32
 Identities = 77/78 (98%)
 Strand = Plus / Plus

                                                                       
Query: 316 caggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccac 375
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 595 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 654

                             
Query: 376 cggtgtcttcactgacaa 393
           ||||||||||||||||||
Sbjct: 655 cggtgtcttcactgacaa 672



to top

>gb|AY349276.1| Hordeum vulgare subsp. spontaneum NPGS PI 236388
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2002

 Score =  218 bits (110), Expect = 1e-53
 Identities = 116/118 (98%)
 Strand = Plus / Plus

                                                                       
Query: 202 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 261
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 402 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 461

                                                                     
Query: 262 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 319
           ||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 462 caaggacgacaagacgctgctctttggcgagaagccagttactgtctttggcgtcagg 519



 Score =  178 bits (90), Expect = 9e-42
 Identities = 99/102 (97%)
 Strand = Plus / Plus

                                                                       
Query: 101 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 160
           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggttttggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 161 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 202
           |||||||||||||||||||| |||||||| ||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccctttcatcacgaccgagtacatg 102



 Score =  147 bits (74), Expect = 3e-32
 Identities = 77/78 (98%)
 Strand = Plus / Plus

                                                                       
Query: 316 caggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccac 375
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 595 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 654

                             
Query: 376 cggtgtcttcactgacaa 393
           ||||||||||||||||||
Sbjct: 655 cggtgtcttcactgacaa 672



to top

>gb|DQ318775.1| Lilium longiflorum glyceraldehyde-3-phosphate dehydrogenase (GAPDH)
           mRNA, partial cds
          Length = 977

 Score =  206 bits (104), Expect = 4e-50
 Identities = 254/304 (83%)
 Strand = Plus / Plus

                                                                       
Query: 90  tcggaatcaacggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcg 149
           |||| ||||| || ||||||||||||||| |  | || || ||||| |||||||||||||
Sbjct: 1   tcgggatcaatggattcggaaggatcgggcgcttggttgctagggttgcactccagagcg 60

                                                                       
Query: 150 acgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatgacgtaca 209
           | ||  |||||||||| ||||||||||| || |||||||| || || |||||||| ||||
Sbjct: 61  atgacatcgagctcgttgccgtcaacgatccgttcatcacgactgattacatgacataca 120

                                                                       
Query: 210 tgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagctcaaagacg 269
           |||||||||| |||||||| ||||| || |||||||||  ||| || ||| | || ||| 
Sbjct: 121 tgttcaagtatgacacagtgcacggtcagtggaagcaccatgagataaaggtgaaggact 180

                                                                       
Query: 270 acaagacgctgctcttcggcgagaagccagttactgtctttggcgtcaggaaccctgagg 329
             ||||| || ||||| |||||||||||||| ||  ||||||| || ||||| |||||||
Sbjct: 181 cgaagactctcctctttggcgagaagccagtcaccatctttggtgttaggaatcctgagg 240

                                                                       
Query: 330 agatcccgtggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcactg 389
           ||||||| ||||||||||| |||||||| | |||||||||||| || ||||| |||||||
Sbjct: 241 agatcccatggggtgaggctggtgctgacttcgttgtggagtctactggtgtattcactg 300

               
Query: 390 acaa 393
           ||||
Sbjct: 301 acaa 304



to top

>gb|BT016360.1| Zea mays clone Contig193 mRNA sequence
          Length = 1293

 Score =  196 bits (99), Expect = 4e-47
 Identities = 228/271 (84%)
 Strand = Plus / Plus

                                                                       
Query: 73  catgggcaagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtcgccag 132
           ||||| |||||| |||||||| ||||| || ||||| |||||||| ||||| || |||||
Sbjct: 61  catggccaagatcaagatcgggatcaatgggttcggcaggatcggaaggctggtggccag 120

                                                                       
Query: 133 ggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccac 192
           ||| || || ||||||||||| ||||||||||||||||| |||||||||||||||| |||
Sbjct: 121 ggtggccctgcagagcgacgacgtcgagctcgtcgccgtgaacgaccccttcatcagcac 180

                                                                       
Query: 193 cgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagcacagtga 252
           ||| |||||||| |||||||||||||| ||||| || ||||| || |||||||||  |||
Sbjct: 181 cgattacatgacctacatgttcaagtatgacactgtgcacggacagtggaagcaccatga 240

                                                                       
Query: 253 catcaagctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtctttgg 312
             ||||| | || |||  |||||| || ||||| || ||||||   ||| |||| |||||
Sbjct: 241 ggtcaaggtgaaggactccaagacccttctctttggtgagaaggaggttgctgtgtttgg 300

                                          
Query: 313 cgtcaggaaccctgaggagatcccgtggggt 343
           |  ||||||||||||||||||||| ||||||
Sbjct: 301 ctgcaggaaccctgaggagatcccatggggt 331



to top

>gb|U45856.1|ZMU45856 Zea mays glyceraldehyde-3-phosphate dehydrogenase GAPC3 (gpc3)
           mRNA, complete cds
          Length = 1281

 Score =  196 bits (99), Expect = 4e-47
 Identities = 264/319 (82%)
 Strand = Plus / Plus

                                                                       
Query: 73  catgggcaagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtcgccag 132
           ||||| |||||| |||||||| ||||| || || || |||||||| ||||| || |||||
Sbjct: 73  catggccaagatcaagatcgggatcaatgggtttggcaggatcggaaggctggtggccag 132

                                                                       
Query: 133 ggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccac 192
           ||| || || ||||||||||| ||||||||||||||||| |||||||||||||||| |||
Sbjct: 133 ggtggccctgcagagcgacgacgtcgagctcgtcgccgtgaacgaccccttcatcagcac 192

                                                                       
Query: 193 cgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagcacagtga 252
           ||| |||||||| |||||||||||||| ||||| || ||||| || |||||||||  |||
Sbjct: 193 cgattacatgacctacatgttcaagtatgacactgtgcacggacagtggaagcaccatga 252

                                                                       
Query: 253 catcaagctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtctttgg 312
             ||||| | || |||  |||||| || ||||| || ||||||   ||| |||| |||||
Sbjct: 253 ggtcaaggtgaaggactccaagacccttctctttggtgagaaggaggttgctgtgtttgg 312

                                                                       
Query: 313 cgtcaggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtc 372
           |  ||||||||||||||||||||| ||||||  ||  || ||||| || ||||| |||||
Sbjct: 313 ctgcaggaaccctgaggagatcccatggggttcggttggcgctgaatatgttgttgagtc 372

                              
Query: 373 caccggtgtcttcactgac 391
            || ||||| |||||||||
Sbjct: 373 tactggtgttttcactgac 391



to top

>gb|AY821550.1| Musa acuminata glyceraldehyde-3-phosphate dehydrogenase mRNA,
           partial cds
          Length = 993

 Score =  194 bits (98), Expect = 1e-46
 Identities = 134/146 (91%)
 Strand = Plus / Plus

                                                                       
Query: 80  aagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtcgccagggtcgca 139
           ||||||||||||||||||||||| |||||||||||||||||||| |||||||| ||||||
Sbjct: 1   aagattaagatcggaatcaacgggttcggaaggatcgggaggctggtcgccagagtcgca 60

                                                                       
Query: 140 ctccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtac 199
           || ||||| |||||||| |||||||| || ||||||||||||||||||||||| || |||
Sbjct: 61  cttcagagtgacgatgtggagctcgttgctgtcaacgaccccttcatcaccactgattac 120

                                     
Query: 200 atgacgtacatgttcaagtacgacac 225
           |||||||||||||| ||||| |||||
Sbjct: 121 atgacgtacatgtttaagtatgacac 146



 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 69/79 (87%)
 Strand = Plus / Plus

                                                                       
Query: 315 tcaggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtcca 374
           |||||||||||||||||||||| ||||||||| | ||||| || ||||| ||||| || |
Sbjct: 236 tcaggaaccctgaggagatcccatggggtgagtctggtgccgagtacgtcgtggaatcaa 295

                              
Query: 375 ccggtgtcttcactgacaa 393
           | |||||||| ||||||||
Sbjct: 296 ctggtgtctttactgacaa 314



to top

>ref|XM_506852.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1791_B03.34
           mRNA
          Length = 1460

 Score =  194 bits (98), Expect = 1e-46
 Identities = 155/174 (89%)
 Strand = Plus / Plus

                                                                       
Query: 73  catgggcaagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtcgccag 132
           ||||||||||||||||||||||||||| || |||||  | ||||| ||||| || |||||
Sbjct: 218 catgggcaagattaagatcggaatcaatgggttcggccgcatcggcaggctggtggccag 277

                                                                       
Query: 133 ggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccac 192
           ||| || || |||||||| |||||||||||||| ||||||||||| ||||||||||||||
Sbjct: 278 ggtggcgctgcagagcgaggatgtcgagctcgttgccgtcaacgatcccttcatcaccac 337

                                                                 
Query: 193 cgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagca 246
           |||||||||||| |||||||||||||| ||||| || |||||||| ||||||||
Sbjct: 338 cgagtacatgacatacatgttcaagtatgacaccgtccacggccagtggaagca 391



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 68/78 (87%)
 Strand = Plus / Plus

                                                                       
Query: 316 caggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccac 375
           ||||||||||||||||||||| |||| || ||| |||||||| |||||||| ||||| ||
Sbjct: 461 caggaaccctgaggagatcccatgggctgcggctggtgctgaatacgttgttgagtctac 520

                             
Query: 376 cggtgtcttcactgacaa 393
            ||||| ||||| |||||
Sbjct: 521 tggtgttttcaccgacaa 538



to top

>ref|XM_466582.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1456

 Score =  194 bits (98), Expect = 1e-46
 Identities = 155/174 (89%)
 Strand = Plus / Plus

                                                                       
Query: 73  catgggcaagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtcgccag 132
           ||||||||||||||||||||||||||| || |||||  | ||||| ||||| || |||||
Sbjct: 234 catgggcaagattaagatcggaatcaatgggttcggccgcatcggcaggctggtggccag 293

                                                                       
Query: 133 ggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccac 192
           ||| || || |||||||| |||||||||||||| ||||||||||| ||||||||||||||
Sbjct: 294 ggtggcgctgcagagcgaggatgtcgagctcgttgccgtcaacgatcccttcatcaccac 353

                                                                 
Query: 193 cgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagca 246
           |||||||||||| |||||||||||||| ||||| || |||||||| ||||||||
Sbjct: 354 cgagtacatgacatacatgttcaagtatgacaccgtccacggccagtggaagca 407



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 68/78 (87%)
 Strand = Plus / Plus

                                                                       
Query: 316 caggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccac 375
           ||||||||||||||||||||| |||| || ||| |||||||| |||||||| ||||| ||
Sbjct: 477 caggaaccctgaggagatcccatgggctgcggctggtgctgaatacgttgttgagtctac 536

                             
Query: 376 cggtgtcttcactgacaa 393
            ||||| ||||| |||||
Sbjct: 537 tggtgttttcaccgacaa 554



to top

>dbj|AK099086.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023009G10, full
           insert sequence
          Length = 1460

 Score =  194 bits (98), Expect = 1e-46
 Identities = 155/174 (89%)
 Strand = Plus / Plus

                                                                       
Query: 73  catgggcaagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtcgccag 132
           ||||||||||||||||||||||||||| || |||||  | ||||| ||||| || |||||
Sbjct: 218 catgggcaagattaagatcggaatcaatgggttcggccgcatcggcaggctggtggccag 277

                                                                       
Query: 133 ggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccac 192
           ||| || || |||||||| |||||||||||||| ||||||||||| ||||||||||||||
Sbjct: 278 ggtggcgctgcagagcgaggatgtcgagctcgttgccgtcaacgatcccttcatcaccac 337

                                                                 
Query: 193 cgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagca 246
           |||||||||||| |||||||||||||| ||||| || |||||||| ||||||||
Sbjct: 338 cgagtacatgacatacatgttcaagtatgacaccgtccacggccagtggaagca 391



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 68/78 (87%)
 Strand = Plus / Plus

                                                                       
Query: 316 caggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccac 375
           ||||||||||||||||||||| |||| || ||| |||||||| |||||||| ||||| ||
Sbjct: 461 caggaaccctgaggagatcccatgggctgcggctggtgctgaatacgttgttgagtctac 520

                             
Query: 376 cggtgtcttcactgacaa 393
            ||||| ||||| |||||
Sbjct: 521 tggtgttttcaccgacaa 538



to top

>dbj|AK062215.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-047-A09, full
           insert sequence
          Length = 1455

 Score =  194 bits (98), Expect = 1e-46
 Identities = 155/174 (89%)
 Strand = Plus / Plus

                                                                       
Query: 73  catgggcaagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtcgccag 132
           ||||||||||||||||||||||||||| || |||||  | ||||| ||||| || |||||
Sbjct: 234 catgggcaagattaagatcggaatcaatgggttcggccgcatcggcaggctggtggccag 293

                                                                       
Query: 133 ggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccac 192
           ||| || || |||||||| |||||||||||||| ||||||||||| ||||||||||||||
Sbjct: 294 ggtggcgctgcagagcgaggatgtcgagctcgttgccgtcaacgatcccttcatcaccac 353

                                                                 
Query: 193 cgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagca 246
           |||||||||||| |||||||||||||| ||||| || |||||||| ||||||||
Sbjct: 354 cgagtacatgacatacatgttcaagtatgacaccgtccacggccagtggaagca 407



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 68/78 (87%)
 Strand = Plus / Plus

                                                                       
Query: 316 caggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccac 375
           ||||||||||||||||||||| |||| || ||| |||||||| |||||||| ||||| ||
Sbjct: 476 caggaaccctgaggagatcccatgggctgcggctggtgctgaatacgttgttgagtctac 535

                             
Query: 376 cggtgtcttcactgacaa 393
            ||||| ||||| |||||
Sbjct: 536 tggtgttttcaccgacaa 553



to top

>emb|X04301.1|SAGAPDHR Mustard mRNA for cytosolic glyceraldehyde-3-phosphate dehydrogenase
           (GAPDH, NAD-specific; EC 1.2.1.12)
          Length = 1091

 Score =  190 bits (96), Expect = 2e-45
 Identities = 207/244 (84%)
 Strand = Plus / Plus

                                                                       
Query: 150 acgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatgacgtaca 209
           ||||||| ||||||||||| || ||||| |||||||||||||||||||||||||||||||
Sbjct: 90  acgatgttgagctcgtcgctgttaacgatcccttcatcaccaccgagtacatgacgtaca 149

                                                                       
Query: 210 tgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagctcaaagacg 269
           |||| ||||| ||||  ||||| || || |||||||||| |||  ||||| | || || |
Sbjct: 150 tgtttaagtatgacagtgttcatggtcagtggaagcacaatgagctcaaggtgaaggatg 209

                                                                       
Query: 270 acaagacgctgctcttcggcgagaagccagttactgtctttggcgtcaggaaccctgagg 329
           | || || || |||||||| |||||||| || ||||| || ||| |||||||||||||||
Sbjct: 210 agaaaacacttctcttcggagagaagcctgtcactgttttcggcatcaggaaccctgagg 269

                                                                       
Query: 330 agatcccgtggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcactg 389
           | ||||| |||||||||||||| ||||| |  ||||| ||||| || |||||||||||||
Sbjct: 270 atatcccatggggtgaggccggagctgactttgttgttgagtctactggtgtcttcactg 329

               
Query: 390 acaa 393
           ||||
Sbjct: 330 acaa 333



 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 37/38 (97%)
 Strand = Plus / Plus

                                                 
Query: 80  aagattaagatcggaatcaacggtttcggaaggatcgg 117
           |||||||||||||||||||||||||||||||| |||||
Sbjct: 20  aagattaagatcggaatcaacggtttcggaagaatcgg 57



to top

>ref|NM_101214.2| Arabidopsis thaliana NAD binding / glyceraldehyde-3-phosphate
           dehydrogenase (phosphorylating)/
           glyceraldehyde-3-phosphate dehydrogenase AT1G13440 mRNA,
           complete cds
          Length = 1333

 Score =  176 bits (89), Expect = 4e-41
 Identities = 251/305 (82%)
 Strand = Plus / Plus

                                                                       
Query: 89  atcggaatcaacggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagc 148
           ||||||||||||||||||||||| |||||  |  | || || || || |  || ||||| 
Sbjct: 96  atcggaatcaacggtttcggaagaatcggtcgtttggttgctagagttgttcttcagagg 155

                                                                       
Query: 149 gacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatgacgtac 208
           || ||||| ||||||||||| || ||||| || ||||||||||||||||||||||| |||
Sbjct: 156 gatgatgttgagctcgtcgctgttaacgatcctttcatcaccaccgagtacatgacatac 215

                                                                       
Query: 209 atgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagctcaaagac 268
           ||||| ||||| ||||  |||||||| || |||||||||  |||  | ||| | || || 
Sbjct: 216 atgtttaagtatgacagtgttcacggtcagtggaagcaccatgagcttaaggtgaaggat 275

                                                                       
Query: 269 gacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcaggaaccctgag 328
           ||||| || || |||||||| ||||||||||| ||||| || ||| ||||||||||||||
Sbjct: 276 gacaaaactcttctcttcggtgagaagccagtcactgttttcggcatcaggaaccctgag 335

                                                                       
Query: 329 gagatcccgtggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcact 388
           || ||||| ||||||||||| || ||||| |  ||||| ||||| || ||||||||||||
Sbjct: 336 gacatcccatggggtgaggctggagctgactttgttgttgagtctactggtgtcttcact 395

                
Query: 389 gacaa 393
           |||||
Sbjct: 396 gacaa 400



to top

>gb|AY090275.1| Arabidopsis thaliana At1g13440/F13B4_8 mRNA, complete cds
          Length = 1017

 Score =  176 bits (89), Expect = 4e-41
 Identities = 251/305 (82%)
 Strand = Plus / Plus

                                                                       
Query: 89  atcggaatcaacggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagc 148
           ||||||||||||||||||||||| |||||  |  | || || || || |  || ||||| 
Sbjct: 22  atcggaatcaacggtttcggaagaatcggtcgtttggttgctagagttgttcttcagagg 81

                                                                       
Query: 149 gacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatgacgtac 208
           || ||||| ||||||||||| || ||||| || ||||||||||||||||||||||| |||
Sbjct: 82  gatgatgttgagctcgtcgctgttaacgatcctttcatcaccaccgagtacatgacatac 141

                                                                       
Query: 209 atgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagctcaaagac 268
           ||||| ||||| ||||  |||||||| || |||||||||  |||  | ||| | || || 
Sbjct: 142 atgtttaagtatgacagtgttcacggtcagtggaagcaccatgagcttaaggtgaaggat 201

                                                                       
Query: 269 gacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcaggaaccctgag 328
           ||||| || || |||||||| ||||||||||| ||||| || ||| ||||||||||||||
Sbjct: 202 gacaaaactcttctcttcggtgagaagccagtcactgttttcggcatcaggaaccctgag 261

                                                                       
Query: 329 gagatcccgtggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcact 388
           || ||||| ||||||||||| || ||||| |  ||||| ||||| || ||||||||||||
Sbjct: 262 gacatcccatggggtgaggctggagctgactttgttgttgagtctactggtgtcttcact 321

                
Query: 389 gacaa 393
           |||||
Sbjct: 322 gacaa 326



to top

>gb|AF410271.1|AF410271 Arabidopsis thaliana At1g13440/F13B4_8 mRNA, complete cds
          Length = 1305

 Score =  176 bits (89), Expect = 4e-41
 Identities = 251/305 (82%)
 Strand = Plus / Plus

                                                                       
Query: 89  atcggaatcaacggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagc 148
           ||||||||||||||||||||||| |||||  |  | || || || || |  || ||||| 
Sbjct: 93  atcggaatcaacggtttcggaagaatcggtcgtttggttgctagagttgttcttcagagg 152

                                                                       
Query: 149 gacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatgacgtac 208
           || ||||| ||||||||||| || ||||| || ||||||||||||||||||||||| |||
Sbjct: 153 gatgatgttgagctcgtcgctgttaacgatcctttcatcaccaccgagtacatgacatac 212

                                                                       
Query: 209 atgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagctcaaagac 268
           ||||| ||||| ||||  |||||||| || |||||||||  |||  | ||| | || || 
Sbjct: 213 atgtttaagtatgacagtgttcacggtcagtggaagcaccatgagcttaaggtgaaggat 272

                                                                       
Query: 269 gacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcaggaaccctgag 328
           ||||| || || |||||||| ||||||||||| ||||| || ||| ||||||||||||||
Sbjct: 273 gacaaaactcttctcttcggtgagaagccagtcactgttttcggcatcaggaaccctgag 332

                                                                       
Query: 329 gagatcccgtggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcact 388
           || ||||| ||||||||||| || ||||| |  ||||| ||||| || ||||||||||||
Sbjct: 333 gacatcccatggggtgaggctggagctgactttgttgttgagtctactggtgtcttcact 392

                
Query: 389 gacaa 393
           |||||
Sbjct: 393 gacaa 397



to top

>gb|AY049259.1| Arabidopsis thaliana At1g13440/F13B4_8 mRNA, complete cds
          Length = 1306

 Score =  176 bits (89), Expect = 4e-41
 Identities = 251/305 (82%)
 Strand = Plus / Plus

                                                                       
Query: 89  atcggaatcaacggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagc 148
           ||||||||||||||||||||||| |||||  |  | || || || || |  || ||||| 
Sbjct: 93  atcggaatcaacggtttcggaagaatcggtcgtttggttgctagagttgttcttcagagg 152

                                                                       
Query: 149 gacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatgacgtac 208
           || ||||| ||||||||||| || ||||| || ||||||||||||||||||||||| |||
Sbjct: 153 gatgatgttgagctcgtcgctgttaacgatcctttcatcaccaccgagtacatgacatac 212

                                                                       
Query: 209 atgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagctcaaagac 268
           ||||| ||||| ||||  |||||||| || |||||||||  |||  | ||| | || || 
Sbjct: 213 atgtttaagtatgacagtgttcacggtcagtggaagcaccatgagcttaaggtgaaggat 272

                                                                       
Query: 269 gacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcaggaaccctgag 328
           ||||| || || |||||||| ||||||||||| ||||| || ||| ||||||||||||||
Sbjct: 273 gacaaaactcttctcttcggtgagaagccagtcactgttttcggcatcaggaaccctgag 332

                                                                       
Query: 329 gagatcccgtggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcact 388
           || ||||| ||||||||||| || ||||| |  ||||| ||||| || ||||||||||||
Sbjct: 333 gacatcccatggggtgaggctggagctgactttgttgttgagtctactggtgtcttcact 392

                
Query: 389 gacaa 393
           |||||
Sbjct: 393 gacaa 397



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
               sequence
          Length = 28434780

 Score =  163 bits (82), Expect = 5e-37
 Identities = 97/102 (95%)
 Strand = Plus / Plus

                                                                           
Query: 101     ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 160
               |||||||||||||||||||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 1519416 ggtttcggaaggatcgggaggctcgtggccagggtggccctccagagcgaggatgtcgag 1519475

                                                         
Query: 161     ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 202
               ||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 1519476 ctcgtcgccgtcaacgaccccttcatcaccaccgactacatg 1519517



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 70/77 (90%)
 Strand = Plus / Plus

                                                                           
Query: 317     aggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccacc 376
               ||||||||||| ||||| ||||||| |||||| |||||||| || || ||||||||||||
Sbjct: 1520011 aggaaccctgacgagattccgtgggctgaggctggtgctgagtatgtcgtggagtccacc 1520070

                                
Query: 377     ggtgtcttcactgacaa 393
               |||||||||||||||||
Sbjct: 1520071 ggtgtcttcactgacaa 1520087



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 81/92 (88%)
 Strand = Plus / Plus

                                                                           
Query: 206     tacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagctcaaa 265
               ||||||||||||||||| || || |||||||| ||||||||||| ||||||||| |||| 
Sbjct: 1519808 tacatgttcaagtacgataccgtgcacggccaatggaagcacagcgacatcaagatcaag 1519867

                                               
Query: 266     gacgacaagacgctgctcttcggcgagaagcc 297
               |||  |||||| |||||||| |||||||||||
Sbjct: 1519868 gactccaagactctgctcttgggcgagaagcc 1519899



 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                          
Query: 77      ggcaagattaagatcggaatcaacggt 103
               |||||||||||||||||||||||||||
Sbjct: 1519277 ggcaagattaagatcggaatcaacggt 1519303



to top

>dbj|AP003886.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1163_G08
          Length = 150676

 Score =  163 bits (82), Expect = 5e-37
 Identities = 97/102 (95%)
 Strand = Plus / Plus

                                                                         
Query: 101   ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 160
             |||||||||||||||||||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 46904 ggtttcggaaggatcgggaggctcgtggccagggtggccctccagagcgaggatgtcgag 46963

                                                       
Query: 161   ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 202
             ||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 46964 ctcgtcgccgtcaacgaccccttcatcaccaccgactacatg 47005



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 70/77 (90%)
 Strand = Plus / Plus

                                                                         
Query: 317   aggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccacc 376
             ||||||||||| ||||| ||||||| |||||| |||||||| || || ||||||||||||
Sbjct: 47499 aggaaccctgacgagattccgtgggctgaggctggtgctgagtatgtcgtggagtccacc 47558

                              
Query: 377   ggtgtcttcactgacaa 393
             |||||||||||||||||
Sbjct: 47559 ggtgtcttcactgacaa 47575



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 81/92 (88%)
 Strand = Plus / Plus

                                                                         
Query: 206   tacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagctcaaa 265
             ||||||||||||||||| || || |||||||| ||||||||||| ||||||||| |||| 
Sbjct: 47296 tacatgttcaagtacgataccgtgcacggccaatggaagcacagcgacatcaagatcaag 47355

                                             
Query: 266   gacgacaagacgctgctcttcggcgagaagcc 297
             |||  |||||| |||||||| |||||||||||
Sbjct: 47356 gactccaagactctgctcttgggcgagaagcc 47387



 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 77    ggcaagattaagatcggaatcaacggt 103
             |||||||||||||||||||||||||||
Sbjct: 46765 ggcaagattaagatcggaatcaacggt 46791



to top

>dbj|AP004166.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
              clone:OJ1499_A07
          Length = 132146

 Score =  163 bits (82), Expect = 5e-37
 Identities = 97/102 (95%)
 Strand = Plus / Plus

                                                                          
Query: 101    ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 160
              |||||||||||||||||||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 129321 ggtttcggaaggatcgggaggctcgtggccagggtggccctccagagcgaggatgtcgag 129380

                                                        
Query: 161    ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 202
              ||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 129381 ctcgtcgccgtcaacgaccccttcatcaccaccgactacatg 129422



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 70/77 (90%)
 Strand = Plus / Plus

                                                                          
Query: 317    aggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccacc 376
              ||||||||||| ||||| ||||||| |||||| |||||||| || || ||||||||||||
Sbjct: 129916 aggaaccctgacgagattccgtgggctgaggctggtgctgagtatgtcgtggagtccacc 129975

                               
Query: 377    ggtgtcttcactgacaa 393
              |||||||||||||||||
Sbjct: 129976 ggtgtcttcactgacaa 129992



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 81/92 (88%)
 Strand = Plus / Plus

                                                                          
Query: 206    tacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagctcaaa 265
              ||||||||||||||||| || || |||||||| ||||||||||| ||||||||| |||| 
Sbjct: 129713 tacatgttcaagtacgataccgtgcacggccaatggaagcacagcgacatcaagatcaag 129772

                                              
Query: 266    gacgacaagacgctgctcttcggcgagaagcc 297
              |||  |||||| |||||||| |||||||||||
Sbjct: 129773 gactccaagactctgctcttgggcgagaagcc 129804



 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                         
Query: 77     ggcaagattaagatcggaatcaacggt 103
              |||||||||||||||||||||||||||
Sbjct: 129182 ggcaagattaagatcggaatcaacggt 129208



to top

>emb|X15596.1|ZMGPC1 Maize Gpc1 gene for glyceraldehyde-3-phosphate dehydrogenase (GADPH)
            subunit C
          Length = 5955

 Score =  149 bits (75), Expect = 8e-33
 Identities = 93/99 (93%)
 Strand = Plus / Plus

                                                                        
Query: 104  ttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgagctc 163
            |||||||||||||| |||||||| ||||||||||| ||||||||||| ||||||||||||
Sbjct: 2836 ttcggaaggatcggcaggctcgtggccagggtcgccctccagagcgaggatgtcgagctc 2895

                                                   
Query: 164  gtcgccgtcaacgaccccttcatcaccaccgagtacatg 202
            ||||||||||||||||||||||||||||| || ||||||
Sbjct: 2896 gtcgccgtcaacgaccccttcatcaccacggactacatg 2934



 Score =  107 bits (54), Expect = 3e-20
 Identities = 72/78 (92%)
 Strand = Plus / Plus

                                                                        
Query: 316  caggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccac 375
            ||||||||||||||| ||||||||||||||||| || ||||| ||||| |||||||||||
Sbjct: 3520 caggaaccctgaggaaatcccgtggggtgaggctggcgctgagtacgtcgtggagtccac 3579

                              
Query: 376  cggtgtcttcactgacaa 393
            ||| ||||||||||||||
Sbjct: 3580 cggcgtcttcactgacaa 3597



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 97/114 (85%)
 Strand = Plus / Plus

                                                                        
Query: 206  tacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagctcaaa 265
            |||||||||||||||||||| || |||||||| ||||||||||| |||||||  ||||| 
Sbjct: 3326 tacatgttcaagtacgacaccgtccacggccactggaagcacagcgacatcacactcaag 3385

                                                                  
Query: 266  gacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 319
            |||  |||||| || |||||||| || ||||| || || ||||||||| |||||
Sbjct: 3386 gactccaagacccttctcttcggtgacaagccggtcaccgtctttggcatcagg 3439



 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                       
Query: 77   ggcaagattaagatcggaatcaacggt 103
            |||||||||||||||||||||||||||
Sbjct: 2692 ggcaagattaagatcggaatcaacggt 2718



to top

>emb|X73151.1|ZMGAPC2 Z.mays GapC2 gene
          Length = 6166

 Score =  147 bits (74), Expect = 3e-32
 Identities = 95/102 (93%)
 Strand = Plus / Plus

                                                                        
Query: 101  ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 160
            ||||||||||||||||| |||||||| ||||||||||| || |||||||| |||||||||
Sbjct: 2389 ggtttcggaaggatcggcaggctcgtggccagggtcgccctgcagagcgaggatgtcgag 2448

                                                      
Query: 161  ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 202
            |||||||||||||||||||||||||||||||| || ||||||
Sbjct: 2449 ctcgtcgccgtcaacgaccccttcatcaccacggattacatg 2490



 Score =  115 bits (58), Expect = 1e-22
 Identities = 73/78 (93%)
 Strand = Plus / Plus

                                                                        
Query: 316  caggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccac 375
            ||||||||| ||||||||||||||||||||||| |||||||| || || |||||||||||
Sbjct: 3031 caggaaccccgaggagatcccgtggggtgaggctggtgctgagtatgtcgtggagtccac 3090

                              
Query: 376  cggtgtcttcactgacaa 393
            ||||||||||||||||||
Sbjct: 3091 cggtgtcttcactgacaa 3108



 Score =  107 bits (54), Expect = 3e-20
 Identities = 99/114 (86%)
 Strand = Plus / Plus

                                                                        
Query: 206  tacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagctcaaa 265
            |||||||||||||||||||| || |||||||| ||||||||||| ||||||   ||||| 
Sbjct: 2830 tacatgttcaagtacgacaccgtgcacggccaatggaagcacagcgacatcgccctcaag 2889

                                                                  
Query: 266  gacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 319
            |||  ||||||||| ||||||||||||||||| || || ||||||||| |||||
Sbjct: 2890 gactccaagacgcttctcttcggcgagaagccggtcaccgtctttggcatcagg 2943



 Score = 46.1 bits (23), Expect = 0.085
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 77   ggcaagattaagatcggaatcaacggt 103
            |||||||| ||||||||||||||||||
Sbjct: 2267 ggcaagatcaagatcggaatcaacggt 2293



to top

>gb|U45858.1|ZMU45858 Zea mays glyceraldehyde-3-phosphate dehydrogenase (gpc2) gene,
           complete cds
          Length = 4590

 Score =  147 bits (74), Expect = 3e-32
 Identities = 95/102 (93%)
 Strand = Plus / Plus

                                                                       
Query: 101 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 160
           ||||||||||||||||| |||||||| ||||||||||| || |||||||| |||||||||
Sbjct: 798 ggtttcggaaggatcggcaggctcgtggccagggtcgccctgcagagcgaggatgtcgag 857

                                                     
Query: 161 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 202
           |||||||||||||||||||||||||||||||| || ||||||
Sbjct: 858 ctcgtcgccgtcaacgaccccttcatcaccacggattacatg 899



 Score =  115 bits (58), Expect = 1e-22
 Identities = 73/78 (93%)
 Strand = Plus / Plus

                                                                        
Query: 316  caggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccac 375
            ||||||||| ||||||||||||||||||||||| |||||||| || || |||||||||||
Sbjct: 1445 caggaaccccgaggagatcccgtggggtgaggctggtgctgagtatgtcgtggagtccac 1504

                              
Query: 376  cggtgtcttcactgacaa 393
            ||||||||||||||||||
Sbjct: 1505 cggtgtcttcactgacaa 1522



 Score =  115 bits (58), Expect = 1e-22
 Identities = 103/118 (87%)
 Strand = Plus / Plus

                                                                        
Query: 202  gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 261
            |||||||||||||||||||||||| || |||||||| ||||||||||| ||||||   ||
Sbjct: 1240 gacgtacatgttcaagtacgacaccgtgcacggccaatggaagcacagcgacatcgccct 1299

                                                                      
Query: 262  caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 319
            ||| |||  ||||||||| ||||||||||||||||| || || ||||||||| |||||
Sbjct: 1300 caaggactccaagacgcttctcttcggcgagaagccggtcaccgtctttggcatcagg 1357



 Score = 46.1 bits (23), Expect = 0.085
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 77  ggcaagattaagatcggaatcaacggt 103
           |||||||| ||||||||||||||||||
Sbjct: 672 ggcaagatcaagatcggaatcaacggt 698



to top

>emb|AL606998.3|OSJN00125 Oryza sativa genomic DNA, chromosome 4, BAC clone: OJ000223_09, complete
              sequence
          Length = 120583

 Score =  141 bits (71), Expect = 2e-30
 Identities = 92/99 (92%)
 Strand = Plus / Plus

                                                                          
Query: 104    ttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgagctc 163
              ||||| ||||||||||||||||| |||||||| || || ||||||||||| |||||||||
Sbjct: 103437 ttcgggaggatcgggaggctcgtggccagggtggccctgcagagcgacgacgtcgagctc 103496

                                                     
Query: 164    gtcgccgtcaacgaccccttcatcaccaccgagtacatg 202
              |||||||||||||||||||||||||||||||| ||||||
Sbjct: 103497 gtcgccgtcaacgaccccttcatcaccaccgactacatg 103535



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 70/79 (88%)
 Strand = Plus / Plus

                                                                          
Query: 315    tcaggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtcca 374
              |||||||||||||||||||||| ||||||||| | || ||||| |  |||||||||||||
Sbjct: 104277 tcaggaaccctgaggagatcccatggggtgagactggcgctgagtttgttgtggagtcca 104336

                                 
Query: 375    ccggtgtcttcactgacaa 393
              | ||||| |||||||||||
Sbjct: 104337 ctggtgttttcactgacaa 104355



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                       
Query: 206    tacatgttcaagtacgacacagttcacggccattggaagca 246
              |||||||||||||| ||||| || |||||||| ||||||||
Sbjct: 104082 tacatgttcaagtatgacactgtgcacggccagtggaagca 104122



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  141 bits (71), Expect = 2e-30
 Identities = 92/99 (92%)
 Strand = Plus / Plus

                                                                            
Query: 104      ttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgagctc 163
                ||||| ||||||||||||||||| |||||||| || || ||||||||||| |||||||||
Sbjct: 24281025 ttcgggaggatcgggaggctcgtggccagggtggccctgcagagcgacgacgtcgagctc 24281084

                                                       
Query: 164      gtcgccgtcaacgaccccttcatcaccaccgagtacatg 202
                |||||||||||||||||||||||||||||||| ||||||
Sbjct: 24281085 gtcgccgtcaacgaccccttcatcaccaccgactacatg 24281123



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 70/79 (88%)
 Strand = Plus / Plus

                                                                            
Query: 315      tcaggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtcca 374
                |||||||||||||||||||||| ||||||||| | || ||||| |  |||||||||||||
Sbjct: 24281865 tcaggaaccctgaggagatcccatggggtgagactggcgctgagtttgttgtggagtcca 24281924

                                   
Query: 375      ccggtgtcttcactgacaa 393
                | ||||| |||||||||||
Sbjct: 24281925 ctggtgttttcactgacaa 24281943



 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                            
Query: 143      cagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 202
                ||||| || ||||||||| | |||||| |||||||| ||||||||||| | |||||||||
Sbjct: 18605737 cagagtgaggatgtcgagttggtcgccatcaacgactccttcatcaccgctgagtacatg 18605678



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                         
Query: 206      tacatgttcaagtacgacacagttcacggccattggaagca 246
                |||||||||||||| ||||| || |||||||| ||||||||
Sbjct: 24281670 tacatgttcaagtatgacactgtgcacggccagtggaagca 24281710



to top

>emb|AL627350.3| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0302E05, complete
            sequence
          Length = 61795

 Score =  141 bits (71), Expect = 2e-30
 Identities = 92/99 (92%)
 Strand = Plus / Plus

                                                                        
Query: 104  ttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgagctc 163
            ||||| ||||||||||||||||| |||||||| || || ||||||||||| |||||||||
Sbjct: 9344 ttcgggaggatcgggaggctcgtggccagggtggccctgcagagcgacgacgtcgagctc 9403

                                                   
Query: 164  gtcgccgtcaacgaccccttcatcaccaccgagtacatg 202
            |||||||||||||||||||||||||||||||| ||||||
Sbjct: 9404 gtcgccgtcaacgaccccttcatcaccaccgactacatg 9442



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 70/79 (88%)
 Strand = Plus / Plus

                                                                         
Query: 315   tcaggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtcca 374
             |||||||||||||||||||||| ||||||||| | || ||||| |  |||||||||||||
Sbjct: 10169 tcaggaaccctgaggagatcccatggggtgagactggcgctgagtttgttgtggagtcca 10228

                                
Query: 375   ccggtgtcttcactgacaa 393
             | ||||| |||||||||||
Sbjct: 10229 ctggtgttttcactgacaa 10247



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                      
Query: 206   tacatgttcaagtacgacacagttcacggccattggaagca 246
             |||||||||||||| ||||| || |||||||| ||||||||
Sbjct: 9974  tacatgttcaagtatgacactgtgcacggccagtggaagca 10014



to top

>emb|X60347.1|MLGADPH M.liliiflora GADPH mRNA for glycolytic glyceraldehyde-3-phosphate
           dehydrogenase
          Length = 1397

 Score =  139 bits (70), Expect = 8e-30
 Identities = 253/314 (80%)
 Strand = Plus / Plus

                                                                       
Query: 80  aagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtcgccagggtcgca 139
           ||||| ||||||||||||||||| || |||||||||||  |  | || || || ||||| 
Sbjct: 55  aagatcaagatcggaatcaacggatttggaaggatcggccgtttggtagcaagagtcgct 114

                                                                       
Query: 140 ctccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtac 199
           || ||||| || ||||| |||||||| |||||||| || |||||||| ||||| || |||
Sbjct: 115 ctgcagagggatgatgtggagctcgttgccgtcaatgatcccttcattaccacagattac 174

                                                                       
Query: 200 atgacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaag 259
           ||||| |||||||||||||| || |  || || || || ||||||||   |||  |||||
Sbjct: 175 atgacttacatgttcaagtatgatagtgtccatgggcaatggaagcatcatgagctcaag 234

                                                                       
Query: 260 ctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 319
            | || |||  |||||| || ||||| || ||||| |||||||| |||||||| ||||||
Sbjct: 235 gtgaaggactccaagacccttctctttggtgagaaaccagttaccgtctttggtgtcagg 294

                                                                       
Query: 320 aaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccaccggt 379
           |||||||| ||||| || ||||||||| | |||||||| |  ||||||||||| || || 
Sbjct: 295 aaccctgaagagattccatggggtgagactggtgctgaatttgttgtggagtcaactgga 354

                         
Query: 380 gtcttcactgacaa 393
           || || ||||||||
Sbjct: 355 gtgtttactgacaa 368



to top

>dbj|D21280.1|RICAD18 Oryza sativa AD18 mRNA for glyceraldehyde-3-phosphate
           dehydrogenase, partial sequence
          Length = 422

 Score =  137 bits (69), Expect = 3e-29
 Identities = 106/119 (89%)
 Strand = Plus / Plus

                                                                       
Query: 128 gccagggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatc 187
           |||||||| || || |||||||| |||||||||||||| ||||||||||  |||||||||
Sbjct: 46  gccagggtggcgctgcagagcgaggatgtcgagctcgttgccgtcaacgntcccttcatc 105

                                                                      
Query: 188 accaccgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagca 246
           ||||||| ||||||||| |||||||||||||| ||||| || |||||||| ||||||||
Sbjct: 106 accaccgngtacatgacatacatgttcaagtatgacaccgtccacggccagtggaagca 164



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 68/79 (86%), Gaps = 1/79 (1%)
 Strand = Plus / Plus

                                                                       
Query: 316 caggaaccctgaggagatcccgtggggtgaggccggtgctgattacg-ttgtggagtcca 374
           ||||||||||||||||||||| |||| || ||| |||||||| |||| |||| ||||| |
Sbjct: 234 caggaaccctgaggagatcccatgggctgcggctggtgctgaatacgtttgttgagtcta 293

                              
Query: 375 ccggtgtcttcactgacaa 393
           | ||||| ||||| |||||
Sbjct: 294 ctggtgttttcaccgacaa 312



to top

>gb|M36650.1|BLYGAPDH Barley glyceraldehyde-3-phosphate dehydrogenase mRNA, 3' end
          Length = 1141

 Score =  127 bits (64), Expect = 3e-26
 Identities = 184/224 (82%)
 Strand = Plus / Plus

                                                                       
Query: 170 gtcaacgaccccttcatcaccaccgagtacatgacgtacatgttcaagtacgacacagtt 229
           ||||||||||| |||||||||||||| |||||||| |||||||||||||| ||||| || 
Sbjct: 1   gtcaacgacccgttcatcaccaccgactacatgacctacatgttcaagtatgacactgtc 60

                                                                       
Query: 230 cacggccattggaagcacagtgacatcaagctcaaagacgacaagacgctgctcttcggc 289
           ||||| || |||||||||  |||  | ||| | || |||  |||||| || |||||||| 
Sbjct: 61  cacggacagtggaagcaccatgaagttaaggtgaaggactccaagacccttctcttcggt 120

                                                                       
Query: 290 gagaagccagttactgtctttggcgtcaggaaccctgaggagatcccgtggggtgaggcc 349
           ||||||   ||| |||| |||||   ||| ||||| |||||||| || ||||  |  || 
Sbjct: 121 gagaaggaggttgctgtgtttggttgcagaaaccccgaggagattccatgggccgctgct 180

                                                       
Query: 350 ggtgctgattacgttgtggagtccaccggtgtcttcactgacaa 393
           |||||||| ||||||||||||||||||||||| |||||||||||
Sbjct: 181 ggtgctgagtacgttgtggagtccaccggtgttttcactgacaa 224



to top

>emb|X75597.1|ANDAP3DH A.nummularia mRNA for glyceraldehyde-3-phosphate dehydrogenase
          Length = 1339

 Score =  125 bits (63), Expect = 1e-25
 Identities = 260/323 (80%), Gaps = 2/323 (0%)
 Strand = Plus / Plus

                                                                       
Query: 72  ccatgggcaagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtcgcca 131
           |||||| |||| ||||||||||||| ||||| |||||||| |||||  |  | ||||| |
Sbjct: 52  ccatggccaaggttaagatcggaattaacggattcggaagaatcggacgtttggtcgcta 111

                                                                       
Query: 132 gggtcgcactccagagcgacga-tgtcgagctcgtcgccgtcaacgaccccttcatcacc 190
           | |||   || |||||||| || ||| ||||| || ||| | ||||| |||||||| |||
Sbjct: 112 gagtcattcttcagagcgatgactgt-gagcttgttgccattaacgatcccttcattacc 170

                                                                       
Query: 191 accgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagcacagt 250
           ||||| |||||||| |||||||| ||||||||||  |||||||| || |||||||||  |
Sbjct: 171 accgattacatgacctacatgtttaagtacgacagtgttcacggtcaatggaagcaccat 230

                                                                       
Query: 251 gacatcaagctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtcttt 310
           ||  | ||| | || || || ||||| || |||||||| |||| ||| || || || || 
Sbjct: 231 gagcttaaggttaaggatgagaagactcttctcttcggtgagaggcccgtcaccgttttc 290

                                                                       
Query: 311 ggcgtcaggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggag 370
           ||   ||||||||| ||||||||||| |||||  || |||| ||||| |||||||| |||
Sbjct: 291 ggtaacaggaacccagaggagatcccatggggccagaccggagctgactacgttgttgag 350

                                  
Query: 371 tccaccggtgtcttcactgacaa 393
           ||||| |||||||||||||||||
Sbjct: 351 tccactggtgtcttcactgacaa 373



to top

>gb|J05223.1|CIPNADGAPD M.crystallinum glyceraldehyde-3-phosphate dehydrogenase (NAD-GAPDH)
           mRNA, complete cds
          Length = 1354

 Score =  125 bits (63), Expect = 1e-25
 Identities = 251/311 (80%), Gaps = 2/311 (0%)
 Strand = Plus / Plus

                                                                       
Query: 84  ttaagatcggaatcaacggtttcggaaggatcgggaggctcgtcgccagggtcgcactcc 143
           ||||| |||||||||||||||| |||||||||||| |  | |||||||| ||    ||||
Sbjct: 65  ttaaggtcggaatcaacggttttggaaggatcgggcgtttggtcgccagagtgatcctcc 124

                                                                       
Query: 144 agagcgacga-tgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 202
           |||| || || ||| ||||||||||| |||||||||||||||||| ||||||| ||||||
Sbjct: 125 agagggatgactgt-gagctcgtcgctgtcaacgaccccttcatctccaccgattacatg 183

                                                                       
Query: 203 acgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagctc 262
           || |||||||||||||||||||  || ||||| || || |||  |  ||| |||||| | 
Sbjct: 184 acatacatgttcaagtacgacagtgtccacggtcagtgcaagagccatgagatcaagttg 243

                                                                       
Query: 263 aaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcaggaac 322
           || ||||| ||||| || |||||||| ||||  || ||  | ||||| ||   |||||||
Sbjct: 244 aaggacgagaagacccttctcttcggtgagaccccggtcgccgtcttcggatgcaggaac 303

                                                                       
Query: 323 cctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccaccggtgtc 382
           || ||||| ||||| |||||| |||| || || || | |||||| || |||||||| |||
Sbjct: 304 ccagaggaaatcccatggggtcaggctggagccgacttcgttgtcgaatccaccggagtc 363

                      
Query: 383 ttcactgacaa 393
           ||||| |||||
Sbjct: 364 ttcaccgacaa 374



to top

>gb|M29956.1|CIPGPDNAD Common ice plant (M.crystallinum) NAD-glyceraldehyde-3-phosphate
           dehydrogenase mRNA, complete cds
          Length = 1354

 Score =  125 bits (63), Expect = 1e-25
 Identities = 251/311 (80%), Gaps = 2/311 (0%)
 Strand = Plus / Plus

                                                                       
Query: 84  ttaagatcggaatcaacggtttcggaaggatcgggaggctcgtcgccagggtcgcactcc 143
           ||||| |||||||||||||||| |||||||||||| |  | |||||||| ||    ||||
Sbjct: 65  ttaaggtcggaatcaacggttttggaaggatcgggcgtttggtcgccagagtgatcctcc 124

                                                                       
Query: 144 agagcgacga-tgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 202
           |||| || || ||| ||||||||||| |||||||||||||||||| ||||||| ||||||
Sbjct: 125 agagggatgactgt-gagctcgtcgctgtcaacgaccccttcatctccaccgattacatg 183

                                                                       
Query: 203 acgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagctc 262
           || |||||||||||||||||||  || ||||| || || |||  |  ||| |||||| | 
Sbjct: 184 acatacatgttcaagtacgacagtgtccacggtcagtgcaagagccatgagatcaagttg 243

                                                                       
Query: 263 aaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcaggaac 322
           || ||||| ||||| || |||||||| ||||  || ||  | ||||| ||   |||||||
Sbjct: 244 aaggacgagaagacccttctcttcggtgagaccccggtcgccgtcttcggatgcaggaac 303

                                                                       
Query: 323 cctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccaccggtgtc 382
           || ||||| ||||| |||||| |||| || || || | |||||| || |||||||| |||
Sbjct: 304 ccagaggaaatcccatggggtcaggctggagccgacttcgttgtcgaatccaccggagtc 363

                      
Query: 383 ttcactgacaa 393
           ||||| |||||
Sbjct: 364 ttcaccgacaa 374



to top

>gb|U02886.1|ANGAPDH Atriplex nummularia glyceraldehyde-3-phosphate dehydrogenase
           (GAPDH) mRNA, complete cds
          Length = 1339

 Score =  125 bits (63), Expect = 1e-25
 Identities = 260/323 (80%), Gaps = 2/323 (0%)
 Strand = Plus / Plus

                                                                       
Query: 72  ccatgggcaagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtcgcca 131
           |||||| |||| ||||||||||||| ||||| |||||||| |||||  |  | ||||| |
Sbjct: 52  ccatggccaaggttaagatcggaattaacggattcggaagaatcggacgtttggtcgcta 111

                                                                       
Query: 132 gggtcgcactccagagcgacga-tgtcgagctcgtcgccgtcaacgaccccttcatcacc 190
           | |||   || |||||||| || ||| ||||| || ||| | ||||| |||||||| |||
Sbjct: 112 gagtcattcttcagagcgatgactgt-gagcttgttgccattaacgatcccttcattacc 170

                                                                       
Query: 191 accgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagcacagt 250
           ||||| |||||||| |||||||| ||||||||||  |||||||| || |||||||||  |
Sbjct: 171 accgattacatgacctacatgtttaagtacgacagtgttcacggtcaatggaagcaccat 230

                                                                       
Query: 251 gacatcaagctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtcttt 310
           ||  | ||| | || || || ||||| || |||||||| |||| ||| || || || || 
Sbjct: 231 gagcttaaggttaaggatgagaagactcttctcttcggtgagaggcccgtcaccgttttc 290

                                                                       
Query: 311 ggcgtcaggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggag 370
           ||   ||||||||| ||||||||||| |||||  || |||| ||||| |||||||| |||
Sbjct: 291 ggtaacaggaacccagaggagatcccatggggccagaccggagctgactacgttgttgag 350

                                  
Query: 371 tccaccggtgtcttcactgacaa 393
           ||||| |||||||||||||||||
Sbjct: 351 tccactggtgtcttcactgacaa 373



to top

>emb|X60346.1|PHGADPHR P.hybrida GADPH mRNA for glycolytic glyceraldehyde-3-phosphate
           dehydrogenase
          Length = 1476

 Score =  123 bits (62), Expect = 5e-25
 Identities = 161/194 (82%)
 Strand = Plus / Plus

                                                                       
Query: 197 tacatgacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatc 256
           |||||||| |||||||||||||| ||||  || |||||||| ||||| |||  |||  ||
Sbjct: 306 tacatgacatacatgttcaagtatgacagtgtccacggccagtggaaacaccatgagctc 365

                                                                       
Query: 257 aagctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtc 316
           |||   || || |||||||| || ||||| ||||||||||| ||||| || || ||| | 
Sbjct: 366 aaggctaaggatgacaagactcttctctttggcgagaagcctgttaccgtattcggcatt 425

                                                                       
Query: 317 aggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccacc 376
           || ||||||||||||||||| ||||||||||| || || |||||||| |||||||| || 
Sbjct: 426 agaaaccctgaggagatcccatggggtgaggctggagcagattacgtcgtggagtcgact 485

                         
Query: 377 ggtgtcttcactga 390
           ||||||||||||||
Sbjct: 486 ggtgtcttcactga 499



 Score = 48.1 bits (24), Expect = 0.022
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 80  aagattaagatcggaatcaacggtttcggaag 111
           ||||||||||| |||||||||||||| |||||
Sbjct: 189 aagattaagattggaatcaacggttttggaag 220



to top

>emb|X73152.1|ZMGAPC4 Z.mays GapC4 gene
          Length = 4929

 Score =  109 bits (55), Expect = 7e-21
 Identities = 88/99 (88%)
 Strand = Plus / Plus

                                                                        
Query: 104  ttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgagctc 163
            ||||| |||||||| ||||| || |||||||| || || ||||| |||||||||||||||
Sbjct: 1126 ttcggcaggatcggaaggctggtggccagggtggccctgcagagtgacgatgtcgagctc 1185

                                                   
Query: 164  gtcgccgtcaacgaccccttcatcaccaccgagtacatg 202
            |||||||| |||||||||||||||| |||||| ||||||
Sbjct: 1186 gtcgccgtgaacgaccccttcatcagcaccgactacatg 1224



 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 66/76 (86%)
 Strand = Plus / Plus

                                                                        
Query: 316  caggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccac 375
            ||||||||||||||||||||||||||||  ||  |||||||| || ||||| ||||| ||
Sbjct: 2888 caggaaccctgaggagatcccgtggggttcggttggtgctgaatatgttgttgagtctac 2947

                            
Query: 376  cggtgtcttcactgac 391
             ||||| |||||||||
Sbjct: 2948 tggtgttttcactgac 2963



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                      
Query: 206  tacatgttcaagtacgacacagttcacggccattggaagcac 247
            |||||||||||||||||||| || ||||| || |||||||||
Sbjct: 2687 tacatgttcaagtacgacactgtgcacggacagtggaagcac 2728



to top

>gb|U45859.1|ZMU45859 Zea mays glyceraldehyde-3-phosphate dehydrogenase (gpc4) gene,
            partial cds
          Length = 4627

 Score =  109 bits (55), Expect = 7e-21
 Identities = 88/99 (88%)
 Strand = Plus / Plus

                                                                        
Query: 104  ttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgagctc 163
            ||||| |||||||| ||||| || |||||||| || || ||||| |||||||||||||||
Sbjct: 3423 ttcggcaggatcggaaggctggtggccagggtggctctgcagagtgacgatgtcgagctc 3482

                                                   
Query: 164  gtcgccgtcaacgaccccttcatcaccaccgagtacatg 202
            |||||||| |||||||||||||||| |||||| ||||||
Sbjct: 3483 gtcgccgtgaacgaccccttcatcagcaccgactacatg 3521



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  107 bits (54), Expect = 3e-20
 Identities = 81/90 (90%)
 Strand = Plus / Plus

                                                                            
Query: 113      atcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgagctcgtcgccgtc 172
                ||||| ||||| || |||||||| || || |||||||| |||||||||||||| ||||||
Sbjct: 23547022 atcggcaggctggtggccagggtggcgctgcagagcgaggatgtcgagctcgttgccgtc 23547081

                                              
Query: 173      aacgaccccttcatcaccaccgagtacatg 202
                ||||| ||||||||||||||||||||||||
Sbjct: 23547082 aacgatcccttcatcaccaccgagtacatg 23547111



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 67/77 (87%)
 Strand = Plus / Plus

                                                                            
Query: 317      aggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccacc 376
                |||||||||||||||||||| |||| || ||| |||||||| |||||||| ||||| || 
Sbjct: 23547895 aggaaccctgaggagatcccatgggctgcggctggtgctgaatacgttgttgagtctact 23547954

                                 
Query: 377      ggtgtcttcactgacaa 393
                ||||| ||||| |||||
Sbjct: 23547955 ggtgttttcaccgacaa 23547971



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                         
Query: 206      tacatgttcaagtacgacacagttcacggccattggaagca 246
                |||||||||||||| ||||| || |||||||| ||||||||
Sbjct: 23547698 tacatgttcaagtatgacaccgtccacggccagtggaagca 23547738



 Score = 46.1 bits (23), Expect = 0.085
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                       
Query: 77       ggcaagattaagatcggaatcaa 99
                |||||||||||||||||||||||
Sbjct: 23546889 ggcaagattaagatcggaatcaa 23546911



to top

>dbj|AP005385.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OJ1791_B03
          Length = 166214

 Score =  107 bits (54), Expect = 3e-20
 Identities = 81/90 (90%)
 Strand = Plus / Plus

                                                                          
Query: 113    atcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgagctcgtcgccgtc 172
              ||||| ||||| || |||||||| || || |||||||| |||||||||||||| ||||||
Sbjct: 112705 atcggcaggctggtggccagggtggcgctgcagagcgaggatgtcgagctcgttgccgtc 112764

                                            
Query: 173    aacgaccccttcatcaccaccgagtacatg 202
              ||||| ||||||||||||||||||||||||
Sbjct: 112765 aacgatcccttcatcaccaccgagtacatg 112794



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 67/77 (87%)
 Strand = Plus / Plus

                                                                          
Query: 317    aggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccacc 376
              |||||||||||||||||||| |||| || ||| |||||||| |||||||| ||||| || 
Sbjct: 113578 aggaaccctgaggagatcccatgggctgcggctggtgctgaatacgttgttgagtctact 113637

                               
Query: 377    ggtgtcttcactgacaa 393
              ||||| ||||| |||||
Sbjct: 113638 ggtgttttcaccgacaa 113654



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                       
Query: 206    tacatgttcaagtacgacacagttcacggccattggaagca 246
              |||||||||||||| ||||| || |||||||| ||||||||
Sbjct: 113381 tacatgttcaagtatgacaccgtccacggccagtggaagca 113421



 Score = 46.1 bits (23), Expect = 0.085
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 77     ggcaagattaagatcggaatcaa 99
              |||||||||||||||||||||||
Sbjct: 112572 ggcaagattaagatcggaatcaa 112594



to top

>gb|DQ267444.1| Elaeis guineensis glyceraldehyde 3-phosphate dehydrogenase mRNA,
           partial cds
          Length = 1139

 Score =  107 bits (54), Expect = 3e-20
 Identities = 105/122 (86%)
 Strand = Plus / Plus

                                                                       
Query: 272 aagacgctgctcttcggcgagaagccagttactgtctttggcgtcaggaaccctgaggag 331
           ||||| || ||||| |||||||||| ||| |||||||||||| | |||||||||||||||
Sbjct: 73  aagacccttctctttggcgagaagcaagtcactgtctttggcattaggaaccctgaggag 132

                                                                       
Query: 332 atcccgtggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcactgac 391
           ||||| ||||||||  | ||||| || || ||||||||||| || |||||||| ||||||
Sbjct: 133 atcccatggggtgaaactggtgcagagtatgttgtggagtctactggtgtctttactgac 192

             
Query: 392 aa 393
           ||
Sbjct: 193 aa 194



to top

>emb|AJ133422.1|NTA133422 Nicotiana tabacum mRNA for glyceraldehyde-3-phosphate dehydrogenase
          Length = 1420

 Score =  105 bits (53), Expect = 1e-19
 Identities = 254/321 (79%)
 Strand = Plus / Plus

                                                                       
Query: 73  catgggcaagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtcgccag 132
           ||||| |||| ||||||| ||||| ||||| || ||||| || ||| |  | || |||||
Sbjct: 132 catggccaaggttaagattggaattaacggatttggaagaattgggcgattagtggccag 191

                                                                       
Query: 133 ggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccac 192
           ||| || ||||| || || ||||| ||||| ||||| || |||||||| |||||| |   
Sbjct: 192 ggttgctctccaaagagatgatgttgagcttgtcgcagttaacgaccctttcatctctgt 251

                                                                       
Query: 193 cgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagcacagtga 252
            || |||||||| || ||||||||||| || |  || |||||||| |||||||||   ||
Sbjct: 252 tgaatacatgacatatatgttcaagtatgatagtgtacacggccagtggaagcaccacga 311

                                                                       
Query: 253 catcaagctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtctttgg 312
             ||||| | || || |||||||| || ||||| || |||||| | |||||||| |||||
Sbjct: 312 gctcaaggttaaggatgacaagacccttctctttggtgagaaggctgttactgtttttgg 371

                                                                       
Query: 313 cgtcaggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtc 372
           | | |||||||| |||||||| || |||||  || | || || |||||| ||||||||||
Sbjct: 372 ctttaggaacccagaggagattccatggggccagactggagcagattacattgtggagtc 431

                                
Query: 373 caccggtgtcttcactgacaa 393
            || |||||||||||||||||
Sbjct: 432 gactggtgtcttcactgacaa 452



to top

>gb|DQ355800.1| Glycine max glyceraldehyde-3-phosphate dehydrogenase (GAPC1) mRNA,
           complete cds
          Length = 1508

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 143/174 (82%)
 Strand = Plus / Plus

                                                                       
Query: 73  catgggcaagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtcgccag 132
           |||||||||| | ||||||||||||||||| || ||||| || ||  |  | || |||||
Sbjct: 64  catgggcaaggtcaagatcggaatcaacggatttggaagaattggccgtttggtagccag 123

                                                                       
Query: 133 ggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccac 192
            || || || ||||| |||||||| || ||||| ||||| |||||||| |||||||||||
Sbjct: 124 agtggctctgcagagagacgatgttgaactcgttgccgttaacgaccctttcatcaccac 183

                                                                 
Query: 193 cgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagca 246
           ||| |||||||| |||||||| || |||||||  ||||| || || ||||||||
Sbjct: 184 cgattacatgacatacatgtttaaatacgacagtgttcatggacactggaagca 237



to top

>emb|AJ246011.1|CAN246011 Capsicum annuum mRNA for partial glyceraldehyde-3-phosphate
           dehydrogenase, subunit GapC1
          Length = 952

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 160/197 (81%)
 Strand = Plus / Plus

                                                                       
Query: 152 gatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatgacgtacatg 211
           ||||| |||||||| || || ||||| || |||||||||  ||| |||||||| ||||||
Sbjct: 67  gatgttgagctcgttgctgttaacgatcctttcatcaccgtcgattacatgacatacatg 126

                                                                       
Query: 212 ttcaagtacgacacagttcacggccattggaagcacagtgacatcaagctcaaagacgac 271
           || ||||| ||||  |||||||| || |||||| ||| |||  ||||| | || ||||| 
Sbjct: 127 tttaagtatgacagtgttcacggtcaatggaagaacaatgaagtcaaggttaaggacgag 186

                                                                       
Query: 272 aagacgctgctcttcggcgagaagccagttactgtctttggcgtcaggaaccctgaggag 331
           ||||| || ||||| || |||||||| |||||||| | |||| | || ||||| ||||||
Sbjct: 187 aagactcttctctttggtgagaagcctgttactgtatatggcattagaaacccagaggag 246

                            
Query: 332 atcccgtggggtgaggc 348
           ||||| |||| ||||||
Sbjct: 247 atcccatgggctgaggc 263



to top

>gb|AC016829.7|ATAC016829 Arabidopsis thaliana chromosome III BAC T6K12 genomic sequence,
             complete sequence
          Length = 110804

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                         
Query: 140   ctccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtac 199
             |||||||| |||||||| ||||||||||| |||||||||||||||||||| || ||||||
Sbjct: 79361 ctccagagggacgatgttgagctcgtcgctgtcaacgaccccttcatcactactgagtac 79302

                
Query: 200   atg 202
             |||
Sbjct: 79301 atg 79299



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 95/114 (83%)
 Strand = Plus / Minus

                                                                         
Query: 206   tacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagctcaaa 265
             |||||||||||||||||||  |||||||| || ||||| |||| |||  ||||| |||| 
Sbjct: 78932 tacatgttcaagtacgacagtgttcacggtcaatggaaacacaatgaactcaagatcaag 78873

                                                                   
Query: 266   gacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 319
             || || ||||| || |||||||| ||||||||||| ||||| || ||| |||||
Sbjct: 78872 gatgagaagacccttctcttcggtgagaagccagtcactgttttcggcatcagg 78819



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 67/77 (87%)
 Strand = Plus / Minus

                                                                         
Query: 317   aggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccacc 376
             |||||||||||||| ||||| ||||  ||||| || ||||| |||||||| ||||| || 
Sbjct: 78727 aggaaccctgaggatatcccatgggccgaggctggagctgactacgttgttgagtctact 78668

                              
Query: 377   ggtgtcttcactgacaa 393
             |||||||||||||||||
Sbjct: 78667 ggtgtcttcactgacaa 78651



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 80    aagattaagatcggaatcaacggt 103
             ||||||| ||||||||||||||||
Sbjct: 79510 aagattaggatcggaatcaacggt 79487



to top

>gb|M64119.1|ATHGAPCA Arabidopsis thaliana cytosolic glyceraldehyde-3-phosphate
           dehydrogenase (GapC) gene, exons 1-9, complete cds
          Length = 2705

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Plus

                                                                       
Query: 140 ctccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtac 199
           |||||||| |||||||| ||||||||||| |||||||||||||||||||| || ||||||
Sbjct: 677 ctccagagggacgatgttgagctcgtcgctgtcaacgaccccttcatcactactgagtac 736

              
Query: 200 atg 202
           |||
Sbjct: 737 atg 739



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 95/114 (83%)
 Strand = Plus / Plus

                                                                        
Query: 206  tacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagctcaaa 265
            |||||||||||||||||||  |||||||| || ||||| |||| |||  ||||| |||| 
Sbjct: 1106 tacatgttcaagtacgacagtgttcacggtcaatggaaacacaatgaactcaagatcaag 1165

                                                                  
Query: 266  gacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 319
            || || ||||| || |||||||| ||||||||||| ||||| || ||| |||||
Sbjct: 1166 gatgagaagacccttctcttcggtgagaagccagtcactgttttcggcatcagg 1219



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 67/77 (87%)
 Strand = Plus / Plus

                                                                        
Query: 317  aggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccacc 376
            |||||||||||||| ||||| ||||  ||||| || ||||| |||||||| ||||| || 
Sbjct: 1311 aggaaccctgaggatatcccatgggccgaggctggagctgactacgttgttgagtctact 1370

                             
Query: 377  ggtgtcttcactgacaa 393
            |||||||||||||||||
Sbjct: 1371 ggtgtcttcactgacaa 1387



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 80  aagattaagatcggaatcaacggt 103
           ||||||| ||||||||||||||||
Sbjct: 528 aagattaggatcggaatcaacggt 551



to top

>gb|BT012693.1| Lycopersicon esculentum clone 113563F, mRNA sequence
          Length = 1323

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 102/122 (83%)
 Strand = Plus / Plus

                                                                       
Query: 272 aagacgctgctcttcggcgagaagccagttactgtctttggcgtcaggaaccctgaggag 331
           ||||| || ||||| || |||||| | ||||| || |||||  ||||||||||||| || 
Sbjct: 292 aagacacttctctttggagagaaggctgttacagtttttggaatcaggaaccctgaagat 351

                                                                       
Query: 332 atcccgtggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcactgac 391
           ||||| |||||||| || |||||||| | |||||| || || ||||||||||||||||||
Sbjct: 352 atcccatggggtgaagctggtgctgacttcgttgttgaatcaaccggtgtcttcactgac 411

             
Query: 392 aa 393
           ||
Sbjct: 412 aa 413



to top

>gb|U96623.1|SLU96623 Selaginella lepidophylla glyceraldehyde-3-phosphate-dehydrogenase
           (GAPDH) mRNA, complete cds
          Length = 1159

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 69/78 (88%)
 Strand = Plus / Plus

                                                                       
Query: 147 gcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatgacgt 206
           |||||||||| |||||||| ||||| ||||| || ||||||| ||| ||||||||| | |
Sbjct: 138 gcgacgatgttgagctcgttgccgtgaacgatccattcatcagcactgagtacatggctt 197

                             
Query: 207 acatgttcaagtacgaca 224
           ||||||||||||||||||
Sbjct: 198 acatgttcaagtacgaca 215



to top

>gb|U97257.1|LEU97257 Lycopersicon esculentum glyceraldehyde 3-phosphate dehydrogenase
           (GAPDH) mRNA, complete cds
          Length = 1285

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 102/122 (83%)
 Strand = Plus / Plus

                                                                       
Query: 272 aagacgctgctcttcggcgagaagccagttactgtctttggcgtcaggaaccctgaggag 331
           ||||| || ||||| || |||||| | ||||| || |||||  ||||||||||||| || 
Sbjct: 270 aagacacttctctttggagagaaggctgttacagtttttggaatcaggaaccctgaagat 329

                                                                       
Query: 332 atcccgtggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcactgac 391
           ||||| |||||||| || |||||||| | |||||| || || ||||||||||||||||||
Sbjct: 330 atcccatggggtgaagctggtgctgacttcgttgttgaatcaaccggtgtcttcactgac 389

             
Query: 392 aa 393
           ||
Sbjct: 390 aa 391



to top

>gb|DQ252489.1| Solanum tuberosum clone 056C03 glyceraldehyde 3-phosphate
           dehydrogenase-like mRNA, complete cds
          Length = 1287

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 102/122 (83%)
 Strand = Plus / Plus

                                                                       
Query: 272 aagacgctgctcttcggcgagaagccagttactgtctttggcgtcaggaaccctgaggag 331
           ||||| || |||||||| |||||| | ||||| || |||||  ||||||||||||| || 
Sbjct: 254 aagacccttctcttcggtgagaaggctgttacagtttttggaatcaggaaccctgaagat 313

                                                                       
Query: 332 atcccgtggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcactgac 391
           ||||| ||||| || || |||||||| | |||||| || || ||||||||||||||||||
Sbjct: 314 atcccatggggagaagctggtgctgacttcgttgttgaatcaaccggtgtcttcactgac 373

             
Query: 392 aa 393
           ||
Sbjct: 374 aa 375



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 77  ggcaagattaagatcggaatcaacggtttcgg 108
           |||||||| || |||||||||||||| |||||
Sbjct: 59  ggcaagatcaaaatcggaatcaacggattcgg 90



to top

>gb|DQ173770.1| Populus maximowiczii x Populus nigra glyceraldehyde-3-phosphate
           dehydrogenase (G3PDH) mRNA, complete cds
          Length = 1349

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 131/161 (81%)
 Strand = Plus / Plus

                                                                       
Query: 197 tacatgacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatc 256
           |||||||| || |||||||| || || ||||||||||| |  ||||||||| ||||  ||
Sbjct: 225 tacatgacatatatgttcaaatatgatacagttcacggtcgctggaagcacggtgagctc 284

                                                                       
Query: 257 aagctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtc 316
           ||| | || || || ||||| || ||||| || |||||| ||||  |||| |||||| ||
Sbjct: 285 aaggttaaggatgagaagacccttctctttggtgagaaggcagtcgctgtttttggcatc 344

                                                    
Query: 317 aggaaccctgaggagatcccgtggggtgaggccggtgctga 357
           |||||||| ||||||||||| |||| | | |||||||||||
Sbjct: 345 aggaacccagaggagatcccatgggctcaagccggtgctga 385



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 80  aagattaagatcggaatcaacggtttcggaaggatcgg 117
           |||||||||||||| |||||||| || |||||||||||
Sbjct: 108 aagattaagatcggtatcaacggatttggaaggatcgg 145



to top

>gb|M14419.1|TOBGAPC Tobacco (N.tabacum) GapC mRNA encoding cytosolic
           glyceraldehyde-3-phosphophate dehydrogenase, partial cds
          Length = 1174

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 68/77 (88%)
 Strand = Plus / Plus

                                                                       
Query: 317 aggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccacc 376
           |||||||||||||| || || |||| ||| || |||||||||| ||||||||| ||||| 
Sbjct: 211 aggaaccctgaggaaattccatgggctgaagctggtgctgatttcgttgtggaatccact 270

                            
Query: 377 ggtgtcttcactgacaa 393
           |||||||||||||||||
Sbjct: 271 ggtgtcttcactgacaa 287



to top

>dbj|AB164359.1| Periploca sepium PsGAPDH mRNA for D-glyceraldehyde-3-phosphate
           dehydrogenase, partial cds
          Length = 593

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 99/119 (83%)
 Strand = Plus / Plus

                                                                       
Query: 272 aagacgctgctcttcggcgagaagccagttactgtctttggcgtcaggaaccctgaggag 331
           ||||| || ||||| ||||||||||| || |  ||||| ||  |||||||||||||||||
Sbjct: 50  aagactcttctctttggcgagaagcctgtaaaggtcttcggaatcaggaaccctgaggag 109

                                                                      
Query: 332 atcccgtggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcactga 390
           ||||| ||||||||||| || ||||| | |||||| ||||| || ||||| || |||||
Sbjct: 110 atcccatggggtgaggctggagctgacttcgttgttgagtctactggtgtttttactga 168



to top

>gb|AF527779.1| Solanum tuberosum glyceraldehyde 3-phosphate dehydrogenase mRNA,
           complete cds
          Length = 1194

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 101/122 (82%)
 Strand = Plus / Plus

                                                                       
Query: 272 aagacgctgctcttcggcgagaagccagttactgtctttggcgtcaggaaccctgaggag 331
           ||||| || |||||||| |||||| | ||||| || |||||  ||||||||||||| || 
Sbjct: 205 aagacccttctcttcggtgagaaggctgttacagtttttggaatcaggaaccctgaagat 264

                                                                       
Query: 332 atcccgtggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcactgac 391
           ||||| ||||| || || |||||||| | ||| || || || ||||||||||||||||||
Sbjct: 265 atcccatggggggaagctggtgctgacttcgtcgttgaatcaaccggtgtcttcactgac 324

             
Query: 392 aa 393
           ||
Sbjct: 325 aa 326



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 77  ggcaagattaagatcggaatcaacggtttcgg 108
           |||||||| || |||||||||||||| |||||
Sbjct: 10  ggcaagatcaaaatcggaatcaacggattcgg 41



to top

>gb|DQ241857.1| Solanum tuberosum clone 014E02 glyceraldehyde 3-phosphate
           dehydrogenase-like mRNA, complete cds
          Length = 1202

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 101/122 (82%)
 Strand = Plus / Plus

                                                                       
Query: 272 aagacgctgctcttcggcgagaagccagttactgtctttggcgtcaggaaccctgaggag 331
           ||||| || |||||||| |||||| | ||||| || |||||  ||||||||||||| || 
Sbjct: 266 aagacccttctcttcggtgagaaggctgttacagtttttggaatcaggaaccctgaagat 325

                                                                       
Query: 332 atcccgtggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcactgac 391
           ||||| ||||| || || |||||||| | ||| || || || ||||||||||||||||||
Sbjct: 326 atcccatggggggaagctggtgctgacttcgtcgttgaatcaaccggtgtcttcactgac 385

             
Query: 392 aa 393
           ||
Sbjct: 386 aa 387



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 77  ggcaagattaagatcggaatcaacggtttcgg 108
           |||||||| || |||||||||||||| |||||
Sbjct: 71  ggcaagatcaaaatcggaatcaacggattcgg 102



to top

>gb|DQ268845.1| Solanum tuberosum clone 147E07 glyceraldehyde 3-phosphate
           dehydrogenase-like protein mRNA, complete cds
          Length = 1293

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 101/122 (82%)
 Strand = Plus / Plus

                                                                       
Query: 272 aagacgctgctcttcggcgagaagccagttactgtctttggcgtcaggaaccctgaggag 331
           ||||| || |||||||| |||||| | ||||| || |||||  ||||||||||||| || 
Sbjct: 265 aagacccttctcttcggtgagaaggctgttacagtttttggaatcaggaaccctgaagat 324

                                                                       
Query: 332 atcccgtggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcactgac 391
           ||||| ||||| || || |||||||| | ||| || || || ||||||||||||||||||
Sbjct: 325 atcccatggggggaagctggtgctgacttcgtcgttgaatcaaccggtgtcttcactgac 384

             
Query: 392 aa 393
           ||
Sbjct: 385 aa 386



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 77  ggcaagattaagatcggaatcaacggtttcgg 108
           |||||||| || |||||||||||||| |||||
Sbjct: 70  ggcaagatcaaaatcggaatcaacggattcgg 101



to top

>emb|X60344.1|PHGADPH P.hortense GADPH mRNA for glycolytic glyceraldehyde-3-phosphate
           dehydrogenase
          Length = 1266

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 61/69 (88%)
 Strand = Plus / Plus

                                                                       
Query: 156 tcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatgacgtacatgttca 215
           ||||||| || ||||||||||| || ||||| ||||| ||||||||||| ||||||||||
Sbjct: 115 tcgagcttgttgccgtcaacgatccattcattaccactgagtacatgacctacatgttca 174

                    
Query: 216 agtacgaca 224
           | |||||||
Sbjct: 175 aatacgaca 183



to top

>gb|AC011810.8|AC011810 Arabidopsis thaliana chromosome I BAC T6J4 genomic sequence, complete
             sequence
          Length = 103157

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 67/77 (87%)
 Strand = Plus / Minus

                                                                         
Query: 317   aggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccacc 376
             |||||||||||||| ||||| ||||||||||| || ||||| |  ||||| ||||| || 
Sbjct: 87880 aggaaccctgaggacatcccatggggtgaggctggagctgactttgttgttgagtctact 87821

                              
Query: 377   ggtgtcttcactgacaa 393
             |||||||||||||||||
Sbjct: 87820 ggtgtcttcactgacaa 87804



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                         
Query: 143   cagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 202
             ||||| || ||||| ||||||||||| || ||||| || |||||||||||||||||||||
Sbjct: 88345 cagagggatgatgttgagctcgtcgctgttaacgatcctttcatcaccaccgagtacatg 88286



 Score = 44.1 bits (22), Expect = 0.34
 Identities = 91/114 (79%)
 Strand = Plus / Minus

                                                                         
Query: 206   tacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagctcaaa 265
             |||||||| ||||| ||||  |||||||| || |||||||||  |||  | ||| | || 
Sbjct: 88082 tacatgtttaagtatgacagtgttcacggtcagtggaagcaccatgagcttaaggtgaag 88023

                                                                   
Query: 266   gacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 319
             || ||||| || || |||||||| ||||||||||| ||||| || ||| |||||
Sbjct: 88022 gatgacaaaactcttctcttcggtgagaagccagtcactgttttcggcatcagg 87969



to top

>gb|AC027134.4|AC027134 Arabidopsis thaliana chromosome I BAC F13B4 genomic sequence, complete
             sequence
          Length = 102183

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 67/77 (87%)
 Strand = Plus / Minus

                                                                         
Query: 317   aggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccacc 376
             |||||||||||||| ||||| ||||||||||| || ||||| |  ||||| ||||| || 
Sbjct: 40573 aggaaccctgaggacatcccatggggtgaggctggagctgactttgttgttgagtctact 40514

                              
Query: 377   ggtgtcttcactgacaa 393
             |||||||||||||||||
Sbjct: 40513 ggtgtcttcactgacaa 40497



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                         
Query: 143   cagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 202
             ||||| || ||||| ||||||||||| || ||||| || |||||||||||||||||||||
Sbjct: 41038 cagagggatgatgttgagctcgtcgctgttaacgatcctttcatcaccaccgagtacatg 40979



 Score = 44.1 bits (22), Expect = 0.34
 Identities = 91/114 (79%)
 Strand = Plus / Minus

                                                                         
Query: 206   tacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagctcaaa 265
             |||||||| ||||| ||||  |||||||| || |||||||||  |||  | ||| | || 
Sbjct: 40775 tacatgtttaagtatgacagtgttcacggtcagtggaagcaccatgagcttaaggtgaag 40716

                                                                   
Query: 266   gacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 319
             || ||||| || || |||||||| ||||||||||| ||||| || ||| |||||
Sbjct: 40715 gatgacaaaactcttctcttcggtgagaagccagtcactgttttcggcatcagg 40662



to top

>emb|CT573421.5| M.truncatula DNA sequence from clone MTH2-27B10 on chromosome 3,
             complete sequence
          Length = 123669

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 67/77 (87%)
 Strand = Plus / Minus

                                                                         
Query: 317   aggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccacc 376
             ||||||||||||||||| || ||||||||||  || |||||||||||| | ||||| || 
Sbjct: 55652 aggaaccctgaggagattccatggggtgaggttggagctgattacgttattgagtcaact 55593

                              
Query: 377   ggtgtcttcactgacaa 393
             ||||| |||||||||||
Sbjct: 55592 ggtgttttcactgacaa 55576



 Score = 44.1 bits (22), Expect = 0.34
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                   
Query: 209   atgttcaagtacgacacagttcacggccattggaagca 246
             ||||||||||| ||||| |||||||| || ||||||||
Sbjct: 55867 atgttcaagtatgacactgttcacggtcagtggaagca 55830



to top

>dbj|AB110609.1| Lycopersicon esculentum GAPDH gene for glyceraldehyde 3-phosphate
           dehydrogenase, partial cds
          Length = 1477

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 67/77 (87%)
 Strand = Plus / Plus

                                                                       
Query: 317 aggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccacc 376
           ||||||||||| || ||||| |||||||| || |||||||| | |||||| || || |||
Sbjct: 161 aggaaccctgaagatatcccatggggtgaagctggtgctgacttcgttgttgaatcaacc 220

                            
Query: 377 ggtgtcttcactgacaa 393
           |||||||||||||||||
Sbjct: 221 ggtgtcttcactgacaa 237



to top

>ref|XM_450090.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2136

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 54/60 (90%)
 Strand = Plus / Plus

                                                                       
Query: 143 cagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 202
           ||||||||  |||||||||| ||||||||||| ||| ||||||||||||| |||||||||
Sbjct: 747 cagagcgagtatgtcgagcttgtcgccgtcaatgactccttcatcaccactgagtacatg 806



to top

>ref|XM_501515.1| Yarrowia lipolytica CLIB122, YALI0C06369g predicted mRNA
          Length = 1017

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 51/56 (91%)
 Strand = Plus / Plus

                                                                   
Query: 332 atcccgtggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           ||||| |||||| |||||||||| || |||||||| ||||||||||||||||||||
Sbjct: 250 atcccctggggtaaggccggtgccgactacgttgtcgagtccaccggtgtcttcac 305



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 59/69 (85%)
 Strand = Plus / Plus

                                                                       
Query: 155 gtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatgacgtacatgttc 214
           |||||| ||||||| || |||||||||||||||  ||||||||||    | |||||||||
Sbjct: 79  gtcgaggtcgtcgctgtgaacgaccccttcatcgacaccgagtacgctgcttacatgttc 138

                    
Query: 215 aagtacgac 223
           |||||||||
Sbjct: 139 aagtacgac 147



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
               sequence
          Length = 22696651

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 54/60 (90%)
 Strand = Plus / Minus

                                                                           
Query: 143     cagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 202
               ||||||||  |||||||||| ||||||||||| ||| ||||||||||||| |||||||||
Sbjct: 1561636 cagagcgagtatgtcgagcttgtcgccgtcaatgactccttcatcaccactgagtacatg 1561577



to top

>dbj|AP005746.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:OSJNBa0018I03
          Length = 145818

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 54/60 (90%)
 Strand = Plus / Minus

                                                                         
Query: 143   cagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 202
             ||||||||  |||||||||| ||||||||||| ||| ||||||||||||| |||||||||
Sbjct: 89880 cagagcgagtatgtcgagcttgtcgccgtcaatgactccttcatcaccactgagtacatg 89821



to top

>dbj|AK066284.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013067C01, full
           insert sequence
          Length = 2137

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 54/60 (90%)
 Strand = Plus / Plus

                                                                       
Query: 143 cagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 202
           ||||||||  |||||||||| ||||||||||| ||| ||||||||||||| |||||||||
Sbjct: 747 cagagcgagtatgtcgagcttgtcgccgtcaatgactccttcatcaccactgagtacatg 806



to top

>emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB122 of Yarrowia lipolytica
          Length = 3272609

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 51/56 (91%)
 Strand = Plus / Plus

                                                                      
Query: 332    atcccgtggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
              ||||| |||||| |||||||||| || |||||||| ||||||||||||||||||||
Sbjct: 827162 atcccctggggtaaggccggtgccgactacgttgtcgagtccaccggtgtcttcac 827217



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 59/69 (85%)
 Strand = Plus / Plus

                                                                          
Query: 155    gtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatgacgtacatgttc 214
              |||||| ||||||| || |||||||||||||||  ||||||||||    | |||||||||
Sbjct: 826991 gtcgaggtcgtcgctgtgaacgaccccttcatcgacaccgagtacgctgcttacatgttc 827050

                       
Query: 215    aagtacgac 223
              |||||||||
Sbjct: 827051 aagtacgac 827059



to top

>gb|AY491512.2| Daucus carota glyceraldehyde 3-phosphate dehydrogenase (G3PDH)
           mRNA, complete cds
          Length = 1307

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 89/107 (83%)
 Strand = Plus / Plus

                                                                       
Query: 287 ggcgagaagccagttactgtctttggcgtcaggaaccctgaggagatcccgtggggtgag 346
           ||||||||||| ||| ||||||||||   ||||||||||||||||||||| |||| |   
Sbjct: 278 ggcgagaagcctgttgctgtctttggttgcaggaaccctgaggagatcccttgggctagc 337

                                                          
Query: 347 gccggtgctgattacgttgtggagtccaccggtgtcttcactgacaa 393
            | ||||| || ||| ||||||||||||| ||||| ||||| |||||
Sbjct: 338 actggtgcagagtacattgtggagtccactggtgtgttcaccgacaa 384



 Score = 48.1 bits (24), Expect = 0.022
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 86  aagatcggaatcaacggtttcggaaggatcgg 117
           ||||||||||||||||| |||||||| |||||
Sbjct: 77  aagatcggaatcaacggattcggaagaatcgg 108



to top

>gb|L13432.1|MZEGAPDB Zea mays GAPC2 glyceraldehyde-3-phosphate dehydrogenase mRNA,
           partial cds
          Length = 971

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 343 tgaggccggtgctgattacgttgtggagtccaccggtgtcttcactgacaa 393
           |||||| |||||||| || || |||||||||||||||||||||||||||||
Sbjct: 1   tgaggctggtgctgagtatgtcgtggagtccaccggtgtcttcactgacaa 51



to top

>ref|XR_003569.1| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate
           dehydrogenase (GAPDH) (LOC386426), mRNA
          Length = 1008

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || ||||||||||| || |||||||||||
Sbjct: 259 tggggtgaggccggtgctgagtatgttgtggagtctactggtgtcttcac 308



to top

>gb|AY436595.1| Anas platyrhynchos glyceraldehyde-3-phosphate dehydrogenase-like
           protein mRNA, complete cds
          Length = 738

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 37/38 (97%)
 Strand = Plus / Plus

                                                 
Query: 350 ggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||| |||||||||||||||||||||||||||||
Sbjct: 167 ggtgctgaatacgttgtggagtccaccggtgtcttcac 204



to top

>gb|AC161826.5| Mus musculus 6 BAC RP23-411G8 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 183238

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                               
Query: 338   tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
             |||||||||||||||||||| || ||||||||||| || |||||||||||
Sbjct: 54709 tggggtgaggccggtgctgagtatgttgtggagtctactggtgtcttcac 54758



to top

>dbj|AB164360.1| Periploca sepium PsGAPDH gene for D-glyceraldehyde-3-phosphate
           dehydrogenase, partial cds
          Length = 1225

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 64/74 (86%)
 Strand = Plus / Plus

                                                                       
Query: 317 aggaaccctgaggagatcccgtggggtgaggccggtgctgattacgttgtggagtccacc 376
           |||||||||||||||||||| ||||||||||| || ||||| | |||||| ||||| || 
Sbjct: 196 aggaaccctgaggagatcccatggggtgaggctggagctgacttcgttgttgagtctact 255

                         
Query: 377 ggtgtcttcactga 390
           ||||| || |||||
Sbjct: 256 ggtgtttttactga 269



to top

>gb|U17005.1|STU17005 Solanum tuberosum glyceraldehyde 3-phosphate dehydrogenase (GAPDH) 
           mRNA, complete cds
          Length = 900

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 100/122 (81%)
 Strand = Plus / Plus

                                                                       
Query: 272 aagacgctgctcttcggcgagaagccagttactgtctttggcgtcaggaaccctgaggag 331
           ||||| || |||||||| |||||| | ||||| || |||||  ||||||||||||| || 
Sbjct: 163 aagacccttctcttcggtgagaaggctgttacagtttttggaatcaggaaccctgaagat 222

                                                                       
Query: 332 atcccgtggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcactgac 391
           ||||| ||||  || || |||||||| | ||| || || || ||||||||||||||||||
Sbjct: 223 atcccatgggcagaagctggtgctgacttcgtcgttgaatcaaccggtgtcttcactgac 282

             
Query: 392 aa 393
           ||
Sbjct: 283 aa 284



to top

>gb|L07500.1|PEAGAPCI Pea glyceraldehyde-3-phosphate dehydrogenase (GapC1) mRNA, complete
           cds
          Length = 1177

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 78/93 (83%)
 Strand = Plus / Plus

                                                                       
Query: 152 gatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatgacgtacatg 211
           ||||| || ||||| || || ||||| || ||||||||||| || ||||||||||| |||
Sbjct: 132 gatgttgaactcgttgcagttaacgatcctttcatcaccactgattacatgacgtatatg 191

                                            
Query: 212 ttcaagtacgacacagttcacggccattggaag 244
           || ||||||||||  |||||||| || ||||||
Sbjct: 192 tttaagtacgacagtgttcacggacagtggaag 224



 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 79  caagattaagatcggaatcaacggtttcggaaggatcgg 117
           |||||| ||||||||||||||||| |||||||| |||||
Sbjct: 59  caagatcaagatcggaatcaacggattcggaagaatcgg 97



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                       
Query: 281 ctcttcggcgagaagccagttactgtctttggcgtcaggaaccctgaggagatcccgtgg 340
           ||||||||  |||||||||||||||||||||    ||||||||| || |||||||| |||
Sbjct: 261 ctcttcggtcagaagccagttactgtctttgcacacaggaacccagaagagatcccatgg 320

            
Query: 341 g 341
           |
Sbjct: 321 g 321



to top

>emb|AJ938036.1| Lupinus albus mRNA for glyceraldehyde-3-phosphate-dehydrogenase
           (gapdh gene)
          Length = 1233

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 68/80 (85%)
 Strand = Plus / Plus

                                                                       
Query: 164 gtcgccgtcaacgaccccttcatcaccaccgagtacatgacgtacatgttcaagtacgac 223
           ||||| || ||||| || |||||||| || || |||||||| ||||||||||||||||||
Sbjct: 5   gtcgctgttaacgatcctttcatcacaactgattacatgacctacatgttcaagtacgac 64

                               
Query: 224 acagttcacggccattggaa 243
           |  |||||||| || |||||
Sbjct: 65  agtgttcacggacactggaa 84



to top

>gb|AY292378.1| Phytophthora palmivora glyceraldehyde-3-phosphate dehydrogenase
           (GAPDH) gene, partial cds
          Length = 955

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 64/75 (85%)
 Strand = Plus / Plus

                                                                       
Query: 162 tcgtcgccgtcaacgaccccttcatcaccaccgagtacatgacgtacatgttcaagtacg 221
           |||| |||||||||| ||| |||||| ||||| ||||||||   |||||| |||| ||||
Sbjct: 80  tcgtggccgtcaacggcccgttcatcgccaccaagtacatggaatacatgctcaaatacg 139

                          
Query: 222 acacagttcacggcc 236
           ||||||| |||||||
Sbjct: 140 acacagtgcacggcc 154



to top

>gb|AY654895.1| Spermophilus citellus glyceraldehyde-3-phosphate dehydrogenase
           (GAPDH) mRNA, complete cds
          Length = 1123

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcact 388
           |||||||| || |||||||| || |||||||||||||| ||||||||||||
Sbjct: 261 tggggtgatgctggtgctgaatatgttgtggagtccactggtgtcttcact 311



to top

>gb|AF232729.2|AF232729 Marmota monax glyceraldehyde 3-phosphate dehydrogenase GAPDH mRNA,
           partial cds
          Length = 535

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcact 388
           |||||||| || |||||||| || |||||||||||||| ||||||||||||
Sbjct: 21  tggggtgatgctggtgctgaatatgttgtggagtccactggtgtcttcact 71



to top

>gb|AC116758.11| Mus musculus chromosome 8, clone RP23-383A10, complete sequence
          Length = 190294

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                                
Query: 338    tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
              |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 120871 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 120822



to top

>gb|AC115877.13| Mus musculus chromosome 15, clone RP24-358H21, complete sequence
          Length = 169136

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                                
Query: 338    tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
              |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 152429 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 152380



to top

>gb|AC114585.19| Mus musculus chromosome 14, clone RP23-296J16, complete sequence
          Length = 192819

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                               
Query: 338   tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
             |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 69811 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 69762



to top

>gb|AC166162.6| Mus musculus BAC clone RP23-436K10 from chromosome 6, complete sequence
          Length = 181038

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                                
Query: 338    tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
              |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 136528 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 136479



to top

>gb|BC085275.1| Mus musculus similar to glyceraldehyde-3-phosphate dehydrogenase,
           mRNA (cDNA clone MGC:103193 IMAGE:30444086), complete
           cds
          Length = 1264

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 320 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 369



to top

>gb|BC085274.1| Mus musculus similar to glyceraldehyde-3-phosphate dehydrogenase,
           mRNA (cDNA clone MGC:103192 IMAGE:6530979), complete cds
          Length = 1257

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 311 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 360



to top

>gb|BC085315.1| Mus musculus similar to glyceraldehyde-3-phosphate dehydrogenase,
           mRNA (cDNA clone MGC:102545 IMAGE:30440429), complete
           cds
          Length = 1249

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 305 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 354



to top

>gb|BC083080.1| Mus musculus glyceraldehyde-3-phosphate dehydrogenase, mRNA (cDNA
           clone MGC:103191 IMAGE:6494145), complete cds
          Length = 1252

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 310 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 359



to top

>gb|BC083149.1| Mus musculus glyceraldehyde-3-phosphate dehydrogenase, mRNA (cDNA
           clone MGC:102546 IMAGE:30459585), complete cds
          Length = 1271

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 289 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 338



to top

>gb|BC083079.1| Mus musculus glyceraldehyde-3-phosphate dehydrogenase, mRNA (cDNA
           clone MGC:102544 IMAGE:6493407), complete cds
          Length = 1249

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 308 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 357



to top

>gb|BC083065.1| Mus musculus glyceraldehyde-3-phosphate dehydrogenase, mRNA (cDNA
           clone MGC:103190 IMAGE:5371133), complete cds
          Length = 1292

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 302 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 351



to top

>gb|AC166075.2| Mus musculus BAC clone RP23-143L15 from chromosome 1, complete sequence
          Length = 212447

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                                
Query: 338    tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
              |||||| ||||||||||||| || ||||||||||| || |||||||||||
Sbjct: 139900 tggggtaaggccggtgctgagtatgttgtggagtctactggtgtcttcac 139851



to top

>gb|AC163335.6| Mus musculus chromosome 7, clone RP24-149G13, complete sequence
          Length = 164660

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                               
Query: 338   tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
             |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 39702 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 39653



to top

>gb|BC082592.1| Mus musculus similar to glyceraldehyde-3-phosphate dehydrogenase,
           mRNA (cDNA clone MGC:105239 IMAGE:30634381), complete
           cds
          Length = 1254

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 303 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 352



to top

>gb|AC102196.7| Mus musculus chromosome 3, clone RP24-445M20, complete sequence
          Length = 166532

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                                
Query: 338    tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
              |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 135540 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 135589



to top

>gb|AY066007.1| Meriones unguiculatus glyceraldehyde-3-phosphate dehydrogenase
           mRNA, complete cds
          Length = 1265

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           ||||| || |||||||| || || ||||||||||||||||||||||||||
Sbjct: 324 tggggcgatgccggtgccgagtatgttgtggagtccaccggtgtcttcac 373



to top

>ref|NG_005470.2| Mus musculus glyceraldehyde-3-phosphate dehydrogenase pseudogene
           (LOC654475) on chromosome 4
          Length = 1433

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 403 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 452



to top

>ref|NG_005467.2| Mus musculus glyceraldehyde-3-phosphate dehydrogenase pseudogene
           (LOC433845) on chromosome 5
          Length = 1406

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 381 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 430



to top

>ref|NG_005469.2| Mus musculus glyceraldehyde-3-phosphate dehydrogenase pseudogene
           (LOC654474) on chromosome X
          Length = 1434

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 403 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 452



to top

>ref|NG_005233.2| Mus musculus glyceraldehyde-3-phosphate dehydrogenase pseudogene
           (LOC433921) on chromosome 5
          Length = 1441

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 414 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 463



to top

>gb|AC124377.4| Mus musculus BAC clone RP24-396N12 from chromosome 5, complete sequence
          Length = 170401

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                                
Query: 338    tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
              |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 101846 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 101895



to top

>ref|NM_008084.1| Mus musculus similar to glyceraldehyde-3-phosphate dehydrogenase
           (LOC14433), mRNA
          Length = 1228

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 299 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 348



to top

>gb|AC124113.9| Mus musculus chromosome 5, clone RP24-354P12, complete sequence
          Length = 156826

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                                
Query: 338    tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
              |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 102276 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 102325



to top

>gb|AC167201.6| Mus musculus 10 BAC RP23-402J11 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 216676

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                                
Query: 338    tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
              |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 201192 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 201143



to top

>gb|AC164428.4| Mus musculus BAC clone RP24-150D18 from chromosome 1, complete sequence
          Length = 170692

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                                
Query: 338    tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
              |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 158283 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 158234



to top

>gb|AC121279.7| Mus musculus chromosome 3, clone RP23-4F17, complete sequence
          Length = 207763

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                                
Query: 338    tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
              |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 131117 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 131166



to top

>ref|XR_003802.1| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate
           dehydrogenase (GAPDH) (LOC672308), mRNA
          Length = 1079

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 259 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 308



to top

>ref|XM_484732.3| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate
           dehydrogenase (GAPDH) (LOC433184), mRNA
          Length = 1008

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 259 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 308



to top

>ref|XM_973383.1| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate
           dehydrogenase (GAPDH) (LOC630967), mRNA
          Length = 1002

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 253 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 302



to top

>ref|XM_982955.1| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate
           dehydrogenase (GAPDH) (LOC670723), mRNA
          Length = 1002

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 253 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 302



to top

>ref|XR_003790.1| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate
           dehydrogenase (GAPDH) (LOC672277), mRNA
          Length = 1396

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 243 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 292



to top

>ref|XM_484436.4| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate
           dehydrogenase (GAPDH) (LOC432919), mRNA
          Length = 1002

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 253 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 302



to top

>ref|XM_904634.2| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate
           dehydrogenase (GAPDH) (LOC630967), mRNA
          Length = 1002

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 253 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 302



to top

>ref|XR_004746.1| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate
           dehydrogenase (GAPDH) (LOC675187), mRNA
          Length = 1396

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 243 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 292



to top

>ref|XR_002153.1| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate
           dehydrogenase (GAPDH) (LOC668177), mRNA
          Length = 1396

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 243 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 292



to top

>ref|XM_987944.1| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate
           dehydrogenase (GAPDH) (LOC667048), mRNA
          Length = 1002

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 253 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 302



to top

>ref|XR_003390.1| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate
            dehydrogenase (GAPDH) (LOC671350), mRNA
          Length = 1926

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                              
Query: 338  tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
            |||||||||| ||||||||| || ||||||||||| || |||||||||||
Sbjct: 1177 tggggtgaggtcggtgctgagtatgttgtggagtctactggtgtcttcac 1226



to top

>ref|XR_001931.1| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate
            dehydrogenase (GAPDH) (LOC666859), mRNA
          Length = 2628

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                              
Query: 338  tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
            |||||||||| ||||||||| || ||||||||||| || |||||||||||
Sbjct: 1879 tggggtgaggtcggtgctgagtatgttgtggagtctactggtgtcttcac 1928



to top

>gb|AC102352.9| Mus musculus chromosome 14, clone RP23-30H7, complete sequence
          Length = 248441

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                                
Query: 338    tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
              |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 124473 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 124522



to top

>ref|XM_620532.3| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate
           dehydrogenase (GAPDH) (LOC545984), mRNA
          Length = 1002

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 253 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 302



to top

>ref|XR_002367.1| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate
           dehydrogenase (GAPDH) (LOC669004), mRNA
          Length = 1007

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||| ||||||| || ||||||||||| || |||||||||||
Sbjct: 259 tggggtgaggcccgtgctgagtatgttgtggagtctactggtgtcttcac 308



to top

>ref|XM_906931.2| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate
           dehydrogenase (GAPDH) (LOC632720), mRNA
          Length = 1002

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 253 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 302



to top

>gb|AC147142.2| Mus musculus BAC clone RP24-391G7 from chromosome Y, complete sequence
          Length = 162132

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                               
Query: 338   tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
             |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 42349 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 42398



to top

>ref|XR_003202.1| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate
           dehydrogenase (GAPDH) (LOC546736), mRNA
          Length = 996

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 259 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 308



to top

>gb|AC146611.2| Mus musculus BAC clone RP23-57A17 from chromosome 5, complete sequence
          Length = 194487

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                                
Query: 338    tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
              |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 175523 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 175474



to top

>gb|AY363102.1|AY363102S1 Mus musculus diadenosine triphosphate hydrolase (Fhit) gene, exons 1
             and 2
          Length = 309506

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                               
Query: 338   tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
             |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 24206 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 24255



to top

>gb|AC115124.6| Mus musculus BAC clone RP24-349M22 from chromosome 18, complete
             sequence
          Length = 137371

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                               
Query: 338   tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
             |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 45027 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 44978



to top

>gb|AC130841.4| Mus musculus BAC clone RP24-445L16 from chromosome 8, complete sequence
          Length = 174384

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                               
Query: 338   tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
             |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 20632 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 20583



to top

>gb|AC132391.3| Mus musculus BAC clone RP23-454N21 from chromosome 12, complete sequence
          Length = 178291

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                                
Query: 338    tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
              |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 122313 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 122362



to top

>gb|AC124581.4| Mus musculus BAC clone RP23-116E3 from chromosome 13, complete sequence
          Length = 205173

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                                
Query: 338    tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
              |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 157136 tggggtgaggccggtgctgagtatgtggtggagtctactggtgtcttcac 157185



to top

>gb|AC121959.3| Mus musculus BAC clone RP24-247N18 from chromosome 3, complete sequence
          Length = 187416

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                                
Query: 338    tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
              |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 140884 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 140933



to top

>gb|AC122039.4| Mus musculus BAC clone RP24-432H3 from chromosome 6, complete sequence
          Length = 169274

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                               
Query: 338   tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
             |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 21870 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 21919



to top

>gb|AC125177.4| Mus musculus BAC clone RP23-315H8 from chromosome 8, complete sequence
          Length = 217567

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                                
Query: 338    tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
              |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 214256 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 214305



to top

>gb|AC124773.4| Mus musculus BAC clone RP23-49B23 from 3, complete sequence
          Length = 216860

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                                
Query: 338    tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
              |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 195929 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 195880



to top

>gb|AC114004.5| Mus musculus BAC clone RP23-174P2 from 7, complete sequence
          Length = 187196

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                               
Query: 338   tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
             |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 17155 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 17204



to top

>gb|AC118474.10| Mus musculus chromosome 8, clone RP23-288O12, complete sequence
          Length = 191490

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                               
Query: 338   tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
             |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 99943 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 99894



to top

>gb|AC102494.6| Mus musculus chromosome 7, clone RP24-565J5, complete sequence
          Length = 161721

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                               
Query: 338   tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
             |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 75839 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 75888



to top

>gb|AC161456.3| Mus musculus BAC clone RP23-190H11 from chromosome 6, complete sequence
          Length = 208350

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                                
Query: 338    tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
              |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 106877 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 106828



to top

>gb|AY364464.1| Phaeosphaeria nodorum isolate S-82-13 glyceraldehyde 3-phosphate
           dehydrogenase gene, complete cds
          Length = 1251

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 150 acgatgtcgagctcgtcgccgtcaacgaccccttcatc 187
           |||| |||||| ||||||||||||||||||||||||||
Sbjct: 185 acgacgtcgagatcgtcgccgtcaacgaccccttcatc 222



to top

>gb|AY364463.1| Phaeosphaeria avenaria f. sp. triticae isolate Sat24-1
           glyceraldehyde 3-phosphate dehydrogenase gene, complete
           cds
          Length = 1251

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 150 acgatgtcgagctcgtcgccgtcaacgaccccttcatc 187
           |||| |||||| ||||||||||||||||||||||||||
Sbjct: 185 acgacgtcgagatcgtcgccgtcaacgaccccttcatc 222



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 359 tacgttgtggagtccaccggtgtcttcac 387
           ||||| || ||||||||||||||||||||
Sbjct: 467 tacgtcgttgagtccaccggtgtcttcac 495



to top

>gb|AY364462.1| Phaeosphaeria nodorum isolate 9074 glyceraldehyde 3-phosphate
           dehydrogenase gene, complete cds
          Length = 1254

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 150 acgatgtcgagctcgtcgccgtcaacgaccccttcatc 187
           |||| |||||| ||||||||||||||||||||||||||
Sbjct: 185 acgacgtcgagatcgtcgccgtcaacgaccccttcatc 222



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 359 tacgttgtggagtccaccggtgtcttcac 387
           ||||| || ||||||||||||||||||||
Sbjct: 468 tacgtcgttgagtccaccggtgtcttcac 496



to top

>gb|AY364461.1| Phaeosphaeria nodorum isolate S74-20A glyceraldehyde 3-phosphate
           dehydrogenase gene, complete cds
          Length = 1253

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 150 acgatgtcgagctcgtcgccgtcaacgaccccttcatc 187
           |||| |||||| ||||||||||||||||||||||||||
Sbjct: 185 acgacgtcgagatcgtcgccgtcaacgaccccttcatc 222



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 359 tacgttgtggagtccaccggtgtcttcac 387
           ||||| || ||||||||||||||||||||
Sbjct: 468 tacgtcgttgagtccaccggtgtcttcac 496



to top

>gb|AY364459.1| Phaeosphaeria avenaria f. sp. avenaria strain ATCC 12277
           glyceraldehyde 3-phosphate dehydrogenase gene, complete
           cds
          Length = 1251

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 150 acgatgtcgagctcgtcgccgtcaacgaccccttcatc 187
           |||| |||||| ||||||||||||||||||||||||||
Sbjct: 185 acgacgtcgagatcgtcgccgtcaacgaccccttcatc 222



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 359 tacgttgtggagtccaccggtgtcttcac 387
           ||||| || ||||||||||||||||||||
Sbjct: 467 tacgtcgttgagtccaccggtgtcttcac 495



to top

>gb|AY364458.1| Stagonospora sp. Sn48-1 glyceraldehyde 3-phosphate dehydrogenase
           gene, complete cds
          Length = 1254

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 150 acgatgtcgagctcgtcgccgtcaacgaccccttcatc 187
           |||| |||||| ||||||||||||||||||||||||||
Sbjct: 185 acgacgtcgagatcgtcgccgtcaacgaccccttcatc 222



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 359 tacgttgtggagtccaccggtgtcttcac 387
           ||||| || ||||||||||||||||||||
Sbjct: 468 tacgtcgttgagtccaccggtgtcttcac 496



to top

>gb|AY364456.1| Phaeosphaeria avenaria f. sp. triticae isolate S81-W10
           glyceraldehyde 3-phosphate dehydrogenase gene, complete
           cds
          Length = 1251

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 150 acgatgtcgagctcgtcgccgtcaacgaccccttcatc 187
           |||| |||||| ||||||||||||||||||||||||||
Sbjct: 185 acgacgtcgagatcgtcgccgtcaacgaccccttcatc 222



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 359 tacgttgtggagtccaccggtgtcttcac 387
           ||||| || ||||||||||||||||||||
Sbjct: 467 tacgtcgttgagtccaccggtgtcttcac 495



to top

>gb|BC098095.1| Mus musculus glyceraldehyde-3-phosphate dehydrogenase pseudogene,
           mRNA (cDNA clone MGC:106682 IMAGE:30551357), complete
           cds
          Length = 1742

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 672 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 721



to top

>gb|AC160632.5| Mus musculus chromosome 8, clone RP24-319F9, complete sequence
          Length = 163311

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                               
Query: 338   tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
             |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 39825 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 39874



to top

>emb|X60345.1|RAGADPHR R.acer GADPH mRNA for glycolytic glyceraldehyde-3-phosphate
           dehydrogenase
          Length = 1236

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 80  aagattaagatcggaatcaacggtttcggaaggatcgg 117
           ||||| |||||||||||||||||||||||||| |||||
Sbjct: 25  aagatcaagatcggaatcaacggtttcggaagaatcgg 62



to top

>gb|AC163619.2| Mus musculus BAC clone RP24-164P4 from chromosome 9, complete sequence
          Length = 161793

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                                
Query: 338    tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
              |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 125201 tggggtgaggccggtgctgagtatgtagtggagtctactggtgtcttcac 125152



to top

>emb|AL607064.16| Mouse DNA sequence from clone RP23-314K19 on chromosome 11 Contains a
             glyceraldehyde-3-phosphate dehydrogenase (Gapd)
             pseudogene, complete sequence
          Length = 57166

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                               
Query: 338   tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
             |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 30019 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 29970



to top

>emb|AL935328.14| Mouse DNA sequence from clone RP23-227C11 on chromosome 11 Contains a
             peptidylprolyl isomerase A (Ppia) pseudogene, a
             glyceraldehyde-3-phosphate dehydrogenase (Gapd)
             pseudogene, a ribosomal protein L17 (Rpl17) pseudogene and
             an uridine monophosphate synthetase (Umps) pseudogene,
             complete sequence
          Length = 182970

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                               
Query: 338   tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
             |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 94334 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 94383



to top

>emb|AL662926.19| Mouse DNA sequence from clone RP23-403O15 on chromosome 11 Contains the
             5' end of the Rab1 gene for RAB1, member RAS oncogene
             family, a ribosomal protein L12 (Rpl12), the Slc1a4 gene
             for solute carrier family 1 (glutamate/neutral amino acid
             transporter) member 4, the gene for a novel protein
             similar to glyceraldehyde-3-phosphate dehydrogenase Gapd
             and two Cpg islands, complete sequence
          Length = 125596

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                               
Query: 338   tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
             |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 87423 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 87374



to top

>emb|AL807395.8| Mouse DNA sequence from clone RP23-81P12 on chromosome 11 Contains the
             5' end of the Tcn2 gene for transcobalamin 2, two novel
             genes, a glyceraldehyde-3-phosphate dehydrogenase (Gapd)
             pseudogene, the Pes1 gene for BRCT domain containing
             pescadillo homolog 1 (zebrafish), the Gcst gene for
             galactosylceramide sulfotransferase, a
             ubiquitin-conjugating enzyme E2L 3 (Ube2l3) pseuogene, the
             Sec14l4 and Sec14l2 genes for SEC14-like 4 (S. cerevisiae)
             and 2, the ortholog of human and rat SEC14-like 3 (S.
             cerevisiae) SEC14L3, a ribosomal protein L29 (Rpl29)
             pseudogene, a transformer 2 alpha homolog (Drosophila)
             (Tra2a) pseudogene and a CpG island, complete sequence
          Length = 201238

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                               
Query: 338   tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
             |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 22989 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 23038



to top

>gb|BC095932.1| Mus musculus glyceraldehyde-3-phosphate dehydrogenase, mRNA (cDNA
           clone MGC:106377 IMAGE:30733532), complete cds
          Length = 1258

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 314 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 363



to top

>gb|AC158345.8| Mus musculus chromosome 7, clone RP23-271M19, complete sequence
          Length = 188354

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                               
Query: 338   tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
             |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 38719 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 38768



to top

>gb|BC092252.1| Mus musculus similar to glyceraldehyde-3-phosphate dehydrogenase,
           mRNA (cDNA clone MGC:102542 IMAGE:5044783), complete cds
          Length = 1255

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 312 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 361



to top

>dbj|AK140794.1| Mus musculus 16 days embryo head cDNA, RIKEN full-length enriched
           library, clone:C130021D09
           product:glyceraldehyde-3-phosphate dehydrogenase, full
           insert sequence
          Length = 1253

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 326 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 375



to top

>dbj|AK146435.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-length enriched
           library, clone:I730090K19
           product:glyceraldehyde-3-phosphate dehydrogenase, full
           insert sequence
          Length = 1253

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 326 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 375



to top

>ref|NM_001001303.1| Mus musculus glyceraldehyde-3-phosphate dehydrogenase (Gapdh), mRNA
          Length = 1243

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 311 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 360



to top

>dbj|AK147969.1| Mus musculus melanocyte cDNA, RIKEN full-length enriched library,
           clone:G270120O18 product:glyceraldehyde-3-phosphate
           dehydrogenase, full insert sequence
          Length = 2176

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 322 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 371



to top

>dbj|AK147891.1| Mus musculus melanocyte cDNA, RIKEN full-length enriched library,
           clone:G270083H09 product:glyceraldehyde-3-phosphate
           dehydrogenase, full insert sequence
          Length = 1196

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 326 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 375



to top

>dbj|AK160399.1| Mus musculus adult male cerebellum cDNA, RIKEN full-length enriched
           library, clone:1500001O05
           product:glyceraldehyde-3-phosphate dehydrogenase, full
           insert sequence
          Length = 1253

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 326 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 375



to top

>dbj|AK147738.1| Mus musculus melanocyte cDNA, RIKEN full-length enriched library,
           clone:G270015C01 product:glyceraldehyde-3-phosphate
           dehydrogenase, full insert sequence
          Length = 1221

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 326 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 375



to top

>dbj|AK164415.1| Mus musculus 12 days embryo eyeball cDNA, RIKEN full-length
           enriched library, clone:D230015A01
           product:glyceraldehyde-3-phosphate dehydrogenase, full
           insert sequence
          Length = 1206

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 324 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 373



to top

>gb|DQ383974.1| Ascochyta sp. Georgia16 glyceraldehyde-3-phosphate dehydrogenase
           (G3PD) gene, partial cds
          Length = 519

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 150 acgatgtcgagctcgtcgccgtcaacgaccccttcatc 187
           |||| |||||| ||||||||||||||||||||||||||
Sbjct: 86  acgacgtcgagatcgtcgccgtcaacgaccccttcatc 123



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 359 tacgttgtggagtccaccggtgtcttcac 387
           ||||| || ||||||||||||||||||||
Sbjct: 378 tacgtcgtcgagtccaccggtgtcttcac 406



to top

>gb|DQ383972.1| Ascochyta sp. Georgia3 glyceraldehyde-3-phosphate dehydrogenase
           (G3PD) gene, partial cds
          Length = 519

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 150 acgatgtcgagctcgtcgccgtcaacgaccccttcatc 187
           |||| |||||| ||||||||||||||||||||||||||
Sbjct: 86  acgacgtcgagatcgtcgccgtcaacgaccccttcatc 123



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 359 tacgttgtggagtccaccggtgtcttcac 387
           ||||| || ||||||||||||||||||||
Sbjct: 378 tacgtcgtcgagtccaccggtgtcttcac 406



to top

>gb|DQ383971.1| Ascochyta sp. Georgia2 glyceraldehyde-3-phosphate dehydrogenase
           (G3PD) gene, partial cds
          Length = 519

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 150 acgatgtcgagctcgtcgccgtcaacgaccccttcatc 187
           |||| |||||| ||||||||||||||||||||||||||
Sbjct: 86  acgacgtcgagatcgtcgccgtcaacgaccccttcatc 123



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 359 tacgttgtggagtccaccggtgtcttcac 387
           ||||| || ||||||||||||||||||||
Sbjct: 378 tacgtcgtcgagtccaccggtgtcttcac 406



to top

>gb|DQ383970.1| Ascochyta fabae f. sp. viciae strain AV11
           glyceraldehyde-3-phosphate dehydrogenase (G3PD) gene,
           partial cds
          Length = 519

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 150 acgatgtcgagctcgtcgccgtcaacgaccccttcatc 187
           |||| |||||| ||||||||||||||||||||||||||
Sbjct: 86  acgacgtcgagatcgtcgccgtcaacgaccccttcatc 123



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 359 tacgttgtggagtccaccggtgtcttcac 387
           ||||| || ||||||||||||||||||||
Sbjct: 378 tacgtcgtcgagtccaccggtgtcttcac 406



to top

>gb|DQ383969.1| Ascochyta sp. AV8 glyceraldehyde-3-phosphate dehydrogenase (G3PD)
           gene, partial cds
          Length = 519

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 150 acgatgtcgagctcgtcgccgtcaacgaccccttcatc 187
           |||| |||||| ||||||||||||||||||||||||||
Sbjct: 86  acgacgtcgagatcgtcgccgtcaacgaccccttcatc 123



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 359 tacgttgtggagtccaccggtgtcttcac 387
           ||||| || ||||||||||||||||||||
Sbjct: 378 tacgtcgtcgagtccaccggtgtcttcac 406



to top

>gb|DQ383968.1| Ascochyta sp. AV1 glyceraldehyde-3-phosphate dehydrogenase (G3PD)
           gene, partial cds
          Length = 519

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 150 acgatgtcgagctcgtcgccgtcaacgaccccttcatc 187
           |||| |||||| ||||||||||||||||||||||||||
Sbjct: 86  acgacgtcgagatcgtcgccgtcaacgaccccttcatc 123



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 359 tacgttgtggagtccaccggtgtcttcac 387
           ||||| || ||||||||||||||||||||
Sbjct: 378 tacgtcgtcgagtccaccggtgtcttcac 406



to top

>gb|DQ383967.1| Ascochyta sp. Georgia12 glyceraldehyde-3-phosphate dehydrogenase
           (G3PD) gene, partial cds
          Length = 519

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 150 acgatgtcgagctcgtcgccgtcaacgaccccttcatc 187
           |||| |||||| ||||||||||||||||||||||||||
Sbjct: 86  acgacgtcgagatcgtcgccgtcaacgaccccttcatc 123



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 359 tacgttgtggagtccaccggtgtcttcac 387
           ||||| || ||||||||||||||||||||
Sbjct: 378 tacgtcgtcgagtccaccggtgtcttcac 406



to top

>gb|DQ383966.1| Ascochyta sp. Georgia6 glyceraldehyde-3-phosphate dehydrogenase
           (G3PD) gene, partial cds
          Length = 519

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 150 acgatgtcgagctcgtcgccgtcaacgaccccttcatc 187
           |||| |||||| ||||||||||||||||||||||||||
Sbjct: 86  acgacgtcgagatcgtcgccgtcaacgaccccttcatc 123



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 359 tacgttgtggagtccaccggtgtcttcac 387
           ||||| || ||||||||||||||||||||
Sbjct: 378 tacgtcgtcgagtccaccggtgtcttcac 406



to top

>gb|DQ383965.1| Ascochyta pisi strain AP5 glyceraldehyde-3-phosphate dehydrogenase
           (G3PD) gene, partial cds
          Length = 519

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 150 acgatgtcgagctcgtcgccgtcaacgaccccttcatc 187
           |||| |||||| ||||||||||||||||||||||||||
Sbjct: 86  acgacgtcgagatcgtcgccgtcaacgaccccttcatc 123



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 359 tacgttgtggagtccaccggtgtcttcac 387
           ||||| || ||||||||||||||||||||
Sbjct: 378 tacgtcgtcgagtccaccggtgtcttcac 406



to top

>gb|DQ383964.1| Ascochyta pisi strain AP4 glyceraldehyde-3-phosphate dehydrogenase
           (G3PD) gene, partial cds
          Length = 519

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 150 acgatgtcgagctcgtcgccgtcaacgaccccttcatc 187
           |||| |||||| ||||||||||||||||||||||||||
Sbjct: 86  acgacgtcgagatcgtcgccgtcaacgaccccttcatc 123



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 359 tacgttgtggagtccaccggtgtcttcac 387
           ||||| || ||||||||||||||||||||
Sbjct: 378 tacgtcgtcgagtccaccggtgtcttcac 406



to top

>gb|DQ383963.1| Ascochyta pisi strain AP1 glyceraldehyde-3-phosphate dehydrogenase
           (G3PD) gene, partial cds
          Length = 519

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 150 acgatgtcgagctcgtcgccgtcaacgaccccttcatc 187
           |||| |||||| ||||||||||||||||||||||||||
Sbjct: 86  acgacgtcgagatcgtcgccgtcaacgaccccttcatc 123



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 359 tacgttgtggagtccaccggtgtcttcac 387
           ||||| || ||||||||||||||||||||
Sbjct: 378 tacgtcgtcgagtccaccggtgtcttcac 406



to top

>gb|DQ383962.1| Didymella lentis strain AL11 glyceraldehyde-3-phosphate
           dehydrogenase (G3PD) gene, partial cds
          Length = 519

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 150 acgatgtcgagctcgtcgccgtcaacgaccccttcatc 187
           |||| |||||| ||||||||||||||||||||||||||
Sbjct: 86  acgacgtcgagatcgtcgccgtcaacgaccccttcatc 123



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 359 tacgttgtggagtccaccggtgtcttcac 387
           ||||| || ||||||||||||||||||||
Sbjct: 378 tacgtcgtcgagtccaccggtgtcttcac 406



to top

>gb|DQ383961.1| Didymella lentis strain AL1 glyceraldehyde-3-phosphate
           dehydrogenase (G3PD) gene, partial cds
          Length = 519

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 150 acgatgtcgagctcgtcgccgtcaacgaccccttcatc 187
           |||| |||||| ||||||||||||||||||||||||||
Sbjct: 86  acgacgtcgagatcgtcgccgtcaacgaccccttcatc 123



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 359 tacgttgtggagtccaccggtgtcttcac 387
           ||||| || ||||||||||||||||||||
Sbjct: 378 tacgtcgtcgagtccaccggtgtcttcac 406



to top

>gb|DQ383960.1| Didymella fabae strain AF8 glyceraldehyde-3-phosphate dehydrogenase
           (G3PD) gene, partial cds
          Length = 519

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 150 acgatgtcgagctcgtcgccgtcaacgaccccttcatc 187
           |||| |||||| ||||||||||||||||||||||||||
Sbjct: 86  acgacgtcgagatcgtcgccgtcaacgaccccttcatc 123



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 359 tacgttgtggagtccaccggtgtcttcac 387
           ||||| || ||||||||||||||||||||
Sbjct: 378 tacgtcgtcgagtccaccggtgtcttcac 406



to top

>gb|DQ383959.1| Didymella fabae strain AF1 glyceraldehyde-3-phosphate dehydrogenase
           (G3PD) gene, partial cds
          Length = 519

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 150 acgatgtcgagctcgtcgccgtcaacgaccccttcatc 187
           |||| |||||| ||||||||||||||||||||||||||
Sbjct: 86  acgacgtcgagatcgtcgccgtcaacgaccccttcatc 123



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 359 tacgttgtggagtccaccggtgtcttcac 387
           ||||| || ||||||||||||||||||||
Sbjct: 378 tacgtcgtcgagtccaccggtgtcttcac 406



to top

>dbj|AK169742.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
            full-length enriched library, clone:E430016M08
            product:glyceraldehyde-3-phosphate dehydrogenase, full
            insert sequence
          Length = 3290

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                              
Query: 338  tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
            |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 1798 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 1847



to top

>gb|AC117588.11| Mus musculus chromosome 15, clone RP23-177B8, complete sequence
          Length = 211177

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                               
Query: 338   tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
             |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 26916 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 26867



to top

>dbj|AK168217.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library,
           clone:I730067N10 product:glyceraldehyde-3-phosphate
           dehydrogenase, full insert sequence
          Length = 1253

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 326 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 375



to top

>gb|BC093508.1| Mus musculus similar to glyceraldehyde-3-phosphate dehydrogenase,
           mRNA (cDNA clone MGC:103189 IMAGE:4975394), complete cds
          Length = 1319

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 283 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 332



to top

>dbj|AK013857.1| Mus musculus 12 days embryo head cDNA, RIKEN full-length enriched
           library, clone:3000002C10
           product:glyceraldehyde-3-phosphate dehydrogenase (EC
           1.2.1.12) homolog [Mus musculus], full insert sequence
          Length = 1612

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 669 tggggtgaggccggtgctgagtatgtagtggagtctactggtgtcttcac 718



to top

>gb|AC157651.3| Mus musculus BAC clone RP24-363O21 from chromosome 6, complete sequence
          Length = 171141

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                               
Query: 338   tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
             |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 36878 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 36927



to top

>dbj|AK081405.1| Mus musculus 16 days embryo head cDNA, RIKEN full-length enriched
           library, clone:C130014J06
           product:glyceraldehyde-3-phosphate dehydrogenase, full
           insert sequence
          Length = 1253

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 326 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 375



to top

>dbj|AK002273.1| Mus musculus adult male kidney cDNA, RIKEN full-length enriched
           library, clone:0610007C02
           product:glyceraldehyde-3-phosphate dehydrogenase, full
           insert sequence
          Length = 1252

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 326 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 375



to top

>gb|AF162137.2|AF162137 Mus musculus WNT-2 gene, partial cds; putative ankyrin-related protein
              and cystic fibrosis transmembrane conductance regulator
              (CFTR) genes, complete cds; and unknown gene
          Length = 357856

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                                
Query: 338    tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
              |||||||||||| ||||||| || ||||||||||| || |||||||||||
Sbjct: 119323 tggggtgaggcccgtgctgagtatgttgtggagtctactggtgtcttcac 119372



to top

>gb|BC096440.1| Mus musculus glyceraldehyde-3-phosphate dehydrogenase, mRNA (cDNA
           clone MGC:106375 IMAGE:2649847), complete cds
          Length = 1279

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 314 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 363



to top

>gb|BC061210.1| Mus musculus RIKEN cDNA 3000002C10 gene, mRNA (cDNA clone
           IMAGE:30250313), containing frame-shift errors
          Length = 1633

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 660 tggggtgaggccggtgctgagtatgtagtggagtctactggtgtcttcac 709



to top

>dbj|AK082178.1| Mus musculus 0 day neonate cerebellum cDNA, RIKEN full-length
           enriched library, clone:C230017M01
           product:glyceraldehyde-3-phosphate dehydrogenase (EC
           1.2.1.12) homolog [Mus musculus], full insert sequence
          Length = 3977

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 798 tggggtgaggccggtgctgagtatgtagtggagtctactggtgtcttcac 847



to top

>gb|AC153557.8| Mus musculus 10 BAC RP23-203H20 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 233640

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                               
Query: 338   tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
             |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 79419 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 79468



to top

>gb|BC094037.1| Mus musculus glyceraldehyde-3-phosphate dehydrogenase, mRNA (cDNA
           clone MGC:102541 IMAGE:5009636), complete cds
          Length = 1232

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 290 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 339



to top

>gb|AC156283.6| Mus musculus 6 BAC RP24-327I4 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 172188

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                               
Query: 338   tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
             |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 71102 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 71151



to top

>dbj|AB070217.1| Meriones unguiculatus GAPD mRNA for Glyceraldehyde-3-phosphate
           dehydrogenase, complete cds
          Length = 1278

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           ||||| || |||||||| || || ||||||||||||||||||||||||||
Sbjct: 324 tggggcgatgccggtgccgagtatgttgtggagtccaccggtgtcttcac 373



to top

>gb|AC150660.4| Mus musculus BAC clone RP23-41F9 from chromosome 15, complete sequence
          Length = 229655

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                                
Query: 338    tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
              |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 160983 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 161032



to top

>gb|BC092294.1| Mus musculus similar to glyceraldehyde-3-phosphate dehydrogenase,
           mRNA (cDNA clone MGC:102543 IMAGE:5068049), complete cds
          Length = 1280

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 303 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 352



to top

>gb|BC092264.1| Mus musculus similar to glyceraldehyde-3-phosphate dehydrogenase,
           mRNA (cDNA clone MGC:102651 IMAGE:2655526), complete cds
          Length = 1258

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 314 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 363



to top

>gb|BC092267.1| Mus musculus similar to glyceraldehyde-3-phosphate dehydrogenase,
           mRNA (cDNA clone MGC:102540 IMAGE:4010884), complete cds
          Length = 1279

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 300 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 349



to top

>ref|NR_002890.1| Mus musculus glyceraldehyde-3-phosphate dehydrogenase pseudogene
           (LOC654472) on chromosome 11
          Length = 1742

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 672 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 721



to top

>dbj|AK198590.1| Mus musculus cDNA, clone:Y1G0128J17, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000051144, based on BLAT search
          Length = 360

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 294 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 343



to top

>dbj|AK188366.1| Mus musculus cDNA, clone:Y0G0144O14, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000070038, based on BLAT search
          Length = 106

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 40  tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 89



to top

>gb|BC092063.1| Mus musculus cDNA clone IMAGE:4195104
          Length = 1714

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 tggggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 387
           |||||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 768 tggggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 817


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,218,127
Number of Sequences: 3902068
Number of extensions: 2218127
Number of successful extensions: 44645
Number of sequences better than 10.0: 1213
Number of HSP's better than 10.0 without gapping: 1208
Number of HSP's successfully gapped in prelim test: 6
Number of HSP's that attempted gapping in prelim test: 42081
Number of HSP's gapped (non-prelim): 2551
length of query: 393
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 371
effective length of database: 17,147,199,772
effective search space: 6361611115412
effective search space used: 6361611115412
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top