ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags31i04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|X64622.1|OS5SRRNMR O.sativa Rrl5 mRNA for 5S ribosomal RNA 404 e-109
2dbj|AK104693.1| Oryza sativa (japonica cultivar-group) cDNA clon... 400 e-108
3dbj|AK065268.1| Oryza sativa (japonica cultivar-group) cDNA clon... 400 e-108
4gb|BT016417.1| Zea mays clone Contig250 mRNA sequence 345 8e-92
5gb|BT016492.1| Zea mays clone Contig325 mRNA sequence 321 1e-84
6gb|AY109375.1| Zea mays CL457_2 mRNA sequence 305 7e-80
7ref|NM_190270.1| Oryza sativa (japonica cultivar-group), predic... 295 6e-77
8ref|NM_190269.1| Oryza sativa (japonica cultivar-group), predic... 295 6e-77
9gb|AY106024.1| Zea mays PCO063168 mRNA sequence 248 1e-62
10dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 170 3e-39
11dbj|AP003349.4| Oryza sativa (japonica cultivar-group) genomic D... 170 3e-39
12dbj|AP003316.4| Oryza sativa (japonica cultivar-group) genomic D... 170 3e-39
13gb|AF457942.1| Zea mays clone cho1c.pk003.i13, mRNA sequence 125 1e-25
14dbj|AB049724.1| Pisum sativum ssa-15 mRNA for putative senescenc... 86 1e-13
15gb|AY087197.1| Arabidopsis thaliana clone 32753 mRNA, complete s... 80 7e-12
16dbj|AK109006.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 7e-12
17ref|NM_123336.3| Arabidopsis thaliana 5S rRNA binding / structur... 78 3e-11
18gb|BT014015.1| Lycopersicon esculentum clone 133077F, mRNA sequence 78 3e-11
19gb|BT008706.1| Arabidopsis thaliana At5g39740 gene, complete cds 78 3e-11
20gb|AY093123.1| Arabidopsis thaliana ribosomal protein L5 - like ... 78 3e-11
21gb|AY079020.1| Arabidopsis thaliana AT5g39740/MKM21_30 mRNA, com... 78 3e-11
22emb|BX831866.1|CNS09ZT2 Arabidopsis thaliana Full-length cDNA Co... 78 3e-11
23gb|AY365248.1| Cucumis sativus 60S ribosomal protein L5 mRNA, co... 74 4e-10
24ref|NM_113448.2| Arabidopsis thaliana ATL5 (A. THALIANA RIBOSOMA... 72 2e-09
25gb|BT000411.1| Arabidopsis thaliana putative ribosomal protein (... 72 2e-09
26gb|BT008705.1| Arabidopsis thaliana At3g25520 gene, complete cds 72 2e-09
27gb|AY136319.1| Arabidopsis thaliana putative ribosomal protein (... 72 2e-09
28gb|AY065103.1| Arabidopsis thaliana 60S ribosomal protein L5 (At... 72 2e-09
29gb|AY081701.1| Arabidopsis thaliana 60S ribosomal protein L5 (At... 72 2e-09
30gb|AY054161.1| Arabidopsis thaliana AT5g39740/MKM21_30 mRNA, com... 72 2e-09
31gb|AY186611.1| Arabidopsis thaliana ribosomal protein L5 mRNA, c... 72 2e-09
32emb|BX823967.1|CNS0A6W1 Arabidopsis thaliana Full-length cDNA Co... 72 2e-09
33gb|BT002427.1| Arabidopsis thaliana ribosomal protein, putative ... 72 2e-09
34dbj|AB016876.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 72 2e-09
35emb|BX832617.1|CNS09YMN Arabidopsis thaliana Full-length cDNA Co... 70 7e-09
36gb|DQ206526.1| Suberites fuscus isolate TOA21 ribosomal protein ... 66 1e-07
37dbj|AB025639.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 62 2e-06
38gb|AY292620.1| Oikopleura dioica 60S ribosomal protein L5 (RL5) ... 60 7e-06
39gb|BT012733.1| Lycopersicon esculentum clone 113662F, mRNA sequence 60 7e-06
40ref|XM_504264.1| Yarrowia lipolytica CLIB122, YALI0E22352g predi... 60 7e-06
41emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB ... 60 7e-06
42gb|AF028833.1|AF028833 Dunaliella salina 60S ribosomal protein (... 58 3e-05
43emb|X95566.1|PS5SRNA P.sativum 5S rRNA gene 58 3e-05
44emb|Z49967.1|CEF54C9 Caenorhabditis elegans Cosmid F54C9, comple... 56 1e-04
45ref|NM_063410.2| Caenorhabditis elegans Ribosomal Protein, Large... 56 1e-04
46gb|AF152472.1|AF152472 Myxine glutinosa ribosomal protein L5 mRN... 56 1e-04
47gb|BT012458.1| Drosophila melanogaster RE57391 full insert cDNA 54 4e-04
48gb|BT011515.1| Drosophila melanogaster SD13191 full insert cDNA 54 4e-04
49emb|AM048991.1| Carabus granulatus partial mRNA for ribosomal pr... 54 4e-04
50gb|AY232050.1| Drosophila yakuba clone yak-ad_yip6 mRNA sequence 54 4e-04
51gb|AY231809.1| Drosophila yakuba clone yak-em_yip6 mRNA sequence 54 4e-04
52emb|CR720352.2|CNS0GIRQ Tetraodon nigroviridis full-length cDNA 54 4e-04
53emb|CR708591.2|CNS0G9P7 Tetraodon nigroviridis full-length cDNA 54 4e-04
54emb|CR705464.2|CNS0G7AC Tetraodon nigroviridis full-length cDNA 54 4e-04
55emb|CR704706.2|CNS0G6PA Tetraodon nigroviridis full-length cDNA 54 4e-04
56emb|CR698243.2|CNS0G1PR Tetraodon nigroviridis full-length cDNA 54 4e-04
57emb|CR697951.2|CNS0G1HN Tetraodon nigroviridis full-length cDNA 54 4e-04
58emb|CR695319.2|CNS0FZGJ Tetraodon nigroviridis full-length cDNA 54 4e-04
59emb|CR692762.2|CNS0FXHI Tetraodon nigroviridis full-length cDNA 54 4e-04
60emb|CR691096.2|CNS0FW78 Tetraodon nigroviridis full-length cDNA 54 4e-04
61emb|CR690457.2|CNS0FVPH Tetraodon nigroviridis full-length cDNA 54 4e-04
62emb|CR689016.2|CNS0FULG Tetraodon nigroviridis full-length cDNA 54 4e-04
63emb|CR687491.2|CNS0FTF3 Tetraodon nigroviridis full-length cDNA 54 4e-04
64emb|CR682806.2|CNS0FPSY Tetraodon nigroviridis full-length cDNA 54 4e-04
65emb|CR669080.1|CNS0FF8E Tetraodon nigroviridis full-length cDNA 54 4e-04
66emb|CR667591.2|CNS0FE31 Tetraodon nigroviridis full-length cDNA 54 4e-04
67dbj|AB246883.1| Lethenteron japonicum RPL5 mRNA for ribosomal pr... 54 4e-04
68gb|AY071305.1| Drosophila melanogaster RE33114 full length cDNA 54 4e-04
69ref|NM_001015438.1| Drosophila melanogaster CG17489-PD.3 (CG1748... 54 4e-04
70ref|NM_001015436.1| Drosophila melanogaster CG17489-PA.3 (CG1748... 54 4e-04
71ref|NM_001015440.1| Drosophila melanogaster CG17489-PC.3 (CG1748... 54 4e-04
72ref|NM_001015439.1| Drosophila melanogaster CG17489-PE.3 (CG1748... 54 4e-04
73ref|NM_001015437.1| Drosophila melanogaster CG17489-PB.3 (CG1748... 54 4e-04
74gb|AY130400.1| Petromyzon marinus ribosomal protein L5 mRNA, par... 54 4e-04
75gb|AY130399.1| Branchiostoma lanceolatum ribosomal protein L5 mR... 54 4e-04
76gb|BT003557.1| Drosophila melanogaster LP07855 full insert cDNA 54 4e-04
77gb|AC128859.4| Rattus norvegicus 10 BAC CH230-436I22 (Children's... 52 0.002
78ref|XM_367123.1| Magnaporthe grisea 70-15 hypothetical protein (... 52 0.002
79ref|XM_390186.1| Gibberella zeae PH-1 chromosome 1 RL5_NEUCR 60S... 52 0.002
80gb|BC041227.1| Xenopus laevis similar to ribosomal protein L5, m... 52 0.002
81gb|BC042258.1| Xenopus laevis similar to ribosomal protein L5, m... 52 0.002
82ref|XM_966854.1| PREDICTED: Tribolium castaneum similar to CG174... 52 0.002
83gb|M29032.1|XELRPL5A X.laevis ribosomal protein L5a 60 S subunit... 52 0.002
84gb|M29033.1|XELPRL5B X.laevis ribosomal protein L5b 60 S subunit... 52 0.002
85gb|AF054907.1| Neurospora crassa putative 5S rRNA binding riboso... 50 0.006
86ref|XM_323670.1| Neurospora crassa OR74A 60S RIBOSOMAL PROTEIN L... 50 0.006
87ref|XM_955485.1| Neurospora crassa OR74A 60S RIBOSOMAL PROTEIN L... 50 0.006
88gb|AF481056.1| Aplysia californica alpha tubulin 2 mRNA, complet... 50 0.006
89emb|BX028070.1|CNS08TTM Single read from an extremity of a full-... 50 0.006
90emb|BX008571.1|CNS08ERZ Single read from an extremity of a full-... 50 0.006
91emb|Z99296.2|SPAC3H5 S.pombe chromosome I cosmid c3H5 50 0.006
92emb|BX294026.1|NCB7H23 Neurospora crassa DNA linkage group V BAC... 50 0.006
93gb|AY857416.1| Suberites domuncula L5 mRNA, complete cds 50 0.006
94ref|NM_001019604.1| Schizosaccharomyces pombe 972h- hypothetical... 50 0.006
95gb|AY130401.1| Scyliorhinus canicula ribosomal protein L5 mRNA, ... 50 0.006
96gb|AY588943.1| Eimeria tenella large subunit ribosomal protein L... 50 0.006
97gb|DQ206601.1| Monosiga brevicollis isolate TOA21 ribosomal prot... 50 0.006
98gb|AF066077.1|AF066077 Helianthus annuus RPL5A-related protein (... 50 0.006
99gb|U48270.1|SPU48270 Schizosaccharomyces pombe ribosomal protein... 50 0.006
100gb|DQ228334.1| Solanum tuberosum clone 145F02 unknown mRNA 48 0.025
101gb|BC076208.1| Danio rerio ribosomal protein L5b, mRNA (cDNA clo... 48 0.025
102gb|BC071498.1| Danio rerio ribosomal protein L5b, mRNA (cDNA clo... 48 0.025
103gb|AY389938.1| Protopterus dolloi ribosomal protein L5 mRNA, par... 48 0.025
104ref|NM_001002106.1| Danio rerio ribosomal protein L5b (rpl5b), mRNA 48 0.025
105emb|BX548019.36| Zebrafish DNA sequence from clone DKEY-20D1 in ... 48 0.025
106emb|BX072137.1|CNS09RTP Single read from an extremity of a full-... 48 0.025
107emb|BX071725.1|CNS09RI9 Single read from an extremity of a full-... 48 0.025
108emb|BX070877.1|CNS09QUP Single read from an extremity of a full-... 48 0.025
109emb|BX070441.1|CNS09QIL Single read from an extremity of a full-... 48 0.025
110emb|BX069649.1|CNS09PWL Single read from an extremity of a full-... 48 0.025
111emb|BX061084.1|CNS09JAO Single read from an extremity of a full-... 48 0.025
112emb|BX069291.1|CNS09PMN Single read from an extremity of a full-... 48 0.025
113emb|BX068955.1|CNS09PDB Single read from an extremity of a full-... 48 0.025
114emb|BX068814.1|CNS09P9E Single read from an extremity of a full-... 48 0.025
115emb|BX068813.1|CNS09P9D Single read from an extremity of a full-... 48 0.025
116emb|BX068507.1|CNS09P0V Single read from an extremity of a full-... 48 0.025
117emb|BX068442.1|CNS09OZ2 Single read from an extremity of a full-... 48 0.025
118emb|BX067725.1|CNS09OF5 Single read from an extremity of a full-... 48 0.025
119emb|BX067047.1|CNS09NWB Single read from an extremity of a full-... 48 0.025
120emb|BX067225.1|CNS09O19 Single read from an extremity of a full-... 48 0.025
121emb|BX067123.1|CNS09NYF Single read from an extremity of a full-... 48 0.025
122emb|BX066661.1|CNS09NLL Single read from an extremity of a full-... 48 0.025
123emb|BX066513.1|CNS09NHH Single read from an extremity of a full-... 48 0.025
124emb|BX066357.1|CNS09ND5 Single read from an extremity of a full-... 48 0.025
125emb|BX065367.1|CNS09MLN Single read from an extremity of a full-... 48 0.025
126emb|BX065342.1|CNS09MKY Single read from an extremity of a full-... 48 0.025
127emb|BX065341.1|CNS09MKX Single read from an extremity of a full-... 48 0.025
128emb|BX065225.1|CNS09MHP Single read from an extremity of a full-... 48 0.025
129emb|BX065207.1|CNS09MH7 Single read from an extremity of a full-... 48 0.025
130emb|BX064978.1|CNS09MAU Single read from an extremity of a full-... 48 0.025
131emb|BX064130.1|CNS09LNA Single read from an extremity of a full-... 48 0.025
132emb|BX063800.1|CNS09LE4 Single read from an extremity of a full-... 48 0.025
133emb|BX062102.1|CNS09K2Y Single read from an extremity of a full-... 48 0.025
134emb|BX061737.1|CNS09JST Single read from an extremity of a full-... 48 0.025
135emb|BX061348.1|CNS09JI0 Single read from an extremity of a full-... 48 0.025
136emb|BX061272.1|CNS09JFW Single read from an extremity of a full-... 48 0.025
137emb|BX060709.1|CNS09J09 Single read from an extremity of a full-... 48 0.025
138emb|BX060454.1|CNS09IT6 Single read from an extremity of a full-... 48 0.025
139emb|BX060398.1|CNS09IRM Single read from an extremity of a full-... 48 0.025
140emb|BX060357.1|CNS09IQH Single read from an extremity of a full-... 48 0.025
141emb|BX060171.1|CNS09ILB Single read from an extremity of a full-... 48 0.025
142emb|BX060096.1|CNS09IJ8 Single read from an extremity of a full-... 48 0.025
143emb|BX057724.1|CNS09GPC Single read from an extremity of a full-... 48 0.025
144emb|BX057702.1|CNS09GOQ Single read from an extremity of a full-... 48 0.025
145emb|BX056485.1|CNS09FQX Single read from an extremity of a full-... 48 0.025
146emb|BX056402.1|CNS09FOM Single read from an extremity of a full-... 48 0.025
147emb|BX056121.1|CNS09FGT Single read from an extremity of a full-... 48 0.025
148emb|BX055563.1|CNS09F1B Single read from an extremity of a full-... 48 0.025
149emb|BX055539.1|CNS09F0N Single read from an extremity of a full-... 48 0.025
150emb|BX054946.1|CNS09EK6 Single read from an extremity of a full-... 48 0.025
151emb|BX053064.1|CNS09D3W Single read from an extremity of a full-... 48 0.025
152emb|BX054258.1|CNS09E12 Single read from an extremity of a full-... 48 0.025
153emb|BX054179.1|CNS09DYV Single read from an extremity of a full-... 48 0.025
154emb|BX052492.1|CNS09CO0 Single read from an extremity of a full-... 48 0.025
155emb|BX052031.1|CNS09CB7 Single read from an extremity of a full-... 48 0.025
156emb|BX051778.1|CNS09C46 Single read from an extremity of a full-... 48 0.025
157emb|BX051308.1|CNS09BR4 Single read from an extremity of a full-... 48 0.025
158emb|BX050125.1|CNS09AU9 Single read from an extremity of a full-... 48 0.025
159emb|BX049866.1|CNS09AN2 Single read from an extremity of a full-... 48 0.025
160emb|BX049865.1|CNS09AN1 Single read from an extremity of a full-... 48 0.025
161emb|BX048664.1|CNS099PO Single read from an extremity of a full-... 48 0.025
162emb|BX048642.1|CNS099P2 Single read from an extremity of a full-... 48 0.025
163emb|BX046441.1|CNS097ZX Single read from an extremity of a full-... 48 0.025
164emb|BX048405.1|CNS099IH Single read from an extremity of a full-... 48 0.025
165emb|BX048093.1|CNS0999T Single read from an extremity of a full-... 48 0.025
166emb|BX047973.1|CNS0996H Single read from an extremity of a full-... 48 0.025
167emb|BX047820.1|CNS09928 Single read from an extremity of a full-... 48 0.025
168emb|BX047472.1|CNS098SK Single read from an extremity of a full-... 48 0.025
169emb|BX046891.1|CNS098CF Single read from an extremity of a full-... 48 0.025
170emb|BX046053.1|CNS097P5 Single read from an extremity of a full-... 48 0.025
171emb|BX045835.1|CNS097J3 Single read from an extremity of a full-... 48 0.025
172emb|BX044952.1|CNS096UK Single read from an extremity of a full-... 48 0.025
173emb|BX045309.1|CNS0974H Single read from an extremity of a full-... 48 0.025
174emb|BX045229.1|CNS09729 Single read from an extremity of a full-... 48 0.025
175emb|BX042893.1|CNS0959D Single read from an extremity of a full-... 48 0.025
176emb|BX042892.1|CNS0959C Single read from an extremity of a full-... 48 0.025
177emb|BX044183.1|CNS09697 Single read from an extremity of a full-... 48 0.025
178emb|BX044179.1|CNS09693 Single read from an extremity of a full-... 48 0.025
179emb|BX043744.1|CNS095X0 Single read from an extremity of a full-... 48 0.025
180emb|BX041808.1|CNS094F8 Single read from an extremity of a full-... 48 0.025
181emb|BX041765.1|CNS094E1 Single read from an extremity of a full-... 48 0.025
182emb|BX040982.1|CNS093SA Single read from an extremity of a full-... 48 0.025
183emb|BX039800.1|CNS092VG Single read from an extremity of a full-... 48 0.025
184emb|BX037062.1|CNS090RE Single read from an extremity of a full-... 48 0.025
185emb|BX036382.1|CNS0908I Single read from an extremity of a full-... 48 0.025
186emb|BX036311.1|CNS0906J Single read from an extremity of a full-... 48 0.025
187emb|BX036244.1|CNS0904O Single read from an extremity of a full-... 48 0.025
188emb|BX036220.1|CNS09040 Single read from an extremity of a full-... 48 0.025
189emb|BX036176.1|CNS0902S Single read from an extremity of a full-... 48 0.025
190emb|BX035828.1|CNS08ZT4 Single read from an extremity of a full-... 48 0.025
191emb|BX035130.1|CNS08Z9Q Single read from an extremity of a full-... 48 0.025
192emb|BX033651.1|CNS08Y4N Single read from an extremity of a full-... 48 0.025
193emb|BX033000.1|CNS08XMK Single read from an extremity of a full-... 48 0.025
194emb|BX032517.1|CNS08X95 Single read from an extremity of a full-... 48 0.025
195emb|BX029959.1|CNS08VA3 Single read from an extremity of a full-... 48 0.025
196emb|BX029742.1|CNS08V42 Single read from an extremity of a full-... 48 0.025
197emb|BX029726.1|CNS08V3M Single read from an extremity of a full-... 48 0.025
198emb|BX029020.1|CNS08UK0 Single read from an extremity of a full-... 48 0.025
199emb|BX028793.1|CNS08UDP Single read from an extremity of a full-... 48 0.025
200emb|BX028263.1|CNS08TYZ Single read from an extremity of a full-... 48 0.025
201emb|BX027759.1|CNS08TKZ Single read from an extremity of a full-... 48 0.025
202emb|BX027717.1|CNS08TJT Single read from an extremity of a full-... 48 0.025
203emb|BX027449.1|CNS08TCD Single read from an extremity of a full-... 48 0.025
204emb|BX027226.1|CNS08T66 Single read from an extremity of a full-... 48 0.025
205emb|BX025392.1|CNS08RR8 Single read from an extremity of a full-... 48 0.025
206emb|BX022858.1|CNS08PSU Single read from an extremity of a full-... 48 0.025
207emb|BX024660.1|CNS08R6W Single read from an extremity of a full-... 48 0.025
208emb|BX024607.1|CNS08R5F Single read from an extremity of a full-... 48 0.025
209emb|BX024532.1|CNS08R3C Single read from an extremity of a full-... 48 0.025
210emb|BX024396.1|CNS08QZK Single read from an extremity of a full-... 48 0.025
211emb|BX023991.1|CNS08QOB Single read from an extremity of a full-... 48 0.025
212emb|BX023463.1|CNS08Q9N Single read from an extremity of a full-... 48 0.025
213emb|BX021699.1|CNS08OWN Single read from an extremity of a full-... 48 0.025
214emb|BX021547.1|CNS08OSF Single read from an extremity of a full-... 48 0.025
215emb|BX021239.1|CNS08OJV Single read from an extremity of a full-... 48 0.025
216emb|BX021076.1|CNS08OFC Single read from an extremity of a full-... 48 0.025
217emb|BX020843.1|CNS08O8V Single read from an extremity of a full-... 48 0.025
218emb|BX020804.1|CNS08O7S Single read from an extremity of a full-... 48 0.025
219emb|BX020803.1|CNS08O7R Single read from an extremity of a full-... 48 0.025
220emb|BX020685.1|CNS08O4H Single read from an extremity of a full-... 48 0.025
221emb|BX020465.1|CNS08NYD Single read from an extremity of a full-... 48 0.025
222emb|BX020377.1|CNS08NVX Single read from an extremity of a full-... 48 0.025
223emb|BX019012.1|CNS08MU0 Single read from an extremity of a full-... 48 0.025
224emb|BX018509.1|CNS08MG1 Single read from an extremity of a full-... 48 0.025
225emb|BX017649.1|CNS08LS5 Single read from an extremity of a full-... 48 0.025
226emb|BX017470.1|CNS08LN6 Single read from an extremity of a full-... 48 0.025
227emb|BX017008.1|CNS08LAC Single read from an extremity of a full-... 48 0.025
228emb|BX016928.1|CNS08L84 Single read from an extremity of a full-... 48 0.025
229emb|BX015789.1|CNS08KCH Single read from an extremity of a full-... 48 0.025
230emb|BX015709.1|CNS08KA9 Single read from an extremity of a full-... 48 0.025
231emb|BX016197.1|CNS08KNT Single read from an extremity of a full-... 48 0.025
232emb|BX016195.1|CNS08KNR Single read from an extremity of a full-... 48 0.025
233emb|BX016151.1|CNS08KMJ Single read from an extremity of a full-... 48 0.025
234emb|BX014821.1|CNS08JLL Single read from an extremity of a full-... 48 0.025
235emb|BX014471.1|CNS08JBV Single read from an extremity of a full-... 48 0.025
236emb|BX014327.1|CNS08J7V Single read from an extremity of a full-... 48 0.025
237emb|BX014036.1|CNS08IZS Single read from an extremity of a full-... 48 0.025
238emb|BX013669.1|CNS08IPL Single read from an extremity of a full-... 48 0.025
239emb|BX013009.1|CNS08I79 Single read from an extremity of a full-... 48 0.025
240emb|BX012170.1|CNS08HJY Single read from an extremity of a full-... 48 0.025
241emb|BX011984.1|CNS08HES Single read from an extremity of a full-... 48 0.025
242emb|BX011867.1|CNS08HBJ Single read from an extremity of a full-... 48 0.025
243emb|BX011754.1|CNS08H8E Single read from an extremity of a full-... 48 0.025
244emb|BX010038.1|CNS08FWQ Single read from an extremity of a full-... 48 0.025
245emb|BX008602.1|CNS08ESU Single read from an extremity of a full-... 48 0.025
246emb|BX007885.1|CNS08E8X Single read from an extremity of a full-... 48 0.025
247emb|BX007280.1|CNS08DS4 Single read from an extremity of a full-... 48 0.025
248emb|BX006576.1|CNS08D8K Single read from an extremity of a full-... 48 0.025
249emb|BX005611.1|CNS08CHR Single read from an extremity of a full-... 48 0.025
250emb|X06148.1|RNRPL5 Rat mRNA for ribosomal protein L5 48 0.025
251gb|BC060561.1| Rattus norvegicus ribosomal protein L5, mRNA (cDN... 48 0.025
252emb|BX571699.10| Zebrafish DNA sequence from clone DKEYP-116G9 i... 48 0.025
253ref|NM_031099.1| Rattus norvegicus ribosomal protein L5 (Rpl5), ... 48 0.025
254ref|XM_576632.1| PREDICTED: Rattus norvegicus similar to 60S rib... 48 0.025
255gb|AY961534.1| Lysiphlebus testaceipes ribosomal protein L5 (RpL... 48 0.025
256ref|XM_319782.2| Anopheles gambiae str. PEST ENSANGP00000005182 ... 48 0.025
257ref|XM_552944.1| Anopheles gambiae str. PEST ENSANGP00000025444 ... 48 0.025
258gb|AF002238.1|AF002238 Anopheles gambiae ribosomal protein L5 mR... 48 0.025
259gb|M17419.1|RATRPL5 Rat ribosomal protein L5 mRNA, complete cds 48 0.025
260gb|BC059751.1| Xenopus tropicalis ribosomal protein L5, mRNA (cD... 46 0.10
261ref|XM_755688.1| Ustilago maydis 521 hypothetical protein (UM046... 46 0.10
262emb|CR730103.2|CNS0GQAL Tetraodon nigroviridis full-length cDNA 46 0.10
263emb|CR729659.2|CNS0GPY9 Tetraodon nigroviridis full-length cDNA 46 0.10
264emb|CR728054.2|CNS0GOPO Tetraodon nigroviridis full-length cDNA 46 0.10
265emb|CR727541.2|CNS0GOBF Tetraodon nigroviridis full-length cDNA 46 0.10
266emb|CR725780.2|CNS0GMYI Tetraodon nigroviridis full-length cDNA 46 0.10
267emb|CR722852.2|CNS0GKP6 Tetraodon nigroviridis full-length cDNA 46 0.10
268emb|CR722290.2|CNS0GK9K Tetraodon nigroviridis full-length cDNA 46 0.10
269emb|CR720370.2|CNS0GIS8 Tetraodon nigroviridis full-length cDNA 46 0.10
270emb|CR719244.2|CNS0GHWY Tetraodon nigroviridis full-length cDNA 46 0.10
271emb|CR717169.2|CNS0GGBE Tetraodon nigroviridis full-length cDNA 46 0.10
272emb|CR709288.2|CNS0GA8K Tetraodon nigroviridis full-length cDNA 46 0.10
273emb|CR704844.2|CNS0G6T4 Tetraodon nigroviridis full-length cDNA 46 0.10
274emb|CR704596.2|CNS0G6M8 Tetraodon nigroviridis full-length cDNA 46 0.10
275emb|CR704417.2|CNS0G6H9 Tetraodon nigroviridis full-length cDNA 46 0.10
276emb|CR703999.2|CNS0G65N Tetraodon nigroviridis full-length cDNA 46 0.10
277emb|CR703852.2|CNS0G61K Tetraodon nigroviridis full-length cDNA 46 0.10
278emb|CR703555.2|CNS0G5TB Tetraodon nigroviridis full-length cDNA 46 0.10
279emb|CR703497.2|CNS0G5RP Tetraodon nigroviridis full-length cDNA 46 0.10
280emb|CR703217.2|CNS0G5JX Tetraodon nigroviridis full-length cDNA 46 0.10
281emb|CR703110.2|CNS0G5GY Tetraodon nigroviridis full-length cDNA 46 0.10
282emb|CR703107.2|CNS0G5GV Tetraodon nigroviridis full-length cDNA 46 0.10
283emb|CR703055.1|CNS0G5FF Tetraodon nigroviridis full-length cDNA 46 0.10
284emb|CR702541.2|CNS0G515 Tetraodon nigroviridis full-length cDNA 46 0.10
285emb|CR702426.2|CNS0G4XY Tetraodon nigroviridis full-length cDNA 46 0.10
286emb|CR702361.2|CNS0G4W5 Tetraodon nigroviridis full-length cDNA 46 0.10
287emb|CR701868.2|CNS0G4IG Tetraodon nigroviridis full-length cDNA 46 0.10
288emb|CR701805.2|CNS0G4GP Tetraodon nigroviridis full-length cDNA 46 0.10
289emb|CR701730.2|CNS0G4EM Tetraodon nigroviridis full-length cDNA 46 0.10
290emb|CR701666.2|CNS0G4CU Tetraodon nigroviridis full-length cDNA 46 0.10
291emb|CR701171.2|CNS0G3Z3 Tetraodon nigroviridis full-length cDNA 46 0.10
292emb|CR700989.2|CNS0G3U1 Tetraodon nigroviridis full-length cDNA 46 0.10
293emb|CR700933.2|CNS0G3SH Tetraodon nigroviridis full-length cDNA 46 0.10
294emb|CR700715.2|CNS0G3MF Tetraodon nigroviridis full-length cDNA 46 0.10
295emb|CR700662.2|CNS0G3KY Tetraodon nigroviridis full-length cDNA 46 0.10
296emb|CR700541.2|CNS0G3HL Tetraodon nigroviridis full-length cDNA 46 0.10
297emb|CR700506.2|CNS0G3GM Tetraodon nigroviridis full-length cDNA 46 0.10
298emb|CR700446.2|CNS0G3EY Tetraodon nigroviridis full-length cDNA 46 0.10
299emb|CR699771.2|CNS0G2W7 Tetraodon nigroviridis full-length cDNA 46 0.10
300emb|CR699748.2|CNS0G2VK Tetraodon nigroviridis full-length cDNA 46 0.10
301emb|CR699716.2|CNS0G2UO Tetraodon nigroviridis full-length cDNA 46 0.10
302emb|CR699696.2|CNS0G2U4 Tetraodon nigroviridis full-length cDNA 46 0.10
303emb|CR700239.2|CNS0G397 Tetraodon nigroviridis full-length cDNA 46 0.10
304emb|CR700195.2|CNS0G37Z Tetraodon nigroviridis full-length cDNA 46 0.10
305emb|CR699989.2|CNS0G329 Tetraodon nigroviridis full-length cDNA 46 0.10
306emb|CR699587.2|CNS0G2R3 Tetraodon nigroviridis full-length cDNA 46 0.10
307emb|CR699465.2|CNS0G2NP Tetraodon nigroviridis full-length cDNA 46 0.10
308emb|CR699501.1|CNS0G2OP Tetraodon nigroviridis full-length cDNA 46 0.10
309emb|CR699279.2|CNS0G2IJ Tetraodon nigroviridis full-length cDNA 46 0.10
310emb|CR698969.2|CNS0G29X Tetraodon nigroviridis full-length cDNA 46 0.10
311emb|CR698915.2|CNS0G28F Tetraodon nigroviridis full-length cDNA 46 0.10
312emb|CR698294.2|CNS0G1R6 Tetraodon nigroviridis full-length cDNA 46 0.10
313emb|CR698266.2|CNS0G1QE Tetraodon nigroviridis full-length cDNA 46 0.10
314emb|CR698120.2|CNS0G1MC Tetraodon nigroviridis full-length cDNA 46 0.10
315emb|CR697983.2|CNS0G1IJ Tetraodon nigroviridis full-length cDNA 46 0.10
316emb|CR697867.2|CNS0G1FB Tetraodon nigroviridis full-length cDNA 46 0.10
317emb|CR697853.2|CNS0G1EX Tetraodon nigroviridis full-length cDNA 46 0.10
318emb|CR697546.2|CNS0G16E Tetraodon nigroviridis full-length cDNA 46 0.10
319emb|CR697531.2|CNS0G15Z Tetraodon nigroviridis full-length cDNA 46 0.10
320emb|CR697773.2|CNS0G1CP Tetraodon nigroviridis full-length cDNA 46 0.10
321emb|CR697693.2|CNS0G1AH Tetraodon nigroviridis full-length cDNA 46 0.10
322emb|CR697670.2|CNS0G19U Tetraodon nigroviridis full-length cDNA 46 0.10
323emb|CR697271.2|CNS0G0YR Tetraodon nigroviridis full-length cDNA 46 0.10
324emb|CR697111.2|CNS0G0UB Tetraodon nigroviridis full-length cDNA 46 0.10
325emb|CR696616.2|CNS0G0GK Tetraodon nigroviridis full-length cDNA 46 0.10
326emb|CR696160.2|CNS0G03W Tetraodon nigroviridis full-length cDNA 46 0.10
327emb|CR696095.2|CNS0G023 Tetraodon nigroviridis full-length cDNA 46 0.10
328emb|CR696075.2|CNS0G01J Tetraodon nigroviridis full-length cDNA 46 0.10
329emb|CR696044.2|CNS0G00O Tetraodon nigroviridis full-length cDNA 46 0.10
330emb|CR695890.2|CNS0FZWE Tetraodon nigroviridis full-length cDNA 46 0.10
331emb|CR695438.2|CNS0FZJU Tetraodon nigroviridis full-length cDNA 46 0.10
332emb|CR695189.2|CNS0FZCX Tetraodon nigroviridis full-length cDNA 46 0.10
333emb|CR695145.2|CNS0FZBP Tetraodon nigroviridis full-length cDNA 46 0.10
334emb|CR694536.2|CNS0FYUS Tetraodon nigroviridis full-length cDNA 46 0.10
335emb|CR694481.2|CNS0FYT9 Tetraodon nigroviridis full-length cDNA 46 0.10
336emb|CR694087.2|CNS0FYIB Tetraodon nigroviridis full-length cDNA 46 0.10
337emb|CR693775.2|CNS0FY9N Tetraodon nigroviridis full-length cDNA 46 0.10
338emb|CR693406.2|CNS0FXZE Tetraodon nigroviridis full-length cDNA 46 0.10
339emb|CR693369.2|CNS0FXYD Tetraodon nigroviridis full-length cDNA 46 0.10
340emb|CR693210.2|CNS0FXTY Tetraodon nigroviridis full-length cDNA 46 0.10
341emb|CR693401.1|CNS0FXZ9 Tetraodon nigroviridis full-length cDNA 46 0.10
342emb|CR692926.2|CNS0FXM2 Tetraodon nigroviridis full-length cDNA 46 0.10
343emb|CR692343.2|CNS0FX5V Tetraodon nigroviridis full-length cDNA 46 0.10
344emb|CR692306.2|CNS0FX4U Tetraodon nigroviridis full-length cDNA 46 0.10
345emb|CR691817.2|CNS0FWR9 Tetraodon nigroviridis full-length cDNA 46 0.10
346emb|CR691654.2|CNS0FWMQ Tetraodon nigroviridis full-length cDNA 46 0.10
347emb|CR691545.2|CNS0FWJP Tetraodon nigroviridis full-length cDNA 46 0.10
348emb|CR691542.2|CNS0FWJM Tetraodon nigroviridis full-length cDNA 46 0.10
349emb|CR691490.2|CNS0FWI6 Tetraodon nigroviridis full-length cDNA 46 0.10
350emb|CR685803.2|CNS0FS47 Tetraodon nigroviridis full-length cDNA 46 0.10
351emb|CR690932.2|CNS0FW2O Tetraodon nigroviridis full-length cDNA 46 0.10
352emb|CR690664.2|CNS0FVV8 Tetraodon nigroviridis full-length cDNA 46 0.10
353emb|CR688444.2|CNS0FU5K Tetraodon nigroviridis full-length cDNA 46 0.10
354emb|CR690185.2|CNS0FVHX Tetraodon nigroviridis full-length cDNA 46 0.10
355emb|CR689628.2|CNS0FV2G Tetraodon nigroviridis full-length cDNA 46 0.10
356emb|CR689780.1|CNS0FV6O Tetraodon nigroviridis full-length cDNA 46 0.10
357emb|CR689211.2|CNS0FUQV Tetraodon nigroviridis full-length cDNA 46 0.10
358emb|CR689187.2|CNS0FUQ7 Tetraodon nigroviridis full-length cDNA 46 0.10
359emb|CR688926.2|CNS0FUIY Tetraodon nigroviridis full-length cDNA 46 0.10
360emb|CR688167.2|CNS0FTXV Tetraodon nigroviridis full-length cDNA 46 0.10
361emb|CR687619.2|CNS0FTIN Tetraodon nigroviridis full-length cDNA 46 0.10
362emb|CR687552.2|CNS0FTGS Tetraodon nigroviridis full-length cDNA 46 0.10
363emb|CR687490.2|CNS0FTF2 Tetraodon nigroviridis full-length cDNA 46 0.10
364emb|CR687573.1|CNS0FTHD Tetraodon nigroviridis full-length cDNA 46 0.10
365emb|CR686725.2|CNS0FSTT Tetraodon nigroviridis full-length cDNA 46 0.10
366emb|CR686675.2|CNS0FSSF Tetraodon nigroviridis full-length cDNA 46 0.10
367emb|CR685750.2|CNS0FS2Q Tetraodon nigroviridis full-length cDNA 46 0.10
368emb|CR685476.2|CNS0FRV4 Tetraodon nigroviridis full-length cDNA 46 0.10
369emb|CR685634.1|CNS0FRZI Tetraodon nigroviridis full-length cDNA 46 0.10
370emb|CR685025.2|CNS0FRIL Tetraodon nigroviridis full-length cDNA 46 0.10
371emb|CR684820.2|CNS0FRCW Tetraodon nigroviridis full-length cDNA 46 0.10
372emb|CR684676.2|CNS0FR8W Tetraodon nigroviridis full-length cDNA 46 0.10
373emb|CR684425.2|CNS0FR1X Tetraodon nigroviridis full-length cDNA 46 0.10
374emb|CR684387.2|CNS0FR0V Tetraodon nigroviridis full-length cDNA 46 0.10
375emb|CR684386.2|CNS0FR0U Tetraodon nigroviridis full-length cDNA 46 0.10
376emb|CR682060.2|CNS0FP88 Tetraodon nigroviridis full-length cDNA 46 0.10
377emb|CR684357.2|CNS0FR01 Tetraodon nigroviridis full-length cDNA 46 0.10
378emb|CR683638.2|CNS0FQG2 Tetraodon nigroviridis full-length cDNA 46 0.10
379emb|CR683227.2|CNS0FQ4N Tetraodon nigroviridis full-length cDNA 46 0.10
380emb|CR683096.2|CNS0FQ10 Tetraodon nigroviridis full-length cDNA 46 0.10
381emb|CR682948.2|CNS0FPWW Tetraodon nigroviridis full-length cDNA 46 0.10
382emb|CR682898.2|CNS0FPVI Tetraodon nigroviridis full-length cDNA 46 0.10
383emb|CR682771.2|CNS0FPRZ Tetraodon nigroviridis full-length cDNA 46 0.10
384emb|CR682767.2|CNS0FPRV Tetraodon nigroviridis full-length cDNA 46 0.10
385emb|CR682482.2|CNS0FPJY Tetraodon nigroviridis full-length cDNA 46 0.10
386emb|CR682151.2|CNS0FPAR Tetraodon nigroviridis full-length cDNA 46 0.10
387emb|CR681699.2|CNS0FOY7 Tetraodon nigroviridis full-length cDNA 46 0.10
388emb|CR681501.2|CNS0FOSP Tetraodon nigroviridis full-length cDNA 46 0.10
389emb|CR680985.2|CNS0FOED Tetraodon nigroviridis full-length cDNA 46 0.10
390emb|CR680900.2|CNS0FOC0 Tetraodon nigroviridis full-length cDNA 46 0.10
391emb|CR680179.2|CNS0FNRZ Tetraodon nigroviridis full-length cDNA 46 0.10
392emb|CR679365.2|CNS0FN5D Tetraodon nigroviridis full-length cDNA 46 0.10
393emb|CR678537.2|CNS0FMID Tetraodon nigroviridis full-length cDNA 46 0.10
394emb|CR678533.2|CNS0FMI9 Tetraodon nigroviridis full-length cDNA 46 0.10
395emb|CR677437.2|CNS0FLO9 Tetraodon nigroviridis full-length cDNA 46 0.10
396emb|CR676527.2|CNS0FKYZ Tetraodon nigroviridis full-length cDNA 46 0.10
397emb|CR676431.2|CNS0FKWB Tetraodon nigroviridis full-length cDNA 46 0.10
398emb|CR676424.2|CNS0FKW4 Tetraodon nigroviridis full-length cDNA 46 0.10
399emb|CR676130.2|CNS0FKO8 Tetraodon nigroviridis full-length cDNA 46 0.10
400emb|CR676010.1|CNS0FKKW Tetraodon nigroviridis full-length cDNA 46 0.10
401emb|CR675331.2|CNS0FK21 Tetraodon nigroviridis full-length cDNA 46 0.10
402emb|CR675702.1|CNS0FKCC Tetraodon nigroviridis full-length cDNA 46 0.10
403emb|CR675431.2|CNS0FK4T Tetraodon nigroviridis full-length cDNA 46 0.10
404emb|CR675114.1|CNS0FJW0 Tetraodon nigroviridis full-length cDNA 46 0.10
405emb|CR674905.2|CNS0FJQ7 Tetraodon nigroviridis full-length cDNA 46 0.10
406emb|CR673581.1|CNS0FIPF Tetraodon nigroviridis full-length cDNA 46 0.10
407emb|CR672131.2|CNS0FHL5 Tetraodon nigroviridis full-length cDNA 46 0.10
408emb|CR672250.2|CNS0FHOG Tetraodon nigroviridis full-length cDNA 46 0.10
409emb|CR671771.2|CNS0FHB5 Tetraodon nigroviridis full-length cDNA 46 0.10
410emb|CR671080.2|CNS0FGRY Tetraodon nigroviridis full-length cDNA 46 0.10
411emb|CR671423.2|CNS0FH1H Tetraodon nigroviridis full-length cDNA 46 0.10
412emb|CR670499.1|CNS0FGBT Tetraodon nigroviridis full-length cDNA 46 0.10
413emb|CR669900.2|CNS0FFV6 Tetraodon nigroviridis full-length cDNA 46 0.10
414emb|CR669601.2|CNS0FFMV Tetraodon nigroviridis full-length cDNA 46 0.10
415emb|CR667861.2|CNS0FEAJ Tetraodon nigroviridis full-length cDNA 46 0.10
416emb|CR667698.2|CNS0FE60 Tetraodon nigroviridis full-length cDNA 46 0.10
417emb|CR667278.2|CNS0FDUC Tetraodon nigroviridis full-length cDNA 46 0.10
418emb|CR667206.2|CNS0FDSC Tetraodon nigroviridis full-length cDNA 46 0.10
419emb|CR667158.2|CNS0FDR0 Tetraodon nigroviridis full-length cDNA 46 0.10
420emb|CR667115.2|CNS0FDPT Tetraodon nigroviridis full-length cDNA 46 0.10
421emb|CR666737.2|CNS0FDFB Tetraodon nigroviridis full-length cDNA 46 0.10
422emb|CR665853.2|CNS0FCQR Tetraodon nigroviridis full-length cDNA 46 0.10
423emb|CR665058.2|CNS0FC4O Tetraodon nigroviridis full-length cDNA 46 0.10
424emb|CR664191.2|CNS0FBGL Tetraodon nigroviridis full-length cDNA 46 0.10
425emb|CR663478.2|CNS0FAWS Tetraodon nigroviridis full-length cDNA 46 0.10
426emb|CR663428.2|CNS0FAVE Tetraodon nigroviridis full-length cDNA 46 0.10
427emb|CR663423.2|CNS0FAV9 Tetraodon nigroviridis full-length cDNA 46 0.10
428emb|CR663390.2|CNS0FAUC Tetraodon nigroviridis full-length cDNA 46 0.10
429emb|CR663548.1|CNS0FAYQ Tetraodon nigroviridis full-length cDNA 46 0.10
430emb|CR662619.2|CNS0FA8X Tetraodon nigroviridis full-length cDNA 46 0.10
431emb|CR662671.2|CNS0FAAD Tetraodon nigroviridis full-length cDNA 46 0.10
432emb|CR662600.1|CNS0FA8E Tetraodon nigroviridis full-length cDNA 46 0.10
433emb|CR661607.2|CNS0F9GT Tetraodon nigroviridis full-length cDNA 46 0.10
434emb|CR660979.2|CNS0F8ZD Tetraodon nigroviridis full-length cDNA 46 0.10
435emb|CR660110.2|CNS0F8B8 Tetraodon nigroviridis full-length cDNA 46 0.10
436emb|CR659675.2|CNS0F7Z5 Tetraodon nigroviridis full-length cDNA 46 0.10
437emb|CR659666.1|CNS0F7YW Tetraodon nigroviridis full-length cDNA 46 0.10
438emb|CR659402.2|CNS0F7RK Tetraodon nigroviridis full-length cDNA 46 0.10
439emb|CR658397.2|CNS0F6ZN Tetraodon nigroviridis full-length cDNA 46 0.10
440emb|CR658352.2|CNS0F6YE Tetraodon nigroviridis full-length cDNA 46 0.10
441emb|CR657093.2|CNS0F5ZF Tetraodon nigroviridis full-length cDNA 46 0.10
442emb|CR656984.2|CNS0F5WE Tetraodon nigroviridis full-length cDNA 46 0.10
443emb|CR655091.2|CNS0F4FT Tetraodon nigroviridis full-length cDNA 46 0.10
444emb|CR654183.2|CNS0F3QL Tetraodon nigroviridis full-length cDNA 46 0.10
445emb|CR654200.1|CNS0F3R2 Tetraodon nigroviridis full-length cDNA 46 0.10
446emb|CR652297.2|CNS0F2A7 Tetraodon nigroviridis full-length cDNA 46 0.10
447emb|CR652599.2|CNS0F2IL Tetraodon nigroviridis full-length cDNA 46 0.10
448emb|CR646430.2|CNS0EXR8 Tetraodon nigroviridis full-length cDNA 46 0.10
449emb|CR645958.2|CNS0EXE4 Tetraodon nigroviridis full-length cDNA 46 0.10
450emb|CR645538.2|CNS0EX2G Tetraodon nigroviridis full-length cDNA 46 0.10
451emb|CR645295.2|CNS0EWVP Tetraodon nigroviridis full-length cDNA 46 0.10
452emb|CR642880.2|CNS0EV0M Tetraodon nigroviridis full-length cDNA 46 0.10
453emb|CR640133.2|CNS0ESWB Tetraodon nigroviridis full-length cDNA 46 0.10
454emb|CR639152.2|CNS0ES52 Tetraodon nigroviridis full-length cDNA 46 0.10
455emb|CR638561.2|CNS0ERON Tetraodon nigroviridis full-length cDNA 46 0.10
456emb|CR637802.2|CNS0ER3K Tetraodon nigroviridis full-length cDNA 46 0.10
457emb|CR637502.1|CNS0EQV8 Tetraodon nigroviridis full-length cDNA 46 0.10
458emb|CR636774.2|CNS0EQB0 Tetraodon nigroviridis full-length cDNA 46 0.10
459emb|CR636323.2|CNS0EPYH Tetraodon nigroviridis full-length cDNA 46 0.10
460emb|CR635209.2|CNS0EP3J Tetraodon nigroviridis full-length cDNA 46 0.10
461emb|BX060816.1|CNS09J38 Single read from an extremity of a full-... 46 0.10
462emb|BX022848.1|CNS08PSK Single read from an extremity of a full-... 46 0.10
463emb|BX020477.1|CNS08NYP Single read from an extremity of a full-... 46 0.10
464ref|NM_203550.1| Xenopus tropicalis ribosomal protein L5 (rpl5),... 46 0.10
465gb|AY096006.1| Branchiostoma belcheri tsingtaunese ribosomal pro... 46 0.10
466ref|XM_346313.2| PREDICTED: Rattus norvegicus similar to ribosom... 46 0.10
467gb|DQ206472.1| Platynereis dumerilii isolate TOA21 ribosomal pro... 46 0.10
468ref|XM_653525.1| Aspergillus nidulans FGSC A4 60S ribosomal prot... 44 0.40
469emb|CR684851.2|CNS0FRDR Tetraodon nigroviridis full-length cDNA 44 0.40
470gb|DQ206554.1| Leucosolenia sp. AR-2003 isolate TOA21 ribosomal ... 44 0.40
471gb|BC106128.1| Mus musculus ribosomal protein L5, mRNA (cDNA clo... 42 1.6
472gb|BC083318.1| Mus musculus ribosomal protein L5, mRNA (cDNA clo... 42 1.6
473gb|AC084780.10| Mus musculus chromosome 5, clone RP23-212N20, co... 42 1.6
474gb|BC065687.1| Danio rerio ribosomal protein L5a, mRNA (cDNA clo... 42 1.6
475gb|BC049035.1| Danio rerio ribosomal protein L5a, mRNA (cDNA clo... 42 1.6
476gb|AC166779.3| Mus musculus chromosome 18, clone RP23-399N10, co... 42 1.6
477ref|NM_016980.1| Mus musculus ribosomal protein L5 (Rpl5), mRNA 42 1.6
478gb|DQ440352.1| Aedes aegypti clone AET-453 60S ribosomal protein... 42 1.6
479gb|AC134595.3| Mus musculus BAC clone RP23-388E14 from chromosom... 42 1.6
480ref|NM_199756.1| Danio rerio ribosomal protein L5a (rpl5a), mRNA 42 1.6
481ref|XM_001005224.1| PREDICTED: Mus musculus similar to 60S ribos... 42 1.6
482gb|BC067999.1| Xenopus tropicalis ubiquitin protein ligase E3A (... 42 1.6
483gb|AC124467.3| Mus musculus BAC clone RP24-163L18 from chromosom... 42 1.6
484ref|XR_004839.1| PREDICTED: Mus musculus similar to 60S ribosoma... 42 1.6
485ref|XR_002121.1| PREDICTED: Mus musculus similar to 60S ribosoma... 42 1.6
486ref|XR_002783.1| PREDICTED: Mus musculus similar to 60S ribosoma... 42 1.6
487ref|XM_907186.1| PREDICTED: Mus musculus similar to 60S ribosoma... 42 1.6
488ref|XM_979543.1| PREDICTED: Mus musculus similar to 60S ribosoma... 42 1.6
489ref|XM_976689.1| PREDICTED: Mus musculus similar to 60S ribosoma... 42 1.6
490gb|AC126410.12| Mus musculus chromosome 5, clone RP23-368H6, com... 42 1.6
491gb|AC122915.2| Mus musculus BAC clone RP23-27G7 from 5, complete... 42 1.6
492gb|AC121789.2| Mus musculus BAC clone RP23-398C14 from 1, comple... 42 1.6
493emb|CR670698.2|CNS0FGHC Tetraodon nigroviridis full-length cDNA 42 1.6
494ref|NM_001001213.1| Xenopus tropicalis ubiquitin protein ligase ... 42 1.6
495emb|AL645923.14| Mouse DNA sequence from clone RP23-75H1 on chro... 42 1.6
496emb|AL031528.1|SPBC11C11 S.pombe chromosome II cosmid c11C11 42 1.6
497emb|CR938621.1| Single read from an extremity of a full-length c... 42 1.6
498emb|CR938548.1| Single read from an extremity of a full-length c... 42 1.6
499emb|CR938504.1| Single read from an extremity of a full-length c... 42 1.6
500emb|CR938450.1| Single read from an extremity of a full-length c... 42 1.6

>emb|X64622.1|OS5SRRNMR O.sativa Rrl5 mRNA for 5S ribosomal RNA
          Length = 1114

 Score =  404 bits (204), Expect = e-109
 Identities = 380/436 (87%), Gaps = 2/436 (0%)
 Strand = Plus / Plus

                                                                       
Query: 8   gtcaagaaccagnaagaccagggcgtactccaagcgtttccaagtcaagttcaagagaag 67
           ||||||| |||| |||||||  || |||| |||||||||||||||||||||||||||| |
Sbjct: 13  gtcaagacccag-aagaccaatgcctactacaagcgtttccaagtcaagttcaagagacg 71

                                                                       
Query: 68  gcgtcaggggaagaccgactacagggcaaggctgaggctcacgaaccaggacaagaacaa 127
           | | ||||| ||||| ||||||||||| ||| | |||||||| ||||| || ||||||||
Sbjct: 72  gaggcagggcaagactgactacagggccaggattaggctcaccaaccaagataagaacaa 131

                                                                       
Query: 128 gtacaatacccccaagtaccgctttgtcgtgcgatttaccaacaagggatgtcactgccc 187
           |||||| || || ||||||||||| || ||| ||||||| ||||| | || |||| || |
Sbjct: 132 gtacaacacaccgaagtaccgcttcgttgtgagatttacaaacaaag-atatcacagctc 190

                                                                       
Query: 188 aaattgtttatgctaccattgctggtgatatcgtgatggctgctgcctactcccatgagt 247
           ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 191 aaattgtctatgctaccattgctggtgatatcgtgatggctgctgcctactcccatgagc 250

                                                                       
Query: 248 tgcctcgctatggtcttgacgttggactcaccaactatgctgcagcctactgcactggtc 307
           ||||||||||||||||||| ||||| |||||||||||||| ||||| || ||||||||  
Sbjct: 251 tgcctcgctatggtcttgaagttggtctcaccaactatgcggcagcttattgcactggct 310

                                                                       
Query: 308 tgcttttggctcgtcgtgtgctcaagtcccgtgatctggatgaggagtatgaaggcaatg 367
           ||||||||||||| ||||||||||||  ||||| | ||||  ||||||| || |||||| 
Sbjct: 311 tgcttttggctcgccgtgtgctcaagctccgtggtttggaccaggagtacgagggcaata 370

                                                                       
Query: 368 ttgaggccactggtgaggacttctctgttgagcctgctgatgagaggaggcctttccgtg 427
           ||||||||||||| ||||||| || |||||| || |||||||| ||| ||||||||||||
Sbjct: 371 ttgaggccactggggaggactactatgttgaaccagctgatgaaaggcggcctttccgtg 430

                           
Query: 428 cgctcttggatgttgg 443
           | ||||||||||||||
Sbjct: 431 ctctcttggatgttgg 446



to top

>dbj|AK104693.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-036-H05, full
           insert sequence
          Length = 1219

 Score =  400 bits (202), Expect = e-108
 Identities = 356/406 (87%), Gaps = 1/406 (0%)
 Strand = Plus / Plus

                                                                       
Query: 38  caagcgtttccaagtcaagttcaagagaaggcgtcaggggaagaccgactacagggcaag 97
           |||||||||||||||||||||||||||| || | ||||| ||||| ||||||||||| ||
Sbjct: 129 caagcgtttccaagtcaagttcaagagacggaggcagggcaagactgactacagggccag 188

                                                                       
Query: 98  gctgaggctcacgaaccaggacaagaacaagtacaatacccccaagtaccgctttgtcgt 157
           | | |||||||| ||||| || |||||||||||||| || || ||||||||||| || ||
Sbjct: 189 gattaggctcaccaaccaagataagaacaagtacaacacaccgaagtaccgcttcgttgt 248

                                                                       
Query: 158 gcgatttaccaacaagggatgtcactgcccaaattgtttatgctaccattgctggtgata 217
           | ||||||| ||||| | || |||| || |||||||| ||||||||||||||||||||||
Sbjct: 249 gagatttacaaacaaag-atatcacagctcaaattgtctatgctaccattgctggtgata 307

                                                                       
Query: 218 tcgtgatggctgctgcctactcccatgagttgcctcgctatggtcttgacgttggactca 277
           ||||||||||||||||||||||||||||| ||||||||||||||||||| ||||| ||||
Sbjct: 308 tcgtgatggctgctgcctactcccatgagctgcctcgctatggtcttgaagttggtctca 367

                                                                       
Query: 278 ccaactatgctgcagcctactgcactggtctgcttttggctcgtcgtgtgctcaagtccc 337
           |||||||||| ||||| || ||||||||  ||||||||||||| ||||||||||||  ||
Sbjct: 368 ccaactatgcggcagcttattgcactggcttgcttttggctcgccgtgtgctcaagctcc 427

                                                                       
Query: 338 gtgatctggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgttg 397
           ||| | ||||  ||||||| || |||||| ||||||||||||| ||||||| || |||||
Sbjct: 428 gtggtttggaccaggagtacgagggcaatattgaggccactggggaggactactatgttg 487

                                                         
Query: 398 agcctgctgatgagaggaggcctttccgtgcgctcttggatgttgg 443
           | || |||||||| ||| ||||||||||||| ||||||||||||||
Sbjct: 488 aaccagctgatgaaaggcggcctttccgtgctctcttggatgttgg 533



to top

>dbj|AK065268.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002K21, full
           insert sequence
          Length = 1219

 Score =  400 bits (202), Expect = e-108
 Identities = 356/406 (87%), Gaps = 1/406 (0%)
 Strand = Plus / Plus

                                                                       
Query: 38  caagcgtttccaagtcaagttcaagagaaggcgtcaggggaagaccgactacagggcaag 97
           |||||||||||||||||||||||||||| || | ||||| ||||| ||||||||||| ||
Sbjct: 130 caagcgtttccaagtcaagttcaagagacggaggcagggcaagactgactacagggccag 189

                                                                       
Query: 98  gctgaggctcacgaaccaggacaagaacaagtacaatacccccaagtaccgctttgtcgt 157
           | | |||||||| ||||| || |||||||||||||| || || ||||||||||| || ||
Sbjct: 190 gattaggctcaccaaccaagataagaacaagtacaacacaccgaagtaccgcttcgttgt 249

                                                                       
Query: 158 gcgatttaccaacaagggatgtcactgcccaaattgtttatgctaccattgctggtgata 217
           | ||||||| ||||| | || |||| || |||||||| ||||||||||||||||||||||
Sbjct: 250 gagatttacaaacaaag-atatcacagctcaaattgtctatgctaccattgctggtgata 308

                                                                       
Query: 218 tcgtgatggctgctgcctactcccatgagttgcctcgctatggtcttgacgttggactca 277
           ||||||||||||||||||||||||||||| ||||||||||||||||||| ||||| ||||
Sbjct: 309 tcgtgatggctgctgcctactcccatgagctgcctcgctatggtcttgaagttggtctca 368

                                                                       
Query: 278 ccaactatgctgcagcctactgcactggtctgcttttggctcgtcgtgtgctcaagtccc 337
           |||||||||| ||||| || ||||||||  ||||||||||||| ||||||||||||  ||
Sbjct: 369 ccaactatgcggcagcttattgcactggcttgcttttggctcgccgtgtgctcaagctcc 428

                                                                       
Query: 338 gtgatctggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgttg 397
           ||| | ||||  ||||||| || |||||| ||||||||||||| ||||||| || |||||
Sbjct: 429 gtggtttggaccaggagtacgagggcaatattgaggccactggggaggactactatgttg 488

                                                         
Query: 398 agcctgctgatgagaggaggcctttccgtgcgctcttggatgttgg 443
           | || |||||||| ||| ||||||||||||| ||||||||||||||
Sbjct: 489 aaccagctgatgaaaggcggcctttccgtgctctcttggatgttgg 534



to top

>gb|BT016417.1| Zea mays clone Contig250 mRNA sequence
          Length = 1212

 Score =  345 bits (174), Expect = 8e-92
 Identities = 373/438 (85%), Gaps = 1/438 (0%)
 Strand = Plus / Plus

                                                                       
Query: 21  aagaccagggcgtactccaagcgtttccaagtcaagttcaagagaaggcgtcaggggaag 80
           |||||||  ||||| | ||| ||||||||||| || ||||||||||||||    || |||
Sbjct: 99  aagaccaatgcgtatttcaaacgtttccaagtgaaattcaagagaaggcgggctggcaag 158

                                                                       
Query: 81  accgactacagggcaaggctgaggctcacgaaccaggacaagaacaagtacaataccccc 140
           || ||||||||||| ||| | ||||| |  ||||| ||||| ||||||||||| || |||
Sbjct: 159 acagactacagggccaggataaggctgattaaccaagacaaaaacaagtacaacacaccc 218

                                                                       
Query: 141 aagtaccgctttgtcgtgcgatttaccaacaagggatgtcactgcccaaattgtttatgc 200
           || ||| | ||||| ||||||||||||||||||| |  |||||||||||||  | | |||
Sbjct: 219 aaatacagatttgttgtgcgatttaccaacaagg-acatcactgcccaaatcatatctgc 277

                                                                       
Query: 201 taccattgctggtgatatcgtgatggctgctgcctactcccatgagttgcctcgctatgg 260
           ||  || || |||||||| ||  | ||| |||||||||| ||||||||||| || |||||
Sbjct: 278 tagtatagcgggtgatatggttcttgcttctgcctactcgcatgagttgccacgatatgg 337

                                                                       
Query: 261 tcttgacgttggactcaccaactatgctgcagcctactgcactggtctgcttttggctcg 320
           |||||| ||||| || ||||||||||| || |||||||||||||| || || ||||||||
Sbjct: 338 tcttgaagttggtctgaccaactatgcagctgcctactgcactggccttctgttggctcg 397

                                                                       
Query: 321 tcgtgtgctcaagtcccgtgatctggatgaggagtatgaaggcaatgttgaggccactgg 380
            ||||||||||||  ||||| | ||||| ||||||| || ||||||||||||||||||||
Sbjct: 398 ccgtgtgctcaagatccgtggtttggatcaggagtacgagggcaatgttgaggccactgg 457

                                                                       
Query: 381 tgaggacttctctgttgagcctgctgatgagaggaggcctttccgtgcgctcttggatgt 440
           ||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||
Sbjct: 458 tgaggacttctctgttgagccagctgatgagaggaggcctttccgtgctctcttggatgt 517

                             
Query: 441 tggtcttatcaggactac 458
           ||| ||||||||||||||
Sbjct: 518 tggccttatcaggactac 535



to top

>gb|BT016492.1| Zea mays clone Contig325 mRNA sequence
          Length = 1365

 Score =  321 bits (162), Expect = 1e-84
 Identities = 361/426 (84%), Gaps = 1/426 (0%)
 Strand = Plus / Plus

                                                                       
Query: 33  tactccaagcgtttccaagtcaagttcaagagaaggcgtcaggggaagaccgactacagg 92
           |||| |||||||||||| || |||||||||||||||||    || ||||| |||||||||
Sbjct: 96  tacttcaagcgtttccaggtgaagttcaagagaaggcgcgctggcaagacagactacagg 155

                                                                       
Query: 93  gcaaggctgaggctcacgaaccaggacaagaacaagtacaatacccccaagtaccgcttt 152
           || ||| | ||||| |  ||||| ||||| |||||||||||||| ||||| ||| | |||
Sbjct: 156 gccaggataaggctgattaaccaagacaaaaacaagtacaatacacccaaatacagattt 215

                                                                       
Query: 153 gtcgtgcgatttaccaacaagggatgtcactgcccaaattgtttatgctaccattgctgg 212
           || ||||||||||||||||||| |  |||| || |||||  | | |||||  || || ||
Sbjct: 216 gttgtgcgatttaccaacaagg-acatcacagcacaaatcatatctgctagtatagcagg 274

                                                                       
Query: 213 tgatatcgtgatggctgctgcctactcccatgagttgcctcgctatggtcttgacgttgg 272
           |||||| ||  | ||| |||| ||||| ||||||||||| || |||||||| || |||||
Sbjct: 275 tgatatggttcttgcttctgcttactcgcatgagttgccacgatatggtctcgaagttgg 334

                                                                       
Query: 273 actcaccaactatgctgcagcctactgcactggtctgcttttggctcgtcgtgtgctcaa 332
            || ||||||||||| || |||||||||||||| || || |||||||| |||||||||||
Sbjct: 335 tctgaccaactatgcagctgcctactgcactggccttctgttggctcgccgtgtgctcaa 394

                                                                       
Query: 333 gtcccgtgatctggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctc 392
           | |||||| | | ||| |||| ||||| ||||||||||||||||||||||||||||||||
Sbjct: 395 gacccgtggtttagataaggaatatgagggcaatgttgaggccactggtgaggacttctc 454

                                                                       
Query: 393 tgttgagcctgctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcag 452
           ||||||||| |||||||||||||||||||||||||| |||||||||||||| ||||| ||
Sbjct: 455 tgttgagccagctgatgagaggaggcctttccgtgctctcttggatgttggccttattag 514

                 
Query: 453 gactac 458
           ||||||
Sbjct: 515 gactac 520



to top

>gb|AY109375.1| Zea mays CL457_2 mRNA sequence
          Length = 1397

 Score =  305 bits (154), Expect = 7e-80
 Identities = 360/429 (83%), Gaps = 1/429 (0%)
 Strand = Plus / Plus

                                                                       
Query: 30  gcgtactccaagcgtttccaagtcaagttcaagagaaggcgtcaggggaagaccgactac 89
           ||||||| |||||||||||| || |||||||||||||||||    || ||||| ||||||
Sbjct: 109 gcgtacttcaagcgtttccaggtgaagttcaagagaaggcgcgctggcaagacagactac 168

                                                                       
Query: 90  agggcaaggctgaggctcacgaaccaggacaagaacaagtacaatacccccaagtaccgc 149
           ||||| ||| | ||||| |  ||||| |||     |||||||||||| ||||| ||| | 
Sbjct: 169 agggccaggataaggctgattaaccaagacnnnnncaagtacaatacacccaaatacaga 228

                                                                       
Query: 150 tttgtcgtgcgatttaccaacaagggatgtcactgcccaaattgtttatgctaccattgc 209
           ||||| ||||||||||||||||||| |  |||| || |||||  | | |||||  || ||
Sbjct: 229 tttgttgtgcgatttaccaacaagg-acatcacagcacaaatcatctctgctagtatagc 287

                                                                       
Query: 210 tggtgatatcgtgatggctgctgcctactcccatgagttgcctcgctatggtcttgacgt 269
            |||||||| ||  | ||| |||| ||||| ||||||||||| || ||||||||||| ||
Sbjct: 288 aggtgatatggttcttgcttctgcttactcgcatgagttgccacgatatggtcttgaagt 347

                                                                       
Query: 270 tggactcaccaactatgctgcagcctactgcactggtctgcttttggctcgtcgtgtgct 329
           ||| || ||||||||||| || |||||||||||||| || || |||||||| ||||||||
Sbjct: 348 tggtctgaccaactatgcagctgcctactgcactggccttctgttggctcgccgtgtgct 407

                                                                       
Query: 330 caagtcccgtgatctggatgaggagtatgaaggcaatgttgaggccactggtgaggactt 389
           |||| |||||| | | ||| |||| ||||| |||||||||||||||||||||||||| ||
Sbjct: 408 caagacccgtggtttagataaggaatatgagggcaatgttgaggccactggtgaggattt 467

                                                                       
Query: 390 ctctgttgagcctgctgatgagaggaggcctttccgtgcgctcttggatgttggtcttat 449
           |||||||||||| |||||||||||||||||||||||||| |||||||||||||| |||||
Sbjct: 468 ctctgttgagccagctgatgagaggaggcctttccgtgctctcttggatgttggccttat 527

                    
Query: 450 caggactac 458
            ||||||||
Sbjct: 528 taggactac 536



to top

>ref|NM_190270.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 906

 Score =  295 bits (149), Expect = 6e-77
 Identities = 230/257 (89%)
 Strand = Plus / Plus

                                                                       
Query: 187 caaattgtttatgctaccattgctggtgatatcgtgatggctgctgcctactcccatgag 246
           |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 181 caaattgtctatgctaccattgctggtgatatcgtgatggctgctgcctactcccatgag 240

                                                                       
Query: 247 ttgcctcgctatggtcttgacgttggactcaccaactatgctgcagcctactgcactggt 306
            ||||||||||||||||||| ||||| |||||||||||||| ||||| || |||||||| 
Sbjct: 241 ctgcctcgctatggtcttgaagttggtctcaccaactatgcggcagcttattgcactggc 300

                                                                       
Query: 307 ctgcttttggctcgtcgtgtgctcaagtcccgtgatctggatgaggagtatgaaggcaat 366
            ||||||||||||| ||||||||||||  ||||| | ||||  ||||||| || ||||||
Sbjct: 301 ttgcttttggctcgccgtgtgctcaagctccgtggtttggaccaggagtacgagggcaat 360

                                                                       
Query: 367 gttgaggccactggtgaggacttctctgttgagcctgctgatgagaggaggcctttccgt 426
            ||||||||||||| ||||||| || |||||| || |||||||| ||| |||||||||||
Sbjct: 361 attgaggccactggggaggactactatgttgaaccagctgatgaaaggcggcctttccgt 420

                            
Query: 427 gcgctcttggatgttgg 443
           || ||||||||||||||
Sbjct: 421 gctctcttggatgttgg 437



 Score =  115 bits (58), Expect = 1e-22
 Identities = 100/114 (87%)
 Strand = Plus / Plus

                                                                       
Query: 38  caagcgtttccaagtcaagttcaagagaaggcgtcaggggaagaccgactacagggcaag 97
           |||||||||||||||||||||||||||| || | ||||| ||||| ||||||||||| ||
Sbjct: 42  caagcgtttccaagtcaagttcaagagacggaggcagggcaagactgactacagggccag 101

                                                                 
Query: 98  gctgaggctcacgaaccaggacaagaacaagtacaatacccccaagtaccgctt 151
           | | |||||||| ||||| || |||||||||||||| || || |||||||||||
Sbjct: 102 gattaggctcaccaaccaagataagaacaagtacaacacaccgaagtaccgctt 155



to top

>ref|NM_190269.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 915

 Score =  295 bits (149), Expect = 6e-77
 Identities = 230/257 (89%)
 Strand = Plus / Plus

                                                                       
Query: 187 caaattgtttatgctaccattgctggtgatatcgtgatggctgctgcctactcccatgag 246
           |||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 190 caaattgtctatgctaccattgcgggtgatatcgtgatggctgctgcctactcccatgag 249

                                                                       
Query: 247 ttgcctcgctatggtcttgacgttggactcaccaactatgctgcagcctactgcactggt 306
            ||||||| ||||||||||| ||||| |||||||||||||| ||||| ||||||||||| 
Sbjct: 250 ctgcctcgttatggtcttgaagttggtctcaccaactatgcggcagcttactgcactggc 309

                                                                       
Query: 307 ctgcttttggctcgtcgtgtgctcaagtcccgtgatctggatgaggagtatgaaggcaat 366
            ||||| |||||||||||||||||| |  ||||| | ||||  ||||||| || ||||||
Sbjct: 310 ttgcttctggctcgtcgtgtgctcacgctccgtggtttggaccaggagtacgagggcaat 369

                                                                       
Query: 367 gttgaggccactggtgaggacttctctgttgagcctgctgatgagaggaggcctttccgt 426
           |||||||||||||| ||||||| || |||||| || |||||||| |||||||||||||||
Sbjct: 370 gttgaggccactggggaggactactatgttgaaccagctgatgaaaggaggcctttccgt 429

                            
Query: 427 gcgctcttggatgttgg 443
           || ||||||||||||||
Sbjct: 430 gctctcttggatgttgg 446



 Score =  109 bits (55), Expect = 8e-21
 Identities = 103/119 (86%)
 Strand = Plus / Plus

                                                                       
Query: 33  tactccaagcgtttccaagtcaagttcaagagaaggcgtcaggggaagaccgactacagg 92
           |||| |||||| ||||||||||||||||||||| || | ||||| ||||| |||||||||
Sbjct: 46  tacttcaagcgattccaagtcaagttcaagagacggaggcagggcaagactgactacagg 105

                                                                      
Query: 93  gcaaggctgaggctcacgaaccaggacaagaacaagtacaatacccccaagtaccgctt 151
           || ||| | |||||||| ||||| || |||||||||||||| || || |||||||||||
Sbjct: 106 gccaggattaggctcaccaaccaagataagaacaagtacaacacaccgaagtaccgctt 164



to top

>gb|AY106024.1| Zea mays PCO063168 mRNA sequence
          Length = 620

 Score =  248 bits (125), Expect = 1e-62
 Identities = 206/233 (88%)
 Strand = Plus / Plus

                                                                       
Query: 226 gctgctgcctactcccatgagttgcctcgctatggtcttgacgttggactcaccaactat 285
           |||||||| || |||| |||| |||| || || ||||| || ||||| || |||||||||
Sbjct: 127 gctgctgcatattcccgtgagctgccacgatacggtctagaagttggtctgaccaactat 186

                                                                       
Query: 286 gctgcagcctactgcactggtctgcttttggctcgtcgtgtgctcaagtcccgtgatctg 345
           ||||||||||||||||||||||| ||||||||||||||||| ||||||  ||||||| ||
Sbjct: 187 gctgcagcctactgcactggtcttcttttggctcgtcgtgttctcaagatccgtgatttg 246

                                                                       
Query: 346 gatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgttgagcctgct 405
           ||| |||||||||| ||||||||||||||||||||||||||||||||||| ||||| || 
Sbjct: 247 gatcaggagtatgagggcaatgttgaggccactggtgaggacttctctgtcgagccagcg 306

                                                                
Query: 406 gatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggactac 458
           || |||||||||||||||||||| ||||| ||||| || ||||| ||||||||
Sbjct: 307 gaagagaggaggcctttccgtgccctcttagatgtcggccttattaggactac 359



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 56/64 (87%)
 Strand = Plus / Plus

                                                                       
Query: 111 aaccaggacaagaacaagtacaatacccccaagtaccgctttgtcgtgcgatttaccaac 170
           ||||| |||||||||||||||||||| ||||| ||||| |||   |||||||| ||||||
Sbjct: 13  aaccaagacaagaacaagtacaatacacccaaataccgatttantgtgcgattnaccaac 72

               
Query: 171 aagg 174
           ||||
Sbjct: 73  aagg 76



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  170 bits (86), Expect = 3e-39
 Identities = 101/106 (95%)
 Strand = Plus / Plus

                                                                            
Query: 187      caaattgtttatgctaccattgctggtgatatcgtgatggctgctgcctactcccatgag 246
                |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 38968063 caaattgtctatgctaccattgctggtgatatcgtgatggctgctgcctactcccatgag 38968122

                                                              
Query: 247      ttgcctcgctatggtcttgacgttggactcaccaactatgctgcag 292
                 ||||||||||||||||||| ||||| |||||||||||||| ||||
Sbjct: 38968123 ctgcctcgctatggtcttgaagttggtctcaccaactatgcggcag 38968168



 Score =  155 bits (78), Expect = 2e-34
 Identities = 99/106 (93%)
 Strand = Plus / Plus

                                                                            
Query: 187      caaattgtttatgctaccattgctggtgatatcgtgatggctgctgcctactcccatgag 246
                |||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 38962753 caaattgtctatgctaccattgcgggtgatatcgtgatggctgctgcctactcccatgag 38962812

                                                              
Query: 247      ttgcctcgctatggtcttgacgttggactcaccaactatgctgcag 292
                 ||||||| ||||||||||| ||||| |||||||||||||| ||||
Sbjct: 38962813 ctgcctcgttatggtcttgaagttggtctcaccaactatgcggcag 38962858



 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 66/73 (90%)
 Strand = Plus / Plus

                                                                            
Query: 371      aggccactggtgaggacttctctgttgagcctgctgatgagaggaggcctttccgtgcgc 430
                |||||||||| ||||||| || |||||| || |||||||| ||||||||||||||||| |
Sbjct: 38963110 aggccactggggaggactactatgttgaaccagctgatgaaaggaggcctttccgtgctc 38963169

                             
Query: 431      tcttggatgttgg 443
                |||||||||||||
Sbjct: 38963170 tcttggatgttgg 38963182



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 65/73 (89%)
 Strand = Plus / Plus

                                                                            
Query: 371      aggccactggtgaggacttctctgttgagcctgctgatgagaggaggcctttccgtgcgc 430
                |||||||||| ||||||| || |||||| || |||||||| ||| ||||||||||||| |
Sbjct: 38968426 aggccactggggaggactactatgttgaaccagctgatgaaaggcggcctttccgtgctc 38968485

                             
Query: 431      tcttggatgttgg 443
                |||||||||||||
Sbjct: 38968486 tcttggatgttgg 38968498



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 78/92 (84%)
 Strand = Plus / Plus

                                                                            
Query: 73       aggggaagaccgactacagggcaaggctgaggctcacgaaccaggacaagaacaagtaca 132
                |||| ||||| ||||||||||| ||| | |||||||| ||||| || |||||||||||||
Sbjct: 38967841 agggcaagactgactacagggccaggattaggctcaccaaccaagataagaacaagtaca 38967900

                                                
Query: 133      atacccccaagtaccgctttgtcgtgcgattt 164
                | || || ||||||||||| || ||| |||||
Sbjct: 38967901 acacaccgaagtaccgcttcgttgtgagattt 38967932



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 78/92 (84%)
 Strand = Plus / Plus

                                                                            
Query: 73       aggggaagaccgactacagggcaaggctgaggctcacgaaccaggacaagaacaagtaca 132
                |||| ||||| ||||||||||| ||| | |||||||| ||||| || |||||||||||||
Sbjct: 38962531 agggcaagactgactacagggccaggattaggctcaccaaccaagataagaacaagtaca 38962590

                                                
Query: 133      atacccccaagtaccgctttgtcgtgcgattt 164
                | || || ||||||||||| || ||| |||||
Sbjct: 38962591 acacaccgaagtaccgcttcgttgtgagattt 38962622



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 67/79 (84%)
 Strand = Plus / Plus

                                                                            
Query: 295      tactgcactggtctgcttttggctcgtcgtgtgctcaagtcccgtgatctggatgaggag 354
                |||||||||||  ||||| |||||||||||||||||| |  ||||| | ||||  |||||
Sbjct: 38962952 tactgcactggcttgcttctggctcgtcgtgtgctcacgctccgtggtttggaccaggag 38963011

                                   
Query: 355      tatgaaggcaatgttgagg 373
                || || |||||||||||||
Sbjct: 38963012 tacgagggcaatgttgagg 38963030



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 64/76 (84%)
 Strand = Plus / Plus

                                                                            
Query: 298      tgcactggtctgcttttggctcgtcgtgtgctcaagtcccgtgatctggatgaggagtat 357
                ||||||||  ||||||||||||| ||||||||||||  ||||| | ||||  ||||||| 
Sbjct: 38968265 tgcactggcttgcttttggctcgccgtgtgctcaagctccgtggtttggaccaggagtac 38968324

                                
Query: 358      gaaggcaatgttgagg 373
                || |||||| ||||||
Sbjct: 38968325 gagggcaatattgagg 38968340



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                            
Query: 38       caagcgtttccaagtcaagttcaagaga 65
                ||||||||||||||||||||||||||||
Sbjct: 38967723 caagcgtttccaagtcaagttcaagaga 38967750



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                                 
Query: 33       tactccaagcgtttccaagtcaagttcaagaga 65
                |||| |||||| |||||||||||||||||||||
Sbjct: 38962394 tacttcaagcgattccaagtcaagttcaagaga 38962426



to top

>dbj|AP003349.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0674H09
          Length = 142955

 Score =  170 bits (86), Expect = 3e-39
 Identities = 101/106 (95%)
 Strand = Plus / Plus

                                                                         
Query: 187   caaattgtttatgctaccattgctggtgatatcgtgatggctgctgcctactcccatgag 246
             |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 41696 caaattgtctatgctaccattgctggtgatatcgtgatggctgctgcctactcccatgag 41755

                                                           
Query: 247   ttgcctcgctatggtcttgacgttggactcaccaactatgctgcag 292
              ||||||||||||||||||| ||||| |||||||||||||| ||||
Sbjct: 41756 ctgcctcgctatggtcttgaagttggtctcaccaactatgcggcag 41801



 Score =  155 bits (78), Expect = 2e-34
 Identities = 99/106 (93%)
 Strand = Plus / Plus

                                                                         
Query: 187   caaattgtttatgctaccattgctggtgatatcgtgatggctgctgcctactcccatgag 246
             |||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 36386 caaattgtctatgctaccattgcgggtgatatcgtgatggctgctgcctactcccatgag 36445

                                                           
Query: 247   ttgcctcgctatggtcttgacgttggactcaccaactatgctgcag 292
              ||||||| ||||||||||| ||||| |||||||||||||| ||||
Sbjct: 36446 ctgcctcgttatggtcttgaagttggtctcaccaactatgcggcag 36491



 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 66/73 (90%)
 Strand = Plus / Plus

                                                                         
Query: 371   aggccactggtgaggacttctctgttgagcctgctgatgagaggaggcctttccgtgcgc 430
             |||||||||| ||||||| || |||||| || |||||||| ||||||||||||||||| |
Sbjct: 36743 aggccactggggaggactactatgttgaaccagctgatgaaaggaggcctttccgtgctc 36802

                          
Query: 431   tcttggatgttgg 443
             |||||||||||||
Sbjct: 36803 tcttggatgttgg 36815



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 65/73 (89%)
 Strand = Plus / Plus

                                                                         
Query: 371   aggccactggtgaggacttctctgttgagcctgctgatgagaggaggcctttccgtgcgc 430
             |||||||||| ||||||| || |||||| || |||||||| ||| ||||||||||||| |
Sbjct: 42059 aggccactggggaggactactatgttgaaccagctgatgaaaggcggcctttccgtgctc 42118

                          
Query: 431   tcttggatgttgg 443
             |||||||||||||
Sbjct: 42119 tcttggatgttgg 42131



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 78/92 (84%)
 Strand = Plus / Plus

                                                                         
Query: 73    aggggaagaccgactacagggcaaggctgaggctcacgaaccaggacaagaacaagtaca 132
             |||| ||||| ||||||||||| ||| | |||||||| ||||| || |||||||||||||
Sbjct: 41474 agggcaagactgactacagggccaggattaggctcaccaaccaagataagaacaagtaca 41533

                                             
Query: 133   atacccccaagtaccgctttgtcgtgcgattt 164
             | || || ||||||||||| || ||| |||||
Sbjct: 41534 acacaccgaagtaccgcttcgttgtgagattt 41565



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 78/92 (84%)
 Strand = Plus / Plus

                                                                         
Query: 73    aggggaagaccgactacagggcaaggctgaggctcacgaaccaggacaagaacaagtaca 132
             |||| ||||| ||||||||||| ||| | |||||||| ||||| || |||||||||||||
Sbjct: 36164 agggcaagactgactacagggccaggattaggctcaccaaccaagataagaacaagtaca 36223

                                             
Query: 133   atacccccaagtaccgctttgtcgtgcgattt 164
             | || || ||||||||||| || ||| |||||
Sbjct: 36224 acacaccgaagtaccgcttcgttgtgagattt 36255



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 67/79 (84%)
 Strand = Plus / Plus

                                                                         
Query: 295   tactgcactggtctgcttttggctcgtcgtgtgctcaagtcccgtgatctggatgaggag 354
             |||||||||||  ||||| |||||||||||||||||| |  ||||| | ||||  |||||
Sbjct: 36585 tactgcactggcttgcttctggctcgtcgtgtgctcacgctccgtggtttggaccaggag 36644

                                
Query: 355   tatgaaggcaatgttgagg 373
             || || |||||||||||||
Sbjct: 36645 tacgagggcaatgttgagg 36663



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 64/76 (84%)
 Strand = Plus / Plus

                                                                         
Query: 298   tgcactggtctgcttttggctcgtcgtgtgctcaagtcccgtgatctggatgaggagtat 357
             ||||||||  ||||||||||||| ||||||||||||  ||||| | ||||  ||||||| 
Sbjct: 41898 tgcactggcttgcttttggctcgccgtgtgctcaagctccgtggtttggaccaggagtac 41957

                             
Query: 358   gaaggcaatgttgagg 373
             || |||||| ||||||
Sbjct: 41958 gagggcaatattgagg 41973



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                         
Query: 38    caagcgtttccaagtcaagttcaagaga 65
             ||||||||||||||||||||||||||||
Sbjct: 41356 caagcgtttccaagtcaagttcaagaga 41383



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                              
Query: 33    tactccaagcgtttccaagtcaagttcaagaga 65
             |||| |||||| |||||||||||||||||||||
Sbjct: 36027 tacttcaagcgattccaagtcaagttcaagaga 36059



to top

>dbj|AP003316.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0696G06
          Length = 142571

 Score =  170 bits (86), Expect = 3e-39
 Identities = 101/106 (95%)
 Strand = Plus / Plus

                                                                          
Query: 187    caaattgtttatgctaccattgctggtgatatcgtgatggctgctgcctactcccatgag 246
              |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 132849 caaattgtctatgctaccattgctggtgatatcgtgatggctgctgcctactcccatgag 132908

                                                            
Query: 247    ttgcctcgctatggtcttgacgttggactcaccaactatgctgcag 292
               ||||||||||||||||||| ||||| |||||||||||||| ||||
Sbjct: 132909 ctgcctcgctatggtcttgaagttggtctcaccaactatgcggcag 132954



 Score =  155 bits (78), Expect = 2e-34
 Identities = 99/106 (93%)
 Strand = Plus / Plus

                                                                          
Query: 187    caaattgtttatgctaccattgctggtgatatcgtgatggctgctgcctactcccatgag 246
              |||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 127539 caaattgtctatgctaccattgcgggtgatatcgtgatggctgctgcctactcccatgag 127598

                                                            
Query: 247    ttgcctcgctatggtcttgacgttggactcaccaactatgctgcag 292
               ||||||| ||||||||||| ||||| |||||||||||||| ||||
Sbjct: 127599 ctgcctcgttatggtcttgaagttggtctcaccaactatgcggcag 127644



 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 66/73 (90%)
 Strand = Plus / Plus

                                                                          
Query: 371    aggccactggtgaggacttctctgttgagcctgctgatgagaggaggcctttccgtgcgc 430
              |||||||||| ||||||| || |||||| || |||||||| ||||||||||||||||| |
Sbjct: 127896 aggccactggggaggactactatgttgaaccagctgatgaaaggaggcctttccgtgctc 127955

                           
Query: 431    tcttggatgttgg 443
              |||||||||||||
Sbjct: 127956 tcttggatgttgg 127968



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 65/73 (89%)
 Strand = Plus / Plus

                                                                          
Query: 371    aggccactggtgaggacttctctgttgagcctgctgatgagaggaggcctttccgtgcgc 430
              |||||||||| ||||||| || |||||| || |||||||| ||| ||||||||||||| |
Sbjct: 133212 aggccactggggaggactactatgttgaaccagctgatgaaaggcggcctttccgtgctc 133271

                           
Query: 431    tcttggatgttgg 443
              |||||||||||||
Sbjct: 133272 tcttggatgttgg 133284



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 78/92 (84%)
 Strand = Plus / Plus

                                                                          
Query: 73     aggggaagaccgactacagggcaaggctgaggctcacgaaccaggacaagaacaagtaca 132
              |||| ||||| ||||||||||| ||| | |||||||| ||||| || |||||||||||||
Sbjct: 132627 agggcaagactgactacagggccaggattaggctcaccaaccaagataagaacaagtaca 132686

                                              
Query: 133    atacccccaagtaccgctttgtcgtgcgattt 164
              | || || ||||||||||| || ||| |||||
Sbjct: 132687 acacaccgaagtaccgcttcgttgtgagattt 132718



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 78/92 (84%)
 Strand = Plus / Plus

                                                                          
Query: 73     aggggaagaccgactacagggcaaggctgaggctcacgaaccaggacaagaacaagtaca 132
              |||| ||||| ||||||||||| ||| | |||||||| ||||| || |||||||||||||
Sbjct: 127317 agggcaagactgactacagggccaggattaggctcaccaaccaagataagaacaagtaca 127376

                                              
Query: 133    atacccccaagtaccgctttgtcgtgcgattt 164
              | || || ||||||||||| || ||| |||||
Sbjct: 127377 acacaccgaagtaccgcttcgttgtgagattt 127408



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 67/79 (84%)
 Strand = Plus / Plus

                                                                          
Query: 295    tactgcactggtctgcttttggctcgtcgtgtgctcaagtcccgtgatctggatgaggag 354
              |||||||||||  ||||| |||||||||||||||||| |  ||||| | ||||  |||||
Sbjct: 127738 tactgcactggcttgcttctggctcgtcgtgtgctcacgctccgtggtttggaccaggag 127797

                                 
Query: 355    tatgaaggcaatgttgagg 373
              || || |||||||||||||
Sbjct: 127798 tacgagggcaatgttgagg 127816



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 64/76 (84%)
 Strand = Plus / Plus

                                                                          
Query: 298    tgcactggtctgcttttggctcgtcgtgtgctcaagtcccgtgatctggatgaggagtat 357
              ||||||||  ||||||||||||| ||||||||||||  ||||| | ||||  ||||||| 
Sbjct: 133051 tgcactggcttgcttttggctcgccgtgtgctcaagctccgtggtttggaccaggagtac 133110

                              
Query: 358    gaaggcaatgttgagg 373
              || |||||| ||||||
Sbjct: 133111 gagggcaatattgagg 133126



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                          
Query: 38     caagcgtttccaagtcaagttcaagaga 65
              ||||||||||||||||||||||||||||
Sbjct: 132509 caagcgtttccaagtcaagttcaagaga 132536



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                               
Query: 33     tactccaagcgtttccaagtcaagttcaagaga 65
              |||| |||||| |||||||||||||||||||||
Sbjct: 127180 tacttcaagcgattccaagtcaagttcaagaga 127212



to top

>gb|AF457942.1| Zea mays clone cho1c.pk003.i13, mRNA sequence
          Length = 542

 Score =  125 bits (63), Expect = 1e-25
 Identities = 254/314 (80%), Gaps = 3/314 (0%)
 Strand = Plus / Plus

                                                                       
Query: 21  aagaccagggcgtactccaagcgtttccaagtcaagttcaagagaaggcgtcaggggaag 80
           |||||||  ||||| | ||| ||||||||||| || ||||||||||||||    || |||
Sbjct: 71  aagaccaatgcgtatttcaaacgtttccaagtgaaattcaagagaaggcgggctggcaag 130

                                                                       
Query: 81  accgactacagggcaaggctgaggctcacgaaccaggacaagaacaagtacaataccccc 140
           || ||||||||||| ||| | ||||| |  ||||| ||||| ||||||||||| || |||
Sbjct: 131 acagactacagggccaggataaggctgattaaccaagacaaaaacaagtacaacacaccc 190

                                                                       
Query: 141 aagtaccgctttgtcgtgcgatttaccaacaagggatgtcactgcccaaattgtttatgc 200
           || ||| | ||||| ||||||||||||||||| |||  ||||||| |||||  | | |||
Sbjct: 191 aaatacagatttgttgtgcgatttaccaacaa-ggacatcactgcacaaatcatatctgc 249

                                                                       
Query: 201 t-accattgctggtgatatcgtgatggctgctgcctactcccatgagttgcctcgctatg 259
           | |  || || |||||||| ||  | ||| |||||||||| ||||||||||| || ||||
Sbjct: 250 taagtatagcgggtgatatggttcttgcttctgcctactctcatgagttgccacgatatg 309

                                                                       
Query: 260 gtcttgacgttggactcaccaactatgctgcagcctactgcact-ggtctgcttttggct 318
           ||||||| ||||| || |||||||||||  | |||||||||||| || || || ||||||
Sbjct: 310 gtcttgaagttggtctgaccaactatgcaactgcctactgcactgggacttctgttggct 369

                         
Query: 319 cgtcgtgtgctcaa 332
           |  |||||||||||
Sbjct: 370 cnccgtgtgctcaa 383



to top

>dbj|AB049724.1| Pisum sativum ssa-15 mRNA for putative senescence-associated
           protein, complete cds
          Length = 1100

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 145/179 (81%)
 Strand = Plus / Plus

                                                                       
Query: 250 cctcgctatggtcttgacgttggactcaccaactatgctgcagcctactgcactggtctg 309
           |||| |||||| ||||| || || || |||||||||||||||||||| ||||| ||||| 
Sbjct: 312 cctcactatgggcttgaagtaggtcttaccaactatgctgcagcctattgcaccggtctc 371

                                                                       
Query: 310 cttttggctcgtcgtgtgctcaagtcccgtgatctggatgaggagtatgaaggcaatgtt 369
           || |||||||| ||||| || ||  | | |||  |||||||||||||||| |||||||| 
Sbjct: 372 ctgttggctcgccgtgttcttaaaactcttgaaatggatgaggagtatgagggcaatgta 431

                                                                      
Query: 370 gaggccactggtgaggacttctctgttgagcctgctgatgagaggaggcctttccgtgc 428
           ||||| | ||| || || |  || ||||| || ||||||   |||||||||||||||||
Sbjct: 432 gaggctagtggagaagattattcggttgaaccagctgattccaggaggcctttccgtgc 490



to top

>gb|AY087197.1| Arabidopsis thaliana clone 32753 mRNA, complete sequence
          Length = 1248

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 94/112 (83%)
 Strand = Plus / Plus

                                                                       
Query: 344 tggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgttgagcctg 403
           ||||||| |||||||| || || |||||||||||||| |||||||| || ||||||||  
Sbjct: 406 tggatgacgagtatgagggaaacgttgaggccactggagaggacttttccgttgagccaa 465

                                                               
Query: 404 ctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggac 455
           |||||   ||||| ||||||||||| ||  | |||||||| |||||||||||
Sbjct: 466 ctgattcaaggagacctttccgtgctcttcttgatgttggacttatcaggac 517



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                       
Query: 78  aagaccgactacagggcaaggctgaggctcacgaaccaggacaagaacaagtacaatacc 137
           ||||| ||||||||||||||| |  | || |  ||||| |||||||||||||||||||| 
Sbjct: 141 aagactgactacagggcaaggatccgtcttatcaaccaagacaagaacaagtacaataca 200

                                              
Query: 138 cccaagtaccgctttgtcgtgcgatttaccaacaa 172
           || ||||| || ||||| || || |||||||||||
Sbjct: 201 cctaagtatcgttttgttgtccggtttaccaacaa 235



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 280 aactatgctgcagcctactgcactggtctgcttttggctcgtcgtgt 326
           |||||||||||||| ||||| ||||| || ||||||||||| |||||
Sbjct: 342 aactatgctgcagcttactgtactggccttcttttggctcgccgtgt 388



to top

>dbj|AK109006.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-153-H04, full
           insert sequence
          Length = 1296

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 103/124 (83%)
 Strand = Plus / Plus

                                                                       
Query: 51  gtcaagttcaagagaaggcgtcaggggaagaccgactacagggcaaggctgaggctcacg 110
           ||||||| || ||||||||||||||| |||||||||||| | ||  | ||  |||| || 
Sbjct: 167 gtcaagtacaggagaaggcgtcagggcaagaccgactaccgcgcccgcctccggctgacc 226

                                                                       
Query: 111 aaccaggacaagaacaagtacaatacccccaagtaccgctttgtcgtgcgatttaccaac 170
           | ||||||||||||||||||||| |||| |||||||||| | || ||||| || | ||||
Sbjct: 227 acccaggacaagaacaagtacaacacccacaagtaccgcatggtggtgcgcttcagcaac 286

               
Query: 171 aagg 174
           ||||
Sbjct: 287 aagg 290



to top

>ref|NM_123336.3| Arabidopsis thaliana 5S rRNA binding / structural constituent of
           ribosome AT5G39740 mRNA, complete cds
          Length = 1223

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 153/191 (80%)
 Strand = Plus / Plus

                                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgcttttggctcgtcgtgtg 327
           ||||| || ||||||||||||||||| ||||| ||||| || ||||||||||||||||| 
Sbjct: 310 gttggtcttaccaactatgctgcagcttactgtactggccttcttttggctcgtcgtgtt 369

                                                                       
Query: 328 ctcaagtcccgtgatctggatgaggagtatgaaggcaatgttgaggccactggtgaggac 387
           || ||    |  ||  ||||||| ||||| || || || || ||||||||||| ||||||
Sbjct: 370 ctgaaaatgctggaaatggatgatgagtacgagggaaacgtagaggccactggagaggac 429

                                                                       
Query: 388 ttctctgttgagcctgctgatgagaggaggcctttccgtgcgctcttggatgttggtctt 447
           || ||||| || ||  |||||   || || ||||||||||| ||  | |||||||| |||
Sbjct: 430 ttttctgtggaaccaactgattccagaagacctttccgtgctcttcttgatgttggactt 489

                      
Query: 448 atcaggactac 458
           |||||||||||
Sbjct: 490 atcaggactac 500



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 104/126 (82%)
 Strand = Plus / Plus

                                                                       
Query: 47  ccaagtcaagttcaagagaaggcgtcaggggaagaccgactacagggcaaggctgaggct 106
           |||||| ||||||| ||||||| |  | |||||||| || |||||||||||| |  | ||
Sbjct: 90  ccaagtgaagttcaggagaaggagagatgggaagactgattacagggcaaggatccgtct 149

                                                                       
Query: 107 cacgaaccaggacaagaacaagtacaatacccccaagtaccgctttgtcgtgcgatttac 166
            |  || || ||||||||||||||||| ||||| |||||||| ||||| || ||||||||
Sbjct: 150 tatcaatcaagacaagaacaagtacaacacccctaagtaccgttttgttgttcgatttac 209

                 
Query: 167 caacaa 172
           ||||||
Sbjct: 210 caacaa 215



to top

>gb|BT014015.1| Lycopersicon esculentum clone 133077F, mRNA sequence
          Length = 1274

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 96/115 (83%)
 Strand = Plus / Plus

                                                                       
Query: 344 tggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgttgagcctg 403
           |||||||||||||| |||| ||   |||||||| ||| ||||| | ||| ||||| | ||
Sbjct: 455 tggatgaggagtatcaaggtaaccctgaggccagtggagaggattactcagttgaacttg 514

                                                                  
Query: 404 ctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggactac 458
           ||||    ||||||||||||||||| |||||||||||||||||||| || |||||
Sbjct: 515 ctgaaagcaggaggcctttccgtgctctcttggatgttggtcttattagaactac 569



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Plus

                                                                       
Query: 21  aagaccagggcgtactccaagcgtttccaagtcaagttcaagagaaggcgtcaggggaag 80
           ||||| ||||| ||||  ||||||||||| || || |||||||||||| |  |||| |||
Sbjct: 133 aagactagggcttactttaagcgtttccaggttaaattcaagagaaggagagagggaaag 192

                      
Query: 81  accgactacag 91
           || ||||||||
Sbjct: 193 actgactacag 203



to top

>gb|BT008706.1| Arabidopsis thaliana At5g39740 gene, complete cds
          Length = 906

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 153/191 (80%)
 Strand = Plus / Plus

                                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgcttttggctcgtcgtgtg 327
           ||||| || ||||||||||||||||| ||||| ||||| || ||||||||||||||||| 
Sbjct: 268 gttggtcttaccaactatgctgcagcttactgtactggccttcttttggctcgtcgtgtt 327

                                                                       
Query: 328 ctcaagtcccgtgatctggatgaggagtatgaaggcaatgttgaggccactggtgaggac 387
           || ||    |  ||  ||||||| ||||| || || || || ||||||||||| ||||||
Sbjct: 328 ctgaaaatgctggaaatggatgatgagtacgagggaaacgtagaggccactggagaggac 387

                                                                       
Query: 388 ttctctgttgagcctgctgatgagaggaggcctttccgtgcgctcttggatgttggtctt 447
           || ||||| || ||  |||||   || || ||||||||||| ||  | |||||||| |||
Sbjct: 388 ttttctgtggaaccaactgattccagaagacctttccgtgctcttcttgatgttggactt 447

                      
Query: 448 atcaggactac 458
           |||||||||||
Sbjct: 448 atcaggactac 458



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 104/126 (82%)
 Strand = Plus / Plus

                                                                       
Query: 47  ccaagtcaagttcaagagaaggcgtcaggggaagaccgactacagggcaaggctgaggct 106
           |||||| ||||||| ||||||| |  | |||||||| || |||||||||||| |  | ||
Sbjct: 48  ccaagtgaagttcaggagaaggagagatgggaagactgattacagggcaaggatccgtct 107

                                                                       
Query: 107 cacgaaccaggacaagaacaagtacaatacccccaagtaccgctttgtcgtgcgatttac 166
            |  || || ||||||||||||||||| ||||| |||||||| ||||| || ||||||||
Sbjct: 108 tatcaatcaagacaagaacaagtacaacacccctaagtaccgttttgttgttcgatttac 167

                 
Query: 167 caacaa 172
           ||||||
Sbjct: 168 caacaa 173



to top

>gb|AY093123.1| Arabidopsis thaliana ribosomal protein L5 - like (At5g39740) mRNA,
           complete cds
          Length = 1100

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 153/191 (80%)
 Strand = Plus / Plus

                                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgcttttggctcgtcgtgtg 327
           ||||| || ||||||||||||||||| ||||| ||||| || ||||||||||||||||| 
Sbjct: 298 gttggtcttaccaactatgctgcagcttactgtactggccttcttttggctcgtcgtgtt 357

                                                                       
Query: 328 ctcaagtcccgtgatctggatgaggagtatgaaggcaatgttgaggccactggtgaggac 387
           || ||    |  ||  ||||||| ||||| || || || || ||||||||||| ||||||
Sbjct: 358 ctgaaaatgctggaaatggatgatgagtacgagggaaacgtagaggccactggagaggac 417

                                                                       
Query: 388 ttctctgttgagcctgctgatgagaggaggcctttccgtgcgctcttggatgttggtctt 447
           || ||||| || ||  |||||   || || ||||||||||| ||  | |||||||| |||
Sbjct: 418 ttttctgtggaaccaactgattccagaagacctttccgtgctcttcttgatgttggactt 477

                      
Query: 448 atcaggactac 458
           |||||||||||
Sbjct: 478 atcaggactac 488



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 104/126 (82%)
 Strand = Plus / Plus

                                                                       
Query: 47  ccaagtcaagttcaagagaaggcgtcaggggaagaccgactacagggcaaggctgaggct 106
           |||||| ||||||| ||||||| |  | |||||||| || |||||||||||| |  | ||
Sbjct: 78  ccaagtgaagttcaggagaaggagagatgggaagactgattacagggcaaggatccgtct 137

                                                                       
Query: 107 cacgaaccaggacaagaacaagtacaatacccccaagtaccgctttgtcgtgcgatttac 166
            |  || || ||||||||||||||||| ||||| |||||||| ||||| || ||||||||
Sbjct: 138 tatcaatcaagacaagaacaagtacaacacccctaagtaccgttttgttgttcgatttac 197

                 
Query: 167 caacaa 172
           ||||||
Sbjct: 198 caacaa 203



to top

>gb|AY079020.1| Arabidopsis thaliana AT5g39740/MKM21_30 mRNA, complete cds
          Length = 1128

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 153/191 (80%)
 Strand = Plus / Plus

                                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgcttttggctcgtcgtgtg 327
           ||||| || ||||||||||||||||| ||||| ||||| || ||||||||||||||||| 
Sbjct: 310 gttggtcttaccaactatgctgcagcttactgtactggccttcttttggctcgtcgtgtt 369

                                                                       
Query: 328 ctcaagtcccgtgatctggatgaggagtatgaaggcaatgttgaggccactggtgaggac 387
           || ||    |  ||  ||||||| ||||| || || || || ||||||||||| ||||||
Sbjct: 370 ctgaaaatgctggaaatggatgatgagtacgagggaaacgtagaggccactggagaggac 429

                                                                       
Query: 388 ttctctgttgagcctgctgatgagaggaggcctttccgtgcgctcttggatgttggtctt 447
           || ||||| || ||  |||||   || || ||||||||||| ||  | |||||||| |||
Sbjct: 430 ttttctgtggaaccaactgattccagaagacctttccgtgctcttcttgatgttggactt 489

                      
Query: 448 atcaggactac 458
           |||||||||||
Sbjct: 490 atcaggactac 500



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 104/126 (82%)
 Strand = Plus / Plus

                                                                       
Query: 47  ccaagtcaagttcaagagaaggcgtcaggggaagaccgactacagggcaaggctgaggct 106
           |||||| ||||||| ||||||| |  | |||||||| || |||||||||||| |  | ||
Sbjct: 90  ccaagtgaagttcaggagaaggagagatgggaagactgattacagggcaaggatccgtct 149

                                                                       
Query: 107 cacgaaccaggacaagaacaagtacaatacccccaagtaccgctttgtcgtgcgatttac 166
            |  || || ||||||||||||||||| ||||| |||||||| ||||| || ||||||||
Sbjct: 150 tatcaatcaagacaagaacaagtacaacacccctaagtaccgttttgttgttcgatttac 209

                 
Query: 167 caacaa 172
           ||||||
Sbjct: 210 caacaa 215



to top

>emb|BX831866.1|CNS09ZT2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH35ZF09 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1048

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 153/191 (80%)
 Strand = Plus / Plus

                                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgcttttggctcgtcgtgtg 327
           ||||| || ||||||||||||||||| ||||| ||||| || ||||||||||||||||| 
Sbjct: 287 gttggtcttaccaactatgctgcagcttactgtactggccttcttttggctcgtcgtgtt 346

                                                                       
Query: 328 ctcaagtcccgtgatctggatgaggagtatgaaggcaatgttgaggccactggtgaggac 387
           || ||    |  ||  ||||||| ||||| || || || || ||||||||||| ||||||
Sbjct: 347 ctgaaaatgctggaaatggatgatgagtacgagggtaacgtagaggccactggagaggac 406

                                                                       
Query: 388 ttctctgttgagcctgctgatgagaggaggcctttccgtgcgctcttggatgttggtctt 447
           || ||||| || ||  |||||   || || ||||||||||| ||  | |||||||| |||
Sbjct: 407 ttttctgtggaaccaactgattccagaagacctttccgtgctcttcttgatgttggactt 466

                      
Query: 448 atcaggactac 458
           |||||||||||
Sbjct: 467 atcaggactac 477



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 104/126 (82%)
 Strand = Plus / Plus

                                                                       
Query: 47  ccaagtcaagttcaagagaaggcgtcaggggaagaccgactacagggcaaggctgaggct 106
           |||||| ||||||| ||||||| |  | |||||||| || |||||||||||| |  | ||
Sbjct: 67  ccaagtgaagttcaggagaaggagagatgggaagactgattacagggcaaggatccgtct 126

                                                                       
Query: 107 cacgaaccaggacaagaacaagtacaatacccccaagtaccgctttgtcgtgcgatttac 166
            |  || || ||||||||||||||||| ||||| |||||||| ||||| || ||||||||
Sbjct: 127 tatcaatcaagacaagaacaagtacaacacccctaagtaccgttttgttgttcgatttac 186

                 
Query: 167 caacaa 172
           ||||||
Sbjct: 187 caacaa 192



to top

>gb|AY365248.1| Cucumis sativus 60S ribosomal protein L5 mRNA, complete cds
          Length = 1171

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 58/65 (89%)
 Strand = Plus / Plus

                                                                       
Query: 256 tatggtcttgacgttggactcaccaactatgctgcagcctactgcactggtctgcttttg 315
           ||||| ||||| ||||| |||||||||||||||||||| ||||||||||| || || |||
Sbjct: 277 tatgggcttgaagttggtctcaccaactatgctgcagcatactgcactgggcttctattg 336

                
Query: 316 gctcg 320
           |||||
Sbjct: 337 gctcg 341



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 82/101 (81%)
 Strand = Plus / Plus

                                                                       
Query: 358 gaaggcaatgttgaggccactggtgaggacttctctgttgagcctgctgatgagaggagg 417
           ||||||||||| ||||| |||||||| || | ||| |||||||| || ||    || |||
Sbjct: 379 gaaggcaatgtggaggctactggtgaagattactcggttgagccagcagacaccagaagg 438

                                                    
Query: 418 cctttccgtgcgctcttggatgttggtcttatcaggactac 458
           || |||||||| ||| | |||||||| |||||||| |||||
Sbjct: 439 ccattccgtgctctccttgatgttgggcttatcagaactac 479



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                              
Query: 33 tactccaagcgtttccaagtcaagttcaagagaagg 68
          |||| ||||||||  |||||||||||||||||||||
Sbjct: 55 tacttcaagcgttatcaagtcaagttcaagagaagg 90



to top

>ref|NM_113448.2| Arabidopsis thaliana ATL5 (A. THALIANA RIBOSOMAL PROTEIN L5);
           structural constituent of ribosome AT3G25520 (ATL5)
           mRNA, complete cds
          Length = 1254

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 93/112 (83%)
 Strand = Plus / Plus

                                                                       
Query: 344 tggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgttgagcctg 403
           ||||||| |||||||| || || |||||||||||||| || ||||| || ||||||||  
Sbjct: 406 tggatgacgagtatgagggaaacgttgaggccactggagaagacttttccgttgagccaa 465

                                                               
Query: 404 ctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggac 455
           |||||   ||||| ||||||||||| ||  | |||||||| |||||||||||
Sbjct: 466 ctgattcaaggagacctttccgtgctcttcttgatgttggacttatcaggac 517



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                       
Query: 78  aagaccgactacagggcaaggctgaggctcacgaaccaggacaagaacaagtacaatacc 137
           ||||| ||||||||||||||| |  | || |  ||||| |||||||||||||||||||| 
Sbjct: 141 aagactgactacagggcaaggatccgtcttatcaaccaagacaagaacaagtacaatact 200

                                              
Query: 138 cccaagtaccgctttgtcgtgcgatttaccaacaa 172
           || ||||| || ||||| || || |||||||||||
Sbjct: 201 cctaagtatcgttttgttgtccggtttaccaacaa 235



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 280 aactatgctgcagcctactgcactggtctgcttttggctcgtcgtgt 326
           |||||||||||||| ||||| ||||| || ||||||||||| |||||
Sbjct: 342 aactatgctgcagcttactgtactggccttcttttggctcgccgtgt 388



to top

>gb|BT000411.1| Arabidopsis thaliana putative ribosomal protein (At3g25520) mRNA,
           complete cds
          Length = 969

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 93/112 (83%)
 Strand = Plus / Plus

                                                                       
Query: 344 tggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgttgagcctg 403
           ||||||| |||||||| || || |||||||||||||| || ||||| || ||||||||  
Sbjct: 344 tggatgacgagtatgagggaaacgttgaggccactggagaagacttttccgttgagccaa 403

                                                               
Query: 404 ctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggac 455
           |||||   ||||| ||||||||||| ||  | |||||||| |||||||||||
Sbjct: 404 ctgattcaaggagacctttccgtgctcttcttgatgttggacttatcaggac 455



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                       
Query: 78  aagaccgactacagggcaaggctgaggctcacgaaccaggacaagaacaagtacaatacc 137
           ||||| ||||||||||||||| |  | || |  ||||| |||||||||||||||||||| 
Sbjct: 79  aagactgactacagggcaaggatccgtcttatcaaccaagacaagaacaagtacaatact 138

                                              
Query: 138 cccaagtaccgctttgtcgtgcgatttaccaacaa 172
           || ||||| || ||||| || || |||||||||||
Sbjct: 139 cctaagtatcgttttgttgtccggtttaccaacaa 173



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 280 aactatgctgcagcctactgcactggtctgcttttggctcgtcgtgt 326
           |||||||||||||| ||||| ||||| || ||||||||||| |||||
Sbjct: 280 aactatgctgcagcttactgtactggccttcttttggctcgccgtgt 326



to top

>gb|BT008705.1| Arabidopsis thaliana At3g25520 gene, complete cds
          Length = 906

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 93/112 (83%)
 Strand = Plus / Plus

                                                                       
Query: 344 tggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgttgagcctg 403
           ||||||| |||||||| || || |||||||||||||| || ||||| || ||||||||  
Sbjct: 344 tggatgacgagtatgagggaaacgttgaggccactggagaagacttttccgttgagccaa 403

                                                               
Query: 404 ctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggac 455
           |||||   ||||| ||||||||||| ||  | |||||||| |||||||||||
Sbjct: 404 ctgattcaaggagacctttccgtgctcttcttgatgttggacttatcaggac 455



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                       
Query: 78  aagaccgactacagggcaaggctgaggctcacgaaccaggacaagaacaagtacaatacc 137
           ||||| ||||||||||||||| |  | || |  ||||| |||||||||||||||||||| 
Sbjct: 79  aagactgactacagggcaaggatccgtcttatcaaccaagacaagaacaagtacaatact 138

                                              
Query: 138 cccaagtaccgctttgtcgtgcgatttaccaacaa 172
           || ||||| || ||||| || || |||||||||||
Sbjct: 139 cctaagtatcgttttgttgtccggtttaccaacaa 173



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 280 aactatgctgcagcctactgcactggtctgcttttggctcgtcgtgt 326
           |||||||||||||| ||||| ||||| || ||||||||||| |||||
Sbjct: 280 aactatgctgcagcttactgtactggccttcttttggctcgccgtgt 326



to top

>gb|AY136319.1| Arabidopsis thaliana putative ribosomal protein (At3g25520) mRNA,
           complete cds
          Length = 1161

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 93/112 (83%)
 Strand = Plus / Plus

                                                                       
Query: 344 tggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgttgagcctg 403
           ||||||| |||||||| || || |||||||||||||| || ||||| || ||||||||  
Sbjct: 403 tggatgacgagtatgagggaaacgttgaggccactggagaagacttttccgttgagccaa 462

                                                               
Query: 404 ctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggac 455
           |||||   ||||| ||||||||||| ||  | |||||||| |||||||||||
Sbjct: 463 ctgattcaaggagacctttccgtgctcttcttgatgttggacttatcaggac 514



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                       
Query: 78  aagaccgactacagggcaaggctgaggctcacgaaccaggacaagaacaagtacaatacc 137
           ||||| ||||||||||||||| |  | || |  ||||| |||||||||||||||||||| 
Sbjct: 138 aagactgactacagggcaaggatccgtcttatcaaccaagacaagaacaagtacaatact 197

                                              
Query: 138 cccaagtaccgctttgtcgtgcgatttaccaacaa 172
           || ||||| || ||||| || || |||||||||||
Sbjct: 198 cctaagtatcgttttgttgtccggtttaccaacaa 232



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 280 aactatgctgcagcctactgcactggtctgcttttggctcgtcgtgt 326
           |||||||||||||| ||||| ||||| || ||||||||||| |||||
Sbjct: 339 aactatgctgcagcttactgtactggccttcttttggctcgccgtgt 385



to top

>gb|AY065103.1| Arabidopsis thaliana 60S ribosomal protein L5 (At3g25550) mRNA,
           complete cds
          Length = 1151

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 93/112 (83%)
 Strand = Plus / Plus

                                                                       
Query: 344 tggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgttgagcctg 403
           ||||||| |||||||| || || |||||||||||||| || ||||| || ||||||||  
Sbjct: 401 tggatgacgagtatgagggaaacgttgaggccactggagaagacttttccgttgagccaa 460

                                                               
Query: 404 ctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggac 455
           |||||   ||||| ||||||||||| ||  | |||||||| |||||||||||
Sbjct: 461 ctgattcaaggagacctttccgtgctcttcttgatgttggacttatcaggac 512



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                       
Query: 78  aagaccgactacagggcaaggctgaggctcacgaaccaggacaagaacaagtacaatacc 137
           ||||| ||||||||||||||| |  | || |  ||||| |||||||||||||||||||| 
Sbjct: 136 aagactgactacagggcaaggatccgtcttatcaaccaagacaagaacaagtacaatact 195

                                              
Query: 138 cccaagtaccgctttgtcgtgcgatttaccaacaa 172
           || ||||| || ||||| || || |||||||||||
Sbjct: 196 cctaagtatcgttttgttgtccggtttaccaacaa 230



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 280 aactatgctgcagcctactgcactggtctgcttttggctcgtcgtgt 326
           |||||||||||||| ||||| ||||| || ||||||||||| |||||
Sbjct: 337 aactatgctgcagcttactgtactggccttcttttggctcgccgtgt 383



to top

>gb|AY081701.1| Arabidopsis thaliana 60S ribosomal protein L5 (At3g25550) mRNA,
           complete cds
          Length = 925

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 93/112 (83%)
 Strand = Plus / Plus

                                                                       
Query: 344 tggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgttgagcctg 403
           ||||||| |||||||| || || |||||||||||||| || ||||| || ||||||||  
Sbjct: 344 tggatgacgagtatgagggaaacgttgaggccactggagaagacttttccgttgagccaa 403

                                                               
Query: 404 ctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggac 455
           |||||   ||||| ||||||||||| ||  | |||||||| |||||||||||
Sbjct: 404 ctgattcaaggagacctttccgtgctcttcttgatgttggacttatcaggac 455



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                       
Query: 78  aagaccgactacagggcaaggctgaggctcacgaaccaggacaagaacaagtacaatacc 137
           ||||| ||||||||||||||| |  | || |  ||||| |||||||||||||||||||| 
Sbjct: 79  aagactgactacagggcaaggatccgtcttatcaaccaagacaagaacaagtacaatact 138

                                              
Query: 138 cccaagtaccgctttgtcgtgcgatttaccaacaa 172
           || ||||| || ||||| || || |||||||||||
Sbjct: 139 cctaagtatcgttttgttgtccggtttaccaacaa 173



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 280 aactatgctgcagcctactgcactggtctgcttttggctcgtcgtgt 326
           |||||||||||||| ||||| ||||| || ||||||||||| |||||
Sbjct: 280 aactatgctgcagcttactgtactggccttcttttggctcgccgtgt 326



to top

>gb|AY054161.1| Arabidopsis thaliana AT5g39740/MKM21_30 mRNA, complete cds
          Length = 1108

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 93/112 (83%)
 Strand = Plus / Plus

                                                                       
Query: 344 tggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgttgagcctg 403
           ||||||| |||||||| || || |||||||||||||| || ||||| || ||||||||  
Sbjct: 391 tggatgacgagtatgagggaaacgttgaggccactggagaagacttttccgttgagccaa 450

                                                               
Query: 404 ctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggac 455
           |||||   ||||| ||||||||||| ||  | |||||||| |||||||||||
Sbjct: 451 ctgattcaaggagacctttccgtgctcttcttgatgttggacttatcaggac 502



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                       
Query: 78  aagaccgactacagggcaaggctgaggctcacgaaccaggacaagaacaagtacaatacc 137
           ||||| ||||||||||||||| |  | || |  ||||| |||||||||||||||||||| 
Sbjct: 126 aagactgactacagggcaaggatccgtcttatcaaccaagacaagaacaagtacaatact 185

                                              
Query: 138 cccaagtaccgctttgtcgtgcgatttaccaacaa 172
           || ||||| || ||||| || || |||||||||||
Sbjct: 186 cctaagtatcgttttgttgtccggtttaccaacaa 220



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 280 aactatgctgcagcctactgcactggtctgcttttggctcgtcgtgt 326
           |||||||||||||| ||||| ||||| || ||||||||||| |||||
Sbjct: 327 aactatgctgcagcttactgtactggccttcttttggctcgccgtgt 373



to top

>gb|AY186611.1| Arabidopsis thaliana ribosomal protein L5 mRNA, complete cds
          Length = 906

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 93/112 (83%)
 Strand = Plus / Plus

                                                                       
Query: 344 tggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgttgagcctg 403
           ||||||| |||||||| || || |||||||||||||| || ||||| || ||||||||  
Sbjct: 344 tggatgacgagtatgagggaaacgttgaggccactggagaagacttttccgttgagccaa 403

                                                               
Query: 404 ctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggac 455
           |||||   ||||| ||||||||||| ||  | |||||||| |||||||||||
Sbjct: 404 ctgattcaaggagacctttccgtgctcttcttgatgttggacttatcaggac 455



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                       
Query: 78  aagaccgactacagggcaaggctgaggctcacgaaccaggacaagaacaagtacaatacc 137
           ||||| ||||||||||||||| |  | || |  ||||| |||||||||||||||||||| 
Sbjct: 79  aagactgactacagggcaaggatccgtcttatcaaccaagacaagaacaagtacaatact 138

                                              
Query: 138 cccaagtaccgctttgtcgtgcgatttaccaacaa 172
           || ||||| || ||||| || || |||||||||||
Sbjct: 139 cctaagtatcgttttgttgtccggtttaccaacaa 173



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 280 aactatgctgcagcctactgcactggtctgcttttggctcgtcgtgt 326
           |||||||||||||| ||||| ||||| || ||||||||||| |||||
Sbjct: 280 aactatgctgcagcttactgtactggccttcttttggctcgccgtgt 326



to top

>emb|BX823967.1|CNS0A6W1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH10ZG11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1076

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 93/112 (83%)
 Strand = Plus / Plus

                                                                       
Query: 344 tggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgttgagcctg 403
           ||||||| |||||||| || || |||||||||||||| || ||||| || ||||||||  
Sbjct: 376 tggatgacgagtatgagggaaacgttgaggccactggagaagacttttccgttgagccaa 435

                                                               
Query: 404 ctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggac 455
           |||||   ||||| ||||||||||| ||  | |||||||| |||||||||||
Sbjct: 436 ctgattcaaggagacctttccgtgctcttcttgatgttggacttatcaggac 487



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                       
Query: 78  aagaccgactacagggcaaggctgaggctcacgaaccaggacaagaacaagtacaatacc 137
           ||||| ||||||||||||||| |  | || |  ||||| |||||||||||||||||||| 
Sbjct: 111 aagactgactacagggcaaggatccgtcttatcaaccaagacaagaacaagtacaatact 170

                                              
Query: 138 cccaagtaccgctttgtcgtgcgatttaccaacaa 172
           || ||||| || ||||| || || |||||||||||
Sbjct: 171 cctaagtatcgttttgttgtccggtttaccaacaa 205



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 280 aactatgctgcagcctactgcactggtctgcttttggctcgtcgtgt 326
           |||||||||||||| ||||| ||||| || ||||||||||| |||||
Sbjct: 312 aactatgctgcagcttactgtactggccttcttttggctcgccgtgt 358



to top

>gb|BT002427.1| Arabidopsis thaliana ribosomal protein, putative (At3g25520) mRNA,
           complete cds
          Length = 1117

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 93/112 (83%)
 Strand = Plus / Plus

                                                                       
Query: 344 tggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgttgagcctg 403
           ||||||| |||||||| || || |||||||||||||| || ||||| || ||||||||  
Sbjct: 401 tggatgacgagtatgagggaaacgttgaggccactggagaagacttttccgttgagccaa 460

                                                               
Query: 404 ctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggac 455
           |||||   ||||| ||||||||||| ||  | |||||||| |||||||||||
Sbjct: 461 ctgattcaaggagacctttccgtgctcttcttgatgttggacttatcaggac 512



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                       
Query: 78  aagaccgactacagggcaaggctgaggctcacgaaccaggacaagaacaagtacaatacc 137
           ||||| ||||||||||||||| |  | || |  ||||| |||||||||||||||||||| 
Sbjct: 136 aagactgactacagggcaaggatccgtcttatcaaccaagacaagaacaagtacaatact 195

                                              
Query: 138 cccaagtaccgctttgtcgtgcgatttaccaacaa 172
           || ||||| || ||||| || || |||||||||||
Sbjct: 196 cctaagtatcgttttgttgtccggtttaccaacaa 230



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 280 aactatgctgcagcctactgcactggtctgcttttggctcgtcgtgt 326
           |||||||||||||| ||||| ||||| || ||||||||||| |||||
Sbjct: 337 aactatgctgcagcttactgtactggccttcttttggctcgccgtgt 383



to top

>dbj|AB016876.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MKM21
          Length = 44499

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Plus

                                                                    
Query: 117  gacaagaacaagtacaatacccccaagtaccgctttgtcgtgcgatttaccaacaa 172
            ||||||||||||||||| ||||| |||||||| ||||| || ||||||||||||||
Sbjct: 7482 gacaagaacaagtacaacacccctaagtaccgttttgttgttcgatttaccaacaa 7537



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 72/88 (81%)
 Strand = Plus / Plus

                                                                        
Query: 371  aggccactggtgaggacttctctgttgagcctgctgatgagaggaggcctttccgtgcgc 430
            |||||||||| |||||||| ||||| || ||  |||||   || || ||||||||||| |
Sbjct: 7915 aggccactggagaggacttttctgtggaaccaactgattccagaagacctttccgtgctc 7974

                                        
Query: 431  tcttggatgttggtcttatcaggactac 458
            |  | |||||||| ||||||||||||||
Sbjct: 7975 ttcttgatgttggacttatcaggactac 8002



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 295  tactgcactggtctgcttttggctcgtcgtgt 326
            ||||| ||||| || |||||||||||||||||
Sbjct: 7747 tactgtactggccttcttttggctcgtcgtgt 7778



to top

>emb|BX832617.1|CNS09YMN Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH85ZA07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1060

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 152/191 (79%)
 Strand = Plus / Plus

                                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgcttttggctcgtcgtgtg 327
           ||||| || ||||||||||||||||| ||||| ||||| || ||||||||||||||||| 
Sbjct: 295 gttggtcttaccaactatgctgcagcttactgtactggccttcttttggctcgtcgtgtt 354

                                                                       
Query: 328 ctcaagtcccgtgatctggatgaggagtatgaaggcaatgttgaggccactggtgaggac 387
           || ||    |  ||  ||||||| ||||| || || || || ||||||||||| ||||||
Sbjct: 355 ctgaaaatgctggaaatggatgatgagtacgagggaaacgtagaggccactggagaggac 414

                                                                       
Query: 388 ttctctgttgagcctgctgatgagaggaggcctttccgtgcgctcttggatgttggtctt 447
           || ||||| || ||  |||||   || ||  |||||||||| ||  | |||||||| |||
Sbjct: 415 ttttctgtggaaccaactgattccagaagaactttccgtgctcttcttgatgttggactt 474

                      
Query: 448 atcaggactac 458
           |||||||||||
Sbjct: 475 atcaggactac 485



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 103/126 (81%)
 Strand = Plus / Plus

                                                                       
Query: 47  ccaagtcaagttcaagagaaggcgtcaggggaagaccgactacagggcaaggctgaggct 106
           |||||| ||||||| ||||||| |  | |||||||| || |||||||||||| |  | ||
Sbjct: 75  ccaagtgaagttcaggagaaggagagatgggaagactgattacagggcaaggatccgtct 134

                                                                       
Query: 107 cacgaaccaggacaagaacaagtacaatacccccaagtaccgctttgtcgtgcgatttac 166
            |  || || || |||||||||||||| ||||| |||||||| ||||| || ||||||||
Sbjct: 135 tatcaatcaagaaaagaacaagtacaaaacccctaagtaccgttttgttgttcgatttac 194

                 
Query: 167 caacaa 172
           ||||||
Sbjct: 195 caacaa 200



to top

>gb|DQ206526.1| Suberites fuscus isolate TOA21 ribosomal protein 5 large subunit
           mRNA, partial cds
          Length = 437

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 69/81 (85%)
 Strand = Plus / Plus

                                                                       
Query: 231 tgcctactcccatgagttgcctcgctatggtcttgacgttggactcaccaactatgctgc 290
           ||||||| | |||||| |||| || |||||| |  | |||||||| ||||||||||||||
Sbjct: 162 tgcctacgctcatgagctgccacgatatggtgtcaaggttggactgaccaactatgctgc 221

                                
Query: 291 agcctactgcactggtctgct 311
            || |||||||||||||||||
Sbjct: 222 tgcatactgcactggtctgct 242



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 117 gacaagaacaagtacaatacccccaagtaccg 148
           ||||||||||||||||| || || ||||||||
Sbjct: 49  gacaagaacaagtacaacacaccaaagtaccg 80



to top

>dbj|AB025639.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MWL2
          Length = 84896

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 79/95 (83%)
 Strand = Plus / Minus

                                                                         
Query: 78    aagaccgactacagggcaaggctgaggctcacgaaccaggacaagaacaagtacaatacc 137
             ||||| ||||||||||||||| |  | || |  ||||| |||||||||||||||||||| 
Sbjct: 57553 aagactgactacagggcaaggatccgtcttatcaaccaagacaagaacaagtacaatact 57494

                                                
Query: 138   cccaagtaccgctttgtcgtgcgatttaccaacaa 172
             || ||||| || ||||| || || |||||||||||
Sbjct: 57493 cctaagtatcgttttgttgtccggtttaccaacaa 57459



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 70/85 (82%)
 Strand = Plus / Minus

                                                                         
Query: 371   aggccactggtgaggacttctctgttgagcctgctgatgagaggaggcctttccgtgcgc 430
             |||||||||| || ||||| || ||||||||  |||||   ||||| ||||||||||| |
Sbjct: 57081 aggccactggagaagacttttccgttgagccaactgattcaaggagacctttccgtgctc 57022

                                      
Query: 431   tcttggatgttggtcttatcaggac 455
             |  | |||||||| |||||||||||
Sbjct: 57021 ttcttgatgttggacttatcaggac 56997



to top

>gb|AY292620.1| Oikopleura dioica 60S ribosomal protein L5 (RL5) gene, complete cds
          Length = 1303

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 113 ccaggacaagaacaagtacaatacccccaagtaccgctttgtcgtgcgatttaccaacaa 172
           ||||||||||||||||||||| || |||||||||||  ||||||| ||  | ||||||||
Sbjct: 144 ccaggacaagaacaagtacaacactcccaagtaccgacttgtcgtccgtgtcaccaacaa 203

             
Query: 173 gg 174
           ||
Sbjct: 204 gg 205



to top

>gb|BT012733.1| Lycopersicon esculentum clone 113662F, mRNA sequence
          Length = 1161

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 78/94 (82%)
 Strand = Plus / Plus

                                                                       
Query: 344 tggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgttgagcctg 403
           ||||||| || ||| |||| ||| |||| | || ||| ||||||| ||||||||| ||||
Sbjct: 401 tggatgaagaatatcaaggaaatcttgatgtcaatggagaggactactctgttgaacctg 460

                                             
Query: 404 ctgatgagaggaggcctttccgtgcgctcttgga 437
           ||||    ||||||||||||||||| ||||||||
Sbjct: 461 ctgaaagcaggaggcctttccgtgctctcttgga 494



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 21  aagaccagggcgtactccaagcgtttccaagtcaagttcaagagaaggcgtcaggggaag 80
           ||||| ||||| |||| |||||||||||| || || |||||||||||| |  |||| |||
Sbjct: 79  aagacaagggcttacttcaagcgtttccaggttaaattcaagagaaggagagagggaaag 138

                      
Query: 81  accgactacag 91
           || ||||||||
Sbjct: 139 actgactacag 149



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 51/61 (83%)
 Strand = Plus / Plus

                                                                       
Query: 114 caggacaagaacaagtacaatacccccaagtaccgctttgtcgtgcgatttaccaacaag 173
           |||||||| ||||||||||| || || || ||||| || || || |||||||| ||||||
Sbjct: 172 caggacaaaaacaagtacaacactccaaaataccgtttcgttgttcgatttactaacaag 231

            
Query: 174 g 174
           |
Sbjct: 232 g 232



to top

>ref|XM_504264.1| Yarrowia lipolytica CLIB122, YALI0E22352g predicted mRNA
          Length = 891

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 125 caagtacaatacccccaagtaccgctttgtcgtgcgatttaccaacaagg 174
           ||||||||| ||||||||||||||  |||| |||||||| ||||||||||
Sbjct: 126 caagtacaacacccccaagtaccgacttgttgtgcgattcaccaacaagg 175



to top

>emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB 122 of Yarrowia lipolytica
          Length = 4224103

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                                 
Query: 125     caagtacaatacccccaagtaccgctttgtcgtgcgatttaccaacaagg 174
               ||||||||| ||||||||||||||  |||| |||||||| ||||||||||
Sbjct: 2629101 caagtacaacacccccaagtaccgacttgttgtgcgattcaccaacaagg 2629150



to top

>gb|AF028833.1|AF028833 Dunaliella salina 60S ribosomal protein (DSRP1) mRNA, complete cds
          Length = 1063

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 35/37 (94%)
 Strand = Plus / Plus

                                                
Query: 113 ccaggacaagaacaagtacaatacccccaagtaccgc 149
           ||||||||||||||||||||| |||| ||||||||||
Sbjct: 136 ccaggacaagaacaagtacaacacccacaagtaccgc 172



to top

>emb|X95566.1|PS5SRNA P.sativum 5S rRNA gene
          Length = 1115

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 114 caggacaagaacaagtacaatacccccaagtaccgctttgt 154
           ||||||||||||||||||||||| |||||||| || |||||
Sbjct: 116 caggacaagaacaagtacaatactcccaagtatcgttttgt 156



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 277 accaactatgctgcagcctactgcactggtctgcttttggct 318
           |||||||||||||||||||| ||||| ||||| || ||||||
Sbjct: 276 accaactatgctgcagcctattgcaccggtctcctgttggct 317



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 344 tggatgaggagtatgaaggcaatgttgaggc 374
           |||||||||||||||| |||||||| |||||
Sbjct: 346 tggatgaggagtatgagggcaatgtagaggc 376



 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 197 atgctaccattgctggtgatat 218
           ||||||||||||||||||||||
Sbjct: 200 atgctaccattgctggtgatat 221



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                              
Query: 48 caagtcaagttcaagagaag 67
          ||||||||||||||||||||
Sbjct: 49 caagtcaagttcaagagaag 68



to top

>emb|Z49967.1|CEF54C9 Caenorhabditis elegans Cosmid F54C9, complete sequence
          Length = 34842

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                                 
Query: 113   ccaggacaagaacaagtacaatacccccaagtaccg 148
             ||||||||||||||||||||| ||||| ||||||||
Sbjct: 15921 ccaggacaagaacaagtacaacaccccaaagtaccg 15956



to top

>ref|NM_063410.2| Caenorhabditis elegans Ribosomal Protein, Large subunit family
           member (rpl-5) (rpl-5) mRNA, complete cds
          Length = 969

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 113 ccaggacaagaacaagtacaatacccccaagtaccg 148
           ||||||||||||||||||||| ||||| ||||||||
Sbjct: 122 ccaggacaagaacaagtacaacaccccaaagtaccg 157



to top

>gb|AF152472.1|AF152472 Myxine glutinosa ribosomal protein L5 mRNA, complete cds
          Length = 1048

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 114 caggacaagaacaagtacaatacccccaagtaccgc 149
           |||||||||||||||||||| || ||||||||||||
Sbjct: 162 caggacaagaacaagtacaacacacccaagtaccgc 197



to top

>gb|BT012458.1| Drosophila melanogaster RE57391 full insert cDNA
          Length = 1004

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 114 caggacaagaacaagtacaatacccccaagtaccg 148
           |||||||||||||||||||| || |||||||||||
Sbjct: 137 caggacaagaacaagtacaacactcccaagtaccg 171



to top

>gb|BT011515.1| Drosophila melanogaster SD13191 full insert cDNA
          Length = 884

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 114 caggacaagaacaagtacaatacccccaagtaccg 148
           |||||||||||||||||||| || |||||||||||
Sbjct: 137 caggacaagaacaagtacaacactcccaagtaccg 171



to top

>emb|AM048991.1| Carabus granulatus partial mRNA for ribosomal protein L5e (rpL5e
           gene)
          Length = 879

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 114 caggacaagaacaagtacaatacccccaagtaccg 148
           |||||||||||||||||||| || |||||||||||
Sbjct: 91  caggacaagaacaagtacaacacacccaagtaccg 125



to top

>gb|AY232050.1| Drosophila yakuba clone yak-ad_yip6 mRNA sequence
          Length = 609

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 114 caggacaagaacaagtacaatacccccaagtaccg 148
           |||||||||||||||||||| || |||||||||||
Sbjct: 115 caggacaagaacaagtacaacactcccaagtaccg 149



to top

>gb|AY231809.1| Drosophila yakuba clone yak-em_yip6 mRNA sequence
          Length = 654

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 114 caggacaagaacaagtacaatacccccaagtaccg 148
           |||||||||||||||||||| || |||||||||||
Sbjct: 115 caggacaagaacaagtacaacactcccaagtaccg 149



to top

>emb|CR720352.2|CNS0GIRQ Tetraodon nigroviridis full-length cDNA
          Length = 437

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 114 caggacaagaacaagtacaatacccccaagtaccg 148
           |||||||||||||||||||| || |||||||||||
Sbjct: 113 caggacaagaacaagtacaacacacccaagtaccg 147



to top

>emb|CR708591.2|CNS0G9P7 Tetraodon nigroviridis full-length cDNA
          Length = 995

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 114 caggacaagaacaagtacaatacccccaagtaccg 148
           |||||||||||||||||||| || |||||||||||
Sbjct: 156 caggacaagaacaagtacaacacacccaagtaccg 190



to top

>emb|CR705464.2|CNS0G7AC Tetraodon nigroviridis full-length cDNA
          Length = 996

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 114 caggacaagaacaagtacaatacccccaagtaccg 148
           |||||||||||||||||||| || |||||||||||
Sbjct: 157 caggacaagaacaagtacaacacacccaagtaccg 191



to top

>emb|CR704706.2|CNS0G6PA Tetraodon nigroviridis full-length cDNA
          Length = 1004

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 114 caggacaagaacaagtacaatacccccaagtaccg 148
           |||||||||||||||||||| || |||||||||||
Sbjct: 166 caggacaagaacaagtacaacacacccaagtaccg 200



to top

>emb|CR698243.2|CNS0G1PR Tetraodon nigroviridis full-length cDNA
          Length = 999

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 114 caggacaagaacaagtacaatacccccaagtaccg 148
           |||||||||||||||||||| || |||||||||||
Sbjct: 159 caggacaagaacaagtacaacacacccaagtaccg 193



to top

>emb|CR697951.2|CNS0G1HN Tetraodon nigroviridis full-length cDNA
          Length = 1010

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 114 caggacaagaacaagtacaatacccccaagtaccg 148
           |||||||||||||||||||| || |||||||||||
Sbjct: 170 caggacaagaacaagtacaacacacccaagtaccg 204



to top

>emb|CR695319.2|CNS0FZGJ Tetraodon nigroviridis full-length cDNA
          Length = 1027

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 114 caggacaagaacaagtacaatacccccaagtaccg 148
           |||||||||||||||||||| || |||||||||||
Sbjct: 188 caggacaagaacaagtacaacacacccaagtaccg 222



to top

>emb|CR692762.2|CNS0FXHI Tetraodon nigroviridis full-length cDNA
          Length = 988

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 114 caggacaagaacaagtacaatacccccaagtaccg 148
           |||||||||||||||||||| || |||||||||||
Sbjct: 166 caggacaagaacaagtacaacacacccaagtaccg 200



to top

>emb|CR691096.2|CNS0FW78 Tetraodon nigroviridis full-length cDNA
          Length = 987

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 114 caggacaagaacaagtacaatacccccaagtaccg 148
           |||||||||||||||||||| || |||||||||||
Sbjct: 188 caggacaagaacaagtacaacacacccaagtaccg 222



to top

>emb|CR690457.2|CNS0FVPH Tetraodon nigroviridis full-length cDNA
          Length = 757

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 114 caggacaagaacaagtacaatacccccaagtaccg 148
           |||||||||||||||||||| || |||||||||||
Sbjct: 211 caggacaagaacaagtacaacacacccaagtaccg 245



to top

>emb|CR689016.2|CNS0FULG Tetraodon nigroviridis full-length cDNA
          Length = 1027

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 114 caggacaagaacaagtacaatacccccaagtaccg 148
           |||||||||||||||||||| || |||||||||||
Sbjct: 188 caggacaagaacaagtacaacacacccaagtaccg 222



to top

>emb|CR687491.2|CNS0FTF3 Tetraodon nigroviridis full-length cDNA
          Length = 1051

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 114 caggacaagaacaagtacaatacccccaagtaccg 148
           |||||||||||||||||||| || |||||||||||
Sbjct: 220 caggacaagaacaagtacaacacacccaagtaccg 254



to top

>emb|CR682806.2|CNS0FPSY Tetraodon nigroviridis full-length cDNA
          Length = 1004

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 114 caggacaagaacaagtacaatacccccaagtaccg 148
           |||||||||||||||||||| || |||||||||||
Sbjct: 165 caggacaagaacaagtacaacacacccaagtaccg 199



to top

>emb|CR669080.1|CNS0FF8E Tetraodon nigroviridis full-length cDNA
          Length = 979

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 114 caggacaagaacaagtacaatacccccaagtaccg 148
           |||||||||||||||||||| || |||||||||||
Sbjct: 157 caggacaagaacaagtacaacacacccaagtaccg 191



to top

>emb|CR667591.2|CNS0FE31 Tetraodon nigroviridis full-length cDNA
          Length = 992

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 114 caggacaagaacaagtacaatacccccaagtaccg 148
           |||||||||||||||||||| || |||||||||||
Sbjct: 161 caggacaagaacaagtacaacacacccaagtaccg 195



to top

>dbj|AB246883.1| Lethenteron japonicum RPL5 mRNA for ribosomal protein L5, complete
           cds
          Length = 945

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 114 caggacaagaacaagtacaatacccccaagtaccg 148
           |||||||||||||||||||| || |||||||||||
Sbjct: 156 caggacaagaacaagtacaacacgcccaagtaccg 190



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 271 ggactcaccaactatgctgcagcctactgcactggtctgct 311
           |||||||||||||| || || ||||||||||| || |||||
Sbjct: 312 ggactcaccaactacgccgccgcctactgcaccggcctgct 352



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 51/61 (83%)
 Strand = Plus / Plus

                                                                       
Query: 29  ggcgtactccaagcgtttccaagtcaagttcaagagaaggcgtcaggggaagaccgacta 88
           ||||||||  ||||| | ||| ||||||||||||||  | ||| |||| |||||||||||
Sbjct: 71  ggcgtactttaagcgctaccaggtcaagttcaagaggcgtcgtgagggaaagaccgacta 130

            
Query: 89  c 89
           |
Sbjct: 131 c 131



to top

>gb|AY071305.1| Drosophila melanogaster RE33114 full length cDNA
          Length = 1077

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 114 caggacaagaacaagtacaatacccccaagtaccg 148
           |||||||||||||||||||| || |||||||||||
Sbjct: 208 caggacaagaacaagtacaacactcccaagtaccg 242



to top

>ref|NM_001015438.1| Drosophila melanogaster CG17489-PD.3 (CG17489), mRNA
          Length = 931

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 114 caggacaagaacaagtacaatacccccaagtaccg 148
           |||||||||||||||||||| || |||||||||||
Sbjct: 194 caggacaagaacaagtacaacactcccaagtaccg 228



to top

>ref|NM_001015436.1| Drosophila melanogaster CG17489-PA.3 (CG17489), mRNA
          Length = 1065

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 114 caggacaagaacaagtacaatacccccaagtaccg 148
           |||||||||||||||||||| || |||||||||||
Sbjct: 194 caggacaagaacaagtacaacactcccaagtaccg 228



to top

>ref|NM_001015440.1| Drosophila melanogaster CG17489-PC.3 (CG17489), mRNA
          Length = 1050

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 114 caggacaagaacaagtacaatacccccaagtaccg 148
           |||||||||||||||||||| || |||||||||||
Sbjct: 179 caggacaagaacaagtacaacactcccaagtaccg 213



to top

>ref|NM_001015439.1| Drosophila melanogaster CG17489-PE.3 (CG17489), mRNA
          Length = 945

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 114 caggacaagaacaagtacaatacccccaagtaccg 148
           |||||||||||||||||||| || |||||||||||
Sbjct: 208 caggacaagaacaagtacaacactcccaagtaccg 242



to top

>ref|NM_001015437.1| Drosophila melanogaster CG17489-PB.3 (CG17489), mRNA
          Length = 1079

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 114 caggacaagaacaagtacaatacccccaagtaccg 148
           |||||||||||||||||||| || |||||||||||
Sbjct: 208 caggacaagaacaagtacaacactcccaagtaccg 242



to top

>gb|AY130400.1| Petromyzon marinus ribosomal protein L5 mRNA, partial cds
          Length = 528

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 114 caggacaagaacaagtacaatacccccaagtaccg 148
           |||||||||||||||||||| || |||||||||||
Sbjct: 112 caggacaagaacaagtacaacacgcccaagtaccg 146



to top

>gb|AY130399.1| Branchiostoma lanceolatum ribosomal protein L5 mRNA, partial cds
          Length = 815

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                         
Query: 30 gcgtactccaagcgtttccaagtcaagttca 60
          ||||||| |||||||||||||||||||||||
Sbjct: 3  gcgtacttcaagcgtttccaagtcaagttca 33



to top

>gb|BT003557.1| Drosophila melanogaster LP07855 full insert cDNA
          Length = 2382

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                               
Query: 114  caggacaagaacaagtacaatacccccaagtaccg 148
            |||||||||||||||||||| || |||||||||||
Sbjct: 1500 caggacaagaacaagtacaacactcccaagtaccg 1534



to top

>gb|AC128859.4| Rattus norvegicus 10 BAC CH230-436I22 (Children's Hospital Oakland
              Research Institute) complete sequence
          Length = 156078

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                            
Query: 266    acgttggactcaccaactatgctgcagcctactgcactggtctgct 311
              ||||||| || || ||||||||||||||||| |||||||| |||||
Sbjct: 124442 acgttggcctgacaaactatgctgcagcctattgcactggcctgct 124397



to top

>ref|XM_367123.1| Magnaporthe grisea 70-15 hypothetical protein (MG07048.4) partial
           mRNA
          Length = 909

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 50/58 (86%)
 Strand = Plus / Plus

                                                                     
Query: 113 ccaggacaagaacaagtacaatacccccaagtaccgctttgtcgtgcgatttaccaac 170
           ||||| |||||||||||||||| | |||||||||||| | || ||||| || ||||||
Sbjct: 114 ccaggccaagaacaagtacaatgcgcccaagtaccgcctggtggtgcgcttcaccaac 171



to top

>ref|XM_390186.1| Gibberella zeae PH-1 chromosome 1 RL5_NEUCR 60S ribosomal protein
           L5 (CPR4) (FG10010.1) partial mRNA
          Length = 906

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                       
Query: 113 ccaggacaagaacaagtacaatacccccaagtaccgctttgtcgtgcgatttaccaacaa 172
           ||||| |||||||||||||||  |||||||||||||| | || || || || ||||||||
Sbjct: 111 ccaggccaagaacaagtacaacgcccccaagtaccgcctggttgtccgcttcaccaacaa 170

             
Query: 173 gg 174
           ||
Sbjct: 171 gg 172



to top

>gb|BC041227.1| Xenopus laevis similar to ribosomal protein L5, mRNA (cDNA clone
           MGC:52733 IMAGE:4683875), complete cds
          Length = 1024

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                             
Query: 113 ccaggacaagaacaagtacaatacccccaagtac 146
           |||||| ||||||||||||||||| |||||||||
Sbjct: 176 ccaggataagaacaagtacaatactcccaagtac 209



to top

>gb|BC042258.1| Xenopus laevis similar to ribosomal protein L5, mRNA (cDNA clone
           MGC:53393 IMAGE:5571522), complete cds
          Length = 1032

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                             
Query: 113 ccaggacaagaacaagtacaatacccccaagtac 146
           |||||| ||||||||||||||||| |||||||||
Sbjct: 177 ccaggataagaacaagtacaatactcccaagtac 210



to top

>ref|XM_966854.1| PREDICTED: Tribolium castaneum similar to CG17489-PA.3 (LOC660641),
           mRNA
          Length = 1030

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                         
Query: 120 aagaacaagtacaatacccccaagtaccgc 149
           |||||||||||||| |||||||||||||||
Sbjct: 187 aagaacaagtacaacacccccaagtaccgc 216



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 33  tactccaagcgtttccaagtcaagttcaagag 64
           |||| ||||||||||||||| ||||| |||||
Sbjct: 100 tacttcaagcgtttccaagttaagtttaagag 131



to top

>gb|M29032.1|XELRPL5A X.laevis ribosomal protein L5a 60 S subunit mRNA, complete cds
          Length = 989

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                             
Query: 113 ccaggacaagaacaagtacaatacccccaagtac 146
           |||||| ||||||||||||||||| |||||||||
Sbjct: 176 ccaggataagaacaagtacaatactcccaagtac 209



to top

>gb|M29033.1|XELPRL5B X.laevis ribosomal protein L5b 60 S subunit mRNA, complete cds
          Length = 986

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                             
Query: 113 ccaggacaagaacaagtacaatacccccaagtac 146
           |||||| ||||||||||||||||| |||||||||
Sbjct: 166 ccaggataagaacaagtacaatactcccaagtac 199



to top

>gb|AF054907.1| Neurospora crassa putative 5S rRNA binding ribosomal protein (crp-4)
            gene, complete cds
          Length = 2755

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                 
Query: 113  ccaggacaagaacaagtacaatacccccaagtaccgc 149
            ||||| |||||||||||||||| | ||||||||||||
Sbjct: 1535 ccaggccaagaacaagtacaatgctcccaagtaccgc 1571



to top

>ref|XM_323670.1| Neurospora crassa OR74A 60S RIBOSOMAL PROTEIN L5 (CPR4)
           (NCU04331.1) partial mRNA
          Length = 906

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                
Query: 113 ccaggacaagaacaagtacaatacccccaagtaccgc 149
           ||||| |||||||||||||||| | ||||||||||||
Sbjct: 114 ccaggccaagaacaagtacaatgctcccaagtaccgc 150



to top

>ref|XM_955485.1| Neurospora crassa OR74A 60S RIBOSOMAL PROTEIN L5 (CPR4)
           (NCU04331.1) partial mRNA
          Length = 906

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                
Query: 113 ccaggacaagaacaagtacaatacccccaagtaccgc 149
           ||||| |||||||||||||||| | ||||||||||||
Sbjct: 114 ccaggccaagaacaagtacaatgctcccaagtaccgc 150



to top

>gb|AF481056.1| Aplysia californica alpha tubulin 2 mRNA, complete cds
          Length = 1945

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 277 accaactatgctgcagcctactgcactggtctgcttttggc 317
           |||||||||||||| || |||||||||||  ||||||||||
Sbjct: 73  accaactatgctgctgcatactgcactggattgcttttggc 113



to top

>emb|BX028070.1|CNS08TTM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA42AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 959

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgctt 312
           ||||| || ||||||||||| || ||||||||||| |||||||||
Sbjct: 341 gttggtctgaccaactatgccgccgcctactgcaccggtctgctt 385



to top

>emb|BX008571.1|CNS08ERZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA14AC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 955

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgctt 312
           ||||| || ||||||||||| || ||||||||||| |||||||||
Sbjct: 357 gttggtctgaccaactatgccgccgcctactgcaccggtctgctt 401



to top

>emb|Z99296.2|SPAC3H5 S.pombe chromosome I cosmid c3H5
          Length = 34284

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 113 ccaggacaagaacaagtacaatacccccaagtaccgctttgtcgt 157
           ||||| |||||||||||||||| | ||||||||||| || |||||
Sbjct: 775 ccaggccaagaacaagtacaatgctcccaagtaccgtttggtcgt 819



to top

>emb|BX294026.1|NCB7H23 Neurospora crassa DNA linkage group V BAC contig B7H23
          Length = 114377

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                   
Query: 113    ccaggacaagaacaagtacaatacccccaagtaccgc 149
              ||||| |||||||||||||||| | ||||||||||||
Sbjct: 112374 ccaggccaagaacaagtacaatgctcccaagtaccgc 112338



to top

>gb|AY857416.1| Suberites domuncula L5 mRNA, complete cds
          Length = 882

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtct 308
           |||||||| ||||||||||| || || ||||||||||||||
Sbjct: 268 gttggactgaccaactatgccgctgcatactgcactggtct 308



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 117 gacaagaacaagtacaatacccccaagtaccg 148
           ||||||||||||||||| || || ||||||||
Sbjct: 118 gacaagaacaagtacaacacaccaaagtaccg 149



to top

>ref|NM_001019604.1| Schizosaccharomyces pombe 972h- hypothetical protein (SPAC3H5.12c),
           partial mRNA
          Length = 885

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 113 ccaggacaagaacaagtacaatacccccaagtaccgctttgtcgt 157
           ||||| |||||||||||||||| | ||||||||||| || |||||
Sbjct: 114 ccaggccaagaacaagtacaatgctcccaagtaccgtttggtcgt 158



to top

>gb|AY130401.1| Scyliorhinus canicula ribosomal protein L5 mRNA, partial cds
          Length = 815

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgctt 312
           ||||| |||||||||||||||||  | || |||||||||||||||
Sbjct: 240 gttgggctcaccaactatgctgcgtcttattgcactggtctgctt 284



to top

>gb|AY588943.1| Eimeria tenella large subunit ribosomal protein L5 (RPL5) mRNA,
           complete cds
          Length = 1141

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                    
Query: 114 caggacaagaacaagtacaatacccccaagtaccgctttgtcgtgcgatttaccaac 170
           ||||| |||||||| |||||| | || |||||||||||||| |||||  ||||||||
Sbjct: 132 caggataagaacaaatacaatgcgccgaagtaccgctttgttgtgcgtgttaccaac 188



to top

>gb|DQ206601.1| Monosiga brevicollis isolate TOA21 ribosomal protein 5 large
           subunit mRNA, partial cds
          Length = 440

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                
Query: 113 ccaggacaagaacaagtacaatacccccaagtaccgc 149
           |||||| |||||||||||||| || ||||||||||||
Sbjct: 45  ccaggagaagaacaagtacaacactcccaagtaccgc 81



to top

>gb|AF066077.1|AF066077 Helianthus annuus RPL5A-related protein (RPL5A) mRNA, complete cds
          Length = 894

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 113 ccaggacaagaacaagtacaatacccccaagtaccgctttgtcgt 157
           ||||||||||||||| ||||| |||||||| |||||  |||||||
Sbjct: 114 ccaggacaagaacaaatacaacacccccaaataccgtcttgtcgt 158



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| ||||||||||| ||||| || ||||||||||| |||||
Sbjct: 268 gttggtctcaccaactacgctgccgcttactgcactggcctgct 311



to top

>gb|U48270.1|SPU48270 Schizosaccharomyces pombe ribosomal protein L5 gene, complete cds
          Length = 1238

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 113 ccaggacaagaacaagtacaatacccccaagtaccgctttgtcgt 157
           ||||| |||||||||||||||| | ||||||||||| || |||||
Sbjct: 150 ccaggccaagaacaagtacaatgctcccaagtaccgtttggtcgt 194



to top

>gb|DQ228334.1| Solanum tuberosum clone 145F02 unknown mRNA
          Length = 1114

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 382 gaggacttctctgttgagcctgctgatgagaggaggcctttccgtgcgctcttgga 437
           ||||||| ||| ||||| ||||||||    ||||||||||||||||| ||||||||
Sbjct: 416 gaggactactccgttgaacctgctgaaagcaggaggcctttccgtgctctcttgga 471



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                           
Query: 21  aagaccagggcgtactccaagcgtttccaagtcaagttcaagagaagg 68
           ||||| ||||| |||| |||||||||||| || || ||||||||||||
Sbjct: 56  aagactagggcttacttcaagcgtttccaggttaaattcaagagaagg 103



to top

>gb|BC076208.1| Danio rerio ribosomal protein L5b, mRNA (cDNA clone MGC:92728
           IMAGE:7075897), complete cds
          Length = 1044

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 114 caggacaagaacaagtacaatacccccaagta 145
           |||||||||||||||||||| || ||||||||
Sbjct: 193 caggacaagaacaagtacaacacacccaagta 224



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 283 tatgctgcagcctactgcactggtctgct 311
           |||||||| |||||||||||||| |||||
Sbjct: 361 tatgctgctgcctactgcactgggctgct 389



to top

>gb|BC071498.1| Danio rerio ribosomal protein L5b, mRNA (cDNA clone MGC:86854
           IMAGE:6902957), complete cds
          Length = 1069

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 114 caggacaagaacaagtacaatacccccaagta 145
           |||||||||||||||||||| || ||||||||
Sbjct: 193 caggacaagaacaagtacaacacacccaagta 224



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 283 tatgctgcagcctactgcactggtctgct 311
           |||||||| |||||||||||||| |||||
Sbjct: 361 tatgctgctgcctactgcactgggctgct 389



to top

>gb|AY389938.1| Protopterus dolloi ribosomal protein L5 mRNA, partial cds
          Length = 815

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgcttttggctcgtcg 323
           |||||||| || || ||||| || || || |||||||| |||||||||||||||||
Sbjct: 240 gttggactgacaaattatgcagccgcatattgcactggcctgcttttggctcgtcg 295



to top

>ref|NM_001002106.1| Danio rerio ribosomal protein L5b (rpl5b), mRNA
          Length = 1069

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 114 caggacaagaacaagtacaatacccccaagta 145
           |||||||||||||||||||| || ||||||||
Sbjct: 193 caggacaagaacaagtacaacacacccaagta 224



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 283 tatgctgcagcctactgcactggtctgct 311
           |||||||| |||||||||||||| |||||
Sbjct: 361 tatgctgctgcctactgcactgggctgct 389



to top

>emb|BX548019.36| Zebrafish DNA sequence from clone DKEY-20D1 in linkage group 6,
             complete sequence
          Length = 202848

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                             
Query: 114   caggacaagaacaagtacaatacccccaagta 145
             |||||||||||||||||||| || ||||||||
Sbjct: 43471 caggacaagaacaagtacaacacacccaagta 43440



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 283   tatgctgcagcctactgcactggtctgct 311
             |||||||| |||||||||||||| |||||
Sbjct: 43113 tatgctgctgcctactgcactgggctgct 43085



to top

>emb|BX072137.1|CNS09RTP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 833

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 351 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 394



to top

>emb|BX071725.1|CNS09RI9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9BE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 913

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 120 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 163



to top

>emb|BX070877.1|CNS09QUP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8AG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 676

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 278 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 321



to top

>emb|BX070441.1|CNS09QIL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7CB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 908

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 343 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 386



to top

>emb|BX069649.1|CNS09PWL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6BF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 907

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 341 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 384



to top

>emb|BX061084.1|CNS09JAO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41CH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 941

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 355 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 398



to top

>emb|BX069291.1|CNS09PMN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53DE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 969

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 364 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 407



to top

>emb|BX068955.1|CNS09PDB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 697

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 359 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 402



to top

>emb|BX068814.1|CNS09P9E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53AH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 952

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 875 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 832



to top

>emb|BX068813.1|CNS09P9D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53AH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1020

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 353 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 396



to top

>emb|BX068507.1|CNS09P0V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52DC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 972

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 584 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 627



to top

>emb|BX068442.1|CNS09OZ2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52CG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 951

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 370 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 413



to top

>emb|BX067725.1|CNS09OF5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 939

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 331 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 374



to top

>emb|BX067047.1|CNS09NWB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50CC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 891

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 345 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 388



to top

>emb|BX067225.1|CNS09O19 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50DC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 337 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 380



to top

>emb|BX067123.1|CNS09NYF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50CF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 685

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 360 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 403



to top

>emb|BX066661.1|CNS09NLL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50AC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 940

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 350 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 393



to top

>emb|BX066513.1|CNS09NHH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5DD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 937

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 352 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 395



to top

>emb|BX066357.1|CNS09ND5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5CE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 353 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 396



to top

>emb|BX065367.1|CNS09MLN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49BA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1008

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 335 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 378



to top

>emb|BX065342.1|CNS09MKY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49AG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 888

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 694 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 651



to top

>emb|BX065341.1|CNS09MKX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49AG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1021

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 327 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 370



to top

>emb|BX065225.1|CNS09MHP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49AB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 987

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 320 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 363



to top

>emb|BX065207.1|CNS09MH7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49AA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 984

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 344 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 387



to top

>emb|BX064978.1|CNS09MAU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48CF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 331 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 374



to top

>emb|BX064130.1|CNS09LNA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46BB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 852

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 328 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 371



to top

>emb|BX063800.1|CNS09LE4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45DD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 426

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 55  gttggtctgaccaactatgccgccgcctactgcaccggtctgct 98



to top

>emb|BX062102.1|CNS09K2Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43AH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 857

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 327 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 370



to top

>emb|BX061737.1|CNS09JST Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42CG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 911

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 358 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 401



to top

>emb|BX061348.1|CNS09JI0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42AD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 764

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 326 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 369



to top

>emb|BX061272.1|CNS09JFW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41DH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 705

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 343 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 386



to top

>emb|BX060709.1|CNS09J09 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41AG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 937

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 326 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 369



to top

>emb|BX060454.1|CNS09IT6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40DD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 819

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 331 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 374



to top

>emb|BX060398.1|CNS09IRM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40DA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 721

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 335 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 378



to top

>emb|BX060357.1|CNS09IQH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40CG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 613

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 241 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 284



to top

>emb|BX060171.1|CNS09ILB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40BG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 335 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 378



to top

>emb|BX060096.1|CNS09IJ8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40BD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 783

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 335 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 378



to top

>emb|BX057724.1|CNS09GPC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37DC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 886

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 358 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 401



to top

>emb|BX057702.1|CNS09GOQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37DB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 591

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 337 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 380



to top

>emb|BX056485.1|CNS09FQX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35DC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 875

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 335 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 378



to top

>emb|BX056402.1|CNS09FOM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35CF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1049

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 353 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 396



to top

>emb|BX056121.1|CNS09FGT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35AF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 865

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 355 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 398



to top

>emb|BX055563.1|CNS09F1B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34AH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 751

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 344 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 387



to top

>emb|BX055539.1|CNS09F0N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34AG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 902

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 344 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 387



to top

>emb|BX054946.1|CNS09EK6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33BD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 703

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 333 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 376



to top

>emb|BX053064.1|CNS09D3W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30CA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 530

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 165 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 208



to top

>emb|BX054258.1|CNS09E12 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 942

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 330 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 373



to top

>emb|BX054179.1|CNS09DYV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32BA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 350 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 393



to top

>emb|BX052492.1|CNS09CO0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3CD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 984

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 351 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 394



to top

>emb|BX052031.1|CNS09CB7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC29DG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 848

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 281 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 324



to top

>emb|BX051778.1|CNS09C46 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC29BE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 931

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 334 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 377



to top

>emb|BX051308.1|CNS09BR4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC28CC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 953

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 233 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 276



to top

>emb|BX050125.1|CNS09AU9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC26BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 713

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 334 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 377



to top

>emb|BX049866.1|CNS09AN2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC26AA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 922

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 717 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 674



to top

>emb|BX049865.1|CNS09AN1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC26AA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 954

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 340 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 383



to top

>emb|BX048664.1|CNS099PO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC23DG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 940

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 169 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 212



to top

>emb|BX048642.1|CNS099P2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC23DF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 877

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 334 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 377



to top

>emb|BX046441.1|CNS097ZX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC20AD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1008

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 334 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 377



to top

>emb|BX048405.1|CNS099IH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC23CB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 830

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 357 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 400



to top

>emb|BX048093.1|CNS0999T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC23AA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 797

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 356 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 399



to top

>emb|BX047973.1|CNS0996H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC22DC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 928

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 310 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 353



to top

>emb|BX047820.1|CNS09928 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC22CC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 973

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 336 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 379



to top

>emb|BX047472.1|CNS098SK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21DA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 963

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 352 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 395



to top

>emb|BX046891.1|CNS098CF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC20DA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 742

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 203 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 246



to top

>emb|BX046053.1|CNS097P5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2BH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 334 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 377



to top

>emb|BX045835.1|CNS097J3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2AF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 963

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 347 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 390



to top

>emb|BX044952.1|CNS096UK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC18DE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 992

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 254 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 297



to top

>emb|BX045309.1|CNS0974H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC19BF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 931

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 351 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 394



to top

>emb|BX045229.1|CNS09729 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC19BB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 463

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 365 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 408



to top

>emb|BX042893.1|CNS0959D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC15AE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 756

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 711 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 668



to top

>emb|BX042892.1|CNS0959C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC15AE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 928

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 342 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 385



to top

>emb|BX044183.1|CNS09697 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC17CE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 589

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 341 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 384



to top

>emb|BX044179.1|CNS09693 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC17CD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 981

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 343 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 386



to top

>emb|BX043744.1|CNS095X0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC16CB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 868

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 349 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 392



to top

>emb|BX041808.1|CNS094F8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC13BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 801

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 349 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 392



to top

>emb|BX041765.1|CNS094E1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC13BF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 731

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 348 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 391



to top

>emb|BX040982.1|CNS093SA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC12AE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 992

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 339 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 382



to top

>emb|BX039800.1|CNS092VG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC10BB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 777

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 137 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 180



to top

>emb|BX037062.1|CNS090RE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9BE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 970

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 335 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 378



to top

>emb|BX036382.1|CNS0908I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA8BA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 358

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 96  gttggtctgaccaactatgccgccgcctactgcaccggtctgct 139



to top

>emb|BX036311.1|CNS0906J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA8AD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 569

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 354 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 397



to top

>emb|BX036244.1|CNS0904O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7DH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 947

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 348 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 391



to top

>emb|BX036220.1|CNS09040 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7DG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 896

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 318 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 361



to top

>emb|BX036176.1|CNS0902S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7DE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 322 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 365



to top

>emb|BX035828.1|CNS08ZT4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7BD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 991

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 355 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 398



to top

>emb|BX035130.1|CNS08Z9Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA6BD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 900

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 325 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 368



to top

>emb|BX033651.1|CNS08Y4N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA5AH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 555

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 347 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 390



to top

>emb|BX033000.1|CNS08XMK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49BA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 921

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 340 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 383



to top

>emb|BX032517.1|CNS08X95 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA48BG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 951

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 345 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 388



to top

>emb|BX029959.1|CNS08VA3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44DA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 966

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 340 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 383



to top

>emb|BX029742.1|CNS08V42 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44BG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 956

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 329 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 372



to top

>emb|BX029726.1|CNS08V3M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44BF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1048

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 351 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 394



to top

>emb|BX029020.1|CNS08UK0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA43BF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 993

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 133 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 176



to top

>emb|BX028793.1|CNS08UDP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA43AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 994

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 341 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 384



to top

>emb|BX028263.1|CNS08TYZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA42BA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 328 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 371



to top

>emb|BX027759.1|CNS08TKZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA41CB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 741

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 359 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 402



to top

>emb|BX027717.1|CNS08TJT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA41BH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 326 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 369



to top

>emb|BX027449.1|CNS08TCD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA41AD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 855

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 289 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 332



to top

>emb|BX027226.1|CNS08T66 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA40DC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1014

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 350 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 393



to top

>emb|BX025392.1|CNS08RR8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA38DG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 961

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 110 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 153



to top

>emb|BX022858.1|CNS08PSU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA34DH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 891

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 30  gttggtctgaccaactatgccgccgcctactgcaccggtctgct 73



to top

>emb|BX024660.1|CNS08R6W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37CH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 364

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 68  gttggtctgaccaactatgccgccgcctactgcaccggtctgct 111



to top

>emb|BX024607.1|CNS08R5F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37CD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 730

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 336 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 379



to top

>emb|BX024532.1|CNS08R3C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37BG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 959

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 357 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 400



to top

>emb|BX024396.1|CNS08QZK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37AG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 805

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 101 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 144



to top

>emb|BX023991.1|CNS08QOB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA36CE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 719

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 346 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 389



to top

>emb|BX023463.1|CNS08Q9N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA35DE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 721

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 356 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 399



to top

>emb|BX021699.1|CNS08OWN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA32AG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 975

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 346 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 389



to top

>emb|BX021547.1|CNS08OSF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA31DG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 756

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 361 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 404



to top

>emb|BX021239.1|CNS08OJV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA31CA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 704

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 361 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 404



to top

>emb|BX021076.1|CNS08OFC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA31AH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 887

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 349 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 392



to top

>emb|BX020843.1|CNS08O8V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA30DA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 886

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 349 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 392



to top

>emb|BX020804.1|CNS08O7S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA30CF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 787

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 569 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 526



to top

>emb|BX020803.1|CNS08O7R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA30CF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 784

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 331 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 374



to top

>emb|BX020685.1|CNS08O4H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA30BH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 616

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 96  gttggtctgaccaactatgccgccgcctactgcaccggtctgct 139



to top

>emb|BX020465.1|CNS08NYD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA30AE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 924

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 350 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 393



to top

>emb|BX020377.1|CNS08NVX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA30AA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 330 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 373



to top

>emb|BX019012.1|CNS08MU0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA28DE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 871

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 342 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 385



to top

>emb|BX018509.1|CNS08MG1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA28AD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 595

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 55  gttggtctgaccaactatgccgccgcctactgcaccggtctgct 98



to top

>emb|BX017649.1|CNS08LS5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA26CG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 350 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 393



to top

>emb|BX017470.1|CNS08LN6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA26BF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 596

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 328 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 371



to top

>emb|BX017008.1|CNS08LAC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA25CC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 632

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 346 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 389



to top

>emb|BX016928.1|CNS08L84 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA25BG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 555

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 194 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 237



to top

>emb|BX015789.1|CNS08KCH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA23CG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1011

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 340 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 383



to top

>emb|BX015709.1|CNS08KA9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA23CD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 973

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 350 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 393



to top

>emb|BX016197.1|CNS08KNT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24BB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 323 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 366



to top

>emb|BX016195.1|CNS08KNR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24BB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 978

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 498 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 541



to top

>emb|BX016151.1|CNS08KMJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24AH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 999

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 349 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 392



to top

>emb|BX014821.1|CNS08JLL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA22BB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 232 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 275



to top

>emb|BX014471.1|CNS08JBV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA21DB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 633

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 93  gttggtctgaccaactatgccgccgcctactgcaccggtctgct 136



to top

>emb|BX014327.1|CNS08J7V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA21CB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 921

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 337 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 380



to top

>emb|BX014036.1|CNS08IZS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA21AC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 825

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 221 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 264



to top

>emb|BX013669.1|CNS08IPL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA20CC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 678

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 93  gttggtctgaccaactatgccgccgcctactgcaccggtctgct 136



to top

>emb|BX013009.1|CNS08I79 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA2CD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 592

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 347 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 390



to top

>emb|BX012170.1|CNS08HJY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA19BE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 972

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 336 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 379



to top

>emb|BX011984.1|CNS08HES Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA19AD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 345 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 388



to top

>emb|BX011867.1|CNS08HBJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA18DG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 917

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 341 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 384



to top

>emb|BX011754.1|CNS08H8E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA18DB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 796

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 344 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 387



to top

>emb|BX010038.1|CNS08FWQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA16AG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 555

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 332 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 375



to top

>emb|BX008602.1|CNS08ESU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA14AD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 951

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 349 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 392



to top

>emb|BX007885.1|CNS08E8X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13AD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 358 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 401



to top

>emb|BX007280.1|CNS08DS4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA12AG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1045

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 347 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 390



to top

>emb|BX006576.1|CNS08D8K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA11AE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 996

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 105 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 148



to top

>emb|BX005611.1|CNS08CHR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA1AF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 901

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 268 gttggactcaccaactatgctgcagcctactgcactggtctgct 311
           ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 351 gttggtctgaccaactatgccgccgcctactgcaccggtctgct 394



to top

>emb|X06148.1|RNRPL5 Rat mRNA for ribosomal protein L5
          Length = 1069

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 280 aactatgctgcagcctactgcactggtctgct 311
           ||||||||||||||||| |||||||| |||||
Sbjct: 403 aactatgctgcagcctattgcactggcctgct 434


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,116,194
Number of Sequences: 3902068
Number of extensions: 3116194
Number of successful extensions: 49272
Number of sequences better than 10.0: 584
Number of HSP's better than 10.0 without gapping: 584
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 48381
Number of HSP's gapped (non-prelim): 875
length of query: 461
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 439
effective length of database: 17,147,199,772
effective search space: 7527620699908
effective search space used: 7527620699908
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top