ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags31g19
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|NM_197857.1| Oryza sativa (japonica cultivar-group) hypothet... 329 5e-87
2dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 329 5e-87
3gb|AC060755.9|AC060755 Oryza sativa chromosome 10 BAC OSJNBa0003... 329 5e-87
4dbj|AK060642.1| Oryza sativa (japonica cultivar-group) cDNA clon... 329 5e-87
5gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 329 5e-87
6dbj|AK101216.1| Oryza sativa (japonica cultivar-group) cDNA clon... 305 7e-80
7dbj|AK073206.1| Oryza sativa (japonica cultivar-group) cDNA clon... 232 8e-58
8gb|AY109670.1| Zea mays CL52253_1 mRNA sequence 170 3e-39
9ref|XM_329527.1| Neurospora crassa OR74A hypothetical protein ( ... 44 0.40
10ref|XM_958061.1| Neurospora crassa OR74A hypothetical protein ( ... 44 0.40
11emb|AL356324.1|NCB9J10 Neurospora crassa DNA linkage group II BA... 44 0.40
12gb|AC105407.5| Mus musculus BAC clone RP24-196J17 from 13, compl... 42 1.6
13gb|AC154454.2| Mus musculus BAC clone RP24-173H15 from chromosom... 42 1.6
14gb|AC016888.23| Homo sapiens chromosome 17, clone RP11-452I5, co... 42 1.6
15gb|AC121895.3| Mus musculus BAC clone RP24-157P5 from chromosome... 40 6.2
16ref|XM_846833.1| PREDICTED: Canis familiaris similar to ash1 (ab... 40 6.2
17ref|XM_537251.2| PREDICTED: Canis familiaris similar to ash1 (ab... 40 6.2
18gb|AY349087.1| Rhizophlyctis harderi ATCC 24053 28S large subuni... 40 6.2
19dbj|AB228651.1| Aspergillus oryzae cDNA, contig sequence: AoEST5524 40 6.2
20dbj|AP007157.1| Aspergillus oryzae RIB40 genomic DNA, SC023 40 6.2
21emb|BX294115.7| Mouse DNA sequence from clone RP24-465I11 on chr... 40 6.2
22emb|BX005279.12| Mouse DNA sequence from clone RP23-321B15 on ch... 40 6.2
23emb|AL929508.6| Zebrafish DNA sequence from clone CH211-158G13, ... 40 6.2
24emb|AL645861.12| Mouse DNA sequence from clone RP23-184G6 on chr... 40 6.2

>ref|NM_197857.1| Oryza sativa (japonica cultivar-group) hypothetical protein
            (OSJNBa0003O19.24), mRNA
          Length = 2136

 Score =  329 bits (166), Expect = 5e-87
 Identities = 343/402 (85%)
 Strand = Plus / Plus

                                                                        
Query: 50   tcgtcctctgcaccaaggtcaccaatgccattgcgctgcttgaccccctcactctgcgtg 109
            |||||||||||| |||||||||||||||||| || ||||||||||||||||| |||||||
Sbjct: 1412 tcgtcctctgcatcaaggtcaccaatgccatcgctctgcttgaccccctcaccctgcgtg 1471

                                                                        
Query: 110  tgcaccatctggaggagaagaagtacagggtgtacaacttcaaggccgctctgactagca 169
            ||||||| || ||||| |||||||||||||| |||||||||||||| ||||| || ||||
Sbjct: 1472 tgcaccacctcgaggaaaagaagtacagggtctacaacttcaaggctgctctcaccagca 1531

                                                                        
Query: 170  agcagctcgtgcagtacatggtgcttgatattgagccagagtcacctgagatcaccattg 229
            ||||||||||  ||||||| ||||| || || ||||  |||||||| ||||| |||||||
Sbjct: 1532 agcagctcgtcgagtacatcgtgctagacatcgagcacgagtcaccagagattaccattg 1591

                                                                        
Query: 230  atggatctcggtaccagctggcatatgcgcaggttgcccggatgtctgattttgggaaaa 289
            | |||||||| |||||| |||| ||||| ||||| |||||| | || || ||||||||||
Sbjct: 1592 acggatctcgctaccagttggcttatgcccaggtcgcccgggtctccgactttgggaaaa 1651

                                                                        
Query: 290  atgatactgtgtttacagtacgaactcatcttgggcaccgtctgaaccctggggaccttg 349
            | || ||  |||| || || || ||||||||||| ||||  ||||| ||||| |||||||
Sbjct: 1652 acgacaccatgttcaccgtgcggactcatcttggccacctgctgaatcctggagaccttg 1711

                                                                        
Query: 350  cccttgggtatgatctctacggtgccaacatgaatgatgatgatatggacaaggctttat 409
            |||||||||||||||| || ||||||||| ||||||||||||| |||||||  ||| |  
Sbjct: 1712 cccttgggtatgatctttatggtgccaacttgaatgatgatgacatggacacagctatga 1771

                                                      
Query: 410  tacgccagaatttgcctgaagtgattcttgtcaagaagagct 451
            | ||||| | | |||||||||| |||||||| ||||||||||
Sbjct: 1772 tgcgccacagtctgcctgaagtcattcttgttaagaagagct 1813



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score =  329 bits (166), Expect = 5e-87
 Identities = 343/402 (85%)
 Strand = Plus / Minus

                                                                            
Query: 50       tcgtcctctgcaccaaggtcaccaatgccattgcgctgcttgaccccctcactctgcgtg 109
                |||||||||||| |||||||||||||||||| || ||||||||||||||||| |||||||
Sbjct: 22263484 tcgtcctctgcatcaaggtcaccaatgccatcgctctgcttgaccccctcaccctgcgtg 22263425

                                                                            
Query: 110      tgcaccatctggaggagaagaagtacagggtgtacaacttcaaggccgctctgactagca 169
                ||||||| || ||||| |||||||||||||| |||||||||||||| ||||| || ||||
Sbjct: 22263424 tgcaccacctcgaggaaaagaagtacagggtctacaacttcaaggctgctctcaccagca 22263365

                                                                            
Query: 170      agcagctcgtgcagtacatggtgcttgatattgagccagagtcacctgagatcaccattg 229
                ||||||||||  ||||||| ||||| || || ||||  |||||||| ||||| |||||||
Sbjct: 22263364 agcagctcgtcgagtacatcgtgctagacatcgagcacgagtcaccagagattaccattg 22263305

                                                                            
Query: 230      atggatctcggtaccagctggcatatgcgcaggttgcccggatgtctgattttgggaaaa 289
                | |||||||| |||||| |||| ||||| ||||| |||||| | || || ||||||||||
Sbjct: 22263304 acggatctcgctaccagttggcttatgcccaggtcgcccgggtctccgactttgggaaaa 22263245

                                                                            
Query: 290      atgatactgtgtttacagtacgaactcatcttgggcaccgtctgaaccctggggaccttg 349
                | || ||  |||| || || || ||||||||||| ||||  ||||| ||||| |||||||
Sbjct: 22263244 acgacaccatgttcaccgtgcggactcatcttggccacctgctgaatcctggagaccttg 22263185

                                                                            
Query: 350      cccttgggtatgatctctacggtgccaacatgaatgatgatgatatggacaaggctttat 409
                |||||||||||||||| || ||||||||| ||||||||||||| |||||||  ||| |  
Sbjct: 22263184 cccttgggtatgatctttatggtgccaacttgaatgatgatgacatggacacagctatga 22263125

                                                          
Query: 410      tacgccagaatttgcctgaagtgattcttgtcaagaagagct 451
                | ||||| | | |||||||||| |||||||| ||||||||||
Sbjct: 22263124 tgcgccacagtctgcctgaagtcattcttgttaagaagagct 22263083



to top

>gb|AC060755.9|AC060755 Oryza sativa chromosome 10 BAC OSJNBa0003O19 genomic sequence, complete
             sequence
          Length = 172427

 Score =  329 bits (166), Expect = 5e-87
 Identities = 343/402 (85%)
 Strand = Plus / Minus

                                                                         
Query: 50    tcgtcctctgcaccaaggtcaccaatgccattgcgctgcttgaccccctcactctgcgtg 109
             |||||||||||| |||||||||||||||||| || ||||||||||||||||| |||||||
Sbjct: 80727 tcgtcctctgcatcaaggtcaccaatgccatcgctctgcttgaccccctcaccctgcgtg 80668

                                                                         
Query: 110   tgcaccatctggaggagaagaagtacagggtgtacaacttcaaggccgctctgactagca 169
             ||||||| || ||||| |||||||||||||| |||||||||||||| ||||| || ||||
Sbjct: 80667 tgcaccacctcgaggaaaagaagtacagggtctacaacttcaaggctgctctcaccagca 80608

                                                                         
Query: 170   agcagctcgtgcagtacatggtgcttgatattgagccagagtcacctgagatcaccattg 229
             ||||||||||  ||||||| ||||| || || ||||  |||||||| ||||| |||||||
Sbjct: 80607 agcagctcgtcgagtacatcgtgctagacatcgagcacgagtcaccagagattaccattg 80548

                                                                         
Query: 230   atggatctcggtaccagctggcatatgcgcaggttgcccggatgtctgattttgggaaaa 289
             | |||||||| |||||| |||| ||||| ||||| |||||| | || || ||||||||||
Sbjct: 80547 acggatctcgctaccagttggcttatgcccaggtcgcccgggtctccgactttgggaaaa 80488

                                                                         
Query: 290   atgatactgtgtttacagtacgaactcatcttgggcaccgtctgaaccctggggaccttg 349
             | || ||  |||| || || || ||||||||||| ||||  ||||| ||||| |||||||
Sbjct: 80487 acgacaccatgttcaccgtgcggactcatcttggccacctgctgaatcctggagaccttg 80428

                                                                         
Query: 350   cccttgggtatgatctctacggtgccaacatgaatgatgatgatatggacaaggctttat 409
             |||||||||||||||| || ||||||||| ||||||||||||| |||||||  ||| |  
Sbjct: 80427 cccttgggtatgatctttatggtgccaacttgaatgatgatgacatggacacagctatga 80368

                                                       
Query: 410   tacgccagaatttgcctgaagtgattcttgtcaagaagagct 451
             | ||||| | | |||||||||| |||||||| ||||||||||
Sbjct: 80367 tgcgccacagtctgcctgaagtcattcttgttaagaagagct 80326



to top

>dbj|AK060642.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-027-F06, full
            insert sequence
          Length = 1620

 Score =  329 bits (166), Expect = 5e-87
 Identities = 343/402 (85%)
 Strand = Plus / Plus

                                                                        
Query: 50   tcgtcctctgcaccaaggtcaccaatgccattgcgctgcttgaccccctcactctgcgtg 109
            |||||||||||| |||||||||||||||||| || ||||||||||||||||| |||||||
Sbjct: 884  tcgtcctctgcatcaaggtcaccaatgccatcgctctgcttgaccccctcaccctgcgtg 943

                                                                        
Query: 110  tgcaccatctggaggagaagaagtacagggtgtacaacttcaaggccgctctgactagca 169
            ||||||| || ||||| |||||||||||||| |||||||||||||| ||||| || ||||
Sbjct: 944  tgcaccacctcgaggaaaagaagtacagggtctacaacttcaaggctgctctcaccagca 1003

                                                                        
Query: 170  agcagctcgtgcagtacatggtgcttgatattgagccagagtcacctgagatcaccattg 229
            ||||||||||  ||||||| ||||| || || ||||  |||||||| ||||| |||||||
Sbjct: 1004 agcagctcgtcgagtacatcgtgctagacatcgagcacgagtcaccagagattaccattg 1063

                                                                        
Query: 230  atggatctcggtaccagctggcatatgcgcaggttgcccggatgtctgattttgggaaaa 289
            | |||||||| |||||| |||| ||||| ||||| |||||| | || || ||||||||||
Sbjct: 1064 acggatctcgctaccagttggcttatgcccaggtcgcccgggtctccgactttgggaaaa 1123

                                                                        
Query: 290  atgatactgtgtttacagtacgaactcatcttgggcaccgtctgaaccctggggaccttg 349
            | || ||  |||| || || || ||||||||||| ||||  ||||| ||||| |||||||
Sbjct: 1124 acgacaccatgttcaccgtgcggactcatcttggccacctgctgaatcctggagaccttg 1183

                                                                        
Query: 350  cccttgggtatgatctctacggtgccaacatgaatgatgatgatatggacaaggctttat 409
            |||||||||||||||| || ||||||||| ||||||||||||| |||||||  ||| |  
Sbjct: 1184 cccttgggtatgatctttatggtgccaacttgaatgatgatgacatggacacagctatga 1243

                                                      
Query: 410  tacgccagaatttgcctgaagtgattcttgtcaagaagagct 451
            | ||||| | | |||||||||| |||||||| ||||||||||
Sbjct: 1244 tgcgccacagtctgcctgaagtcattcttgttaagaagagct 1285



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score =  329 bits (166), Expect = 5e-87
 Identities = 343/402 (85%)
 Strand = Plus / Minus

                                                                            
Query: 50       tcgtcctctgcaccaaggtcaccaatgccattgcgctgcttgaccccctcactctgcgtg 109
                |||||||||||| |||||||||||||||||| || ||||||||||||||||| |||||||
Sbjct: 22275552 tcgtcctctgcatcaaggtcaccaatgccatcgctctgcttgaccccctcaccctgcgtg 22275493

                                                                            
Query: 110      tgcaccatctggaggagaagaagtacagggtgtacaacttcaaggccgctctgactagca 169
                ||||||| || ||||| |||||||||||||| |||||||||||||| ||||| || ||||
Sbjct: 22275492 tgcaccacctcgaggaaaagaagtacagggtctacaacttcaaggctgctctcaccagca 22275433

                                                                            
Query: 170      agcagctcgtgcagtacatggtgcttgatattgagccagagtcacctgagatcaccattg 229
                ||||||||||  ||||||| ||||| || || ||||  |||||||| ||||| |||||||
Sbjct: 22275432 agcagctcgtcgagtacatcgtgctagacatcgagcacgagtcaccagagattaccattg 22275373

                                                                            
Query: 230      atggatctcggtaccagctggcatatgcgcaggttgcccggatgtctgattttgggaaaa 289
                | |||||||| |||||| |||| ||||| ||||| |||||| | || || ||||||||||
Sbjct: 22275372 acggatctcgctaccagttggcttatgcccaggtcgcccgggtctccgactttgggaaaa 22275313

                                                                            
Query: 290      atgatactgtgtttacagtacgaactcatcttgggcaccgtctgaaccctggggaccttg 349
                | || ||  |||| || || || ||||||||||| ||||  ||||| ||||| |||||||
Sbjct: 22275312 acgacaccatgttcaccgtgcggactcatcttggccacctgctgaatcctggagaccttg 22275253

                                                                            
Query: 350      cccttgggtatgatctctacggtgccaacatgaatgatgatgatatggacaaggctttat 409
                |||||||||||||||| || ||||||||| ||||||||||||| |||||||  ||| |  
Sbjct: 22275252 cccttgggtatgatctttatggtgccaacttgaatgatgatgacatggacacagctatga 22275193

                                                          
Query: 410      tacgccagaatttgcctgaagtgattcttgtcaagaagagct 451
                | ||||| | | |||||||||| |||||||| ||||||||||
Sbjct: 22275192 tgcgccacagtctgcctgaagtcattcttgttaagaagagct 22275151



to top

>dbj|AK101216.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033031B21, full
            insert sequence
          Length = 2004

 Score =  305 bits (154), Expect = 7e-80
 Identities = 341/402 (84%), Gaps = 1/402 (0%)
 Strand = Plus / Plus

                                                                        
Query: 50   tcgtcctctgcaccaaggtcaccaatgccattgcgctgcttgaccccctcactctgcgtg 109
            |||||||||||| |||||||||||||||||| || ||||||||||||||||| |||||  
Sbjct: 895  tcgtcctctgcatcaaggtcaccaatgccatcgctctgcttgaccccctcaccctgcgc- 953

                                                                        
Query: 110  tgcaccatctggaggagaagaagtacagggtgtacaacttcaaggccgctctgactagca 169
            ||||||| || ||||| |||||||||||||| |||||||||||||| ||||| || ||||
Sbjct: 954  tgcaccacctcgaggaaaagaagtacagggtctacaacttcaaggctgctctcaccagca 1013

                                                                        
Query: 170  agcagctcgtgcagtacatggtgcttgatattgagccagagtcacctgagatcaccattg 229
            ||||||||||  ||||||| ||||| || || ||||  |||||||| ||||| |||||||
Sbjct: 1014 agcagctcgtcgagtacatcgtgctagacatcgagcacgagtcaccagagattaccattg 1073

                                                                        
Query: 230  atggatctcggtaccagctggcatatgcgcaggttgcccggatgtctgattttgggaaaa 289
            | |||||||| |||||| |||| ||||| ||||| |||||| | || || ||||||||||
Sbjct: 1074 acggatctcgctaccagttggcttatgcccaggtcgcccgggtctccgactttgggaaaa 1133

                                                                        
Query: 290  atgatactgtgtttacagtacgaactcatcttgggcaccgtctgaaccctggggaccttg 349
            | || ||  |||| || || || ||||||||||| ||||  ||||| ||||| |||||||
Sbjct: 1134 acgacaccatgttcaccgtgcggactcatcttggccacctgctgaatcctggagaccttg 1193

                                                                        
Query: 350  cccttgggtatgatctctacggtgccaacatgaatgatgatgatatggacaaggctttat 409
            |||||||||||||||| || ||||||||| ||||||||||||| |||||||  ||| |  
Sbjct: 1194 cccttgggtatgatctttatggtgccaacttgaatgatgatgacatggacacagctatga 1253

                                                      
Query: 410  tacgccagaatttgcctgaagtgattcttgtcaagaagagct 451
            | ||||| | | |||||||||| |||||||| ||||||||||
Sbjct: 1254 tgcgccacagtctgcctgaagtcattcttgttaagaagagct 1295



to top

>dbj|AK073206.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033004L13, full
           insert sequence
          Length = 1460

 Score =  232 bits (117), Expect = 8e-58
 Identities = 273/325 (84%)
 Strand = Plus / Plus

                                                                       
Query: 127 aagaagtacagggtgtacaacttcaaggccgctctgactagcaagcagctcgtgcagtac 186
           |||||||||||||| |||||||||||||| ||||| || ||||||||||||||  |||||
Sbjct: 4   aagaagtacagggtctacaacttcaaggctgctctcaccagcaagcagctcgtcgagtac 63

                                                                       
Query: 187 atggtgcttgatattgagccagagtcacctgagatcaccattgatggatctcggtaccag 246
           || ||||| || || ||||  |||||||| ||||| |||||||| |||||||| ||||||
Sbjct: 64  atcgtgctagacatcgagcacgagtcaccagagattaccattgacggatctcgctaccag 123

                                                                       
Query: 247 ctggcatatgcgcaggttgcccggatgtctgattttgggaaaaatgatactgtgtttaca 306
            |||| ||||| ||||| |||||| | || || ||||||||||| || ||  |||| || 
Sbjct: 124 ttggcttatgcccaggtcgcccgggtctccgactttgggaaaaacgacaccatgttcacc 183

                                                                       
Query: 307 gtacgaactcatcttgggcaccgtctgaaccctggggaccttgcccttgggtatgatctc 366
           || || ||||||||||| ||||  ||||| ||||| ||||||||||||||||||||||| 
Sbjct: 184 gtgcggactcatcttggccacctgctgaatcctggagaccttgcccttgggtatgatctt 243

                                                                       
Query: 367 tacggtgccaacatgaatgatgatgatatggacaaggctttattacgccagaatttgcct 426
           || ||||||||| ||||||||||||| |||||||  ||| |  | ||||| | | |||||
Sbjct: 244 tatggtgccaacttgaatgatgatgacatggacacagctatgatgcgccacagtctgcct 303

                                    
Query: 427 gaagtgattcttgtcaagaagagct 451
           ||||| |||||||| ||||||||||
Sbjct: 304 gaagtcattcttgttaagaagagct 328



to top

>gb|AY109670.1| Zea mays CL52253_1 mRNA sequence
          Length = 1069

 Score =  170 bits (86), Expect = 3e-39
 Identities = 215/260 (82%)
 Strand = Plus / Minus

                                                                       
Query: 34  ggtgggctaggcccgctcgtcctctgcaccaaggtcaccaatgccattgcgctgcttgac 93
           ||||| || ||||||||||| |||||   ||||||||| ||||||||||| || ||||| 
Sbjct: 950 ggtggccttggcccgctcgtgctctgtgtcaaggtcacaaatgccattgctcttcttgat 891

                                                                       
Query: 94  cccctcactctgcgtgtgcaccatctggaggagaagaagtacagggtgtacaacttcaag 153
           ||||| || ||||| |||||||| |||||||||      |||||||| || || || || 
Sbjct: 890 cccctaacgctgcgagtgcaccacctggaggagnnnnnntacagggtttataattttaaa 831

                                                                       
Query: 154 gccgctctgactagcaagcagctcgtgcagtacatggtgcttgatattgagccagagtca 213
           || ||||| || ||||||||||||||| ||||||| |||||||| ||||| ||||| || 
Sbjct: 830 gcagctctcaccagcaagcagctcgtggagtacattgtgcttgacattgaaccagaatcg 771

                                                                       
Query: 214 cctgagatcaccattgatggatctcggtaccagctggcatatgcgcaggttgcccggatg 273
           ||||| ||   ||| ||||| |||||||||||| |||| |||||||||||||||||||||
Sbjct: 770 cctgaaatttgcatcgatgggtctcggtaccagttggcttatgcgcaggttgcccggatg 711

                               
Query: 274 tctgattttgggaaaaatga 293
           || ||||| ||||| |||||
Sbjct: 710 tcagatttcgggaagaatga 691



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 37/39 (94%)
 Strand = Plus / Minus

                                                  
Query: 424 cctgaagtgattcttgtcaagaagagctatgagaagagg 462
           ||||| ||| |||||||||||||||||||||||||||||
Sbjct: 560 cctgaggtggttcttgtcaagaagagctatgagaagagg 522



to top

>ref|XM_329527.1| Neurospora crassa OR74A hypothetical protein ( hypothetical protein
           B9J10.310 [imported] - Neurospora crassa OR74A )
           (NCU08483.1) partial mRNA
          Length = 372

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 383 atgatgatgatatggacaaggcttta 408
           |||||||||| |||||||||||||||
Sbjct: 179 atgatgatgaaatggacaaggcttta 204



to top

>ref|XM_958061.1| Neurospora crassa OR74A hypothetical protein ( hypothetical protein
           B9J10.310 [imported] - Neurospora crassa OR74A )
           (NCU08483.1) partial mRNA
          Length = 372

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 383 atgatgatgatatggacaaggcttta 408
           |||||||||| |||||||||||||||
Sbjct: 179 atgatgatgaaatggacaaggcttta 204



to top

>emb|AL356324.1|NCB9J10 Neurospora crassa DNA linkage group II BAC clone B9J10
          Length = 66924

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 383   atgatgatgatatggacaaggcttta 408
             |||||||||| |||||||||||||||
Sbjct: 58651 atgatgatgaaatggacaaggcttta 58676



to top

>gb|AC105407.5| Mus musculus BAC clone RP24-196J17 from 13, complete sequence
          Length = 175889

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 84    gctgcttgaccccctcactct 104
             |||||||||||||||||||||
Sbjct: 77527 gctgcttgaccccctcactct 77507



to top

>gb|AC154454.2| Mus musculus BAC clone RP24-173H15 from chromosome 13, complete sequence
          Length = 181147

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 84     gctgcttgaccccctcactct 104
              |||||||||||||||||||||
Sbjct: 176286 gctgcttgaccccctcactct 176306



to top

>gb|AC016888.23| Homo sapiens chromosome 17, clone RP11-452I5, complete sequence
          Length = 163597

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 55    ctctgcaccaaggtcaccaatgcca 79
             |||| ||||||||||||||||||||
Sbjct: 62977 ctctccaccaaggtcaccaatgcca 63001



to top

>gb|AC121895.3| Mus musculus BAC clone RP24-157P5 from chromosome 2, complete sequence
          Length = 171557

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 418   aatttgcctgaagtgattct 437
             ||||||||||||||||||||
Sbjct: 59142 aatttgcctgaagtgattct 59161



to top

>ref|XM_846833.1| PREDICTED: Canis familiaris similar to ash1 (absent, small, or
            homeotic)-like, transcript variant 2 (LOC480128), mRNA
          Length = 9298

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 236  ctcggtaccagctggcatat 255
            ||||||||||||||||||||
Sbjct: 7153 ctcggtaccagctggcatat 7134



to top

>ref|XM_537251.2| PREDICTED: Canis familiaris similar to ash1 (absent, small, or
            homeotic)-like, transcript variant 1 (LOC480128), mRNA
          Length = 9271

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 236  ctcggtaccagctggcatat 255
            ||||||||||||||||||||
Sbjct: 7126 ctcggtaccagctggcatat 7107



to top

>gb|AY349087.1| Rhizophlyctis harderi ATCC 24053 28S large subunit ribosomal RNA
           gene, partial sequence
          Length = 774

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 294 tactgtgtttacagtacgaa 313
           ||||||||||||||||||||
Sbjct: 37  tactgtgtttacagtacgaa 56



to top

>dbj|AB228651.1| Aspergillus oryzae cDNA, contig sequence: AoEST5524
          Length = 216

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 85  ctgcttgaccccctcactct 104
           ||||||||||||||||||||
Sbjct: 63  ctgcttgaccccctcactct 44



to top

>dbj|AP007157.1| Aspergillus oryzae RIB40 genomic DNA, SC023
          Length = 2661830

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 85      ctgcttgaccccctcactct 104
               ||||||||||||||||||||
Sbjct: 1504476 ctgcttgaccccctcactct 1504457



to top

>emb|BX294115.7| Mouse DNA sequence from clone RP24-465I11 on chromosome 2, complete
            sequence
          Length = 15018

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 418  aatttgcctgaagtgattct 437
            ||||||||||||||||||||
Sbjct: 9564 aatttgcctgaagtgattct 9583



to top

>emb|BX005279.12| Mouse DNA sequence from clone RP23-321B15 on chromosome X, complete
             sequence
          Length = 222627

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 287   aaaatgatactgtgtttaca 306
             ||||||||||||||||||||
Sbjct: 26401 aaaatgatactgtgtttaca 26420



to top

>emb|AL929508.6| Zebrafish DNA sequence from clone CH211-158G13, complete sequence
          Length = 180029

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 375   caacatgaatgatgatgata 394
             ||||||||||||||||||||
Sbjct: 12129 caacatgaatgatgatgata 12110



to top

>emb|AL645861.12| Mouse DNA sequence from clone RP23-184G6 on chromosome 11, complete
             sequence
          Length = 212385

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 101   ctctgcgtgtgcaccatctggagg 124
             ||||||||||| ||||||||||||
Sbjct: 34790 ctctgcgtgtgtaccatctggagg 34767


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,696,986
Number of Sequences: 3902068
Number of extensions: 3696986
Number of successful extensions: 69652
Number of sequences better than 10.0: 24
Number of HSP's better than 10.0 without gapping: 24
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 69565
Number of HSP's gapped (non-prelim): 86
length of query: 462
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 440
effective length of database: 17,147,199,772
effective search space: 7544767899680
effective search space used: 7544767899680
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top