ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags31i17
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC104283.2| Oryza sativa (japonica cultivar-group) chromosome... 113 5e-22
2dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 113 5e-22
3gb|AY108180.1| Zea mays PCO134590 mRNA sequence 78 3e-11
4gb|AC125291.3| Drosophila melanogaster X BAC CH221-17A11 (CHORI ... 52 0.002
5gb|AC023723.4| Drosophila melanogaster X BAC RP98-48E6 (Roswell ... 52 0.002
6gb|AC023709.4| Drosophila melanogaster X BAC RP98-10I17 (Roswell... 52 0.002
7ref|NM_132412.1| Drosophila melanogaster CG9817-RA (CG9817), mRNA 52 0.002
8gb|AE003451.5| Drosophila melanogaster chromosome X, section 35 ... 52 0.002
9ref|XM_638141.1| Dictyostelium discoideum hypothetical protein (... 48 0.026
10gb|AC154910.3| Mus musculus BAC clone RP23-70L9 from chromosome ... 48 0.026
11gb|AC116924.3| Dictyostelium discoideum chromosome 2 map 6357117... 48 0.026
12gb|AC122029.4| Mus musculus BAC clone RP24-400A11 from chromosom... 48 0.026
13gb|AC137155.3| Mus musculus BAC clone RP23-66E11 from 12, comple... 48 0.026
14ref|NM_033448.1| Homo sapiens keratin 6 irs (KRT6IRS), mRNA 46 0.10
15gb|BC103918.1| Homo sapiens keratin 6 irs, mRNA (cDNA clone MGC:... 46 0.10
16gb|BC103917.1| Homo sapiens keratin 6 irs, mRNA (cDNA clone MGC:... 46 0.10
17ref|XM_637697.1| Dictyostelium discoideum hypothetical protein (... 46 0.10
18ref|XM_509079.1| PREDICTED: Pan troglodytes similar to keratin 6... 46 0.10
19ref|XM_611783.2| PREDICTED: Bos taurus similar to keratin 6 irs ... 46 0.10
20gb|AC116977.2| Dictyostelium discoideum chromosome 2 map 5515173... 46 0.10
21emb|AL596210.20| Human DNA sequence from clone RP11-92O17 on chr... 46 0.10
22ref|XM_502474.1| Yarrowia lipolytica CLIB122, YALI0D06193g predi... 46 0.10
23gb|BT009932.1| Drosophila melanogaster SD08871 full insert cDNA 46 0.10
24emb|AJ308599.1|HSA308599 Homo sapiens mRNA for keratin 6 irs (KR... 46 0.10
25emb|CR858130.1| Pongo pygmaeus mRNA; cDNA DKFZp468M2112 (from cl... 46 0.10
26gb|AC023722.4| Drosophila melanogaster X BAC RP98-48O24 (Roswell... 46 0.10
27gb|AC023699.4| Drosophila melanogaster X BAC RP98-11K20 (Roswell... 46 0.10
28dbj|AK122795.1| Homo sapiens cDNA FLJ16362 fis, clone THYMU20309... 46 0.10
29ref|NM_132114.1| Drosophila melanogaster CG14442-RA (CG14442), mRNA 46 0.10
30gb|AF113024.1|AF113024 Cyprinodon diabolis microsatellite C275 s... 46 0.10
31gb|AE003438.3| Drosophila melanogaster chromosome X, section 22 ... 46 0.10
32emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB1... 46 0.10
33emb|AJ308600.1|HSA308600 Homo sapiens partial mRNA for nonsensic... 46 0.10
34ref|XM_855259.1| PREDICTED: Canis familiaris similar to Keratin,... 44 0.40
35ref|XM_855231.1| PREDICTED: Canis familiaris similar to Keratin,... 44 0.40
36ref|XM_855192.1| PREDICTED: Canis familiaris similar to Keratin,... 44 0.40
37ref|XM_543648.2| PREDICTED: Canis familiaris similar to Keratin,... 44 0.40
38ref|XM_855095.1| PREDICTED: Canis familiaris similar to Keratin,... 44 0.40
39ref|XM_855013.1| PREDICTED: Canis familiaris similar to Keratin,... 44 0.40
40ref|XM_854944.1| PREDICTED: Canis familiaris similar to Keratin,... 44 0.40
41ref|XM_854908.1| PREDICTED: Canis familiaris similar to Keratin,... 44 0.40
42ref|XM_854761.1| PREDICTED: Canis familiaris similar to Keratin,... 44 0.40
43ref|XM_854730.1| PREDICTED: Canis familiaris similar to Keratin,... 44 0.40
44ref|XM_854630.1| PREDICTED: Canis familiaris similar to Keratin,... 44 0.40
45gb|AC138739.8| Mus musculus chromosome 9, clone RP23-380A10, com... 44 0.40
46emb|BX041769.1|CNS094E5 Single read from an extremity of a full-... 44 0.40
47emb|BX041768.1|CNS094E4 Single read from an extremity of a full-... 44 0.40
48emb|BX005022.7| Zebrafish DNA sequence from clone DKEY-6N21 in l... 44 0.40
49emb|AL807778.10| Mouse DNA sequence from clone RP23-198G1 on chr... 44 0.40
50gb|CP000096.1| Pelodictyon luteolum DSM 273, complete genome 42 1.6
51gb|AC107823.11| Mus musculus chromosome 8, clone RP23-184K1, com... 42 1.6
52gb|AC007928.7| Drosophila melanogaster clone BACR04O02, complete... 42 1.6
53ref|XM_419682.1| PREDICTED: Gallus gallus similar to mitochondri... 42 1.6
54gb|AC141565.3| Mus musculus BAC clone RP23-160M21 from chromosom... 42 1.6
55gb|AC159994.7| Mus musculus chromosome 7, clone RP23-368F23, com... 42 1.6
56gb|AC161884.5| Mus musculus BAC clone RP23-77K23 from chromosome... 42 1.6
57gb|AC107798.10| Mus musculus chromosome 8, clone RP23-4D24, comp... 42 1.6
58ref|XM_757360.1| Ustilago maydis 521 hypothetical protein (UM063... 42 1.6
59gb|AC117262.2| Mus musculus BAC clone RP24-537M7 from 2, complet... 42 1.6
60emb|AL512449.6| Human DNA sequence from clone RP11-286E7 on chro... 42 1.6
61emb|AL139259.15| Human DNA sequence from clone RP5-861H2 on chro... 42 1.6
62gb|AY305027.1| Halichoeres tenuispinis estrogen receptor beta mR... 42 1.6
63emb|X55735.1|DPBCD D.pseudoobscura bcd (bicoid) gene involved in... 42 1.6
64emb|AL591064.11| Mouse DNA sequence from clone RP23-395E18 on ch... 42 1.6
65gb|AC023741.4| Drosophila melanogaster X BAC RP98-23O9 (Roswell ... 42 1.6
66gb|AC104627.8| Drosophila melanogaster X BAC RP98-4A11 (Roswell ... 42 1.6
67gb|AC010054.7| Drosophila melanogaster 3L BAC RP98-15E10 (Roswel... 42 1.6
68ref|NM_167335.1| Drosophila melanogaster Smrter CG4013-RC, trans... 42 1.6
69ref|NM_167334.1| Drosophila melanogaster Smrter CG4013-RB, trans... 42 1.6
70ref|NM_140744.1| Drosophila melanogaster TORC CG6064-RA (TORC), ... 42 1.6
71gb|AF375008.1| Oncorhynchus mykiss microsatellite OMM1004 sequence 42 1.6
72gb|AF450964.1| Drosophila miranda strain Mather28 bicoid (bcd) g... 42 1.6
73gb|AF450963.1| Drosophila miranda strain MSH38 bicoid (bcd) gene... 42 1.6
74gb|AF450962.1| Drosophila persimilis strain Salem bicoid (bcd) g... 42 1.6
75gb|AF450961.1| Drosophila persimilis strain MSH7 bicoid (bcd) ge... 42 1.6
76gb|AF450960.1| Drosophila persimilis strain MSH3 bicoid (bcd) ge... 42 1.6
77gb|AF450959.1| Drosophila persimilis strain MSH1 bicoid (bcd) ge... 42 1.6
78gb|AF450958.1| Drosophila persimilis strain MSH42 bicoid (bcd) g... 42 1.6
79gb|AF450957.1| Drosophila persimilis strain MSH25 bicoid (bcd) g... 42 1.6
80gb|AF450956.1| Drosophila persimilis strain MatherB bicoid (bcd)... 42 1.6
81gb|AF450955.1| Drosophila persimilis strain MatherG bicoid (bcd)... 42 1.6
82gb|AF450953.1| Drosophila persimilis strain Mather37 bicoid (bcd... 42 1.6
83gb|AF450952.1| Drosophila persimilis strain Mather41 bicoid (bcd... 42 1.6
84gb|AF450951.1| Drosophila persimilis strain Mather27 bicoid (bcd... 42 1.6
85gb|AF450950.1| Drosophila persimilis strain Mather6 bicoid (bcd)... 42 1.6
86gb|AF450949.1| Drosophila persimilis strain Mather40 bicoid (bcd... 42 1.6
87gb|AF450948.1| Drosophila pseudoobscura bogotana strain Potosi3 ... 42 1.6
88gb|AF450947.1| Drosophila pseudoobscura bogotana strain Potosi2 ... 42 1.6
89gb|AF450946.1| Drosophila pseudoobscura bogotana strain Toro4 bi... 42 1.6
90gb|AF450945.1| Drosophila pseudoobscura bogotana strain Toro6 bi... 42 1.6
91gb|AF450944.1| Drosophila pseudoobscura bogotana strain Toro7 bi... 42 1.6
92gb|AF450943.1| Drosophila pseudoobscura bogotana strain Toro1 bi... 42 1.6
93gb|AF450942.1| Drosophila pseudoobscura bogotana strain Sutataus... 42 1.6
94gb|AF450941.1| Drosophila pseudoobscura bogotana strain Sutataus... 42 1.6
95gb|AF450940.1| Drosophila pseudoobscura bogotana strain Sutataus... 42 1.6
96gb|AF450939.1| Drosophila pseudoobscura bogotana strain Sutataus... 42 1.6
97gb|AF450938.1| Drosophila pseudoobscura bogotana strain Susa2 bi... 42 1.6
98gb|AF450937.1| Drosophila pseudoobscura bogotana strain Susa1 bi... 42 1.6
99gb|AF450936.1| Drosophila pseudoobscura bogotana strain Susa6 bi... 42 1.6
100gb|AF450935.1| Drosophila pseudoobscura bogotana strain Susa3 bi... 42 1.6
101gb|AF450934.1| Drosophila pseudoobscura strain MSH21 bicoid (bcd... 42 1.6
102gb|AF450933.1| Drosophila pseudoobscura strain MSH24 bicoid (bcd... 42 1.6
103gb|AF450932.1| Drosophila pseudoobscura strain MSH32 bicoid (bcd... 42 1.6
104gb|AF450931.1| Drosophila pseudoobscura strain MSH9 bicoid (bcd)... 42 1.6
105gb|AF450930.1| Drosophila pseudoobscura strain MSH10 bicoid (bcd... 42 1.6
106gb|AF450928.1| Drosophila pseudoobscura strain Mather48 bicoid (... 42 1.6
107gb|AF450927.1| Drosophila pseudoobscura strain Mather32 bicoid (... 42 1.6
108gb|AF450926.1| Drosophila pseudoobscura strain Mather17 bicoid (... 42 1.6
109gb|AF450925.1| Drosophila pseudoobscura strain Mather10 bicoid (... 42 1.6
110gb|AF450924.1| Drosophila pseudoobscura strain Flagstaff18 bicoi... 42 1.6
111gb|AF450923.1| Drosophila pseudoobscura strain Flagstaff16 bicoi... 42 1.6
112gb|AF450922.1| Drosophila pseudoobscura strain Flagstaff14 bicoi... 42 1.6
113gb|AF450921.1| Drosophila pseudoobscura strain Flagstaff6 bicoid... 42 1.6
114gb|AF450919.1| Drosophila pseudoobscura strain AFC12 bicoid (bcd... 42 1.6
115gb|AF450918.1| Drosophila pseudoobscura strain AFC7 bicoid (bcd)... 42 1.6
116gb|AF450917.1| Drosophila pseudoobscura strain AFC3 bicoid (bcd)... 42 1.6
117gb|AF450916.1| Drosophila pseudoobscura strain AF2 bicoid (bcd) ... 42 1.6
118gb|AF450915.1| Drosophila pseudoobscura strain Abajo36 bicoid (b... 42 1.6
119gb|AC009375.8| Drosophila melanogaster 3L BAC RP98-44L18 (Roswel... 42 1.6
120ref|NM_080536.2| Drosophila melanogaster Smrter CG4013-RA, trans... 42 1.6
121gb|AC011454.6|AC011454 Homo sapiens chromosome 19 clone CTC-347E... 42 1.6
122gb|AF320180.1|AF320180 Drosophila miranda strain MSH38 bicoid (b... 42 1.6
123gb|AF320179.1|AF320179 Drosophila persimilis strain MatherB bico... 42 1.6
124gb|AF320178.1|AF320178 Drosophila persimilis strain Mather27 bic... 42 1.6
125gb|AF320177.1|AF320177 Drosophila persimilis strain Salem bicoid... 42 1.6
126gb|AF320176.1|AF320176 Drosophila persimilis strain MSH25 bicoid... 42 1.6
127gb|AF320175.1|AF320175 Drosophila persimilis strain MSH3 bicoid ... 42 1.6
128gb|AF320174.1|AF320174 Drosophila persimilis strain Mather40 bic... 42 1.6
129gb|AF320173.1|AF320173 Drosophila persimilis strain Mather6 bico... 42 1.6
130gb|AF320172.1|AF320172 Drosophila pseudoobscura strain Mather48 ... 42 1.6
131gb|AF320171.1|AF320171 Drosophila pseudoobscura strain Mather32 ... 42 1.6
132gb|AF320170.1|AF320170 Drosophila pseudoobscura strain Mather17 ... 42 1.6
133gb|AF320169.1|AF320169 Drosophila pseudoobscura strain Mather10 ... 42 1.6
134gb|AF320168.1|AF320168 Drosophila pseudoobscura strain AF2 bicoi... 42 1.6
135gb|AF320167.1|AF320167 Drosophila pseudoobscura strain Abajo36 b... 42 1.6
136gb|AC020754.4|AC020754 Homo sapiens chromosome 3 clone RP11-37I4... 42 1.6
137gb|AC097628.2| Takifugu rubripes clone 264E2, complete sequence 42 1.6
138gb|AY754446.1| Drosophila affinis bicoid (bcd) gene, exons 2, 3 ... 42 1.6
139gb|AY754445.1| Drosophila miranda strain MSH38 bicoid (bcd) gene... 42 1.6
140gb|AY754444.1| Drosophila miranda strain MSH22 bicoid (bcd) gene... 42 1.6
141gb|AY754443.1| Drosophila miranda strain SP235 bicoid (bcd) gene... 42 1.6
142gb|AY754442.1| Drosophila miranda strain SP138 bicoid (bcd) gene... 42 1.6
143gb|AY754441.1| Drosophila miranda strain MA32 bicoid (bcd) gene,... 42 1.6
144gb|AY754440.1| Drosophila miranda strain MA28 bicoid (bcd) gene,... 42 1.6
145gb|AY754439.1| Drosophila miranda strain 0101.9 bicoid (bcd) gen... 42 1.6
146gb|AY754438.1| Drosophila miranda strain 0101.7 bicoid (bcd) gen... 42 1.6
147gb|AY754437.1| Drosophila miranda strain 0101.5 bicoid (bcd) gen... 42 1.6
148gb|AY754436.1| Drosophila miranda strain 0101.4 bicoid (bcd) gen... 42 1.6
149gb|AY754435.1| Drosophila miranda strain 0101.3 bicoid (bcd) gen... 42 1.6
150gb|AY754434.1| Drosophila pseudoobscura bicoid (bcd) gene, exons... 42 1.6
151emb|BX663609.29| Zebrafish DNA sequence from clone DKEY-182H7 in... 42 1.6
152gb|AE003705.3| Drosophila melanogaster chromosome 3R, section 43... 42 1.6
153gb|AE003523.3| Drosophila melanogaster chromosome 3L, section 62... 42 1.6
154gb|AE003490.3| Drosophila melanogaster chromosome X, section 42 ... 42 1.6
155emb|BX571856.1| Staphylococcus aureus subsp. aureus strain MRSA2... 42 1.6
156dbj|AP001972.4| Homo sapiens genomic DNA, chromosome 11q, clone:... 42 1.6
157gb|DQ314865.1| Homo sapiens arrestin, beta 1 (ARRB1) gene, compl... 42 1.6
158gb|AC140409.3| Mus musculus BAC clone RP23-138K22 from 9, comple... 42 1.6
159gb|AC090955.3| Homo sapiens chromosome 3 clone RP11-622A14 map 3... 42 1.6
160emb|AL845161.5| Mouse DNA sequence from clone RP23-214I20 on chr... 42 1.6
161emb|AL928639.5| Mouse DNA sequence from clone RP23-446O17 on chr... 42 1.6
162emb|X97283.1|GCINTALPH G.cydonium mRNA for integrin alpha subunit 42 1.6
163gb|AC021999.5| Homo sapiens chromosome 3 clone RP11-129J10 map 3... 42 1.6
164gb|AY830454.1| Petromyzon marinus SoxF (SoxF) mRNA, complete cds 40 6.3
165gb|AC159998.6| Mus musculus BAC clone RP24-576J22 from chromosom... 40 6.3
166gb|AC006259.1| Arabidopsis thaliana BAC F21J6 from chromosome V,... 40 6.3
167gb|AE014832.1| Plasmodium falciparum 3D7 chromosome 10 section 4... 40 6.3
168gb|AC005964.1| Arabidopsis thaliana chromosome V map 60.5 cM, co... 40 6.3
169ref|XM_368359.1| Magnaporthe grisea 70-15 chromosome VI hypothet... 40 6.3
170gb|AC134348.2| Oryza sativa (japonica cultivar-group) chromosome... 40 6.3
171ref|XM_453868.1| Kluyveromyces lactis NRRL Y-1140, KLLA0D18238g ... 40 6.3
172gb|AY176327.1| Staphylococcus phage K, complete genome 40 6.3
173ref|XM_549330.2| PREDICTED: Canis familiaris similar to CG1 prot... 40 6.3
174gb|AC132378.3| Mus musculus BAC clone RP23-407N22 from chromosom... 40 6.3
175gb|AC113031.11| Mus musculus chromosome 14, clone RP23-220B20, c... 40 6.3
176emb|CR954256.1| Anopheles gambiae Pen-1 region; BAC clones 30N20... 40 6.3
177gb|AC137948.12| Mus musculus chromosome 1, clone RP23-393D20, co... 40 6.3
178ref|XM_815541.1| Trypanosoma cruzi strain CL Brener mucin-associ... 40 6.3
179ref|XM_815553.1| Trypanosoma cruzi strain CL Brener mucin-associ... 40 6.3
180gb|AC121791.3| Mus musculus BAC clone RP23-401H19 from chromosom... 40 6.3
181gb|AY225852.2| Ctenopharyngodon idella CBP/p300-interacting tran... 40 6.3
182ref|XM_950044.1| Theileria annulata strain Ankara hypothetical p... 40 6.3
183gb|AY060464.1| Drosophila melanogaster SD04616 full insert cDNA 40 6.3
184gb|AC136716.12| Mus musculus, clone RP23-42E21, complete sequence 40 6.3
185emb|AL391989.9| Human DNA sequence from clone RP11-388E20 on chr... 40 6.3
186gb|BT010312.1| Drosophila melanogaster AT29286 full insert cDNA 40 6.3
187emb|AL353700.14| Human DNA sequence from clone RP3-350J21 on chr... 40 6.3
188gb|AC023714.5| Drosophila melanogaster X BAC RP98-19D19 (Roswell... 40 6.3
189emb|CR382124.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso... 40 6.3
190gb|AC132401.4| Mus musculus BAC clone RP23-404A8 from chromosome... 40 6.3
191emb|AJ308118.2|LFL308118 Lampetra fluviatilis mRNA for type I ke... 40 6.3
192gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome 40 6.3
193gb|AC104626.3| Drosophila melanogaster X BAC RP98-28L7 (Roswell ... 40 6.3
194gb|AC010557.4| Drosophila melanogaster 3L BAC RP98-9E21 (Roswell... 40 6.3
195gb|AY119550.1| Drosophila melanogaster GH27233 full insert cDNA 40 6.3
196gb|AY119466.1| Drosophila melanogaster GH03957 full insert cDNA 40 6.3
197gb|AC104510.6| Drosophila melanogaster X BAC RP98-26J12 (Roswell... 40 6.3
198ref|NM_206288.1| Drosophila melanogaster CG33277-PA (CG33277) mR... 40 6.3
199ref|NM_206622.2| Drosophila melanogaster CG32776-RB, transcript ... 40 6.3
200ref|NM_206150.1| Drosophila melanogaster CG30460-RB, transcript ... 40 6.3
201ref|NM_206149.1| Drosophila melanogaster CG30460-RA, transcript ... 40 6.3
202ref|NM_206148.1| Drosophila melanogaster CG30460-RD, transcript ... 40 6.3
203gb|AC067793.9| Homo sapiens chromosome 15, clone RP11-552D14, co... 40 6.3
204ref|NM_167277.1| Drosophila melanogaster CG11105-RA, transcript ... 40 6.3
205ref|NM_137342.2| Drosophila melanogaster CG30460-RC, transcript ... 40 6.3
206ref|NM_132471.1| Drosophila melanogaster CG11105-RB, transcript ... 40 6.3
207ref|NM_057659.2| Drosophila melanogaster Dopamine receptor CG965... 40 6.3
208ref|NM_001038740.1| Drosophila melanogaster CG32776-RD, transcri... 40 6.3
209gb|AC008631.6| Homo sapiens chromosome 5 clone CTB-163B16, compl... 40 6.3
210gb|AC099032.1| Drosophila melanogaster, chromosome 2R, region 53... 40 6.3
211emb|AJ586737.2| Drosophila virilis partial mod(mdg4) gene 40 6.3
212emb|BX000999.9| Zebrafish DNA sequence from clone DKEY-77F5 in l... 40 6.3
213dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.3
214gb|AC114738.4| Homo sapiens BAC clone CTD-2192M1 from 4, complet... 40 6.3
215gb|AC007904.6|AC007904 Drosophila melanogaster, chromosome 3R, r... 40 6.3
216gb|AC095046.3| Homo sapiens BAC clone RP11-147K21 from 4, comple... 40 6.3
217gb|AC016759.11| Homo sapiens BAC clone RP11-535J8 from 2, comple... 40 6.3
218gb|AC154664.2| Mus musculus BAC clone RP24-284G3 from chromosome... 40 6.3
219gb|AC093784.3| Homo sapiens BAC clone RP11-211K17 from 2, comple... 40 6.3
220gb|CP000252.1| Syntrophus aciditrophicus SB, complete genome 40 6.3
221gb|AY954969.1| Bacteriophage G1, complete genome 40 6.3
222gb|AC107209.4| Homo sapiens BAC clone RP11-4F12 from 2, complete... 40 6.3
223dbj|AP004399.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.3
224gb|DQ020489.1| Sus scrofa clone BAC KNP_992H3, complete sequence 40 6.3
225dbj|AK106046.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.3
226gb|AC154663.2| Mus musculus BAC clone RP24-283H12 from 16, compl... 40 6.3
227emb|BX897729.6| Zebrafish DNA sequence from clone DKEY-240A12 in... 40 6.3
228emb|X97073.1|AOLECTIN A.oligospora gene encoding lectin 40 6.3
229gb|AE003703.3| Drosophila melanogaster chromosome 3R, section 41... 40 6.3
230gb|AE003804.4| Drosophila melanogaster chromosome 2R, section 46... 40 6.3
231gb|AC005717.2|AC005717 Drosophila melanogaster, chromosome 2R, r... 40 6.3
232gb|AE003559.3| Drosophila melanogaster chromosome 3L, section 26... 40 6.3
233gb|AE003485.3| Drosophila melanogaster chromosome X, section 37 ... 40 6.3
234gb|AE003429.4| Drosophila melanogaster chromosome X, section 13 ... 40 6.3
235emb|AL158058.5|CNS01RGJ Human chromosome 14 DNA sequence BAC R-2... 40 6.3
236gb|AC104867.18| Mus musculus chromosome 18, clone RP24-320L19, c... 40 6.3
237gb|AC124095.7| Mus musculus chromosome 1, clone RP23-245G9, comp... 40 6.3
238gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome 40 6.3
239emb|AL772258.9| Mouse DNA sequence from clone RP23-337P24 on chr... 40 6.3
240emb|AL133166.3|CNS01DU6 Human chromosome 14 DNA sequence BAC C-2... 40 6.3
241emb|AL928923.8| Mouse DNA sequence from clone RP23-472B12 on chr... 40 6.3
242gb|AC152974.1| Oryza sativa (japonica cultivar-group) chromosome... 40 6.3
243emb|X77234.1|DMDOPREC D.melanogaster mRNA for dopamine receptor 40 6.3
244dbj|AP005117.2| Homo sapiens genomic DNA, chromosome 18p clone:R... 40 6.3

>gb|AC104283.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1607_F09,
             complete sequence
          Length = 95755

 Score =  113 bits (57), Expect = 5e-22
 Identities = 99/113 (87%)
 Strand = Plus / Minus

                                                                         
Query: 319   aaaacaaaaagagttacgagagtggaactgaacaaaagggctcgtcgtaaagagaggtta 378
             ||||| ||||||||||| ||||| |||||||||||||| ||||||||||| |||||||||
Sbjct: 50102 aaaacgaaaagagttacaagagtagaactgaacaaaagagctcgtcgtaaggagaggtta 50043

                                                                  
Query: 379   aggacagaagcagatgcaaagaaactggaagttctttcaaagcaaatagatag 431
             ||  ||||||| || ||||||||  |||||  |||||||||| ||||||||||
Sbjct: 50042 agagcagaagctgaagcaaagaagatggaaaatctttcaaaggaaatagatag 49990



 Score =  103 bits (52), Expect = 5e-19
 Identities = 97/112 (86%)
 Strand = Plus / Minus

                                                                         
Query: 95    aggatgctcttgctctagccgttgctgatgaaatgcgcaagatctacacgaaagagttag 154
             ||||| ||||||||| ||| ||||||||||| ||||| || |||||||||||||||||||
Sbjct: 51094 aggattctcttgctcaagctgttgctgatgagatgcgtaaaatctacacgaaagagttag 51035

                                                                 
Query: 155   gccccacaccagtgccacttactgttcttggtcaagcagtagctgaagaaga 206
             | |||| ||| |||||||||| ||||| |||| ||||| |  ||||||||||
Sbjct: 51034 ggcccaaacctgtgccacttattgttcctggtgaagcaatcactgaagaaga 50983



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 57/63 (90%), Gaps = 1/63 (1%)
 Strand = Plus / Minus

                                                                         
Query: 14    aggtctaccacatctgtgattcctgcggttgaagttgagcctcaagggatgttcatttaa 73
             ||||||||| |||||||||||||||| |||||||||||| | | | ||||||||||||||
Sbjct: 51296 aggtctaccgcatctgtgattcctgctgttgaagttgaggcccca-ggatgttcatttaa 51238

                
Query: 74    tcc 76
             |||
Sbjct: 51237 tcc 51235



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                             
Query: 249   tgatggagatgtagatgctgcagaaggcgatggagaccaggatgctga 296
             ||||||||||| || || || |||||| |||| |||||||| ||||||
Sbjct: 50644 tgatggagatgaagctgttgaagaaggtgatgaagaccaggctgctga 50597



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
               sequence
          Length = 29737217

 Score =  113 bits (57), Expect = 5e-22
 Identities = 99/113 (87%)
 Strand = Plus / Minus

                                                                           
Query: 319     aaaacaaaaagagttacgagagtggaactgaacaaaagggctcgtcgtaaagagaggtta 378
               ||||| ||||||||||| ||||| |||||||||||||| ||||||||||| |||||||||
Sbjct: 2483080 aaaacgaaaagagttacaagagtagaactgaacaaaagagctcgtcgtaaggagaggtta 2483021

                                                                    
Query: 379     aggacagaagcagatgcaaagaaactggaagttctttcaaagcaaatagatag 431
               ||  ||||||| || ||||||||  |||||  |||||||||| ||||||||||
Sbjct: 2483020 agagcagaagctgaagcaaagaagatggaaaatctttcaaaggaaatagatag 2482968



 Score =  103 bits (52), Expect = 5e-19
 Identities = 97/112 (86%)
 Strand = Plus / Minus

                                                                           
Query: 95      aggatgctcttgctctagccgttgctgatgaaatgcgcaagatctacacgaaagagttag 154
               ||||| ||||||||| ||| ||||||||||| ||||| || |||||||||||||||||||
Sbjct: 2484072 aggattctcttgctcaagctgttgctgatgagatgcgtaaaatctacacgaaagagttag 2484013

                                                                   
Query: 155     gccccacaccagtgccacttactgttcttggtcaagcagtagctgaagaaga 206
               | |||| ||| |||||||||| ||||| |||| ||||| |  ||||||||||
Sbjct: 2484012 ggcccaaacctgtgccacttattgttcctggtgaagcaatcactgaagaaga 2483961



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 57/63 (90%), Gaps = 1/63 (1%)
 Strand = Plus / Minus

                                                                           
Query: 14      aggtctaccacatctgtgattcctgcggttgaagttgagcctcaagggatgttcatttaa 73
               ||||||||| |||||||||||||||| |||||||||||| | | | ||||||||||||||
Sbjct: 2484274 aggtctaccgcatctgtgattcctgctgttgaagttgaggcccca-ggatgttcatttaa 2484216

                  
Query: 74      tcc 76
               |||
Sbjct: 2484215 tcc 2484213



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 305      ctggagagaggaagaaaacaaaaa 328
                ||||||||| ||||||||||||||
Sbjct: 17032505 ctggagagaagaagaaaacaaaaa 17032482



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                               
Query: 249     tgatggagatgtagatgctgcagaaggcgatggagaccaggatgctga 296
               ||||||||||| || || || |||||| |||| |||||||| ||||||
Sbjct: 2483622 tgatggagatgaagctgttgaagaaggtgatgaagaccaggctgctga 2483575



to top

>gb|AY108180.1| Zea mays PCO134590 mRNA sequence
          Length = 1538

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 120/147 (81%)
 Strand = Plus / Plus

                                                                        
Query: 321  aacaaaaagagttacgagagtggaactgaacaaaagggctcgtcgtaaagagaggttaag 380
            ||||||||||||||| ||||| ||| |||||| ||| ||||| || || |||||||||||
Sbjct: 907  aacaaaaagagttacaagagtagaaatgaacagaagagctcgccggaaggagaggttaag 966

                                                                        
Query: 381  gacagaagcagatgcaaagaaactggaagttctttcaaagcaaatagatagcttgccaaa 440
              |||||||  | ||||||||| |||||  | |||  ||  |||| || |||||||||||
Sbjct: 967  agcagaagcgaaagcaaagaaaatggaaaatattttgaaagaaattgacagcttgccaaa 1026

                                       
Query: 441  tatattagaggagatagcgaaagagga 467
            |||| | || |||||||| ||||||||
Sbjct: 1027 tataatggatgagatagctaaagagga 1053



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 158/195 (81%), Gaps = 2/195 (1%)
 Strand = Plus / Plus

                                                                       
Query: 32  attcctgcggttgaagttgagcctcaagggatgttcatttaatcctccacatgaagccca 91
           |||||||| |||||||||||||||  ||| ||||||||||||||| |||   ||||| ||
Sbjct: 635 attcctgctgttgaagttgagcctgcagg-atgttcatttaatcccccattcgaagcgca 693

                                                                       
Query: 92  tcaaggatgctcttgctctagccgttgctgatgaaatgcgcaagatctacacgaaagagt 151
           ||||| || ||||||||| ||| || || |||||||  |||||    |||| ||||||| 
Sbjct: 694 tcaag-attctcttgctcaagctgtagcagatgaaaaacgcaaagagtacatgaaagagc 752

                                                                       
Query: 152 taggccccacaccagtgccacttactgttcttggtcaagcagtagctgaagaagacaaat 211
           | || || ||||| || ||||| |  |||| |||| ||||  |||| |||||||| ||||
Sbjct: 753 tggggccaacacctgtaccactcatagttcctggtgaagctatagccgaagaagataaat 812

                          
Query: 212 tttttcttgatgctg 226
           |||||||||||||||
Sbjct: 813 tttttcttgatgctg 827



to top

>gb|AC125291.3| Drosophila melanogaster X BAC CH221-17A11 (CHORI Sheared BAC Drosophila
              melanogaster library) complete sequence
          Length = 166613

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                            
Query: 240    tgctgctgctgatggagatgtagatgctgc 269
              ||||||||||||||||||||||| ||||||
Sbjct: 160270 tgctgctgctgatggagatgtagttgctgc 160241



to top

>gb|AC023723.4| Drosophila melanogaster X BAC RP98-48E6 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 179363

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                           
Query: 240   tgctgctgctgatggagatgtagatgctgc 269
             ||||||||||||||||||||||| ||||||
Sbjct: 23527 tgctgctgctgatggagatgtagttgctgc 23498



to top

>gb|AC023709.4| Drosophila melanogaster X BAC RP98-10I17 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 163710

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                            
Query: 240    tgctgctgctgatggagatgtagatgctgc 269
              ||||||||||||||||||||||| ||||||
Sbjct: 121574 tgctgctgctgatggagatgtagttgctgc 121545



to top

>ref|NM_132412.1| Drosophila melanogaster CG9817-RA (CG9817), mRNA
          Length = 6497

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                          
Query: 240  tgctgctgctgatggagatgtagatgctgc 269
            ||||||||||||||||||||||| ||||||
Sbjct: 2858 tgctgctgctgatggagatgtagttgctgc 2829



to top

>gb|AE003451.5| Drosophila melanogaster chromosome X, section 35 of 74 of the complete
              sequence
          Length = 285729

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                            
Query: 240    tgctgctgctgatggagatgtagatgctgc 269
              ||||||||||||||||||||||| ||||||
Sbjct: 121172 tgctgctgctgatggagatgtagttgctgc 121201



to top

>ref|XM_638141.1| Dictyostelium discoideum hypothetical protein (DDB0217783), partial
            mRNA
          Length = 3012

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 238  gatgctgctgctgatggagatgta 261
            ||||||||||||||||||||||||
Sbjct: 2630 gatgctgctgctgatggagatgta 2607



to top

>gb|AC154910.3| Mus musculus BAC clone RP23-70L9 from chromosome 12, complete
            sequence
          Length = 243671

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                
Query: 219  tgatgctgctgatgatggagatgctgctgctgatgg 254
            ||||| || ||||||||| |||||||||||||||||
Sbjct: 4065 tgatggtgatgatgatggtgatgctgctgctgatgg 4030



to top

>gb|AC116924.3| Dictyostelium discoideum chromosome 2 map 6357117-6445670 strain AX4,
            complete sequence
          Length = 88549

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 238  gatgctgctgctgatggagatgta 261
            ||||||||||||||||||||||||
Sbjct: 5055 gatgctgctgctgatggagatgta 5078



to top

>gb|AC122029.4| Mus musculus BAC clone RP24-400A11 from chromosome 12, complete sequence
          Length = 139357

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                  
Query: 219    tgatgctgctgatgatggagatgctgctgctgatgg 254
              ||||| || ||||||||| |||||||||||||||||
Sbjct: 120639 tgatggtgatgatgatggtgatgctgctgctgatgg 120604



to top

>gb|AC137155.3| Mus musculus BAC clone RP23-66E11 from 12, complete sequence
          Length = 211064

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                 
Query: 219   tgatgctgctgatgatggagatgctgctgctgatgg 254
             ||||| || ||||||||| |||||||||||||||||
Sbjct: 92730 tgatggtgatgatgatggtgatgctgctgctgatgg 92695



to top

>ref|NM_033448.1| Homo sapiens keratin 6 irs (KRT6IRS), mRNA
          Length = 2255

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 222  tgctgctgatgatggagatgctg 244
            |||||||||||||||||||||||
Sbjct: 1417 tgctgctgatgatggagatgctg 1395



to top

>gb|BC103918.1| Homo sapiens keratin 6 irs, mRNA (cDNA clone MGC:119391
            IMAGE:40006781), complete cds
          Length = 1921

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 222  tgctgctgatgatggagatgctg 244
            |||||||||||||||||||||||
Sbjct: 1395 tgctgctgatgatggagatgctg 1373



to top

>gb|BC103917.1| Homo sapiens keratin 6 irs, mRNA (cDNA clone MGC:119390
            IMAGE:40006780), complete cds
          Length = 1921

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 222  tgctgctgatgatggagatgctg 244
            |||||||||||||||||||||||
Sbjct: 1395 tgctgctgatgatggagatgctg 1373



to top

>ref|XM_637697.1| Dictyostelium discoideum hypothetical protein (DDB0217964), partial
           mRNA
          Length = 1035

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 219 tgatgctgctgatgatggagatgctgctgctgatg 253
           |||||||||||||||||  |||||||||| |||||
Sbjct: 786 tgatgctgctgatgatgatgatgctgctgatgatg 752



to top

>ref|XM_509079.1| PREDICTED: Pan troglodytes similar to keratin 6 irs (LOC451919), mRNA
          Length = 3921

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 222  tgctgctgatgatggagatgctg 244
            |||||||||||||||||||||||
Sbjct: 1450 tgctgctgatgatggagatgctg 1428



to top

>ref|XM_611783.2| PREDICTED: Bos taurus similar to keratin 6 irs (LOC532644), mRNA
          Length = 1758

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 222  tgctgctgatgatggagatgctg 244
            |||||||||||||||||||||||
Sbjct: 1381 tgctgctgatgatggagatgctg 1359



to top

>gb|AC116977.2| Dictyostelium discoideum chromosome 2 map 5515173-5817331 strain AX4,
              complete sequence
          Length = 302156

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                 
Query: 219    tgatgctgctgatgatggagatgctgctgctgatg 253
              |||||||||||||||||  |||||||||| |||||
Sbjct: 278529 tgatgctgctgatgatgatgatgctgctgatgatg 278495



to top

>emb|AL596210.20| Human DNA sequence from clone RP11-92O17 on chromosome 1 Contains part
             of the CAMTA1 gene for calmodulin binding transcription
             activator 1, complete sequence
          Length = 107112

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 228   tgatgatggagatgctgctgctgatgg 254
             ||||||||| |||||||||||||||||
Sbjct: 16011 tgatgatggtgatgctgctgctgatgg 15985



to top

>ref|XM_502474.1| Yarrowia lipolytica CLIB122, YALI0D06193g predicted mRNA
          Length = 1944

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 219 tgatgctgctgatgatggagatgctgctgctgatg 253
           |||||||||||||| ||  ||||||||||||||||
Sbjct: 440 tgatgctgctgatgctgttgatgctgctgctgatg 406



to top

>gb|BT009932.1| Drosophila melanogaster SD08871 full insert cDNA
          Length = 4382

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                           
Query: 220  gatgctgctgatgatggagatgctgctgctg 250
            |||||||||| |||||||| |||||||||||
Sbjct: 3712 gatgctgctgctgatggagctgctgctgctg 3682



to top

>emb|AJ308599.1|HSA308599 Homo sapiens mRNA for keratin 6 irs (KRT6IRS gene)
          Length = 2255

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 222  tgctgctgatgatggagatgctg 244
            |||||||||||||||||||||||
Sbjct: 1417 tgctgctgatgatggagatgctg 1395



to top

>emb|CR858130.1| Pongo pygmaeus mRNA; cDNA DKFZp468M2112 (from clone DKFZp468M2112)
          Length = 2283

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 222  tgctgctgatgatggagatgctg 244
            |||||||||||||||||||||||
Sbjct: 1446 tgctgctgatgatggagatgctg 1424



to top

>gb|AC023722.4| Drosophila melanogaster X BAC RP98-48O24 (Roswell Park Cancer
            Institute Drosophila BAC Library) complete sequence
          Length = 191590

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                           
Query: 220  gatgctgctgatgatggagatgctgctgctg 250
            |||||||||| |||||||| |||||||||||
Sbjct: 4323 gatgctgctgctgatggagctgctgctgctg 4353



to top

>gb|AC023699.4| Drosophila melanogaster X BAC RP98-11K20 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 177941

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                             
Query: 220    gatgctgctgatgatggagatgctgctgctg 250
              |||||||||| |||||||| |||||||||||
Sbjct: 108427 gatgctgctgctgatggagctgctgctgctg 108457



to top

>dbj|AK122795.1| Homo sapiens cDNA FLJ16362 fis, clone THYMU2030912, highly  similar
            to Mus musculus mRNA for type II cytokeratin
          Length = 2264

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 222  tgctgctgatgatggagatgctg 244
            |||||||||||||||||||||||
Sbjct: 1445 tgctgctgatgatggagatgctg 1423



to top

>ref|NM_132114.1| Drosophila melanogaster CG14442-RA (CG14442), mRNA
          Length = 4747

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                           
Query: 220  gatgctgctgatgatggagatgctgctgctg 250
            |||||||||| |||||||| |||||||||||
Sbjct: 3967 gatgctgctgctgatggagctgctgctgctg 3937



to top

>gb|AF113024.1|AF113024 Cyprinodon diabolis microsatellite C275 sequence
          Length = 300

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 219 tgatgctgctgatgatggagatgctgctgctgatg 253
           |||||||||||||||||  |||| |||||||||||
Sbjct: 215 tgatgctgctgatgatgatgatgatgctgctgatg 181



to top

>gb|AE003438.3| Drosophila melanogaster chromosome X, section 22 of 74 of the complete
              sequence
          Length = 299943

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                             
Query: 220    gatgctgctgatgatggagatgctgctgctg 250
              |||||||||| |||||||| |||||||||||
Sbjct: 150314 gatgctgctgctgatggagctgctgctgctg 150344



to top

>emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB122 of Yarrowia lipolytica
          Length = 3633272

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                 
Query: 219    tgatgctgctgatgatggagatgctgctgctgatg 253
              |||||||||||||| ||  ||||||||||||||||
Sbjct: 794763 tgatgctgctgatgctgttgatgctgctgctgatg 794729



to top

>emb|AJ308600.1|HSA308600 Homo sapiens partial mRNA for nonsensical transcript of keratin 6 irs
            (KRT6IRS gene), clone scl204
          Length = 2153

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 222  tgctgctgatgatggagatgctg 244
            |||||||||||||||||||||||
Sbjct: 1324 tgctgctgatgatggagatgctg 1302



to top

>ref|XM_855259.1| PREDICTED: Canis familiaris similar to Keratin, type II cytoskeletal
            5 (Cytokeratin 5) (K5) (CK 5) (58 kDa cytokeratin),
            transcript variant 20 (LOC486522), mRNA
          Length = 3250

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 223  gctgctgatgatggagatgctg 244
            ||||||||||||||||||||||
Sbjct: 1380 gctgctgatgatggagatgctg 1359



to top

>ref|XM_855231.1| PREDICTED: Canis familiaris similar to Keratin, type II cytoskeletal
            5 (Cytokeratin 5) (K5) (CK 5) (58 kDa cytokeratin),
            transcript variant 19 (LOC486522), mRNA
          Length = 3229

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 223  gctgctgatgatggagatgctg 244
            ||||||||||||||||||||||
Sbjct: 1380 gctgctgatgatggagatgctg 1359



to top

>ref|XM_855192.1| PREDICTED: Canis familiaris similar to Keratin, type II cytoskeletal
            5 (Cytokeratin 5) (K5) (CK 5) (58 kDa cytokeratin),
            transcript variant 18 (LOC486522), mRNA
          Length = 3131

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 223  gctgctgatgatggagatgctg 244
            ||||||||||||||||||||||
Sbjct: 1380 gctgctgatgatggagatgctg 1359



to top

>ref|XM_543648.2| PREDICTED: Canis familiaris similar to Keratin, type II cytoskeletal
            5 (Cytokeratin 5) (K5) (CK 5) (58 kDa cytokeratin),
            transcript variant 1 (LOC486522), mRNA
          Length = 2639

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 223  gctgctgatgatggagatgctg 244
            ||||||||||||||||||||||
Sbjct: 1380 gctgctgatgatggagatgctg 1359



to top

>ref|XM_855095.1| PREDICTED: Canis familiaris similar to Keratin, type II cytoskeletal
            5 (Cytokeratin 5) (K5) (CK 5) (58 kDa cytokeratin),
            transcript variant 16 (LOC486522), mRNA
          Length = 3271

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 223  gctgctgatgatggagatgctg 244
            ||||||||||||||||||||||
Sbjct: 1380 gctgctgatgatggagatgctg 1359



to top

>ref|XM_855013.1| PREDICTED: Canis familiaris similar to Keratin, type II cytoskeletal
            5 (Cytokeratin 5) (K5) (CK 5) (58 kDa cytokeratin),
            transcript variant 14 (LOC486522), mRNA
          Length = 3286

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 223  gctgctgatgatggagatgctg 244
            ||||||||||||||||||||||
Sbjct: 1380 gctgctgatgatggagatgctg 1359



to top

>ref|XM_854944.1| PREDICTED: Canis familiaris similar to Keratin, type II cytoskeletal
            5 (Cytokeratin 5) (K5) (CK 5) (58 kDa cytokeratin),
            transcript variant 12 (LOC486522), mRNA
          Length = 2368

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 223  gctgctgatgatggagatgctg 244
            ||||||||||||||||||||||
Sbjct: 1380 gctgctgatgatggagatgctg 1359



to top

>ref|XM_854908.1| PREDICTED: Canis familiaris similar to Keratin, type II cytoskeletal
            5 (Cytokeratin 5) (K5) (CK 5) (58 kDa cytokeratin),
            transcript variant 11 (LOC486522), mRNA
          Length = 3187

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 223  gctgctgatgatggagatgctg 244
            ||||||||||||||||||||||
Sbjct: 1380 gctgctgatgatggagatgctg 1359



to top

>ref|XM_854761.1| PREDICTED: Canis familiaris similar to Keratin, type II cytoskeletal
            5 (Cytokeratin 5) (K5) (CK 5) (58 kDa cytokeratin),
            transcript variant 7 (LOC486522), mRNA
          Length = 2868

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 223  gctgctgatgatggagatgctg 244
            ||||||||||||||||||||||
Sbjct: 1380 gctgctgatgatggagatgctg 1359



to top

>ref|XM_854730.1| PREDICTED: Canis familiaris similar to Keratin, type II cytoskeletal
            5 (Cytokeratin 5) (K5) (CK 5) (58 kDa cytokeratin),
            transcript variant 6 (LOC486522), mRNA
          Length = 1578

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 223  gctgctgatgatggagatgctg 244
            ||||||||||||||||||||||
Sbjct: 1380 gctgctgatgatggagatgctg 1359



to top

>ref|XM_854630.1| PREDICTED: Canis familiaris similar to Keratin, type II cytoskeletal
            5 (Cytokeratin 5) (K5) (CK 5) (58 kDa cytokeratin),
            transcript variant 3 (LOC486522), mRNA
          Length = 3283

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 223  gctgctgatgatggagatgctg 244
            ||||||||||||||||||||||
Sbjct: 1380 gctgctgatgatggagatgctg 1359



to top

>gb|AC138739.8| Mus musculus chromosome 9, clone RP23-380A10, complete sequence
          Length = 217813

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 251   atggagatgtagatgctgcaga 272
             ||||||||||||||||||||||
Sbjct: 73098 atggagatgtagatgctgcaga 73119



to top

>emb|BX041769.1|CNS094E5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC13BF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 851

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 221 atgctgctgatgatggagatgctgctgctg 250
           |||||| ||||||||| |||||||||||||
Sbjct: 453 atgctgatgatgatggcgatgctgctgctg 482



to top

>emb|BX041768.1|CNS094E4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC13BF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 949

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 221 atgctgctgatgatggagatgctgctgctg 250
           |||||| ||||||||| |||||||||||||
Sbjct: 502 atgctgatgatgatggcgatgctgctgctg 473



to top

>emb|BX005022.7| Zebrafish DNA sequence from clone DKEY-6N21 in linkage group 7,
             complete sequence
          Length = 217582

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 209   aattttttcttgatgctgctgatgat 234
             ||||||||||||||||| ||||||||
Sbjct: 13765 aattttttcttgatgctcctgatgat 13790



to top

>emb|AL807778.10| Mouse DNA sequence from clone RP23-198G1 on chromosome 2, complete
             sequence
          Length = 203518

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 36/40 (90%), Gaps = 3/40 (7%)
 Strand = Plus / Plus

                                                     
Query: 224   ctgctgatgatggagatg---ctgctgctgatggagatgt 260
             |||||| |||||||||||   |||||||||||||||||||
Sbjct: 55210 ctgctgctgatggagatgtctctgctgctgatggagatgt 55249



to top

>gb|CP000096.1| Pelodictyon luteolum DSM 273, complete genome
          Length = 2364842

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 274     ggcgatggagaccaggatgctgact 298
               |||||||||||||||||||| ||||
Sbjct: 1361582 ggcgatggagaccaggatgccgact 1361558



to top

>gb|AC107823.11| Mus musculus chromosome 8, clone RP23-184K1, complete sequence
          Length = 190966

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 5    aataaaaataggtctaccaca 25
            |||||||||||||||||||||
Sbjct: 7165 aataaaaataggtctaccaca 7145



to top

>gb|AC007928.7| Drosophila melanogaster clone BACR04O02, complete sequence
          Length = 176395

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 114   cgttgctgatgaaatgcgcaa 134
             |||||||||||||||||||||
Sbjct: 66330 cgttgctgatgaaatgcgcaa 66350



to top

>ref|XM_419682.1| PREDICTED: Gallus gallus similar to mitochondrial translational
            release factor 1-like (LOC421643), mRNA
          Length = 1740

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 311  agaggaagaaaacaaaaagag 331
            |||||||||||||||||||||
Sbjct: 1254 agaggaagaaaacaaaaagag 1274



to top

>gb|AC141565.3| Mus musculus BAC clone RP23-160M21 from chromosome 14, complete
            sequence
          Length = 210128

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 386  aagcagatgcaaagaaactgg 406
            |||||||||||||||||||||
Sbjct: 5537 aagcagatgcaaagaaactgg 5557



to top

>gb|AC159994.7| Mus musculus chromosome 7, clone RP23-368F23, complete sequence
          Length = 181238

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 232    gatggagatgctgctgctgat 252
              |||||||||||||||||||||
Sbjct: 145607 gatggagatgctgctgctgat 145627



to top

>gb|AC161884.5| Mus musculus BAC clone RP23-77K23 from chromosome 14, complete sequence
          Length = 243730

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 386    aagcagatgcaaagaaactgg 406
              |||||||||||||||||||||
Sbjct: 212144 aagcagatgcaaagaaactgg 212164



to top

>gb|AC107798.10| Mus musculus chromosome 8, clone RP23-4D24, complete sequence
          Length = 234420

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 5      aataaaaataggtctaccaca 25
              |||||||||||||||||||||
Sbjct: 215472 aataaaaataggtctaccaca 215452



to top

>ref|XM_757360.1| Ustilago maydis 521 hypothetical protein (UM06306.1) partial mRNA
          Length = 4104

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 240  tgctgctgctgatggagatgtagatgctg 268
            |||||||||||||| ||||| ||||||||
Sbjct: 3962 tgctgctgctgatgcagatgcagatgctg 3934



to top

>gb|AC117262.2| Mus musculus BAC clone RP24-537M7 from 2, complete sequence
          Length = 156547

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 310    gagaggaagaaaacaaaaagagtta 334
              ||||||||||||| |||||||||||
Sbjct: 108442 gagaggaagaaaagaaaaagagtta 108418



to top

>emb|AL512449.6| Human DNA sequence from clone RP11-286E7 on chromosome 1 Contains part
             of the RPS6KC1 gene for ribosomal protein S6 kinase 52kDa
             polypeptide 1 and a CpG island, complete sequence
          Length = 176690

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 308   gagagaggaagaaaacaaaaagagt 332
             ||||||||||||||| |||||||||
Sbjct: 69741 gagagaggaagaaaagaaaaagagt 69717



to top

>emb|AL139259.15| Human DNA sequence from clone RP5-861H2 on chromosome 1q41 Contains
             part of a novel gene, complete sequence
          Length = 28489

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 213   ttttcttgatgctgctgatga 233
             |||||||||||||||||||||
Sbjct: 15989 ttttcttgatgctgctgatga 16009



to top

>gb|AY305027.1| Halichoeres tenuispinis estrogen receptor beta mRNA, complete cds
          Length = 2195

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 229 gatgatggagatgctgctgctgatg 253
           |||||||||| ||||||||||||||
Sbjct: 573 gatgatggagctgctgctgctgatg 549



to top

>emb|X55735.1|DPBCD D.pseudoobscura bcd (bicoid) gene involved in anterior positional
            specification during embryogenesis
          Length = 3476

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 222  tgctgctgatgatggagatgctgctgctg 250
            |||||||| |||||||| |||||||||||
Sbjct: 1524 tgctgctgctgatggagctgctgctgctg 1496



to top

>emb|AL591064.11| Mouse DNA sequence from clone RP23-395E18 on chromosome 2, complete
             sequence
          Length = 200078

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 222   tgctgctgatgatggagatgctgctgctg 250
             |||| |||||||||| |||||||||||||
Sbjct: 70125 tgctcctgatgatggtgatgctgctgctg 70097



to top

>gb|AC023741.4| Drosophila melanogaster X BAC RP98-23O9 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 160440

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                              
Query: 222   tgctgctgatgatggagatgctgctgctgatgg 254
             ||||||||||||||  | |||||||||||||||
Sbjct: 90146 tgctgctgatgatgttgctgctgctgctgatgg 90178



to top

>gb|AC104627.8| Drosophila melanogaster X BAC RP98-4A11 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 187921

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                              
Query: 222   tgctgctgatgatggagatgctgctgctgatgg 254
             ||||||||||||||  | |||||||||||||||
Sbjct: 25340 tgctgctgatgatgttgctgctgctgctgatgg 25372



to top

>gb|AC010054.7| Drosophila melanogaster 3L BAC RP98-15E10 (Roswell Park Cancer
             Institute Drosophila BAC Library) complete sequence
          Length = 173109

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 222   tgctgctgatgatggagatgctgctgctg 250
             ||||||||||||||| | |||||||||||
Sbjct: 96733 tgctgctgatgatggtggtgctgctgctg 96761



to top

>ref|NM_167335.1| Drosophila melanogaster Smrter CG4013-RC, transcript variant C (Smr),
            mRNA
          Length = 13475

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                             
Query: 222  tgctgctgatgatggagatgctgctgctgatgg 254
            ||||||||||||||  | |||||||||||||||
Sbjct: 1581 tgctgctgatgatgttgctgctgctgctgatgg 1549



to top

>ref|NM_167334.1| Drosophila melanogaster Smrter CG4013-RB, transcript variant B
           (Smr), mRNA
          Length = 12702

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 222 tgctgctgatgatggagatgctgctgctgatgg 254
           ||||||||||||||  | |||||||||||||||
Sbjct: 808 tgctgctgatgatgttgctgctgctgctgatgg 776



to top

>ref|NM_140744.1| Drosophila melanogaster TORC CG6064-RA (TORC), mRNA
          Length = 2992

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 222  tgctgctgatgatggagatgctgctgctg 250
            ||||||||||||||| | |||||||||||
Sbjct: 1955 tgctgctgatgatggtggtgctgctgctg 1927



to top

>gb|AF375008.1| Oncorhynchus mykiss microsatellite OMM1004 sequence
          Length = 698

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 32/35 (91%), Gaps = 3/35 (8%)
 Strand = Plus / Plus

                                              
Query: 219 tgatgctgctgatgatggagatgctgctgctgatg 253
           ||||||||||||||||   ||||||||||||||||
Sbjct: 141 tgatgctgctgatgat---gatgctgctgctgatg 172



to top

>gb|AF450964.1| Drosophila miranda strain Mather28 bicoid (bcd) gene, partial cds
          Length = 1369

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 752 tgctgctgctgatggagctgctgctgctg 724



to top

>gb|AF450963.1| Drosophila miranda strain MSH38 bicoid (bcd) gene, partial cds
          Length = 1369

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 752 tgctgctgctgatggagctgctgctgctg 724



to top

>gb|AF450962.1| Drosophila persimilis strain Salem bicoid (bcd) gene, partial cds
          Length = 1378

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 749 tgctgctgctgatggagctgctgctgctg 721



to top

>gb|AF450961.1| Drosophila persimilis strain MSH7 bicoid (bcd) gene, partial cds
          Length = 1387

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 758 tgctgctgctgatggagctgctgctgctg 730



to top

>gb|AF450960.1| Drosophila persimilis strain MSH3 bicoid (bcd) gene, partial cds
          Length = 1378

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 749 tgctgctgctgatggagctgctgctgctg 721



to top

>gb|AF450959.1| Drosophila persimilis strain MSH1 bicoid (bcd) gene, partial cds
          Length = 1378

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 749 tgctgctgctgatggagctgctgctgctg 721



to top

>gb|AF450958.1| Drosophila persimilis strain MSH42 bicoid (bcd) gene, partial cds
          Length = 1378

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 749 tgctgctgctgatggagctgctgctgctg 721



to top

>gb|AF450957.1| Drosophila persimilis strain MSH25 bicoid (bcd) gene, partial cds
          Length = 1378

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 749 tgctgctgctgatggagctgctgctgctg 721



to top

>gb|AF450956.1| Drosophila persimilis strain MatherB bicoid (bcd) gene, partial cds
          Length = 1378

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 749 tgctgctgctgatggagctgctgctgctg 721



to top

>gb|AF450955.1| Drosophila persimilis strain MatherG bicoid (bcd) gene, partial cds
          Length = 1378

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 749 tgctgctgctgatggagctgctgctgctg 721



to top

>gb|AF450953.1| Drosophila persimilis strain Mather37 bicoid (bcd) gene, partial
           cds
          Length = 1378

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 749 tgctgctgctgatggagctgctgctgctg 721



to top

>gb|AF450952.1| Drosophila persimilis strain Mather41 bicoid (bcd) gene, partial
           cds
          Length = 1384

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 749 tgctgctgctgatggagctgctgctgctg 721



to top

>gb|AF450951.1| Drosophila persimilis strain Mather27 bicoid (bcd) gene, partial
           cds
          Length = 1378

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 749 tgctgctgctgatggagctgctgctgctg 721



to top

>gb|AF450950.1| Drosophila persimilis strain Mather6 bicoid (bcd) gene, partial cds
          Length = 1378

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 749 tgctgctgctgatggagctgctgctgctg 721



to top

>gb|AF450949.1| Drosophila persimilis strain Mather40 bicoid (bcd) gene, partial
           cds
          Length = 1378

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 749 tgctgctgctgatggagctgctgctgctg 721



to top

>gb|AF450948.1| Drosophila pseudoobscura bogotana strain Potosi3 bicoid (bcd) gene,
           partial cds
          Length = 1372

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 749 tgctgctgctgatggagctgctgctgctg 721



to top

>gb|AF450947.1| Drosophila pseudoobscura bogotana strain Potosi2 bicoid (bcd) gene,
           partial cds
          Length = 1378

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 749 tgctgctgctgatggagctgctgctgctg 721



to top

>gb|AF450946.1| Drosophila pseudoobscura bogotana strain Toro4 bicoid (bcd) gene,
           partial cds
          Length = 1378

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 749 tgctgctgctgatggagctgctgctgctg 721



to top

>gb|AF450945.1| Drosophila pseudoobscura bogotana strain Toro6 bicoid (bcd) gene,
           partial cds
          Length = 1363

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 749 tgctgctgctgatggagctgctgctgctg 721



to top

>gb|AF450944.1| Drosophila pseudoobscura bogotana strain Toro7 bicoid (bcd) gene,
           partial cds
          Length = 1372

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 749 tgctgctgctgatggagctgctgctgctg 721



to top

>gb|AF450943.1| Drosophila pseudoobscura bogotana strain Toro1 bicoid (bcd) gene,
           partial cds
          Length = 1372

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 749 tgctgctgctgatggagctgctgctgctg 721



to top

>gb|AF450942.1| Drosophila pseudoobscura bogotana strain Sutatausa3 bicoid (bcd)
           gene, partial cds
          Length = 1372

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 749 tgctgctgctgatggagctgctgctgctg 721



to top

>gb|AF450941.1| Drosophila pseudoobscura bogotana strain Sutatausa2 bicoid (bcd)
           gene, partial cds
          Length = 1372

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 749 tgctgctgctgatggagctgctgctgctg 721



to top

>gb|AF450940.1| Drosophila pseudoobscura bogotana strain Sutatausa5 bicoid (bcd)
           gene, partial cds
          Length = 1372

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 749 tgctgctgctgatggagctgctgctgctg 721



to top

>gb|AF450939.1| Drosophila pseudoobscura bogotana strain Sutatausa1 bicoid (bcd)
           gene, partial cds
          Length = 1372

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 749 tgctgctgctgatggagctgctgctgctg 721



to top

>gb|AF450938.1| Drosophila pseudoobscura bogotana strain Susa2 bicoid (bcd) gene,
           partial cds
          Length = 1372

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 749 tgctgctgctgatggagctgctgctgctg 721



to top

>gb|AF450937.1| Drosophila pseudoobscura bogotana strain Susa1 bicoid (bcd) gene,
           partial cds
          Length = 1372

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 749 tgctgctgctgatggagctgctgctgctg 721



to top

>gb|AF450936.1| Drosophila pseudoobscura bogotana strain Susa6 bicoid (bcd) gene,
           partial cds
          Length = 1372

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 749 tgctgctgctgatggagctgctgctgctg 721



to top

>gb|AF450935.1| Drosophila pseudoobscura bogotana strain Susa3 bicoid (bcd) gene,
           partial cds
          Length = 1372

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 749 tgctgctgctgatggagctgctgctgctg 721



to top

>gb|AF450934.1| Drosophila pseudoobscura strain MSH21 bicoid (bcd) gene, partial
           cds
          Length = 1378

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 749 tgctgctgctgatggagctgctgctgctg 721



to top

>gb|AF450933.1| Drosophila pseudoobscura strain MSH24 bicoid (bcd) gene, partial
           cds
          Length = 1378

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 749 tgctgctgctgatggagctgctgctgctg 721



to top

>gb|AF450932.1| Drosophila pseudoobscura strain MSH32 bicoid (bcd) gene, partial
           cds
          Length = 1381

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 752 tgctgctgctgatggagctgctgctgctg 724



to top

>gb|AF450931.1| Drosophila pseudoobscura strain MSH9 bicoid (bcd) gene, partial cds
          Length = 1378

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 749 tgctgctgctgatggagctgctgctgctg 721



to top

>gb|AF450930.1| Drosophila pseudoobscura strain MSH10 bicoid (bcd) gene, partial
           cds
          Length = 1378

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 749 tgctgctgctgatggagctgctgctgctg 721



to top

>gb|AF450928.1| Drosophila pseudoobscura strain Mather48 bicoid (bcd) gene, partial
           cds
          Length = 1375

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 749 tgctgctgctgatggagctgctgctgctg 721



to top

>gb|AF450927.1| Drosophila pseudoobscura strain Mather32 bicoid (bcd) gene, partial
           cds
          Length = 1378

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 749 tgctgctgctgatggagctgctgctgctg 721



to top

>gb|AF450926.1| Drosophila pseudoobscura strain Mather17 bicoid (bcd) gene, partial
           cds
          Length = 1378

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 749 tgctgctgctgatggagctgctgctgctg 721



to top

>gb|AF450925.1| Drosophila pseudoobscura strain Mather10 bicoid (bcd) gene, partial
           cds
          Length = 1378

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 749 tgctgctgctgatggagctgctgctgctg 721



to top

>gb|AF450924.1| Drosophila pseudoobscura strain Flagstaff18 bicoid (bcd) gene,
           partial cds
          Length = 1372

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 749 tgctgctgctgatggagctgctgctgctg 721



to top

>gb|AF450923.1| Drosophila pseudoobscura strain Flagstaff16 bicoid (bcd) gene,
           partial cds
          Length = 1372

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 749 tgctgctgctgatggagctgctgctgctg 721



to top

>gb|AF450922.1| Drosophila pseudoobscura strain Flagstaff14 bicoid (bcd) gene,
           partial cds
          Length = 1378

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 749 tgctgctgctgatggagctgctgctgctg 721



to top

>gb|AF450921.1| Drosophila pseudoobscura strain Flagstaff6 bicoid (bcd) gene,
           partial cds
          Length = 1366

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 749 tgctgctgctgatggagctgctgctgctg 721



to top

>gb|AF450919.1| Drosophila pseudoobscura strain AFC12 bicoid (bcd) gene, partial
           cds
          Length = 1378

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 749 tgctgctgctgatggagctgctgctgctg 721



to top

>gb|AF450918.1| Drosophila pseudoobscura strain AFC7 bicoid (bcd) gene, partial cds
          Length = 1372

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 749 tgctgctgctgatggagctgctgctgctg 721



to top

>gb|AF450917.1| Drosophila pseudoobscura strain AFC3 bicoid (bcd) gene, partial cds
          Length = 1372

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 749 tgctgctgctgatggagctgctgctgctg 721



to top

>gb|AF450916.1| Drosophila pseudoobscura strain AF2 bicoid (bcd) gene, partial cds
          Length = 1369

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 752 tgctgctgctgatggagctgctgctgctg 724



to top

>gb|AF450915.1| Drosophila pseudoobscura strain Abajo36 bicoid (bcd) gene, partial
           cds
          Length = 1372

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 749 tgctgctgctgatggagctgctgctgctg 721



to top

>gb|AC009375.8| Drosophila melanogaster 3L BAC RP98-44L18 (Roswell Park Cancer
             Institute Drosophila BAC Library) complete sequence
          Length = 180787

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 222   tgctgctgatgatggagatgctgctgctg 250
             ||||||||||||||| | |||||||||||
Sbjct: 11380 tgctgctgatgatggtggtgctgctgctg 11408



to top

>ref|NM_080536.2| Drosophila melanogaster Smrter CG4013-RA, transcript variant A
           (Smr), mRNA
          Length = 12622

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 222 tgctgctgatgatggagatgctgctgctgatgg 254
           ||||||||||||||  | |||||||||||||||
Sbjct: 728 tgctgctgatgatgttgctgctgctgctgatgg 696



to top

>gb|AC011454.6|AC011454 Homo sapiens chromosome 19 clone CTC-347E6, complete sequence
          Length = 163120

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 219    tgatgctgctgatgatggagatgctgctg 247
              |||||||||||||||||| |||| |||||
Sbjct: 129822 tgatgctgctgatgatggtgatgatgctg 129850



to top

>gb|AF320180.1|AF320180 Drosophila miranda strain MSH38 bicoid (bcd) gene, partial cds
          Length = 60

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 53  tgctgctgctgatggagctgctgctgctg 25



to top

>gb|AF320179.1|AF320179 Drosophila persimilis strain MatherB bicoid (bcd) gene, partial cds
          Length = 57

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 50  tgctgctgctgatggagctgctgctgctg 22



to top

>gb|AF320178.1|AF320178 Drosophila persimilis strain Mather27 bicoid (bcd) gene, partial
           cds
          Length = 57

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 50  tgctgctgctgatggagctgctgctgctg 22



to top

>gb|AF320177.1|AF320177 Drosophila persimilis strain Salem bicoid (bcd) gene, partial cds
          Length = 57

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 50  tgctgctgctgatggagctgctgctgctg 22



to top

>gb|AF320176.1|AF320176 Drosophila persimilis strain MSH25 bicoid (bcd) gene, partial cds
          Length = 57

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 50  tgctgctgctgatggagctgctgctgctg 22



to top

>gb|AF320175.1|AF320175 Drosophila persimilis strain MSH3 bicoid (bcd) gene, partial cds
          Length = 57

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 50  tgctgctgctgatggagctgctgctgctg 22



to top

>gb|AF320174.1|AF320174 Drosophila persimilis strain Mather40 bicoid (bcd) gene, partial
           cds
          Length = 57

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 50  tgctgctgctgatggagctgctgctgctg 22



to top

>gb|AF320173.1|AF320173 Drosophila persimilis strain Mather6 bicoid (bcd) gene, partial cds
          Length = 57

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 50  tgctgctgctgatggagctgctgctgctg 22



to top

>gb|AF320172.1|AF320172 Drosophila pseudoobscura strain Mather48 bicoid (bcd) gene, partial
           cds
          Length = 57

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 50  tgctgctgctgatggagctgctgctgctg 22



to top

>gb|AF320171.1|AF320171 Drosophila pseudoobscura strain Mather32 bicoid (bcd) gene, partial
           cds
          Length = 57

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 50  tgctgctgctgatggagctgctgctgctg 22



to top

>gb|AF320170.1|AF320170 Drosophila pseudoobscura strain Mather17 bicoid (bcd) gene, partial
           cds
          Length = 57

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 50  tgctgctgctgatggagctgctgctgctg 22



to top

>gb|AF320169.1|AF320169 Drosophila pseudoobscura strain Mather10 bicoid (bcd) gene, partial
           cds
          Length = 57

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 50  tgctgctgctgatggagctgctgctgctg 22



to top

>gb|AF320168.1|AF320168 Drosophila pseudoobscura strain AF2 bicoid (bcd) gene, partial cds
          Length = 60

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 53  tgctgctgctgatggagctgctgctgctg 25



to top

>gb|AF320167.1|AF320167 Drosophila pseudoobscura strain Abajo36 bicoid (bcd) gene, partial
           cds
          Length = 60

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 53  tgctgctgctgatggagctgctgctgctg 25



to top

>gb|AC020754.4|AC020754 Homo sapiens chromosome 3 clone RP11-37I4 map 3p, complete sequence
          Length = 161612

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 268    gcagaaggcgatggagaccag 288
              |||||||||||||||||||||
Sbjct: 145816 gcagaaggcgatggagaccag 145836



to top

>gb|AC097628.2| Takifugu rubripes clone 264E2, complete sequence
          Length = 88203

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 222   tgctgctgatgatggagatgctgctgctg 250
             ||||||||||| ||||| |||||||||||
Sbjct: 73887 tgctgctgatggtggagctgctgctgctg 73915



to top

>gb|AY754446.1| Drosophila affinis bicoid (bcd) gene, exons 2, 3 and partial cds
          Length = 1132

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 666 tgctgctgctgatggagttgctgctgctg 638



to top

>gb|AY754445.1| Drosophila miranda strain MSH38 bicoid (bcd) gene, exons 2, 3 and
           partial cds
          Length = 1110

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 662 tgctgctgctgatggagctgctgctgctg 634



to top

>gb|AY754444.1| Drosophila miranda strain MSH22 bicoid (bcd) gene, exons 2, 3 and
           partial cds
          Length = 1109

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 661 tgctgctgctgatggagctgctgctgctg 633



to top

>gb|AY754443.1| Drosophila miranda strain SP235 bicoid (bcd) gene, exons 2, 3 and
           partial cds
          Length = 1115

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 661 tgctgctgctgatggagctgctgctgctg 633



to top

>gb|AY754442.1| Drosophila miranda strain SP138 bicoid (bcd) gene, exons 2, 3 and
           partial cds
          Length = 1115

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 661 tgctgctgctgatggagctgctgctgctg 633



to top

>gb|AY754441.1| Drosophila miranda strain MA32 bicoid (bcd) gene, exons 2, 3 and
           partial cds
          Length = 1115

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 661 tgctgctgctgatggagctgctgctgctg 633



to top

>gb|AY754440.1| Drosophila miranda strain MA28 bicoid (bcd) gene, exons 2, 3 and
           partial cds
          Length = 1115

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 661 tgctgctgctgatggagctgctgctgctg 633



to top

>gb|AY754439.1| Drosophila miranda strain 0101.9 bicoid (bcd) gene, exons 2, 3 and
           partial cds
          Length = 1115

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 661 tgctgctgctgatggagctgctgctgctg 633



to top

>gb|AY754438.1| Drosophila miranda strain 0101.7 bicoid (bcd) gene, exons 2, 3 and
           partial cds
          Length = 1116

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 662 tgctgctgctgatggagctgctgctgctg 634



to top

>gb|AY754437.1| Drosophila miranda strain 0101.5 bicoid (bcd) gene, exons 2, 3 and
           partial cds
          Length = 1116

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 662 tgctgctgctgatggagctgctgctgctg 634



to top

>gb|AY754436.1| Drosophila miranda strain 0101.4 bicoid (bcd) gene, exons 2, 3 and
           partial cds
          Length = 1115

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 661 tgctgctgctgatggagctgctgctgctg 633



to top

>gb|AY754435.1| Drosophila miranda strain 0101.3 bicoid (bcd) gene, exons 2, 3 and
           partial cds
          Length = 1115

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 661 tgctgctgctgatggagctgctgctgctg 633



to top

>gb|AY754434.1| Drosophila pseudoobscura bicoid (bcd) gene, exons 2, 3 and partial
           cds
          Length = 1110

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 222 tgctgctgatgatggagatgctgctgctg 250
           |||||||| |||||||| |||||||||||
Sbjct: 659 tgctgctgctgatggagctgctgctgctg 631



to top

>emb|BX663609.29| Zebrafish DNA sequence from clone DKEY-182H7 in linkage group 7, complete
              sequence
          Length = 248960

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 222    tgctgctgatgatggagatgctgctgctg 250
              ||||||||||||||  |||||||||||||
Sbjct: 119547 tgctgctgatgatgatgatgctgctgctg 119575



to top

>gb|AE003705.3| Drosophila melanogaster chromosome 3R, section 43 of 118 of the
             complete sequence
          Length = 216741

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 114   cgttgctgatgaaatgcgcaa 134
             |||||||||||||||||||||
Sbjct: 18754 cgttgctgatgaaatgcgcaa 18734



to top

>gb|AE003523.3| Drosophila melanogaster chromosome 3L, section 62 of 83 of the complete
              sequence
          Length = 290640

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 222    tgctgctgatgatggagatgctgctgctg 250
              ||||||||||||||| | |||||||||||
Sbjct: 175627 tgctgctgatgatggtggtgctgctgctg 175655



to top

>gb|AE003490.3| Drosophila melanogaster chromosome X, section 42 of 74 of the complete
              sequence
          Length = 302665

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                               
Query: 222    tgctgctgatgatggagatgctgctgctgatgg 254
              ||||||||||||||  | |||||||||||||||
Sbjct: 107267 tgctgctgatgatgttgctgctgctgctgatgg 107299



to top

>emb|BX571856.1| Staphylococcus aureus subsp. aureus strain MRSA252, complete genome
          Length = 2902619

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 251    atggagatgtagatgctgcag 271
              |||||||||||||||||||||
Sbjct: 159211 atggagatgtagatgctgcag 159191



to top

>dbj|AP001972.4| Homo sapiens genomic DNA, chromosome 11q, clone:CTD-2562J17, complete
              sequences
          Length = 215225

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 309    agagaggaagaaaacaaaaag 329
              |||||||||||||||||||||
Sbjct: 175179 agagaggaagaaaacaaaaag 175199



to top

>gb|DQ314865.1| Homo sapiens arrestin, beta 1 (ARRB1) gene, complete cds
          Length = 89549

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 309   agagaggaagaaaacaaaaag 329
             |||||||||||||||||||||
Sbjct: 81579 agagaggaagaaaacaaaaag 81559



to top

>gb|AC140409.3| Mus musculus BAC clone RP23-138K22 from 9, complete sequence
          Length = 200157

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                       
Query: 219    tgatgctgctgatgatggagatgctgctgctgatggagatg 259
              ||||| |||||||||||| |||| ||||| |||||| ||||
Sbjct: 102383 tgatgatgctgatgatggtgatgatgctgatgatggtgatg 102343



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                       
Query: 219    tgatgctgctgatgatggagatgctgctgctgatggagatg 259
              ||||| |||||||||||| |||| ||||| |||||| ||||
Sbjct: 102365 tgatgatgctgatgatggtgatgatgctgatgatggtgatg 102325



to top

>gb|AC090955.3| Homo sapiens chromosome 3 clone RP11-622A14 map 3p, complete sequence
          Length = 209168

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 268   gcagaaggcgatggagaccag 288
             |||||||||||||||||||||
Sbjct: 82022 gcagaaggcgatggagaccag 82042



to top

>emb|AL845161.5| Mouse DNA sequence from clone RP23-214I20 on chromosome 2, complete
              sequence
          Length = 233212

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 313    aggaagaaaacaaaaagagtt 333
              |||||||||||||||||||||
Sbjct: 104425 aggaagaaaacaaaaagagtt 104445



to top

>emb|AL928639.5| Mouse DNA sequence from clone RP23-446O17 on chromosome 2, complete
              sequence
          Length = 177843

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 310    gagaggaagaaaacaaaaagagtta 334
              ||||||||||||| |||||||||||
Sbjct: 158857 gagaggaagaaaagaaaaagagtta 158881



to top

>emb|X97283.1|GCINTALPH G.cydonium mRNA for integrin alpha subunit
          Length = 3546

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 291  tgctgactctctaactggagagagg 315
            |||||||||||| ||||||||||||
Sbjct: 2242 tgctgactctctgactggagagagg 2266



to top

>gb|AC021999.5| Homo sapiens chromosome 3 clone RP11-129J10 map 3p, complete sequence
          Length = 153152

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 268    gcagaaggcgatggagaccag 288
              |||||||||||||||||||||
Sbjct: 137349 gcagaaggcgatggagaccag 137369



to top

>gb|AY830454.1| Petromyzon marinus SoxF (SoxF) mRNA, complete cds
          Length = 1805

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 222  tgctgctgatgatggagatgctgctgctgatg 253
            |||||||| |||||  ||||||||||||||||
Sbjct: 1191 tgctgctgctgatgatgatgctgctgctgatg 1160



to top

>gb|AC159998.6| Mus musculus BAC clone RP24-576J22 from chromosome 10, complete
             sequence
          Length = 166313

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                         
Query: 225   tgctgatgatggagatgctgctgctgatggagatgtagatgctg 268
             |||||||||||  |||| || ||||||||  |||||||||||||
Sbjct: 72195 tgctgatgatgctgatggtgatgctgatgaggatgtagatgctg 72238



to top

>gb|AC006259.1| Arabidopsis thaliana BAC F21J6 from chromosome V, containing KNAT3 and
             mapping near 60.5 cM, complete sequence
          Length = 110680

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 309   agagaggaagaaaacaaaaa 328
             ||||||||||||||||||||
Sbjct: 15872 agagaggaagaaaacaaaaa 15853



to top

>gb|AE014832.1| Plasmodium falciparum 3D7 chromosome 10 section 4 of 7 of the complete
              sequence
          Length = 258658

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 316    aagaaaacaaaaagagttac 335
              ||||||||||||||||||||
Sbjct: 150460 aagaaaacaaaaagagttac 150441



to top

>gb|AC005964.1| Arabidopsis thaliana chromosome V map 60.5 cM, complete sequence
          Length = 91916

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 309   agagaggaagaaaacaaaaa 328
             ||||||||||||||||||||
Sbjct: 83273 agagaggaagaaaacaaaaa 83254



to top

>ref|XM_368359.1| Magnaporthe grisea 70-15 chromosome VI hypothetical protein
            (MG00885.4) partial mRNA
          Length = 2445

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 219  tgatgctgctgatgatggagatgctgctgctg 250
            |||||||||||||| || || |||||||||||
Sbjct: 1469 tgatgctgctgatgttgaagctgctgctgctg 1438



to top

>gb|AC134348.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0530H10,
             complete sequence
          Length = 148373

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 305   ctggagagaggaagaaaacaaaaa 328
             ||||||||| ||||||||||||||
Sbjct: 25872 ctggagagaagaagaaaacaaaaa 25849



to top

>ref|XM_453868.1| Kluyveromyces lactis NRRL Y-1140, KLLA0D18238g predicted mRNA
          Length = 1437

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 398 agaaactggaagttctttca 417
           ||||||||||||||||||||
Sbjct: 361 agaaactggaagttctttca 380



to top

>gb|AY176327.1| Staphylococcus phage K, complete genome
          Length = 127395

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 1     gcttaataaaaataggtcta 20
             ||||||||||||||||||||
Sbjct: 96556 gcttaataaaaataggtcta 96575



to top

>ref|XM_549330.2| PREDICTED: Canis familiaris similar to CG1 protein (F18) (LOC492210),
            mRNA
          Length = 2490

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 219  tgatgctgctgatgatggagatgctgctgctg 250
            |||||||||||||| ||  |||||||||||||
Sbjct: 1706 tgatgctgctgatgctgctgatgctgctgctg 1675



to top

>gb|AC132378.3| Mus musculus BAC clone RP23-407N22 from chromosome 18, complete sequence
          Length = 207683

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 209    aattttttcttgatgctgct 228
              ||||||||||||||||||||
Sbjct: 134584 aattttttcttgatgctgct 134565



to top

>gb|AC113031.11| Mus musculus chromosome 14, clone RP23-220B20, complete sequence
          Length = 250215

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 382   acagaagcagatgcaaagaa 401
             ||||||||||||||||||||
Sbjct: 70511 acagaagcagatgcaaagaa 70530



to top

>emb|CR954256.1| Anopheles gambiae Pen-1 region; BAC clones 30N20, 10K02, 13E09, 31J16 and
              01G10 from library NotreDame1 of Anopheles gambiae (African
              malaria mosquito) strain PEST
          Length = 447895

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 219    tgatgctgctgatgatggagatgctgct 246
              |||||||||||||||||  |||||||||
Sbjct: 393258 tgatgctgctgatgatgatgatgctgct 393231



to top

>gb|AC137948.12| Mus musculus chromosome 1, clone RP23-393D20, complete sequence
          Length = 233077

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 401    aactggaagttctttcaaagcaaa 424
              |||||||| |||||||||||||||
Sbjct: 201773 aactggaacttctttcaaagcaaa 201796



to top

>ref|XM_815541.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein
           (MASP) (Tc00.1047053506599.50) partial mRNA
          Length = 1155

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 241 gctgctgctgatggagatgt 260
           ||||||||||||||||||||
Sbjct: 73  gctgctgctgatggagatgt 92



to top

>ref|XM_815553.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein
           (MASP) (Tc00.1047053506599.330) partial mRNA
          Length = 1281

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 241 gctgctgctgatggagatgt 260
           ||||||||||||||||||||
Sbjct: 73  gctgctgctgatggagatgt 92



to top

>gb|AC121791.3| Mus musculus BAC clone RP23-401H19 from chromosome 14, complete
             sequence
          Length = 197720

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 222   tgctgctgatgatggagatgctgctgctgatg 253
             |||||||| |||||  ||||||||||||||||
Sbjct: 94254 tgctgctgttgatgatgatgctgctgctgatg 94223



to top

>gb|AY225852.2| Ctenopharyngodon idella CBP/p300-interacting transactivator
           (cited3) mRNA, complete cds
          Length = 1585

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 218 ttgatgctgctgatgatggagatgctgctgctgatg 253
           |||||||||||| |||||  | ||||||||||||||
Sbjct: 478 ttgatgctgctgctgatgctgctgctgctgctgatg 443



to top

>ref|XM_950044.1| Theileria annulata strain Ankara hypothetical protein (TA04620)
            partial mRNA
          Length = 2850

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 318  gaaaacaaaaagagttacga 337
            ||||||||||||||||||||
Sbjct: 2019 gaaaacaaaaagagttacga 2038



to top

>gb|AY060464.1| Drosophila melanogaster SD04616 full insert cDNA
          Length = 4295

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 219 tgatgctgctgatgatggagatgctgctgctg 250
           |||||||||||||| ||  |||||||||||||
Sbjct: 580 tgatgctgctgatgctgctgatgctgctgctg 549



to top

>gb|AC136716.12| Mus musculus, clone RP23-42E21, complete sequence
          Length = 259603

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 309    agagaggaagaaaacaaaaa 328
              ||||||||||||||||||||
Sbjct: 128812 agagaggaagaaaacaaaaa 128793



to top

>emb|AL391989.9| Human DNA sequence from clone RP11-388E20 on chromosome 13 Contains a
             ribosomal protein L31 (RPL31) pseudogene, complete
             sequence
          Length = 167496

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 221   atgctgctgatgatggagat 240
             ||||||||||||||||||||
Sbjct: 88664 atgctgctgatgatggagat 88645



to top

>gb|BT010312.1| Drosophila melanogaster AT29286 full insert cDNA
          Length = 4932

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 222  tgctgctgatgatggagatgctgctgct 249
            |||||||||||||| || ||||||||||
Sbjct: 4302 tgctgctgatgatgaagctgctgctgct 4275



to top

>emb|AL353700.14| Human DNA sequence from clone RP3-350J21 on chromosome 6 Contains part
             of the DNAH8 gene for dynein axonemal heavy polypeptide 8
             and the 5' part of a novel gene, complete sequence
          Length = 56509

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 231   tgatggagatgctgctgctg 250
             ||||||||||||||||||||
Sbjct: 52803 tgatggagatgctgctgctg 52784



to top

>gb|AC023714.5| Drosophila melanogaster X BAC RP98-19D19 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 160100

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 222   tgctgctgatgatggagatgctgctgctgatg 253
             ||||||||||| || || ||||||||||||||
Sbjct: 38795 tgctgctgatgctgcagctgctgctgctgatg 38764



to top

>emb|CR382124.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome D of strain NRRL Y-1140
               of Kluyveromyces lactis
          Length = 1715506

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 398     agaaactggaagttctttca 417
               ||||||||||||||||||||
Sbjct: 1540059 agaaactggaagttctttca 1540078



to top

>gb|AC132401.4| Mus musculus BAC clone RP23-404A8 from chromosome 3, complete sequence
          Length = 200657

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 222    tgctgctgatgatggagatgctgctgctgatg 253
              ||||||||||||||  |||||||||| |||||
Sbjct: 167959 tgctgctgatgatgatgatgctgctgatgatg 167990



to top

>emb|AJ308118.2|LFL308118 Lampetra fluviatilis mRNA for type I keratin 18
          Length = 2508

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 222 tgctgctgatgatggagatgctgctgctgatg 253
           ||||||||||||||  |||||||||| |||||
Sbjct: 60  tgctgctgatgatgatgatgctgctgatgatg 29



to top

>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome
          Length = 7074893

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 234     tggagatgctgctgctgatggaga 257
               ||||||||||| ||||||||||||
Sbjct: 4682869 tggagatgctgttgctgatggaga 4682846



to top

>gb|AC104626.3| Drosophila melanogaster X BAC RP98-28L7 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 184454

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 219   tgatgctgctgatgatggagatgctgctgctg 250
             ||||||| |||||| || ||||||||||||||
Sbjct: 15648 tgatgcttctgatgctgcagatgctgctgctg 15679



to top

>gb|AC010557.4| Drosophila melanogaster 3L BAC RP98-9E21 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 169425

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                  
Query: 219    tgatgctgctgatgatggagatgctgctgctgatgg 254
              ||||||||||| |||||  |||| ||||||||||||
Sbjct: 117937 tgatgctgctgctgatgctgatgttgctgctgatgg 117902



to top

>gb|AY119550.1| Drosophila melanogaster GH27233 full insert cDNA
          Length = 3796

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 222  tgctgctgatgatggagatgctgctgct 249
            |||||||||||||| || ||||||||||
Sbjct: 3361 tgctgctgatgatgaagctgctgctgct 3334



to top

>gb|AY119466.1| Drosophila melanogaster GH03957 full insert cDNA
          Length = 4347

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 222  tgctgctgatgatggagatgctgctgct 249
            |||||||||||||| || ||||||||||
Sbjct: 3310 tgctgctgatgatgaagctgctgctgct 3283



to top

>gb|AC104510.6| Drosophila melanogaster X BAC RP98-26J12 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 168583

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 219    tgatgctgctgatgatggagatgctgctgctg 250
              ||||||| |||||| || ||||||||||||||
Sbjct: 158295 tgatgcttctgatgctgcagatgctgctgctg 158326



to top

>ref|NM_206288.1| Drosophila melanogaster CG33277-PA (CG33277) mRNA, complete cds
          Length = 1215

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 219 tgatgctgctgatgatggagatgctgctgctgatgg 254
           ||||||||||| |||||  |||| ||||||||||||
Sbjct: 977 tgatgctgctgctgatgctgatgttgctgctgatgg 942



to top

>ref|NM_206622.2| Drosophila melanogaster CG32776-RB, transcript variant B (CG32776),
           mRNA
          Length = 3981

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 222 tgctgctgatgatggagatgctgctgctgatg 253
           ||||||||||| || || ||||||||||||||
Sbjct: 746 tgctgctgatgctgcagctgctgctgctgatg 715



to top

>ref|NM_206150.1| Drosophila melanogaster CG30460-RB, transcript variant B (CG30460),
            mRNA
          Length = 4790

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 222  tgctgctgatgatggagatgctgctgct 249
            |||||||||||||| || ||||||||||
Sbjct: 3759 tgctgctgatgatgaagctgctgctgct 3732



to top

>ref|NM_206149.1| Drosophila melanogaster CG30460-RA, transcript variant A (CG30460),
            mRNA
          Length = 5954

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 222  tgctgctgatgatggagatgctgctgct 249
            |||||||||||||| || ||||||||||
Sbjct: 4923 tgctgctgatgatgaagctgctgctgct 4896



to top

>ref|NM_206148.1| Drosophila melanogaster CG30460-RD, transcript variant D (CG30460),
            mRNA
          Length = 5111

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 222  tgctgctgatgatggagatgctgctgct 249
            |||||||||||||| || ||||||||||
Sbjct: 4080 tgctgctgatgatgaagctgctgctgct 4053



to top

>gb|AC067793.9| Homo sapiens chromosome 15, clone RP11-552D14, complete sequence
          Length = 189722

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 219    tgatgctgctgatgatggagatgctgctgctg 250
              ||||| |||||||||||  |||||||||||||
Sbjct: 124071 tgatgatgctgatgatgctgatgctgctgctg 124102



to top

>ref|NM_167277.1| Drosophila melanogaster CG11105-RA, transcript variant A (CG11105),
           mRNA
          Length = 1275

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 219 tgatgctgctgatgatggagatgctgctgctg 250
           ||||||| |||||| || ||||||||||||||
Sbjct: 395 tgatgcttctgatgctgcagatgctgctgctg 364



to top

>ref|NM_137342.2| Drosophila melanogaster CG30460-RC, transcript variant C (CG30460),
            mRNA
          Length = 6491

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 222  tgctgctgatgatggagatgctgctgct 249
            |||||||||||||| || ||||||||||
Sbjct: 5460 tgctgctgatgatgaagctgctgctgct 5433



to top

>ref|NM_132471.1| Drosophila melanogaster CG11105-RB, transcript variant B (CG11105),
           mRNA
          Length = 1469

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 219 tgatgctgctgatgatggagatgctgctgctg 250
           ||||||| |||||| || ||||||||||||||
Sbjct: 589 tgatgcttctgatgctgcagatgctgctgctg 558



to top

>ref|NM_057659.2| Drosophila melanogaster Dopamine receptor CG9652-RA (DopR), mRNA
          Length = 2538

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 228 tgatgatggagatgctgctgctgatgga 255
           ||||||||| | ||||||||||||||||
Sbjct: 522 tgatgatggtggtgctgctgctgatgga 495



to top

>ref|NM_001038740.1| Drosophila melanogaster CG32776-RD, transcript variant D (CG32776),
           mRNA
          Length = 3984

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 222 tgctgctgatgatggagatgctgctgctgatg 253
           ||||||||||| || || ||||||||||||||
Sbjct: 746 tgctgctgatgctgcagctgctgctgctgatg 715



to top

>gb|AC008631.6| Homo sapiens chromosome 5 clone CTB-163B16, complete sequence
          Length = 107857

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 307   ggagagaggaagaaaacaaa 326
             ||||||||||||||||||||
Sbjct: 13676 ggagagaggaagaaaacaaa 13695



to top

>gb|AC099032.1| Drosophila melanogaster, chromosome 2R, region 53F-54A, BAC clone
             BACR32P08, complete sequence
          Length = 163072

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 222   tgctgctgatgatggagatgctgctgct 249
             |||||||||||||| || ||||||||||
Sbjct: 74483 tgctgctgatgatgaagctgctgctgct 74510



to top

>emb|AJ586737.2| Drosophila virilis partial mod(mdg4) gene
          Length = 24391

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 219   tgatgctgctgatgatggagatgctgctgctg 250
             ||||| || ||||||||||| |||||||||||
Sbjct: 11234 tgatgatgatgatgatggagctgctgctgctg 11265



to top

>emb|BX000999.9| Zebrafish DNA sequence from clone DKEY-77F5 in linkage group 15,
             complete sequence
          Length = 200989

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 257   atgtagatgctgcagaaggc 276
             ||||||||||||||||||||
Sbjct: 43719 atgtagatgctgcagaaggc 43700



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 234      tggagatgctgctgctgatg 253
                ||||||||||||||||||||
Sbjct: 23390221 tggagatgctgctgctgatg 23390202



to top

>gb|AC114738.4| Homo sapiens BAC clone CTD-2192M1 from 4, complete sequence
          Length = 134697

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 231    tgatggagatgctgctgctgatgg 254
              |||||| |||||||||||||||||
Sbjct: 114964 tgatggtgatgctgctgctgatgg 114941



to top

>gb|AC007904.6|AC007904 Drosophila melanogaster, chromosome 3R, region 88B-88B, BAC clone
             BACR01H04, complete sequence
          Length = 190325

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 228   tgatgatggagatgctgctgctgatgga 255
             ||||||||| | ||||||||||||||||
Sbjct: 94340 tgatgatggtggtgctgctgctgatgga 94367



to top

>gb|AC095046.3| Homo sapiens BAC clone RP11-147K21 from 4, complete sequence
          Length = 156786

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 6      ataaaaataggtctaccaca 25
              ||||||||||||||||||||
Sbjct: 116921 ataaaaataggtctaccaca 116940



to top

>gb|AC016759.11| Homo sapiens BAC clone RP11-535J8 from 2, complete sequence
          Length = 219574

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 311  agaggaagaaaacaaaaaga 330
            ||||||||||||||||||||
Sbjct: 4084 agaggaagaaaacaaaaaga 4103



to top

>gb|AC154664.2| Mus musculus BAC clone RP24-284G3 from chromosome 14, complete sequence
          Length = 157658

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 382    acagaagcagatgcaaagaa 401
              ||||||||||||||||||||
Sbjct: 156198 acagaagcagatgcaaagaa 156217



to top

>gb|AC093784.3| Homo sapiens BAC clone RP11-211K17 from 2, complete sequence
          Length = 165500

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 229   gatgatggagatgctgctgctgat 252
             |||||||||||||||| |||||||
Sbjct: 19508 gatgatggagatgctgatgctgat 19531



to top

>gb|CP000252.1| Syntrophus aciditrophicus SB, complete genome
          Length = 3179300

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 229    gatgatggagatgctgctgc 248
              ||||||||||||||||||||
Sbjct: 892138 gatgatggagatgctgctgc 892157



to top

>gb|AY954969.1| Bacteriophage G1, complete genome
          Length = 138715

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 1     gcttaataaaaataggtcta 20
             ||||||||||||||||||||
Sbjct: 61734 gcttaataaaaataggtcta 61753



to top

>gb|AC107209.4| Homo sapiens BAC clone RP11-4F12 from 2, complete sequence
          Length = 113078

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 311   agaggaagaaaacaaaaaga 330
             ||||||||||||||||||||
Sbjct: 34895 agaggaagaaaacaaaaaga 34914



to top

>dbj|AP004399.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0451G12
          Length = 142182

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 234   tggagatgctgctgctgatg 253
             ||||||||||||||||||||
Sbjct: 72058 tggagatgctgctgctgatg 72039



to top

>gb|DQ020489.1| Sus scrofa clone BAC KNP_992H3, complete sequence
          Length = 121023

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 209   aattttttcttgatgctgct 228
             ||||||||||||||||||||
Sbjct: 17879 aattttttcttgatgctgct 17898



to top

>dbj|AK106046.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-206-E07, full
            insert sequence
          Length = 1273

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 305  ctggagagaggaagaaaacaaaaa 328
            ||||||||| ||||||||||||||
Sbjct: 1057 ctggagagaagaagaaaacaaaaa 1034



to top

>gb|AC154663.2| Mus musculus BAC clone RP24-283H12 from 16, complete sequence
          Length = 177341

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 219   tgatgctgctgatgatggagatgctgctgctg 250
             ||||| |||||||||||  |||||||||||||
Sbjct: 97984 tgatgatgctgatgatgctgatgctgctgctg 97953



to top

>emb|BX897729.6| Zebrafish DNA sequence from clone DKEY-240A12 in linkage group 4,
              complete sequence
          Length = 201932

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 219    tgatgctgctgatgatggagatgctgctgctg 250
              ||||| |||||||||||  |||||||||||||
Sbjct: 115043 tgatgatgctgatgatgatgatgctgctgctg 115074



to top

>emb|X97073.1|AOLECTIN A.oligospora gene encoding lectin
          Length = 1711

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 212 tttttcttgatgctgctgatgatggaga 239
           |||| |||||||||||||| ||||||||
Sbjct: 503 ttttgcttgatgctgctgaggatggaga 476



to top

>gb|AE003703.3| Drosophila melanogaster chromosome 3R, section 41 of 118 of the complete
              sequence
          Length = 223948

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 228    tgatgatggagatgctgctgctgatgga 255
              ||||||||| | ||||||||||||||||
Sbjct: 177961 tgatgatggtggtgctgctgctgatgga 177988



to top

>gb|AE003804.4| Drosophila melanogaster chromosome 2R, section 46 of 73 of the complete
             sequence
          Length = 260337

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 222   tgctgctgatgatggagatgctgctgct 249
             |||||||||||||| || ||||||||||
Sbjct: 61775 tgctgctgatgatgaagctgctgctgct 61802



to top

>gb|AC005717.2|AC005717 Drosophila melanogaster, chromosome 2R, region 53E6-53F4, P1 clone
             DS00078, complete sequence
          Length = 51289

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 222   tgctgctgatgatggagatgctgctgct 249
             |||||||||||||| || ||||||||||
Sbjct: 18095 tgctgctgatgatgaagctgctgctgct 18068



to top

>gb|AE003559.3| Drosophila melanogaster chromosome 3L, section 26 of 83 of the complete
              sequence
          Length = 269948

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                  
Query: 219    tgatgctgctgatgatggagatgctgctgctgatgg 254
              ||||||||||| |||||  |||| ||||||||||||
Sbjct: 241038 tgatgctgctgctgatgctgatgttgctgctgatgg 241003



to top

>gb|AE003485.3| Drosophila melanogaster chromosome X, section 37 of 74 of the complete
              sequence
          Length = 283075

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 219    tgatgctgctgatgatggagatgctgctgctg 250
              ||||||| |||||| || ||||||||||||||
Sbjct: 138488 tgatgcttctgatgctgcagatgctgctgctg 138519



to top

>gb|AE003429.4| Drosophila melanogaster chromosome X, section 13 of 74 of the complete
              sequence
          Length = 326403

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 222    tgctgctgatgatggagatgctgctgctgatg 253
              ||||||||||| || || ||||||||||||||
Sbjct: 139458 tgctgctgatgctgcagctgctgctgctgatg 139489



to top

>emb|AL158058.5|CNS01RGJ Human chromosome 14 DNA sequence BAC R-260G13 of library RPCI-11 from
            chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 180372

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 365  gtaaagagaggttaaggaca 384
            ||||||||||||||||||||
Sbjct: 6243 gtaaagagaggttaaggaca 6262



to top

>gb|AC104867.18| Mus musculus chromosome 18, clone RP24-320L19, complete sequence
          Length = 148876

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 222   tgctgctgatgatggagatgctgctgctgatg 253
             ||||||||||||||  ||||||| ||||||||
Sbjct: 44232 tgctgctgatgatgatgatgctgatgctgatg 44201



to top

>gb|AC124095.7| Mus musculus chromosome 1, clone RP23-245G9, complete sequence
          Length = 198825

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 401   aactggaagttctttcaaagcaaa 424
             |||||||| |||||||||||||||
Sbjct: 55164 aactggaacttctttcaaagcaaa 55187



to top

>gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome
          Length = 5224283

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 386     aagcagatgcaaagaaactg 405
               ||||||||||||||||||||
Sbjct: 4053982 aagcagatgcaaagaaactg 4053963



to top

>emb|AL772258.9| Mouse DNA sequence from clone RP23-337P24 on chromosome 2, complete
             sequence
          Length = 200480

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 240   tgctgctgctgatggagatg 259
             ||||||||||||||||||||
Sbjct: 12002 tgctgctgctgatggagatg 12021



to top

>emb|AL133166.3|CNS01DU6 Human chromosome 14 DNA sequence BAC C-2010O1 of library CalTech-D from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 105587

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 365   gtaaagagaggttaaggaca 384
             ||||||||||||||||||||
Sbjct: 89963 gtaaagagaggttaaggaca 89982



to top

>emb|AL928923.8| Mouse DNA sequence from clone RP23-472B12 on chromosome 2, complete
             sequence
          Length = 41605

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 219   tgatgctgctgatgatggagatgctgctgctg 250
             ||||| || ||||||||| |||||||||||||
Sbjct: 10237 tgatgatgatgatgatggtgatgctgctgctg 10206



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 219   tgatgctgctgatgatggagatgctgctgctg 250
             ||||| || ||||||||| |||||||||||||
Sbjct: 10169 tgatgatgatgatgatggtgatgctgctgctg 10138



to top

>gb|AC152974.1| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNOa0153K02, complete sequence
          Length = 40117

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 305   ctggagagaggaagaaaacaaaaa 328
             ||||||||| ||||||||||||||
Sbjct: 33769 ctggagagaagaagaaaacaaaaa 33746



to top

>emb|X77234.1|DMDOPREC D.melanogaster mRNA for dopamine receptor
          Length = 2538

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 228 tgatgatggagatgctgctgctgatgga 255
           ||||||||| | ||||||||||||||||
Sbjct: 522 tgatgatggtggtgctgctgctgatgga 495



to top

>dbj|AP005117.2| Homo sapiens genomic DNA, chromosome 18p clone:RP11-21G15, complete
             sequences
          Length = 148790

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 209   aattttttcttgatgctgct 228
             ||||||||||||||||||||
Sbjct: 60091 aattttttcttgatgctgct 60110


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,494,518
Number of Sequences: 3902068
Number of extensions: 6494518
Number of successful extensions: 152426
Number of sequences better than 10.0: 244
Number of HSP's better than 10.0 without gapping: 243
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 151379
Number of HSP's gapped (non-prelim): 1024
length of query: 467
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 445
effective length of database: 17,147,199,772
effective search space: 7630503898540
effective search space used: 7630503898540
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top