ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags31f14
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AK104806.1| Oryza sativa (japonica cultivar-group) cDNA clon... 488 e-135
2dbj|AK070647.1| Oryza sativa (japonica cultivar-group) cDNA clon... 480 e-132
3gb|AY105581.1| Zea mays PCO150618 mRNA sequence 462 e-127
4gb|AY109618.1| Zea mays CL8996_1 mRNA sequence 440 e-120
5gb|AY108123.1| Zea mays PCO067267 mRNA sequence 402 e-109
6dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 287 1e-74
7gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 287 1e-74
8emb|AL731784.3|CNS08C88 Oryza sativa chromosome 12, . BAC OSJNBa... 287 1e-74
9gb|AF479049.1| Triticum aestivum ribosomal protein L2 mRNA, part... 204 2e-49
10emb|AJ404848.1|GMA404848 Glycine max mRNA for ribosomal protein ... 194 2e-46
11ref|NM_127358.3| Arabidopsis thaliana EMB2296; structural consti... 190 2e-45
12gb|AY128314.1| Arabidopsis thaliana 60S ribosomal protein L2 (At... 190 2e-45
13emb|BX820233.1|CNS0A8O8 Arabidopsis thaliana Full-length cDNA Co... 190 2e-45
14emb|BX820320.1|CNS0A7WS Arabidopsis thaliana Full-length cDNA Co... 190 2e-45
15gb|BT001177.1| Arabidopsis thaliana 60S ribosomal protein L2 (At... 190 2e-45
16emb|BX820589.1|CNS0A8QO Arabidopsis thaliana Full-length cDNA Co... 182 6e-43
17emb|BX820387.1|CNS0A8NL Arabidopsis thaliana Full-length cDNA Co... 174 1e-40
18emb|BX820333.1|CNS0A8NS Arabidopsis thaliana Full-length cDNA Co... 170 2e-39
19emb|X86765.1|ATC24RPL2 A.thaliana mRNA for ribosomal protein L2 167 4e-38
20gb|AF156372.1| Nicotiana tabacum clone PR60 60S ribosomal protei... 163 5e-37
21ref|NM_119780.2| Arabidopsis thaliana structural constituent of ... 161 2e-36
22emb|AL161588.2|ATCHRIV84 Arabidopsis thaliana DNA chromosome 4, ... 161 2e-36
23emb|AL022141.1|ATF23E13 Arabidopsis thaliana DNA chromosome 4, B... 161 2e-36
24emb|AL022373.1|ATT19K4 Arabidopsis thaliana DNA chromosome 4, BA... 161 2e-36
25gb|AF361610.1| Arabidopsis thaliana AT4g36130/F23E13_20 mRNA, co... 161 2e-36
26gb|AF367335.1| Arabidopsis thaliana AT4g36130/F23E13_20 mRNA, co... 161 2e-36
27gb|AY058221.1| Arabidopsis thaliana AT4g36130/F23E13_20 mRNA, co... 161 2e-36
28emb|BX820018.1|CNS0A8IW Arabidopsis thaliana Full-length cDNA Co... 161 2e-36
29emb|BX818795.1|CNS0A8ZD Arabidopsis thaliana Full-length cDNA Co... 159 9e-36
30gb|AC006201.4| Arabidopsis thaliana chromosome 2 clone T27K22 ma... 157 3e-35
31emb|X64562.1|LERPL2MR L.esculentum mRNA for ribosomal protein L2 153 5e-34
32gb|DQ252497.1| Solanum tuberosum clone 068C11 ribosomal protein ... 153 5e-34
33emb|X62500.1|NTRL2RNA N.tabacum RL2 mRNA for 60S ribosomal prote... 147 3e-32
34gb|BT013866.1| Lycopersicon esculentum clone 132846R, mRNA sequence 145 1e-31
35gb|AC135311.13| Medicago truncatula clone mth2-27l9, complete se... 145 1e-31
36emb|BX827983.1|CNS0A32V Arabidopsis thaliana Full-length cDNA Co... 143 5e-31
37gb|DQ316258.1| Litopenaeus vannamei ribosomal protein L8 mRNA, c... 127 3e-26
38gb|AF098520.1|AF098520 Drosophila melanogaster ribosomal protein... 86 1e-13
39gb|BT014913.1| Drosophila melanogaster RH21963 full insert cDNA 82 2e-12
40gb|AY485337.1| Mamestra brassicae ribosomal protein L8 (rpl8) mR... 82 2e-12
41gb|AC011905.4| Drosophila melanogaster 3L BAC RP98-27A3 (Roswell... 82 2e-12
42ref|NM_167955.1| Drosophila melanogaster Ribosomal protein L8 CG... 82 2e-12
43ref|NM_079987.2| Drosophila melanogaster Ribosomal protein L8 CG... 82 2e-12
44gb|AY071342.1| Drosophila melanogaster RE37829 full length cDNA 82 2e-12
45gb|BT022891.1| Drosophila melanogaster IP12501 full insert cDNA 82 2e-12
46gb|AE003475.4| Drosophila melanogaster chromosome 3L, section 9 ... 82 2e-12
47gb|DQ440262.1| Aedes aegypti clone AET-322 60S ribosomal protein... 78 3e-11
48emb|CR938631.1| Single read from an extremity of a full-length c... 78 3e-11
49emb|CR938630.1| Single read from an extremity of a full-length c... 78 3e-11
50emb|CR938124.1| Single read from an extremity of a full-length c... 78 3e-11
51gb|M99055.1|MQSRPL8X Mosquito ribosomal protein L8 (rpL8) gene e... 78 3e-11
52emb|CR937651.1| Single read from an extremity of a cDNA clone ma... 76 1e-10
53emb|CR937650.1| Single read from an extremity of a cDNA clone ma... 76 1e-10
54gb|AF526214.1| Argopecten irradians isolate iolsaicl63ct83cn90 r... 74 4e-10
55emb|CT033188.1| Platynereis dumerilii EST IB0AAA25AH04EM1 72 2e-09
56emb|CT033187.1| Platynereis dumerilii EST IB0AAA25AH04FM1 72 2e-09
57gb|AY432072.1| Aedes aegypti ASAP ID: 34485 cytosolic large ribo... 70 6e-09
58ref|XM_582676.2| PREDICTED: Bos taurus similar to 60S ribosomal ... 70 6e-09
59gb|AY128671.1| Drosophila virilis daughter of sevenless (dos) ge... 70 6e-09
60emb|CR938453.1| Single read from an extremity of a full-length c... 70 6e-09
61emb|CR937938.1| Single read from an extremity of a full-length c... 70 6e-09
62gb|AY943311.1| Wyeomyia smithii ribosomal protein L8 mRNA, parti... 70 6e-09
63ref|XM_447807.1| Candida glabrata CBS138, CAGL0J02354g partial mRNA 68 2e-08
64emb|AM049012.1| Timarcha balearica partial mRNA for ribosomal pr... 68 2e-08
65emb|AM049011.1| Mycetophagus quadripustulatus mRNA for ribosomal... 68 2e-08
66emb|CR380956.1| Candida glabrata strain CBS138 chromosome J comp... 68 2e-08
67gb|AF164152.1|AF164152 Anopheles gambiae strain M2 ribosomal pro... 68 2e-08
68gb|DQ206473.1| Platynereis dumerilii isolate TOA23 ribosomal pro... 68 2e-08
69emb|CT033650.1| Platynereis dumerilii EST IB0AAA16CH07EM1 68 2e-08
70emb|CT033649.1| Platynereis dumerilii EST IB0AAA16CH07FM1 68 2e-08
71emb|CT033621.1| Platynereis dumerilii EST IB0AAA17BB03EM1 68 2e-08
72emb|CT033394.1| Platynereis dumerilii EST IB0AAA21BA08EM1 68 2e-08
73emb|CT033393.1| Platynereis dumerilii EST IB0AAA21BA08FM1 68 2e-08
74emb|CT033017.1| Platynereis dumerilii EST IB0AAA27DH06EM1 68 2e-08
75emb|CT033016.1| Platynereis dumerilii EST IB0AAA27DH06FM1 68 2e-08
76emb|CT032883.1| Platynereis dumerilii EST IB0AAA30AD02EM1 68 2e-08
77emb|CT032882.1| Platynereis dumerilii EST IB0AAA30AD02FM1 68 2e-08
78emb|CT032622.1| Platynereis dumerilii EST IB0AAA35AA08FM1 68 2e-08
79emb|CT032614.1| Platynereis dumerilii EST IB0AAA35BC06EM1 68 2e-08
80emb|CT032322.1| Platynereis dumerilii EST IB0AAA40CH03EM1 68 2e-08
81emb|CT032321.1| Platynereis dumerilii EST IB0AAA40CH03FM1 68 2e-08
82emb|CT032290.1| Platynereis dumerilii EST IB0AAA41CE04EM1 68 2e-08
83emb|CT032289.1| Platynereis dumerilii EST IB0AAA41CE04FM1 68 2e-08
84emb|CT032278.1| Platynereis dumerilii EST IB0AAA41DB03EM1 68 2e-08
85emb|CT032277.1| Platynereis dumerilii EST IB0AAA41DB03FM1 68 2e-08
86dbj|AU066544.1| Chlamydomonas sp. HS-5 mRNA for 60S ribosomal pr... 68 2e-08
87gb|AY919670.1| Pimephales promelas 60S ribosomal protein L8 mRNA... 66 1e-07
88gb|BC102277.1| Bos taurus similar to 60S ribosomal protein L8, m... 66 1e-07
89gb|AF401561.1| Ictalurus punctatus ribosomal protein L8 mRNA, co... 66 1e-07
90ref|NM_001034625.1| Bos taurus similar to 60S ribosomal protein ... 66 1e-07
91emb|AM049010.1| Meladema coriacea partial mRNA for ribosomal pro... 64 4e-07
92emb|AM049009.1| Georissus sp. APV-2005 mRNA for ribosomal protei... 64 4e-07
93ref|XM_962890.1| PREDICTED: Tribolium castaneum similar to CG126... 64 4e-07
94ref|XM_393671.2| PREDICTED: Apis mellifera similar to ribosomal ... 64 4e-07
95gb|AY190734.1| Pagrus major ribosomal protein L8 mRNA, partial cds 62 1e-06
96gb|AY533227.1| Chinchilla lanigera ribosomal protein L8 mRNA, pa... 62 1e-06
97dbj|AK175100.1| Ciona intestinalis cDNA, clone:cixxx00151, full ... 62 1e-06
98dbj|AK175099.1| Ciona intestinalis cDNA, clone:cixxx00150, full ... 62 1e-06
99dbj|AK174301.1| Ciona intestinalis cDNA, clone:cicl028m21, full ... 62 1e-06
100gb|DQ213525.1| Taeniopygia guttata clone 0058P0034B06 ribosomal ... 60 6e-06
101gb|DQ213524.1| Taeniopygia guttata clone 0058P0020H02 ribosomal ... 60 6e-06
102gb|DQ213523.1| Taeniopygia guttata clone 0058P0011G02 ribosomal ... 60 6e-06
103gb|DQ213521.1| Taeniopygia guttata clone 0058P0051G10 ribosomal ... 60 6e-06
104emb|BX071470.1|CNS09RB6 Single read from an extremity of a full-... 60 6e-06
105emb|BX071012.1|CNS09QYG Single read from an extremity of a full-... 60 6e-06
106emb|BX070207.1|CNS09QC3 Single read from an extremity of a full-... 60 6e-06
107emb|BX061050.1|CNS09J9Q Single read from an extremity of a full-... 60 6e-06
108emb|BX068769.1|CNS09P85 Single read from an extremity of a full-... 60 6e-06
109emb|BX067648.1|CNS09OD0 Single read from an extremity of a full-... 60 6e-06
110emb|BX067520.1|CNS09O9G Single read from an extremity of a full-... 60 6e-06
111emb|BX066574.1|CNS09NJ6 Single read from an extremity of a full-... 60 6e-06
112emb|BX066544.1|CNS09NIC Single read from an extremity of a full-... 60 6e-06
113emb|BX065896.1|CNS09N0C Single read from an extremity of a full-... 60 6e-06
114emb|BX064864.1|CNS09M7O Single read from an extremity of a full-... 60 6e-06
115emb|BX064747.1|CNS09M4F Single read from an extremity of a full-... 60 6e-06
116emb|BX064211.1|CNS09LPJ Single read from an extremity of a full-... 60 6e-06
117emb|BX063827.1|CNS09LEV Single read from an extremity of a full-... 60 6e-06
118emb|BX063245.1|CNS09KYP Single read from an extremity of a full-... 60 6e-06
119emb|BX063171.1|CNS09KWN Single read from an extremity of a full-... 60 6e-06
120emb|BX062318.1|CNS09K8Y Single read from an extremity of a full-... 60 6e-06
121emb|BX062038.1|CNS09K16 Single read from an extremity of a full-... 60 6e-06
122emb|BX061861.1|CNS09JW9 Single read from an extremity of a full-... 60 6e-06
123emb|BX061503.1|CNS09JMB Single read from an extremity of a full-... 60 6e-06
124emb|BX061238.1|CNS09JEY Single read from an extremity of a full-... 60 6e-06
125emb|BX060724.1|CNS09J0O Single read from an extremity of a full-... 60 6e-06
126emb|BX059267.1|CNS09HW7 Single read from an extremity of a full-... 60 6e-06
127emb|BX059235.1|CNS09HVB Single read from an extremity of a full-... 60 6e-06
128emb|BX057044.1|CNS09G6G Single read from an extremity of a full-... 60 6e-06
129emb|BX056961.1|CNS09G45 Single read from an extremity of a full-... 60 6e-06
130emb|BX055189.1|CNS09EQX Single read from an extremity of a full-... 60 6e-06
131emb|BX054843.1|CNS09EHB Single read from an extremity of a full-... 60 6e-06
132emb|BX054769.1|CNS09EF9 Single read from an extremity of a full-... 60 6e-06
133emb|BX054768.1|CNS09EF8 Single read from an extremity of a full-... 60 6e-06
134emb|BX053031.1|CNS09D2Z Single read from an extremity of a full-... 60 6e-06
135emb|BX054430.1|CNS09E5U Single read from an extremity of a full-... 60 6e-06
136emb|BX054417.1|CNS09E5H Single read from an extremity of a full-... 60 6e-06
137emb|BX054379.1|CNS09E4F Single read from an extremity of a full-... 60 6e-06
138emb|BX054108.1|CNS09DWW Single read from an extremity of a full-... 60 6e-06
139emb|BX053844.1|CNS09DPK Single read from an extremity of a full-... 60 6e-06
140emb|BX053555.1|CNS09DHJ Single read from an extremity of a full-... 60 6e-06
141emb|BX052540.1|CNS09CPC Single read from an extremity of a full-... 60 6e-06
142emb|BX052387.1|CNS09CL3 Single read from an extremity of a full-... 60 6e-06
143emb|BX051644.1|CNS09C0G Single read from an extremity of a full-... 60 6e-06
144emb|BX051423.1|CNS09BUB Single read from an extremity of a full-... 60 6e-06
145emb|BX050118.1|CNS09AU2 Single read from an extremity of a full-... 60 6e-06
146emb|BX050810.1|CNS09BDA Single read from an extremity of a full-... 60 6e-06
147emb|BX050569.1|CNS09B6L Single read from an extremity of a full-... 60 6e-06
148emb|BX049265.1|CNS09A6D Single read from an extremity of a full-... 60 6e-06
149emb|BX048973.1|CNS099Y9 Single read from an extremity of a full-... 60 6e-06
150emb|BX046434.1|CNS097ZQ Single read from an extremity of a full-... 60 6e-06
151emb|BX047425.1|CNS098R9 Single read from an extremity of a full-... 60 6e-06
152emb|BX047145.1|CNS098JH Single read from an extremity of a full-... 60 6e-06
153emb|BX045582.1|CNS097C2 Single read from an extremity of a full-... 60 6e-06
154emb|BX045137.1|CNS096ZP Single read from an extremity of a full-... 60 6e-06
155emb|BX043850.1|CNS095ZY Single read from an extremity of a full-... 60 6e-06
156emb|BX043551.1|CNS095RN Single read from an extremity of a full-... 60 6e-06
157emb|BX041268.1|CNS09408 Single read from an extremity of a full-... 60 6e-06
158emb|BX041134.1|CNS093WI Single read from an extremity of a full-... 60 6e-06
159emb|BX041072.1|CNS093US Single read from an extremity of a full-... 60 6e-06
160emb|BX040787.1|CNS093MV Single read from an extremity of a full-... 60 6e-06
161emb|BX040786.1|CNS093MU Single read from an extremity of a full-... 60 6e-06
162emb|BX039654.1|CNS092RE Single read from an extremity of a full-... 60 6e-06
163emb|BX036687.1|CNS090GZ Single read from an extremity of a full-... 60 6e-06
164emb|BX037078.1|CNS090RU Single read from an extremity of a full-... 60 6e-06
165emb|BX035978.1|CNS08ZXA Single read from an extremity of a full-... 60 6e-06
166emb|BX034653.1|CNS08YWH Single read from an extremity of a full-... 60 6e-06
167emb|BX033967.1|CNS08YDF Single read from an extremity of a full-... 60 6e-06
168emb|BX033761.1|CNS08Y7P Single read from an extremity of a full-... 60 6e-06
169emb|BX033234.1|CNS08XT2 Single read from an extremity of a full-... 60 6e-06
170emb|BX033107.1|CNS08XPJ Single read from an extremity of a full-... 60 6e-06
171emb|BX032954.1|CNS08XLA Single read from an extremity of a full-... 60 6e-06
172emb|BX032912.1|CNS08XK4 Single read from an extremity of a full-... 60 6e-06
173emb|BX032378.1|CNS08X5A Single read from an extremity of a full-... 60 6e-06
174emb|BX031877.1|CNS08WRD Single read from an extremity of a full-... 60 6e-06
175emb|BX031828.1|CNS08WQ0 Single read from an extremity of a full-... 60 6e-06
176emb|BX031537.1|CNS08WHX Single read from an extremity of a full-... 60 6e-06
177emb|BX030749.1|CNS08VW1 Single read from an extremity of a full-... 60 6e-06
178emb|BX031289.1|CNS08WB1 Single read from an extremity of a full-... 60 6e-06
179emb|BX030002.1|CNS08VBA Single read from an extremity of a full-... 60 6e-06
180emb|BX029262.1|CNS08UQQ Single read from an extremity of a full-... 60 6e-06
181emb|BX029602.1|CNS08V06 Single read from an extremity of a full-... 60 6e-06
182emb|BX028637.1|CNS08U9D Single read from an extremity of a full-... 60 6e-06
183emb|BX022357.1|CNS08PEX Single read from an extremity of a full-... 60 6e-06
184emb|BX026844.1|CNS08SVK Single read from an extremity of a full-... 60 6e-06
185emb|BX026789.1|CNS08SU1 Single read from an extremity of a full-... 60 6e-06
186emb|BX025698.1|CNS08RZQ Single read from an extremity of a full-... 60 6e-06
187emb|BX025349.1|CNS08RQ1 Single read from an extremity of a full-... 60 6e-06
188emb|BX025079.1|CNS08RIJ Single read from an extremity of a full-... 60 6e-06
189emb|BX025073.1|CNS08RID Single read from an extremity of a full-... 60 6e-06
190emb|BX025038.1|CNS08RHE Single read from an extremity of a full-... 60 6e-06
191emb|BX025033.1|CNS08RH9 Single read from an extremity of a full-... 60 6e-06
192emb|BX024670.1|CNS08R76 Single read from an extremity of a full-... 60 6e-06
193emb|BX024145.1|CNS08QSL Single read from an extremity of a full-... 60 6e-06
194emb|BX023815.1|CNS08QJF Single read from an extremity of a full-... 60 6e-06
195emb|BX022223.1|CNS08PB7 Single read from an extremity of a full-... 60 6e-06
196emb|BX021031.1|CNS08OE3 Single read from an extremity of a full-... 60 6e-06
197emb|BX020305.1|CNS08NTX Single read from an extremity of a full-... 60 6e-06
198emb|BX018974.1|CNS08MSY Single read from an extremity of a full-... 60 6e-06
199emb|BX018003.1|CNS08M1Z Single read from an extremity of a full-... 60 6e-06
200emb|BX017981.1|CNS08M1D Single read from an extremity of a full-... 60 6e-06
201emb|BX018524.1|CNS08MGG Single read from an extremity of a full-... 60 6e-06
202emb|BX018377.1|CNS08MCD Single read from an extremity of a full-... 60 6e-06
203emb|BX017737.1|CNS08LUL Single read from an extremity of a full-... 60 6e-06
204emb|BX017331.1|CNS08LJB Single read from an extremity of a full-... 60 6e-06
205emb|BX016524.1|CNS08KWW Single read from an extremity of a full-... 60 6e-06
206emb|BX016411.1|CNS08KTR Single read from an extremity of a full-... 60 6e-06
207emb|BX015958.1|CNS08KH6 Single read from an extremity of a full-... 60 6e-06
208emb|BX014218.1|CNS08J4U Single read from an extremity of a full-... 60 6e-06
209emb|BX013506.1|CNS08IL2 Single read from an extremity of a full-... 60 6e-06
210emb|BX013505.1|CNS08IL1 Single read from an extremity of a full-... 60 6e-06
211emb|BX013494.1|CNS08IKQ Single read from an extremity of a full-... 60 6e-06
212emb|BX012299.1|CNS08HNJ Single read from an extremity of a full-... 60 6e-06
213emb|BX010378.1|CNS08G66 Single read from an extremity of a full-... 60 6e-06
214emb|BX010208.1|CNS08G1G Single read from an extremity of a full-... 60 6e-06
215emb|BX009864.1|CNS08FRW Single read from an extremity of a full-... 60 6e-06
216emb|BX009834.1|CNS08FR2 Single read from an extremity of a full-... 60 6e-06
217emb|BX008448.1|CNS08EOK Single read from an extremity of a full-... 60 6e-06
218emb|BX008129.1|CNS08EFP Single read from an extremity of a full-... 60 6e-06
219emb|BX008128.1|CNS08EFO Single read from an extremity of a full-... 60 6e-06
220emb|BX007575.1|CNS08E0B Single read from an extremity of a full-... 60 6e-06
221emb|BX007182.1|CNS08DPE Single read from an extremity of a full-... 60 6e-06
222emb|BX006812.1|CNS08DF4 Single read from an extremity of a full-... 60 6e-06
223emb|BX006811.1|CNS08DF3 Single read from an extremity of a full-... 60 6e-06
224emb|BX005817.1|CNS08CNH Single read from an extremity of a full-... 60 6e-06
225emb|BX005504.1|CNS08CES Single read from an extremity of a full-... 60 6e-06
226gb|AY957563.1| Oncorhynchus mykiss ribosomal protein L8 mRNA, pa... 60 6e-06
227gb|AY168762.1| Branchiostoma belcheri tsingtaunese ribosomal pro... 60 6e-06
228ref|XM_315817.2| Anopheles gambiae str. PEST ENSANGP00000010416 ... 60 6e-06
229emb|CT032253.1| Platynereis dumerilii EST IB0AAA42BC10FM1 60 6e-06
230gb|BC059473.1| Danio rerio ribosomal protein L8, mRNA (cDNA clon... 58 2e-05
231ref|NM_200713.1| Danio rerio ribosomal protein L8 (rpl8), mRNA 58 2e-05
232emb|BX067521.1|CNS09O9H Single read from an extremity of a full-... 58 2e-05
233emb|BX050252.1|CNS09AXS Single read from an extremity of a full-... 58 2e-05
234emb|BX046386.1|CNS097YE Single read from an extremity of a full-... 58 2e-05
235gb|BC065432.1| Danio rerio ribosomal protein L8, mRNA (cDNA clon... 58 2e-05
236gb|DQ213522.1| Taeniopygia guttata clone 0061P0021C08 ribosomal ... 56 9e-05
237gb|AY857413.1| Suberites domuncula L2/L8 mRNA, partial cds 56 9e-05
238ref|NM_075539.2| Caenorhabditis elegans Ribosomal Protein, Large... 56 9e-05
239ref|NM_001026174.2| Caenorhabditis elegans B0250.3 (B0250.3) mRN... 56 9e-05
240dbj|AK060350.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 9e-05
241ref|NM_114978.1| Arabidopsis thaliana structural constituent of ... 54 4e-04
242ref|XM_453766.1| Kluyveromyces lactis NRRL Y-1140, KLLA0D16027g ... 54 4e-04
243emb|CR382124.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso... 54 4e-04
244emb|AL132980.3|ATF24M12 Arabidopsis thaliana DNA chromosome 3, B... 54 4e-04
245gb|DQ056619.1| Arabidopsis thaliana 60S ribosomal protein L8 (At... 54 4e-04
246gb|DQ206502.1| Priapulus caudatus isolate TOA23 ribosomal protei... 54 4e-04
247gb|BC043017.1| Mus musculus ribosomal protein L8, mRNA (cDNA clo... 52 0.001
248ref|NM_012053.1| Mus musculus ribosomal protein L8 (Rpl8), mRNA 52 0.001
249emb|BX060935.1|CNS09J6J Single read from an extremity of a full-... 52 0.001
250emb|BX063741.1|CNS09LCH Single read from an extremity of a full-... 52 0.001
251emb|BX057209.1|CNS09GB1 Single read from an extremity of a full-... 52 0.001
252emb|BX055232.1|CNS09ES4 Single read from an extremity of a full-... 52 0.001
253emb|BX052582.1|CNS09CQI Single read from an extremity of a full-... 52 0.001
254emb|BX052386.1|CNS09CL2 Single read from an extremity of a full-... 52 0.001
255emb|BX050253.1|CNS09AXT Single read from an extremity of a full-... 52 0.001
256emb|BX044908.1|CNS096TC Single read from an extremity of a full-... 52 0.001
257emb|BX043909.1|CNS0961L Single read from an extremity of a full-... 52 0.001
258emb|BX036920.1|CNS090NG Single read from an extremity of a full-... 52 0.001
259emb|BX036225.1|CNS09045 Single read from an extremity of a full-... 52 0.001
260emb|BX034140.1|CNS08YI8 Single read from an extremity of a full-... 52 0.001
261emb|BX025869.1|CNS08S4H Single read from an extremity of a full-... 52 0.001
262emb|BX022874.1|CNS08PTA Single read from an extremity of a full-... 52 0.001
263emb|BX021963.1|CNS08P3Z Single read from an extremity of a full-... 52 0.001
264emb|BX018523.1|CNS08MGF Single read from an extremity of a full-... 52 0.001
265emb|BX012237.1|CNS08HLT Single read from an extremity of a full-... 52 0.001
266emb|BX008695.1|CNS08EVF Single read from an extremity of a full-... 52 0.001
267emb|BX008408.1|CNS08ENG Single read from an extremity of a full-... 52 0.001
268emb|BX007216.1|CNS08DQC Single read from an extremity of a full-... 52 0.001
269emb|Z67999.1|SPAC21E11 S.pombe chromosome I cosmid c21E11 52 0.001
270emb|X51659.1|SPRIBK5 S.pombe DNA for ribosomal protein gene K5 52 0.001
271dbj|AK131970.1| Mus musculus 13 days embryo liver cDNA, RIKEN fu... 52 0.001
272dbj|AK145498.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 52 0.001
273dbj|AK146330.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-... 52 0.001
274dbj|AK152063.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 52 0.001
275dbj|AK151408.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 52 0.001
276dbj|AK167775.1| Mus musculus cDNA, RIKEN full-length enriched li... 52 0.001
277dbj|AK168769.1| Mus musculus 13 days embryo liver cDNA, RIKEN fu... 52 0.001
278dbj|AK168332.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length... 52 0.001
279ref|NM_001019928.1| Schizosaccharomyces pombe 972h- hypothetical... 52 0.001
280dbj|AK088263.1| Mus musculus 2 days neonate thymus thymic cells ... 52 0.001
281gb|AY130440.1| Danio rerio ribosomal protein L8-like mRNA, parti... 52 0.001
282gb|AY130436.1| Branchiostoma lanceolatum ribosomal protein L8 mR... 52 0.001
283gb|AF429973.1| Spodoptera frugiperda ribosomal protein L8 mRNA, ... 52 0.001
284gb|U87870.1|SPU87870 Schizosaccharomyces pombe transcription fac... 52 0.001
285gb|U67771.1|MMU67771 Mus musculus ribosomal protein L8 (RPL8) mR... 52 0.001
286gb|AY184410.1| Brassica juncea ribosomal protein L2 (RP1) mRNA, ... 52 0.001
287emb|AM049008.1| Biphyllus lunatus mRNA for ribosomal protein L8e... 50 0.006
288emb|AL031229.2|HS15D7 Human DNA sequence from clone RP1-15D7 on ... 50 0.006
289emb|BX072099.1|CNS09RSN Single read from an extremity of a full-... 50 0.006
290emb|BX071992.1|CNS09RPO Single read from an extremity of a full-... 50 0.006
291emb|BX071991.1|CNS09RPN Single read from an extremity of a full-... 50 0.006
292emb|BX071469.1|CNS09RB5 Single read from an extremity of a full-... 50 0.006
293emb|BX071375.1|CNS09R8J Single read from an extremity of a full-... 50 0.006
294emb|BX071011.1|CNS09QYF Single read from an extremity of a full-... 50 0.006
295emb|BX070723.1|CNS09QQF Single read from an extremity of a full-... 50 0.006
296emb|BX070722.1|CNS09QQE Single read from an extremity of a full-... 50 0.006
297emb|BX070206.1|CNS09QC2 Single read from an extremity of a full-... 50 0.006
298emb|BX069680.1|CNS09PXG Single read from an extremity of a full-... 50 0.006
299emb|BX061049.1|CNS09J9P Single read from an extremity of a full-... 50 0.006
300emb|BX060936.1|CNS09J6K Single read from an extremity of a full-... 50 0.006
301emb|BX069391.1|CNS09PPF Single read from an extremity of a full-... 50 0.006
302emb|BX069233.1|CNS09PL1 Single read from an extremity of a full-... 50 0.006
303emb|BX068985.1|CNS09PE5 Single read from an extremity of a full-... 50 0.006
304emb|BX068984.1|CNS09PE4 Single read from an extremity of a full-... 50 0.006
305emb|BX068768.1|CNS09P84 Single read from an extremity of a full-... 50 0.006
306emb|BX067647.1|CNS09OCZ Single read from an extremity of a full-... 50 0.006
307emb|BX067528.1|CNS09O9O Single read from an extremity of a full-... 50 0.006
308emb|BX067519.1|CNS09O9F Single read from an extremity of a full-... 50 0.006
309emb|BX067280.1|CNS09O2S Single read from an extremity of a full-... 50 0.006
310emb|BX067279.1|CNS09O2R Single read from an extremity of a full-... 50 0.006
311emb|BX066817.1|CNS09NPX Single read from an extremity of a full-... 50 0.006
312emb|BX066816.1|CNS09NPW Single read from an extremity of a full-... 50 0.006
313emb|BX066573.1|CNS09NJ5 Single read from an extremity of a full-... 50 0.006
314emb|BX066543.1|CNS09NIB Single read from an extremity of a full-... 50 0.006
315emb|BX066504.1|CNS09NH8 Single read from an extremity of a full-... 50 0.006
316emb|BX066503.1|CNS09NH7 Single read from an extremity of a full-... 50 0.006
317emb|BX066033.1|CNS09N45 Single read from an extremity of a full-... 50 0.006
318emb|BX066032.1|CNS09N44 Single read from an extremity of a full-... 50 0.006
319emb|BX065895.1|CNS09N0B Single read from an extremity of a full-... 50 0.006
320emb|BX065536.1|CNS09MQC Single read from an extremity of a full-... 50 0.006
321emb|BX065162.1|CNS09MFY Single read from an extremity of a full-... 50 0.006
322emb|BX065161.1|CNS09MFX Single read from an extremity of a full-... 50 0.006
323emb|BX065009.1|CNS09MBP Single read from an extremity of a full-... 50 0.006
324emb|BX064926.1|CNS09M9E Single read from an extremity of a full-... 50 0.006
325emb|BX064863.1|CNS09M7N Single read from an extremity of a full-... 50 0.006
326emb|BX064746.1|CNS09M4E Single read from an extremity of a full-... 50 0.006
327emb|BX064324.1|CNS09LSO Single read from an extremity of a full-... 50 0.006
328emb|BX064323.1|CNS09LSN Single read from an extremity of a full-... 50 0.006
329emb|BX064210.1|CNS09LPI Single read from an extremity of a full-... 50 0.006
330emb|BX063826.1|CNS09LEU Single read from an extremity of a full-... 50 0.006
331emb|BX063740.1|CNS09LCG Single read from an extremity of a full-... 50 0.006
332emb|BX063296.1|CNS09L04 Single read from an extremity of a full-... 50 0.006
333emb|BX063295.1|CNS09L03 Single read from an extremity of a full-... 50 0.006
334emb|BX063244.1|CNS09KYO Single read from an extremity of a full-... 50 0.006
335emb|BX063170.1|CNS09KWM Single read from an extremity of a full-... 50 0.006
336emb|BX062637.1|CNS09KHT Single read from an extremity of a full-... 50 0.006
337emb|BX062521.1|CNS09KEL Single read from an extremity of a full-... 50 0.006
338emb|BX062520.1|CNS09KEK Single read from an extremity of a full-... 50 0.006
339emb|BX062317.1|CNS09K8X Single read from an extremity of a full-... 50 0.006
340emb|BX062058.1|CNS09K1Q Single read from an extremity of a full-... 50 0.006
341emb|BX062037.1|CNS09K15 Single read from an extremity of a full-... 50 0.006
342emb|BX061860.1|CNS09JW8 Single read from an extremity of a full-... 50 0.006
343emb|BX061502.1|CNS09JMA Single read from an extremity of a full-... 50 0.006
344emb|BX061237.1|CNS09JEX Single read from an extremity of a full-... 50 0.006
345emb|BX061206.1|CNS09JE2 Single read from an extremity of a full-... 50 0.006
346emb|BX061125.1|CNS09JBT Single read from an extremity of a full-... 50 0.006
347emb|BX060723.1|CNS09J0N Single read from an extremity of a full-... 50 0.006
348emb|BX059882.1|CNS09IDA Single read from an extremity of a full-... 50 0.006
349emb|BX059853.1|CNS09ICH Single read from an extremity of a full-... 50 0.006
350emb|BX059852.1|CNS09ICG Single read from an extremity of a full-... 50 0.006
351emb|BX059824.1|CNS09IBO Single read from an extremity of a full-... 50 0.006
352emb|BX059823.1|CNS09IBN Single read from an extremity of a full-... 50 0.006
353emb|BX059792.1|CNS09IAS Single read from an extremity of a full-... 50 0.006
354emb|BX059791.1|CNS09IAR Single read from an extremity of a full-... 50 0.006
355emb|BX059611.1|CNS09I5R Single read from an extremity of a full-... 50 0.006
356emb|BX059266.1|CNS09HW6 Single read from an extremity of a full-... 50 0.006
357emb|BX059234.1|CNS09HVA Single read from an extremity of a full-... 50 0.006
358emb|BX059042.1|CNS09HPY Single read from an extremity of a full-... 50 0.006
359emb|BX058790.1|CNS09HIY Single read from an extremity of a full-... 50 0.006
360emb|BX058789.1|CNS09HIX Single read from an extremity of a full-... 50 0.006
361emb|BX058354.1|CNS09H6U Single read from an extremity of a full-... 50 0.006
362emb|BX056725.1|CNS09FXL Single read from an extremity of a full-... 50 0.006
363emb|BX057698.1|CNS09GOM Single read from an extremity of a full-... 50 0.006
364emb|BX057195.1|CNS09GAN Single read from an extremity of a full-... 50 0.006
365emb|BX057157.1|CNS09G9L Single read from an extremity of a full-... 50 0.006
366emb|BX057092.1|CNS09G7S Single read from an extremity of a full-... 50 0.006
367emb|BX057043.1|CNS09G6F Single read from an extremity of a full-... 50 0.006
368emb|BX056960.1|CNS09G44 Single read from an extremity of a full-... 50 0.006
369emb|BX056408.1|CNS09FOS Single read from an extremity of a full-... 50 0.006
370emb|BX056091.1|CNS09FFZ Single read from an extremity of a full-... 50 0.006
371emb|BX055357.1|CNS09EVL Single read from an extremity of a full-... 50 0.006
372emb|BX055194.1|CNS09ER2 Single read from an extremity of a full-... 50 0.006
373emb|BX055188.1|CNS09EQW Single read from an extremity of a full-... 50 0.006
374emb|BX053306.1|CNS09DAM Single read from an extremity of a full-... 50 0.006
375emb|BX054842.1|CNS09EHA Single read from an extremity of a full-... 50 0.006
376emb|BX054817.1|CNS09EGL Single read from an extremity of a full-... 50 0.006
377emb|BX054816.1|CNS09EGK Single read from an extremity of a full-... 50 0.006
378emb|BX053072.1|CNS09D44 Single read from an extremity of a full-... 50 0.006
379emb|BX053030.1|CNS09D2Y Single read from an extremity of a full-... 50 0.006
380emb|BX054429.1|CNS09E5T Single read from an extremity of a full-... 50 0.006
381emb|BX054378.1|CNS09E4E Single read from an extremity of a full-... 50 0.006
382emb|BX054107.1|CNS09DWV Single read from an extremity of a full-... 50 0.006
383emb|BX053843.1|CNS09DPJ Single read from an extremity of a full-... 50 0.006
384emb|BX053757.1|CNS09DN5 Single read from an extremity of a full-... 50 0.006
385emb|BX053554.1|CNS09DHI Single read from an extremity of a full-... 50 0.006
386emb|BX052869.1|CNS09CYH Single read from an extremity of a full-... 50 0.006
387emb|BX052868.1|CNS09CYG Single read from an extremity of a full-... 50 0.006
388emb|BX052583.1|CNS09CQJ Single read from an extremity of a full-... 50 0.006
389emb|BX052554.1|CNS09CPQ Single read from an extremity of a full-... 50 0.006
390emb|BX052553.1|CNS09CPP Single read from an extremity of a full-... 50 0.006
391emb|BX052272.1|CNS09CHW Single read from an extremity of a full-... 50 0.006
392emb|BX052271.1|CNS09CHV Single read from an extremity of a full-... 50 0.006
393emb|BX052221.1|CNS09CGH Single read from an extremity of a full-... 50 0.006
394emb|BX051687.1|CNS09C1N Single read from an extremity of a full-... 50 0.006
395emb|BX051643.1|CNS09C0F Single read from an extremity of a full-... 50 0.006
396emb|BX051422.1|CNS09BUA Single read from an extremity of a full-... 50 0.006
397emb|BX051408.1|CNS09BTW Single read from an extremity of a full-... 50 0.006
398emb|BX051385.1|CNS09BT9 Single read from an extremity of a full-... 50 0.006
399emb|BX051372.1|CNS09BSW Single read from an extremity of a full-... 50 0.006
400emb|BX051371.1|CNS09BSV Single read from an extremity of a full-... 50 0.006
401emb|BX050117.1|CNS09AU1 Single read from an extremity of a full-... 50 0.006
402emb|BX050088.1|CNS09AT8 Single read from an extremity of a full-... 50 0.006
403emb|BX051089.1|CNS09BL1 Single read from an extremity of a full-... 50 0.006
404emb|BX050852.1|CNS09BEG Single read from an extremity of a full-... 50 0.006
405emb|BX050809.1|CNS09BD9 Single read from an extremity of a full-... 50 0.006
406emb|BX050761.1|CNS09BBX Single read from an extremity of a full-... 50 0.006
407emb|BX050568.1|CNS09B6K Single read from an extremity of a full-... 50 0.006
408emb|BX031017.1|CNS08W3H Single read from an extremity of a full-... 50 0.006
409emb|BX049264.1|CNS09A6C Single read from an extremity of a full-... 50 0.006
410emb|BX049005.1|CNS099Z5 Single read from an extremity of a full-... 50 0.006
411emb|BX048972.1|CNS099Y8 Single read from an extremity of a full-... 50 0.006
412emb|BX046433.1|CNS097ZP Single read from an extremity of a full-... 50 0.006
413emb|BX046385.1|CNS097YD Single read from an extremity of a full-... 50 0.006
414emb|BX048280.1|CNS099F0 Single read from an extremity of a full-... 50 0.006
415emb|BX048091.1|CNS0999R Single read from an extremity of a full-... 50 0.006
416emb|BX047771.1|CNS0990V Single read from an extremity of a full-... 50 0.006
417emb|BX047770.1|CNS0990U Single read from an extremity of a full-... 50 0.006
418emb|BX047427.1|CNS098RB Single read from an extremity of a full-... 50 0.006
419emb|BX047424.1|CNS098R8 Single read from an extremity of a full-... 50 0.006
420emb|BX047421.1|CNS098R5 Single read from an extremity of a full-... 50 0.006
421emb|BX047420.1|CNS098R4 Single read from an extremity of a full-... 50 0.006
422emb|BX047144.1|CNS098JG Single read from an extremity of a full-... 50 0.006
423emb|BX045784.1|CNS097HO Single read from an extremity of a full-... 50 0.006
424emb|BX045783.1|CNS097HN Single read from an extremity of a full-... 50 0.006
425emb|BX045716.1|CNS097FS Single read from an extremity of a full-... 50 0.006
426emb|BX045715.1|CNS097FR Single read from an extremity of a full-... 50 0.006
427emb|BX045689.1|CNS097F1 Single read from an extremity of a full-... 50 0.006
428emb|BX045581.1|CNS097C1 Single read from an extremity of a full-... 50 0.006
429emb|BX045136.1|CNS096ZO Single read from an extremity of a full-... 50 0.006
430emb|BX044981.1|CNS096VD Single read from an extremity of a full-... 50 0.006
431emb|BX044980.1|CNS096VC Single read from an extremity of a full-... 50 0.006
432emb|BX044907.1|CNS096TB Single read from an extremity of a full-... 50 0.006
433emb|BX044546.1|CNS096JA Single read from an extremity of a full-... 50 0.006
434emb|BX044545.1|CNS096J9 Single read from an extremity of a full-... 50 0.006
435emb|BX043973.1|CNS0963D Single read from an extremity of a full-... 50 0.006
436emb|BX043908.1|CNS0961K Single read from an extremity of a full-... 50 0.006
437emb|BX043849.1|CNS095ZX Single read from an extremity of a full-... 50 0.006
438emb|BX043616.1|CNS095TG Single read from an extremity of a full-... 50 0.006
439emb|BX043550.1|CNS095RM Single read from an extremity of a full-... 50 0.006
440emb|BX042540.1|CNS094ZK Single read from an extremity of a full-... 50 0.006
441emb|BX042527.1|CNS094Z7 Single read from an extremity of a full-... 50 0.006
442emb|BX042526.1|CNS094Z6 Single read from an extremity of a full-... 50 0.006
443emb|BX042393.1|CNS094VH Single read from an extremity of a full-... 50 0.006
444emb|BX042392.1|CNS094VG Single read from an extremity of a full-... 50 0.006
445emb|BX042234.1|CNS094R2 Single read from an extremity of a full-... 50 0.006
446emb|BX042233.1|CNS094R1 Single read from an extremity of a full-... 50 0.006
447emb|BX041744.1|CNS094DG Single read from an extremity of a full-... 50 0.006
448emb|BX041743.1|CNS094DF Single read from an extremity of a full-... 50 0.006
449emb|BX042002.1|CNS094KM Single read from an extremity of a full-... 50 0.006
450emb|BX042001.1|CNS094KL Single read from an extremity of a full-... 50 0.006
451emb|BX041959.1|CNS094JF Single read from an extremity of a full-... 50 0.006
452emb|BX041357.1|CNS0942P Single read from an extremity of a full-... 50 0.006
453emb|BX041267.1|CNS09407 Single read from an extremity of a full-... 50 0.006
454emb|BX041133.1|CNS093WH Single read from an extremity of a full-... 50 0.006
455emb|BX041098.1|CNS093VI Single read from an extremity of a full-... 50 0.006
456emb|BX041071.1|CNS093UR Single read from an extremity of a full-... 50 0.006
457emb|BX040846.1|CNS093OI Single read from an extremity of a full-... 50 0.006
458emb|BX040845.1|CNS093OH Single read from an extremity of a full-... 50 0.006
459emb|BX040801.1|CNS093N9 Single read from an extremity of a full-... 50 0.006
460emb|BX039653.1|CNS092RD Single read from an extremity of a full-... 50 0.006
461emb|BX039398.1|CNS092KA Single read from an extremity of a full-... 50 0.006
462emb|BX039397.1|CNS092K9 Single read from an extremity of a full-... 50 0.006
463emb|BX039232.1|CNS092FO Single read from an extremity of a full-... 50 0.006
464emb|BX037342.1|CNS090Z6 Single read from an extremity of a full-... 50 0.006
465emb|BX037341.1|CNS090Z5 Single read from an extremity of a full-... 50 0.006
466emb|BX036731.1|CNS090I7 Single read from an extremity of a full-... 50 0.006
467emb|BX036730.1|CNS090I6 Single read from an extremity of a full-... 50 0.006
468emb|BX036686.1|CNS090GY Single read from an extremity of a full-... 50 0.006
469emb|BX036655.1|CNS090G3 Single read from an extremity of a full-... 50 0.006
470emb|BX036654.1|CNS090G2 Single read from an extremity of a full-... 50 0.006
471emb|BX036919.1|CNS090NF Single read from an extremity of a full-... 50 0.006
472emb|BX036377.1|CNS0908D Single read from an extremity of a full-... 50 0.006
473emb|BX036193.1|CNS09039 Single read from an extremity of a full-... 50 0.006
474emb|BX035977.1|CNS08ZX9 Single read from an extremity of a full-... 50 0.006
475emb|BX035586.1|CNS08ZME Single read from an extremity of a full-... 50 0.006
476emb|BX035585.1|CNS08ZMD Single read from an extremity of a full-... 50 0.006
477emb|BX035382.1|CNS08ZGQ Single read from an extremity of a full-... 50 0.006
478emb|BX034652.1|CNS08YWG Single read from an extremity of a full-... 50 0.006
479emb|BX034453.1|CNS08YQX Single read from an extremity of a full-... 50 0.006
480emb|BX034452.1|CNS08YQW Single read from an extremity of a full-... 50 0.006
481emb|BX034377.1|CNS08YOT Single read from an extremity of a full-... 50 0.006
482emb|BX034376.1|CNS08YOS Single read from an extremity of a full-... 50 0.006
483emb|BX034141.1|CNS08YI9 Single read from an extremity of a full-... 50 0.006
484emb|BX033760.1|CNS08Y7O Single read from an extremity of a full-... 50 0.006
485emb|BX033507.1|CNS08Y0N Single read from an extremity of a full-... 50 0.006
486emb|BX033506.1|CNS08Y0M Single read from an extremity of a full-... 50 0.006
487emb|BX033244.1|CNS08XTC Single read from an extremity of a full-... 50 0.006
488emb|BX033243.1|CNS08XTB Single read from an extremity of a full-... 50 0.006
489emb|BX033233.1|CNS08XT1 Single read from an extremity of a full-... 50 0.006
490emb|BX033148.1|CNS08XQO Single read from an extremity of a full-... 50 0.006
491emb|BX033106.1|CNS08XPI Single read from an extremity of a full-... 50 0.006
492emb|BX032911.1|CNS08XK3 Single read from an extremity of a full-... 50 0.006
493emb|BX032727.1|CNS08XEZ Single read from an extremity of a full-... 50 0.006
494emb|BX032620.1|CNS08XC0 Single read from an extremity of a full-... 50 0.006
495emb|BX032619.1|CNS08XBZ Single read from an extremity of a full-... 50 0.006
496emb|BX032444.1|CNS08X74 Single read from an extremity of a full-... 50 0.006
497emb|BX032377.1|CNS08X59 Single read from an extremity of a full-... 50 0.006
498emb|BX031935.1|CNS08WSZ Single read from an extremity of a full-... 50 0.006
499emb|BX031924.1|CNS08WSO Single read from an extremity of a full-... 50 0.006
500emb|BX031876.1|CNS08WRC Single read from an extremity of a full-... 50 0.006

>dbj|AK104806.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-E03, full
           insert sequence
          Length = 1037

 Score =  488 bits (246), Expect = e-135
 Identities = 354/389 (91%), Gaps = 1/389 (0%)
 Strand = Plus / Plus

                                                                       
Query: 21  atgtacaccggccagttcgtctactgcggnacgccgcgccacgctctccgtaggcaacgt 80
           |||||||| || |||||||||||||||||  |||||||||||||||||| | ||||||||
Sbjct: 309 atgtacacggggcagttcgtctactgcggc-cgccgcgccacgctctccatcggcaacgt 367

                                                                       
Query: 81  cctccccctccggtccgtgcctgagggaggcgtcatctgcaacgtcgagcaccacgtcgg 140
            |||||  ||||||| || || ||||| | |||  |||||||||||||||||||||||||
Sbjct: 368 gctcccgatccggtcggtacccgagggcgccgtggtctgcaacgtcgagcaccacgtcgg 427

                                                                       
Query: 141 cgaccgtggtgtcttcgccagggcctccggtgactacgccatcgtcatcagccacaaccc 200
           |||||| || |||||||||||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 428 cgaccgcggcgtcttcgccagggcgtccggcgactacgccatcgtcatcagccacaaccc 487

                                                                       
Query: 201 cgacaacggcacctcaaggatcaagctaccctctggtgctaagaagatcgtcccaagcag 260
           ||| |||||||| || ||||||||||| ||||||||||| |||||||| ||||| |||||
Sbjct: 488 cgataacggcacatccaggatcaagctcccctctggtgccaagaagattgtccccagcag 547

                                                                       
Query: 261 ctgccgtgctatgattggtcaggttgctggtggtggcaggactgagaagccaatgctgaa 320
           ||||||||| ||||| ||||||||||||||||||||||||||||||||||| ||||| ||
Sbjct: 548 ctgccgtgccatgatcggtcaggttgctggtggtggcaggactgagaagccgatgctcaa 607

                                                                       
Query: 321 ggctggtaacgcctaccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtgg 380
           |||||| |||||||||||||||||||| ||||||||||||| ||||||||||||||||||
Sbjct: 608 ggctggaaacgcctaccacaagtaccgcgtgaagaggaactgctggcctaaggtgcgtgg 667

                                        
Query: 381 tgtggccatgaaccctgttgagcatcccc 409
           ||||||||||||||| |||||||||||||
Sbjct: 668 tgtggccatgaaccccgttgagcatcccc 696



to top

>dbj|AK070647.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023063F19, full
           insert sequence
          Length = 1072

 Score =  480 bits (242), Expect = e-132
 Identities = 353/389 (90%), Gaps = 1/389 (0%)
 Strand = Plus / Plus

                                                                       
Query: 21  atgtacaccggccagttcgtctactgcggnacgccgcgccacgctctccgtaggcaacgt 80
           |||||||| || |||||||||||||||||  |||||||||||||||||| | ||||||||
Sbjct: 310 atgtacacggggcagttcgtctactgcggc-cgccgcgccacgctctccatcggcaacgt 368

                                                                       
Query: 81  cctccccctccggtccgtgcctgagggaggcgtcatctgcaacgtcgagcaccacgtcgg 140
            |||||  ||||||| || || ||||| | |||  |||||||||||||||||||||||||
Sbjct: 369 gctcccgatccggtcggtacccgagggcgccgtggtctgcaacgtcgagcaccacgtcgg 428

                                                                       
Query: 141 cgaccgtggtgtcttcgccagggcctccggtgactacgccatcgtcatcagccacaaccc 200
           |||||| || |||||||||||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 429 cgaccgcggcgtcttcgccagggcgtccggcgactacgccatcgtcatcagccacaaccc 488

                                                                       
Query: 201 cgacaacggcacctcaaggatcaagctaccctctggtgctaagaagatcgtcccaagcag 260
           ||| |||||||| || ||||||||||| ||||||||||| |||||||| ||||| |||||
Sbjct: 489 cgataacggcacatccaggatcaagctcccctctggtgccaagaagattgtccccagcag 548

                                                                       
Query: 261 ctgccgtgctatgattggtcaggttgctggtggtggcaggactgagaagccaatgctgaa 320
           ||||||||| ||||| ||||||||||||||||||||||||||||||||||| ||||| ||
Sbjct: 549 ctgccgtgccatgatcggtcaggttgctggtggtggcaggactgagaagccgatgctcaa 608

                                                                       
Query: 321 ggctggtaacgcctaccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtgg 380
           |||||| |||||||||||||||||||| ||||||||||||| |||||||| |||||||||
Sbjct: 609 ggctggaaacgcctaccacaagtaccgcgtgaagaggaactgctggcctagggtgcgtgg 668

                                        
Query: 381 tgtggccatgaaccctgttgagcatcccc 409
           ||||||||||||||| |||||||||||||
Sbjct: 669 tgtggccatgaaccccgttgagcatcccc 697



to top

>gb|AY105581.1| Zea mays PCO150618 mRNA sequence
          Length = 1102

 Score =  462 bits (233), Expect = e-127
 Identities = 364/407 (89%), Gaps = 1/407 (0%)
 Strand = Plus / Plus

                                                                       
Query: 3   tttgtcgccgccgngggtatgtacaccggccagttcgtctactgcggnacgccgcgccac 62
           ||||||||||||| ||| |||||||| ||||||||||||||||||||  |||||||||||
Sbjct: 297 tttgtcgccgccgagggcatgtacacgggccagttcgtctactgcggt-cgccgcgccac 355

                                                                       
Query: 63  gctctccgtaggcaacgtcctccccctccggtccgtgcctgagggaggcgtcatctgcaa 122
            |||||| | |||||||| || ||||||||     | |||||||| | |||| |||||||
Sbjct: 356 cctctccatcggcaacgtgctgcccctccgcgggatccctgagggtgccgtcgtctgcaa 415

                                                                       
Query: 123 cgtcgagcaccacgtcggcgaccgtggtgtcttcgccagggcctccggtgactacgccat 182
           |||||||||||||||||| ||||| |||||||||||||||||||| || |||||||||||
Sbjct: 416 cgtcgagcaccacgtcggtgaccgcggtgtcttcgccagggcctctggggactacgccat 475

                                                                       
Query: 183 cgtcatcagccacaaccccgacaacggcacctcaaggatcaagctaccctctggtgctaa 242
            || |||||||||||||| ||||||||||| || ||||| ||||| |||||||| || ||
Sbjct: 476 tgtgatcagccacaaccctgacaacggcacatcgaggattaagctgccctctggcgccaa 535

                                                                       
Query: 243 gaagatcgtcccaagcagctgccgtgctatgattggtcaggttgctggtggtggcaggac 302
           |||||| ||||| ||||||||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 536 gaagattgtccccagcagctgccgtgctatgattgggcaggttgctggtggaggcaggac 595

                                                                       
Query: 303 tgagaagccaatgctgaaggctggtaacgcctaccacaagtaccgtgtgaagaggaactc 362
           ||||||||| ||||| |||||||||||||| |||||||||||||||||||||||||||  
Sbjct: 596 tgagaagccgatgctcaaggctggtaacgcgtaccacaagtaccgtgtgaagaggaacag 655

                                                          
Query: 363 ctggcctaaggtgcgtggtgtggccatgaaccctgttgagcatcccc 409
           |||||| ||||||||||||||||||||||||||||| ||||||||||
Sbjct: 656 ctggcccaaggtgcgtggtgtggccatgaaccctgtggagcatcccc 702



to top

>gb|AY109618.1| Zea mays CL8996_1 mRNA sequence
          Length = 1322

 Score =  440 bits (222), Expect = e-120
 Identities = 360/404 (89%), Gaps = 2/404 (0%)
 Strand = Plus / Plus

                                                                       
Query: 6   gtcgccgccgngggtatgtacaccggccagttcgtctactgcggnacgccgcgccacgct 65
           |||||||||| ||| |||||||||||||||||||| ||||||||  ||||||||||||||
Sbjct: 305 gtcgccgccgagggcatgtacaccggccagttcgtttactgcggc-cgccgcgccacgct 363

                                                                       
Query: 66  ctccgtaggcaacgtcctccccctccggtccgtgcctgagggaggcgtcatctgcaacgt 125
           |||| | ||||||||||| || |||||     | || ||||| | |||| | ||||||||
Sbjct: 364 ctccatcggcaacgtcctgccgctccgcgggatccccgagggtgccgtcgtatgcaacgt 423

                                                                       
Query: 126 cgagcaccacgtcggcgaccgtggtgtcttcgccagggcctccggtgactacgccatcgt 185
           ||||||||||||||| ||||| |||||||||||||||||||| || ||||||||||||||
Sbjct: 424 cgagcaccacgtcggtgaccgcggtgtcttcgccagggcctctggggactacgccatcgt 483

                                                                       
Query: 186 catcagccacaaccccgacaacggcacctcaaggatcaagctaccctctggtgctaagaa 245
            |||||||||||||| |||||||||||||| |||||||||||||| ||||| ||||||||
Sbjct: 484 gatcagccacaaccctgacaacggcacctcgaggatcaagctaccatctgg-gctaagaa 542

                                                                       
Query: 246 gatcgtcccaagcagctgccgtgctatgattggtcaggttgctggtggtggcaggactga 305
            || ||||| |||||||||||||| |||||||| |||||||| |||||||||||||||||
Sbjct: 543 aattgtccccagcagctgccgtgccatgattgggcaggttgccggtggtggcaggactga 602

                                                                       
Query: 306 gaagccaatgctgaaggctggtaacgcctaccacaagtaccgtgtgaagaggaactcctg 365
           |||||| |||||||||||||| |||||||||| ||||||||||||||||||||||  |||
Sbjct: 603 gaagccgatgctgaaggctggcaacgcctaccccaagtaccgtgtgaagaggaacagctg 662

                                                       
Query: 366 gcctaaggtgcgtggtgtggccatgaaccctgttgagcatcccc 409
           ||| ||||| |||||||||||||||||||| || ||||||||||
Sbjct: 663 gcccaaggtccgtggtgtggccatgaaccccgtggagcatcccc 706



to top

>gb|AY108123.1| Zea mays PCO067267 mRNA sequence
          Length = 1062

 Score =  402 bits (203), Expect = e-109
 Identities = 342/387 (88%), Gaps = 1/387 (0%)
 Strand = Plus / Plus

                                                                       
Query: 21  atgtacaccggccagttcgtctactgcggnacgccgcgccacgctctccgtaggcaacgt 80
           |||||||| ||||||||||| |||||||| |||||| || || |||||| | ||||||||
Sbjct: 340 atgtacactggccagttcgtttactgcgg-acgccgtgctacactctccattggcaacgt 398

                                                                       
Query: 81  cctccccctccggtccgtgcctgagggaggcgtcatctgcaacgtcgagcaccacgtcgg 140
           ||| || ||| ||    | |||||||| | |||  |||||||||| ||||||||||||||
Sbjct: 399 cctgccgctcagggggatccctgagggtgccgttgtctgcaacgttgagcaccacgtcgg 458

                                                                       
Query: 141 cgaccgtggtgtcttcgccagggcctccggtgactacgccatcgtcatcagccacaaccc 200
            || || ||||||||||||||||| || || |||||||| ||||| |||||||| |||||
Sbjct: 459 ggatcgcggtgtcttcgccagggcgtctggggactacgcgatcgttatcagccataaccc 518

                                                                       
Query: 201 cgacaacggcacctcaaggatcaagctaccctctggtgctaagaagatcgtcccaagcag 260
            ||||||||||| || ||||||||||| |||||||||||||||||||| |||||||| ||
Sbjct: 519 agacaacggcacatcgaggatcaagctcccctctggtgctaagaagattgtcccaagtag 578

                                                                       
Query: 261 ctgccgtgctatgattggtcaggttgctggtggtggcaggactgagaagccaatgctgaa 320
           ||||||||| |||||||| ||||| |||||||||||||||||||||||||||||||||||
Sbjct: 579 ctgccgtgccatgattgggcaggtcgctggtggtggcaggactgagaagccaatgctgaa 638

                                                                       
Query: 321 ggctggtaacgcctaccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtgg 380
           |||||| || ||||||||||||||||| || |||||||||  ||||||||||||||||||
Sbjct: 639 ggctggcaatgcctaccacaagtaccgcgtcaagaggaacagctggcctaaggtgcgtgg 698

                                      
Query: 381 tgtggccatgaaccctgttgagcatcc 407
           |||||||||||||||||||||||||||
Sbjct: 699 tgtggccatgaaccctgttgagcatcc 725



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score =  287 bits (145), Expect = 1e-74
 Identities = 181/193 (93%)
 Strand = Plus / Plus

                                                                            
Query: 217      aggatcaagctaccctctggtgctaagaagatcgtcccaagcagctgccgtgctatgatt 276
                ||||||||||| ||||||||||| |||||||| ||||| |||||||||||||| ||||| 
Sbjct: 23384900 aggatcaagctcccctctggtgccaagaagattgtccccagcagctgccgtgccatgatc 23384959

                                                                            
Query: 277      ggtcaggttgctggtggtggcaggactgagaagccaatgctgaaggctggtaacgcctac 336
                ||||||||||||||||||||||||||||||||||| ||||| |||||||| |||||||||
Sbjct: 23384960 ggtcaggttgctggtggtggcaggactgagaagccgatgctcaaggctggaaacgcctac 23385019

                                                                            
Query: 337      cacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaaccct 396
                ||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||| 
Sbjct: 23385020 cacaagtaccgcgtgaagaggaactgctggcctaaggtgcgtggtgtggccatgaacccc 23385079

                             
Query: 397      gttgagcatcccc 409
                |||||||||||||
Sbjct: 23385080 gttgagcatcccc 23385092



 Score =  208 bits (105), Expect = 1e-50
 Identities = 171/192 (89%), Gaps = 1/192 (0%)
 Strand = Plus / Plus

                                                                            
Query: 21       atgtacaccggccagttcgtctactgcggnacgccgcgccacgctctccgtaggcaacgt 80
                |||||||| || |||||||||||||||||  |||||||||||||||||| | ||||||||
Sbjct: 23383947 atgtacacggggcagttcgtctactgcggc-cgccgcgccacgctctccatcggcaacgt 23384005

                                                                            
Query: 81       cctccccctccggtccgtgcctgagggaggcgtcatctgcaacgtcgagcaccacgtcgg 140
                 |||||  ||||||| || || ||||| | |||  |||||||||||||||||||||||||
Sbjct: 23384006 gctcccgatccggtcggtacccgagggcgccgtggtctgcaacgtcgagcaccacgtcgg 23384065

                                                                            
Query: 141      cgaccgtggtgtcttcgccagggcctccggtgactacgccatcgtcatcagccacaaccc 200
                |||||| || |||||||||||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 23384066 cgaccgcggcgtcttcgccagggcgtccggcgactacgccatcgtcatcagccacaaccc 23384125

                            
Query: 201      cgacaacggcac 212
                ||| ||||||||
Sbjct: 23384126 cgataacggcac 23384137



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  287 bits (145), Expect = 1e-74
 Identities = 181/193 (93%)
 Strand = Plus / Plus

                                                                            
Query: 217      aggatcaagctaccctctggtgctaagaagatcgtcccaagcagctgccgtgctatgatt 276
                ||||||||||| ||||||||||| |||||||| ||||| |||||||||||||| ||||| 
Sbjct: 23313091 aggatcaagctcccctctggtgccaagaagattgtccccagcagctgccgtgccatgatc 23313150

                                                                            
Query: 277      ggtcaggttgctggtggtggcaggactgagaagccaatgctgaaggctggtaacgcctac 336
                ||||||||||||||||||||||||||||||||||| ||||| |||||||| |||||||||
Sbjct: 23313151 ggtcaggttgctggtggtggcaggactgagaagccgatgctcaaggctggaaacgcctac 23313210

                                                                            
Query: 337      cacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaaccct 396
                ||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||| 
Sbjct: 23313211 cacaagtaccgcgtgaagaggaactgctggcctaaggtgcgtggtgtggccatgaacccc 23313270

                             
Query: 397      gttgagcatcccc 409
                |||||||||||||
Sbjct: 23313271 gttgagcatcccc 23313283



 Score =  208 bits (105), Expect = 1e-50
 Identities = 171/192 (89%), Gaps = 1/192 (0%)
 Strand = Plus / Plus

                                                                            
Query: 21       atgtacaccggccagttcgtctactgcggnacgccgcgccacgctctccgtaggcaacgt 80
                |||||||| || |||||||||||||||||  |||||||||||||||||| | ||||||||
Sbjct: 23312138 atgtacacggggcagttcgtctactgcggc-cgccgcgccacgctctccatcggcaacgt 23312196

                                                                            
Query: 81       cctccccctccggtccgtgcctgagggaggcgtcatctgcaacgtcgagcaccacgtcgg 140
                 |||||  ||||||| || || ||||| | |||  |||||||||||||||||||||||||
Sbjct: 23312197 gctcccgatccggtcggtacccgagggcgccgtggtctgcaacgtcgagcaccacgtcgg 23312256

                                                                            
Query: 141      cgaccgtggtgtcttcgccagggcctccggtgactacgccatcgtcatcagccacaaccc 200
                |||||| || |||||||||||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 23312257 cgaccgcggcgtcttcgccagggcgtccggcgactacgccatcgtcatcagccacaaccc 23312316

                            
Query: 201      cgacaacggcac 212
                ||| ||||||||
Sbjct: 23312317 cgataacggcac 23312328



to top

>emb|AL731784.3|CNS08C88 Oryza sativa chromosome 12, . BAC OSJNBa0016C14 of library OSJNBa from
              chromosome 12 of cultivar Nipponbare of ssp. japonica of
              Oryza sativa (rice), complete sequence
          Length = 162261

 Score =  287 bits (145), Expect = 1e-74
 Identities = 181/193 (93%)
 Strand = Plus / Minus

                                                                          
Query: 217    aggatcaagctaccctctggtgctaagaagatcgtcccaagcagctgccgtgctatgatt 276
              ||||||||||| ||||||||||| |||||||| ||||| |||||||||||||| ||||| 
Sbjct: 117259 aggatcaagctcccctctggtgccaagaagattgtccccagcagctgccgtgccatgatc 117200

                                                                          
Query: 277    ggtcaggttgctggtggtggcaggactgagaagccaatgctgaaggctggtaacgcctac 336
              ||||||||||||||||||||||||||||||||||| ||||| |||||||| |||||||||
Sbjct: 117199 ggtcaggttgctggtggtggcaggactgagaagccgatgctcaaggctggaaacgcctac 117140

                                                                          
Query: 337    cacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaaccct 396
              ||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||| 
Sbjct: 117139 cacaagtaccgcgtgaagaggaactgctggcctaaggtgcgtggtgtggccatgaacccc 117080

                           
Query: 397    gttgagcatcccc 409
              |||||||||||||
Sbjct: 117079 gttgagcatcccc 117067



 Score =  208 bits (105), Expect = 1e-50
 Identities = 171/192 (89%), Gaps = 1/192 (0%)
 Strand = Plus / Minus

                                                                          
Query: 21     atgtacaccggccagttcgtctactgcggnacgccgcgccacgctctccgtaggcaacgt 80
              |||||||| || |||||||||||||||||  |||||||||||||||||| | ||||||||
Sbjct: 118212 atgtacacggggcagttcgtctactgcggc-cgccgcgccacgctctccatcggcaacgt 118154

                                                                          
Query: 81     cctccccctccggtccgtgcctgagggaggcgtcatctgcaacgtcgagcaccacgtcgg 140
               |||||  ||||||| || || ||||| | |||  |||||||||||||||||||||||||
Sbjct: 118153 gctcccgatccggtcggtacccgagggcgccgtggtctgcaacgtcgagcaccacgtcgg 118094

                                                                          
Query: 141    cgaccgtggtgtcttcgccagggcctccggtgactacgccatcgtcatcagccacaaccc 200
              |||||| || |||||||||||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 118093 cgaccgcggcgtcttcgccagggcgtccggcgactacgccatcgtcatcagccacaaccc 118034

                          
Query: 201    cgacaacggcac 212
              ||| ||||||||
Sbjct: 118033 cgataacggcac 118022



to top

>gb|AF479049.1| Triticum aestivum ribosomal protein L2 mRNA, partial cds
          Length = 270

 Score =  204 bits (103), Expect = 2e-49
 Identities = 112/115 (97%)
 Strand = Plus / Plus

                                                                       
Query: 295 ggcaggactgagaagccaatgctgaaggctggtaacgcctaccacaagtaccgtgtgaag 354
           ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggcaggactgagaagccaatgctcaaggctggtaacgcctaccacaagtaccgtgtgaag 60

                                                                  
Query: 355 aggaactcctggcctaaggtgcgtggtgtggccatgaaccctgttgagcatcccc 409
           |||||||| ||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 61  aggaactcgtggcctaaggtgcgtggtgtggccatgaaccctgtggagcatcccc 115



to top

>emb|AJ404848.1|GMA404848 Glycine max mRNA for ribosomal protein L2 (rpL2 gene)
          Length = 1000

 Score =  194 bits (98), Expect = 2e-46
 Identities = 248/298 (83%)
 Strand = Plus / Plus

                                                                       
Query: 112 gtcatctgcaacgtcgagcaccacgtcggcgaccgtggtgtcttcgccagggcctccggt 171
           ||||||||||||||||||||||| ||||||||||| || |||||||| ||||| || || 
Sbjct: 378 gtcatctgcaacgtcgagcaccatgtcggcgaccgcggcgtcttcgctagggcgtctgga 437

                                                                       
Query: 172 gactacgccatcgtcatcagccacaaccccgacaacggcacctcaaggatcaagctaccc 231
           ||||||||||| || ||||| |||||||| || || | |||||| ||||| ||||| || 
Sbjct: 438 gactacgccattgttatcagtcacaaccctgataatgacacctctaggattaagctccca 497

                                                                       
Query: 232 tctggtgctaagaagatcgtcccaagcagctgccgtgctatgattggtcaggttgctggt 291
           |||||| | |||||||| || |||||   |||  | || ||||||||||| ||||| |||
Sbjct: 498 tctggttcaaagaagattgttccaagtgactgtagggccatgattggtcaagttgcaggt 557

                                                                       
Query: 292 ggtggcaggactgagaagccaatgctgaaggctggtaacgcctaccacaagtaccgtgtg 351
           || || || |||||||||||  | || |||||||| || || |||||||||| | | |||
Sbjct: 558 ggagggagaactgagaagcctcttctcaaggctggaaatgcttaccacaagttcagagtg 617

                                                                     
Query: 352 aagaggaactcctggcctaaggtgcgtggtgtggccatgaaccctgttgagcatcccc 409
           |||||||| | |||||| ||||| |||||||| || ||||||||||||||||||||||
Sbjct: 618 aagaggaattgctggcccaaggttcgtggtgttgctatgaaccctgttgagcatcccc 675



 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactgcgg 49
           ||||||||| |||| | ||||||||||||||| ||||||||||
Sbjct: 274 tcgccgccgagggtctctacaccggccagttcatctactgcgg 316



to top

>ref|NM_127358.3| Arabidopsis thaliana EMB2296; structural constituent of ribosome
           AT2G18020 (EMB2296) mRNA, complete cds
          Length = 968

 Score =  190 bits (96), Expect = 2e-45
 Identities = 243/292 (83%)
 Strand = Plus / Plus

                                                                       
Query: 116 tctgcaacgtcgagcaccacgtcggcgaccgtggtgtcttcgccagggcctccggtgact 175
           |||||||||||||||| |||||||| || ||||||||| |||| || || || ||||| |
Sbjct: 385 tctgcaacgtcgagcatcacgtcggtgatcgtggtgtcctcgctagagcttctggtgatt 444

                                                                       
Query: 176 acgccatcgtcatcagccacaaccccgacaacggcacctcaaggatcaagctaccctctg 235
           ||||||| || |||   |||||||| |||| || |||  | ||||| ||| | || || |
Sbjct: 445 acgccattgttatcgctcacaaccctgacagcgacactactaggattaagttgccatcgg 504

                                                                       
Query: 236 gtgctaagaagatcgtcccaagcagctgccgtgctatgattggtcaggttgctggtggtg 295
           || | |||||||| ||||||||  | ||| | ||||||||||| || |||||||| ||||
Sbjct: 505 gttcgaagaagattgtcccaagtggatgcagggctatgattggacaagttgctggaggtg 564

                                                                       
Query: 296 gcaggactgagaagccaatgctgaaggctggtaacgcctaccacaagtaccgtgtgaaga 355
           | || ||||||||||| ||||| ||||| || ||||| ||||||||||||||||||||||
Sbjct: 565 gaagaactgagaagccgatgctcaaggcaggaaacgcgtaccacaagtaccgtgtgaaga 624

                                                               
Query: 356 ggaactcctggcctaaggtgcgtggtgtggccatgaaccctgttgagcatcc 407
           ||||||| ||||||||||| ||||||||||| ||||| || || ||||||||
Sbjct: 625 ggaactcatggcctaaggttcgtggtgtggctatgaatccagtggagcatcc 676



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 6   gtcgccgccgngggtatgtacaccggccagttcgtctactgcgg 49
           ||||||||||  |||||||||||||| |||||| | ||||||||
Sbjct: 276 gtcgccgccgaaggtatgtacaccggtcagttcttgtactgcgg 319



to top

>gb|AY128314.1| Arabidopsis thaliana 60S ribosomal protein L2 (At2g18020) mRNA,
           complete cds
          Length = 944

 Score =  190 bits (96), Expect = 2e-45
 Identities = 243/292 (83%)
 Strand = Plus / Plus

                                                                       
Query: 116 tctgcaacgtcgagcaccacgtcggcgaccgtggtgtcttcgccagggcctccggtgact 175
           |||||||||||||||| |||||||| || ||||||||| |||| || || || ||||| |
Sbjct: 385 tctgcaacgtcgagcatcacgtcggtgatcgtggtgtcctcgctagagcttctggtgatt 444

                                                                       
Query: 176 acgccatcgtcatcagccacaaccccgacaacggcacctcaaggatcaagctaccctctg 235
           ||||||| || |||   |||||||| |||| || |||  | ||||| ||| | || || |
Sbjct: 445 acgccattgttatcgctcacaaccctgacagcgacactactaggattaagttgccatcgg 504

                                                                       
Query: 236 gtgctaagaagatcgtcccaagcagctgccgtgctatgattggtcaggttgctggtggtg 295
           || | |||||||| ||||||||  | ||| | ||||||||||| || |||||||| ||||
Sbjct: 505 gttcgaagaagattgtcccaagtggatgcagggctatgattggacaagttgctggaggtg 564

                                                                       
Query: 296 gcaggactgagaagccaatgctgaaggctggtaacgcctaccacaagtaccgtgtgaaga 355
           | || ||||||||||| ||||| ||||| || ||||| ||||||||||||||||||||||
Sbjct: 565 gaagaactgagaagccgatgctcaaggcaggaaacgcgtaccacaagtaccgtgtgaaga 624

                                                               
Query: 356 ggaactcctggcctaaggtgcgtggtgtggccatgaaccctgttgagcatcc 407
           ||||||| ||||||||||| ||||||||||| ||||| || || ||||||||
Sbjct: 625 ggaactcatggcctaaggttcgtggtgtggctatgaatccagtggagcatcc 676



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 6   gtcgccgccgngggtatgtacaccggccagttcgtctactgcgg 49
           ||||||||||  |||||||||||||| |||||| | ||||||||
Sbjct: 276 gtcgccgccgaaggtatgtacaccggtcagttcttgtactgcgg 319



to top

>emb|BX820233.1|CNS0A8O8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH10ZE05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 881

 Score =  190 bits (96), Expect = 2e-45
 Identities = 243/292 (83%)
 Strand = Plus / Plus

                                                                       
Query: 116 tctgcaacgtcgagcaccacgtcggcgaccgtggtgtcttcgccagggcctccggtgact 175
           |||||||||||||||| |||||||| || ||||||||| |||| || || || ||||| |
Sbjct: 349 tctgcaacgtcgagcatcacgtcggtgatcgtggtgtcctcgctagagcttctggtgatt 408

                                                                       
Query: 176 acgccatcgtcatcagccacaaccccgacaacggcacctcaaggatcaagctaccctctg 235
           ||||||| || |||   |||||||| |||| || |||  | ||||| ||| | || || |
Sbjct: 409 acgccattgttatcgctcacaaccctgacagcgacactactaggattaagttgccatcgg 468

                                                                       
Query: 236 gtgctaagaagatcgtcccaagcagctgccgtgctatgattggtcaggttgctggtggtg 295
           || | |||||||| ||||||||  | ||| | ||||||||||| || |||||||| ||||
Sbjct: 469 gttcgaagaagattgtcccaagtggatgcagggctatgattggacaagttgctggaggtg 528

                                                                       
Query: 296 gcaggactgagaagccaatgctgaaggctggtaacgcctaccacaagtaccgtgtgaaga 355
           | || ||||||||||| ||||| ||||| || ||||| ||||||||||||||||||||||
Sbjct: 529 gaagaactgagaagccgatgctcaaggcaggaaacgcgtaccacaagtaccgtgtgaaga 588

                                                               
Query: 356 ggaactcctggcctaaggtgcgtggtgtggccatgaaccctgttgagcatcc 407
           ||||||| ||||||||||| ||||||||||| ||||| || || ||||||||
Sbjct: 589 ggaactcatggcctaaggttcgtggtgtggctatgaatccagtggagcatcc 640



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 6   gtcgccgccgngggtatgtacaccggccagttcgtctactgcgg 49
           ||||||||||  |||||||||||||| |||||| | ||||||||
Sbjct: 240 gtcgccgccgaaggtatgtacaccggtcagttcttgtactgcgg 283



to top

>emb|BX820320.1|CNS0A7WS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH22ZA07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 901

 Score =  190 bits (96), Expect = 2e-45
 Identities = 243/292 (83%)
 Strand = Plus / Plus

                                                                       
Query: 116 tctgcaacgtcgagcaccacgtcggcgaccgtggtgtcttcgccagggcctccggtgact 175
           |||||||||||||||| |||||||| || ||||||||| |||| || || || ||||| |
Sbjct: 334 tctgcaacgtcgagcatcacgtcggtgatcgtggtgtcctcgctagagcttctggtgatt 393

                                                                       
Query: 176 acgccatcgtcatcagccacaaccccgacaacggcacctcaaggatcaagctaccctctg 235
           ||||||| || |||   |||||||| |||| || |||  | ||||| ||| | || || |
Sbjct: 394 acgccattgttatcgctcacaaccctgacagcgacactactaggattaagttgccatcgg 453

                                                                       
Query: 236 gtgctaagaagatcgtcccaagcagctgccgtgctatgattggtcaggttgctggtggtg 295
           || | |||||||| ||||||||  | ||| | ||||||||||| || |||||||| ||||
Sbjct: 454 gttcgaagaagattgtcccaagtggatgcagggctatgattggacaagttgctggaggtg 513

                                                                       
Query: 296 gcaggactgagaagccaatgctgaaggctggtaacgcctaccacaagtaccgtgtgaaga 355
           | || ||||||||||| ||||| ||||| || ||||| ||||||||||||||||||||||
Sbjct: 514 gaagaactgagaagccgatgctcaaggcaggaaacgcgtaccacaagtaccgtgtgaaga 573

                                                               
Query: 356 ggaactcctggcctaaggtgcgtggtgtggccatgaaccctgttgagcatcc 407
           ||||||| ||||||||||| ||||||||||| ||||| || || ||||||||
Sbjct: 574 ggaactcatggcctaaggttcgtggtgtggctatgaatccagtggagcatcc 625



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 6   gtcgccgccgngggtatgtacaccggccagttcgtctactgcgg 49
           ||||||||||  |||||||||||||| |||||| | ||||||||
Sbjct: 225 gtcgccgccgaaggtatgtacaccggtcagttcttgtactgcgg 268



to top

>gb|BT001177.1| Arabidopsis thaliana 60S ribosomal protein L2 (At2g18020) mRNA,
           complete cds
          Length = 858

 Score =  190 bits (96), Expect = 2e-45
 Identities = 243/292 (83%)
 Strand = Plus / Plus

                                                                       
Query: 116 tctgcaacgtcgagcaccacgtcggcgaccgtggtgtcttcgccagggcctccggtgact 175
           |||||||||||||||| |||||||| || ||||||||| |||| || || || ||||| |
Sbjct: 338 tctgcaacgtcgagcatcacgtcggtgatcgtggtgtcctcgctagagcttctggtgatt 397

                                                                       
Query: 176 acgccatcgtcatcagccacaaccccgacaacggcacctcaaggatcaagctaccctctg 235
           ||||||| || |||   |||||||| |||| || |||  | ||||| ||| | || || |
Sbjct: 398 acgccattgttatcgctcacaaccctgacagcgacactactaggattaagttgccatcgg 457

                                                                       
Query: 236 gtgctaagaagatcgtcccaagcagctgccgtgctatgattggtcaggttgctggtggtg 295
           || | |||||||| ||||||||  | ||| | ||||||||||| || |||||||| ||||
Sbjct: 458 gttcgaagaagattgtcccaagtggatgcagggctatgattggacaagttgctggaggtg 517

                                                                       
Query: 296 gcaggactgagaagccaatgctgaaggctggtaacgcctaccacaagtaccgtgtgaaga 355
           | || ||||||||||| ||||| ||||| || ||||| ||||||||||||||||||||||
Sbjct: 518 gaagaactgagaagccgatgctcaaggcaggaaacgcgtaccacaagtaccgtgtgaaga 577

                                                               
Query: 356 ggaactcctggcctaaggtgcgtggtgtggccatgaaccctgttgagcatcc 407
           ||||||| ||||||||||| ||||||||||| ||||| || || ||||||||
Sbjct: 578 ggaactcatggcctaaggttcgtggtgtggctatgaatccagtggagcatcc 629



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 6   gtcgccgccgngggtatgtacaccggccagttcgtctactgcgg 49
           ||||||||||  |||||||||||||| |||||| | ||||||||
Sbjct: 229 gtcgccgccgaaggtatgtacaccggtcagttcttgtactgcgg 272



to top

>emb|BX820589.1|CNS0A8QO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH50ZB11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 930

 Score =  182 bits (92), Expect = 6e-43
 Identities = 242/292 (82%)
 Strand = Plus / Plus

                                                                       
Query: 116 tctgcaacgtcgagcaccacgtcggcgaccgtggtgtcttcgccagggcctccggtgact 175
           |||||||||||||||| |||||||| || ||||||||| |||| || || || ||||| |
Sbjct: 363 tctgcaacgtcgagcatcacgtcggtgatcgtggtgtcctcgctagagcttctggtgatt 422

                                                                       
Query: 176 acgccatcgtcatcagccacaaccccgacaacggcacctcaaggatcaagctaccctctg 235
           |||||||  | |||   |||||||| |||| || |||  | ||||| ||| | || || |
Sbjct: 423 acgccatttttatcgctcacaaccctgacagcgacactactaggattaagttgccatcgg 482

                                                                       
Query: 236 gtgctaagaagatcgtcccaagcagctgccgtgctatgattggtcaggttgctggtggtg 295
           || | |||||||| ||||||||  | ||| | ||||||||||| || |||||||| ||||
Sbjct: 483 gttcgaagaagattgtcccaagtggatgcagggctatgattggacaagttgctggaggtg 542

                                                                       
Query: 296 gcaggactgagaagccaatgctgaaggctggtaacgcctaccacaagtaccgtgtgaaga 355
           | || ||||||||||| ||||| ||||| || ||||| ||||||||||||||||||||||
Sbjct: 543 gaagaactgagaagccgatgctcaaggcaggaaacgcgtaccacaagtaccgtgtgaaga 602

                                                               
Query: 356 ggaactcctggcctaaggtgcgtggtgtggccatgaaccctgttgagcatcc 407
           ||||||| ||||||||||| ||||||||||| ||||| || || ||||||||
Sbjct: 603 ggaactcatggcctaaggttcgtggtgtggctatgaatccagtggagcatcc 654



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 6   gtcgccgccgngggtatgtacaccggccagttcgtctactgcgg 49
           ||||||||||  |||||||||||||| |||||| | ||||||||
Sbjct: 254 gtcgccgccgaaggtatgtacaccggtcagttcttgtactgcgg 297



to top

>emb|BX820387.1|CNS0A8NL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH28ZH04 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 946

 Score =  174 bits (88), Expect = 1e-40
 Identities = 241/292 (82%)
 Strand = Plus / Plus

                                                                       
Query: 116 tctgcaacgtcgagcaccacgtcggcgaccgtggtgtcttcgccagggcctccggtgact 175
           |||||||||||||||| |||||||| || ||||||||| |||| || || || ||||| |
Sbjct: 363 tctgcaacgtcgagcatcacgtcggtgatcgtggtgtcctcgctagagcttctggtgatt 422

                                                                       
Query: 176 acgccatcgtcatcagccacaaccccgacaacggcacctcaaggatcaagctaccctctg 235
           |||||||  | |||   ||||||||  ||| || |||  | ||||| ||| | || || |
Sbjct: 423 acgccatttttatcgctcacaaccctcacagcgacactactaggattaagttgccatcgg 482

                                                                       
Query: 236 gtgctaagaagatcgtcccaagcagctgccgtgctatgattggtcaggttgctggtggtg 295
           || | |||||||| ||||||||  | ||| | ||||||||||| || |||||||| ||||
Sbjct: 483 gttcgaagaagattgtcccaagtggatgcagggctatgattggacaagttgctggaggtg 542

                                                                       
Query: 296 gcaggactgagaagccaatgctgaaggctggtaacgcctaccacaagtaccgtgtgaaga 355
           | || ||||||||||| ||||| ||||| || ||||| ||||||||||||||||||||||
Sbjct: 543 gaagaactgagaagccgatgctcaaggcaggaaacgcgtaccacaagtaccgtgtgaaga 602

                                                               
Query: 356 ggaactcctggcctaaggtgcgtggtgtggccatgaaccctgttgagcatcc 407
           ||||||| ||||||||||| ||||||||||| ||||| || || ||||||||
Sbjct: 603 ggaactcatggcctaaggttcgtggtgtggctatgaatccagtggagcatcc 654



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 6   gtcgccgccgngggtatgtacaccggccagttcgtctactgcgg 49
           ||||||||||  |||||||||||||| |||||| | ||||||||
Sbjct: 254 gtcgccgccgaaggtatgtacaccggtcagttcttgtactgcgg 297



to top

>emb|BX820333.1|CNS0A8NS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH23ZG05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 916

 Score =  170 bits (86), Expect = 2e-39
 Identities = 231/278 (83%), Gaps = 1/278 (0%)
 Strand = Plus / Plus

                                                                       
Query: 116 tctgcaacgtcgagcaccacgtcggcgaccgtggtgtcttcgccagggcctccggtgact 175
           |||||||||||||||| |||||||| || ||||||||| |||| || || || ||||| |
Sbjct: 367 tctgcaacgtcgagcatcacgtcggtgatcgtggtgtcctcgctagagcttctggtgatt 426

                                                                       
Query: 176 acgccatcgtcatcagccacaaccccgacaacggcacctcaaggatcaagctaccctctg 235
           ||||||| || |||   |||||||| |||| || |||  | ||||| ||| | || || |
Sbjct: 427 acgccattgttatcgctcacaaccctgacagcgacactactaggattaagttgccatcgg 486

                                                                       
Query: 236 gtgctaagaagatcgtcccaagcagctgccgtgctatgattggtcaggttgctggtggtg 295
           || | |||||||| ||||||||  | ||| | ||||||||||| || |||||||| ||||
Sbjct: 487 gttcgaagaagattgtcccaagtggatgcagggctatgattggacaagttgctggaggtg 546

                                                                       
Query: 296 gcaggactgagaagccaatgctgaaggctggtaacgcctaccacaagta-ccgtgtgaag 354
           | || ||||||||||| ||||| ||||| || ||||| ||||||||||| ||||||||||
Sbjct: 547 gaagaactgagaagccgatgctcaaggcaggaaacgcgtaccacaagtacccgtgtgaag 606

                                                 
Query: 355 aggaactcctggcctaaggtgcgtggtgtggccatgaa 392
           |||||||| ||||||||||| ||||||||||| |||||
Sbjct: 607 aggaactcatggcctaaggttcgtggtgtggctatgaa 644



 Score = 46.1 bits (23), Expect = 0.089
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 8   cgccgccgngggtatgtacaccggccagttcgtctactgcgg 49
           ||||||||  |||||||||||||| |||||| | ||||||||
Sbjct: 259 cgccgccgaaggtatgtacaccggtcagttcttgtactgcgg 300



to top

>emb|X86765.1|ATC24RPL2 A.thaliana mRNA for ribosomal protein L2
          Length = 1002

 Score =  167 bits (84), Expect = 4e-38
 Identities = 240/292 (82%)
 Strand = Plus / Plus

                                                                       
Query: 116 tctgcaacgtcgagcaccacgtcggcgaccgtggtgtcttcgccagggcctccggtgact 175
           |||||||||||||||| |||||||| || ||||||||| |||| || || || ||||| |
Sbjct: 402 tctgcaacgtcgagcatcacgtcggtgatcgtggtgtcctcgctagagcttctggtgatt 461

                                                                       
Query: 176 acgccatcgtcatcagccacaaccccgacaacggcacctcaaggatcaagctaccctctg 235
           ||||||| || |||    | ||||| |||| || |||  | ||||| ||| | || || |
Sbjct: 462 acgccattgttatcgctgagaaccctgacagcgacactactaggattaagttgccatcgg 521

                                                                       
Query: 236 gtgctaagaagatcgtcccaagcagctgccgtgctatgattggtcaggttgctggtggtg 295
           || | |||||||| ||||||||  |  || | ||||||||||| || |||||||| ||||
Sbjct: 522 gttcgaagaagattgtcccaagtggtagcagggctatgattggacaagttgctggaggtg 581

                                                                       
Query: 296 gcaggactgagaagccaatgctgaaggctggtaacgcctaccacaagtaccgtgtgaaga 355
           | || ||||||||||| ||||| ||||| || ||||| ||||||||||||||||||||||
Sbjct: 582 gaagaactgagaagccgatgctcaaggcaggaaacgcgtaccacaagtaccgtgtgaaga 641

                                                               
Query: 356 ggaactcctggcctaaggtgcgtggtgtggccatgaaccctgttgagcatcc 407
           ||||||| ||||||||||| ||||||||||| ||||| || || ||||||||
Sbjct: 642 ggaactcatggcctaaggttcgtggtgtggctatgaatccagtggagcatcc 693



to top

>gb|AF156372.1| Nicotiana tabacum clone PR60 60S ribosomal protein L2 mRNA, partial
           cds
          Length = 644

 Score =  163 bits (82), Expect = 5e-37
 Identities = 220/266 (82%)
 Strand = Plus / Plus

                                                                       
Query: 142 gaccgtggtgtcttcgccagggcctccggtgactacgccatcgtcatcagccacaacccc 201
           ||||||||||| || ||||||  ||| ||||| || || || ||||| || |||||||||
Sbjct: 106 gaccgtggtgtttttgccaggtgctctggtgattatgctattgtcattagtcacaacccc 165

                                                                       
Query: 202 gacaacggcacctcaaggatcaagctaccctctggtgctaagaagatcgtcccaagcagc 261
           || ||||| ||| | ||||| ||||| || || ||  | |||||||| || || ||  | 
Sbjct: 166 gataacggaaccaccaggattaagctgccttcaggatccaagaagattgtgcccagtggg 225

                                                                       
Query: 262 tgccgtgctatgattggtcaggttgctggtggtggcaggactgagaagccaatgctgaag 321
           || ||||||||||||||||| |||||||| || ||  | |||||||| |||||||| |||
Sbjct: 226 tgtcgtgctatgattggtcaagttgctggaggaggacgtactgagaaaccaatgcttaag 285

                                                                       
Query: 322 gctggtaacgcctaccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggt 381
           || |||||||| |||||||||||||| || |||||||||| |||||| ||||| ||||||
Sbjct: 286 gccggtaacgcataccacaagtaccgggtaaagaggaactgctggcccaaggttcgtggt 345

                                     
Query: 382 gtggccatgaaccctgttgagcatcc 407
           || |||||||||||||| ||||||||
Sbjct: 346 gttgccatgaaccctgtggagcatcc 371



to top

>ref|NM_119780.2| Arabidopsis thaliana structural constituent of ribosome AT4G36130
           mRNA, complete cds
          Length = 1048

 Score =  161 bits (81), Expect = 2e-36
 Identities = 123/137 (89%)
 Strand = Plus / Plus

                                                                       
Query: 271 atgattggtcaggttgctggtggtggcaggactgagaagccaatgctgaaggctggtaac 330
           ||||||||||| ||||| |||||||| || || |||||||| ||||| ||||||||||||
Sbjct: 541 atgattggtcaagttgcaggtggtggaagaacagagaagccgatgctcaaggctggtaac 600

                                                                       
Query: 331 gcctaccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatg 390
           || ||||||||||||||||||||||| |||| |||||||||||| ||||||||||| |||
Sbjct: 601 gcataccacaagtaccgtgtgaagagaaactgctggcctaaggttcgtggtgtggctatg 660

                            
Query: 391 aaccctgttgagcatcc 407
           || || |||||||||||
Sbjct: 661 aatccagttgagcatcc 677



to top

>emb|AL161588.2|ATCHRIV84 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 84
          Length = 195452

 Score =  161 bits (81), Expect = 2e-36
 Identities = 123/137 (89%)
 Strand = Plus / Plus

                                                                          
Query: 271    atgattggtcaggttgctggtggtggcaggactgagaagccaatgctgaaggctggtaac 330
              ||||||||||| ||||| |||||||| || || |||||||| ||||| ||||||||||||
Sbjct: 170132 atgattggtcaagttgcaggtggtggaagaacagagaagccgatgctcaaggctggtaac 170191

                                                                          
Query: 331    gcctaccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatg 390
              || ||||||||||||||||||||||| |||| |||||||||||| ||||||||||| |||
Sbjct: 170192 gcataccacaagtaccgtgtgaagagaaactgctggcctaaggttcgtggtgtggctatg 170251

                               
Query: 391    aaccctgttgagcatcc 407
              || || |||||||||||
Sbjct: 170252 aatccagttgagcatcc 170268



to top

>emb|AL022141.1|ATF23E13 Arabidopsis thaliana DNA chromosome 4, BAC clone F23E13 (ESSAII
            project)
          Length = 94695

 Score =  161 bits (81), Expect = 2e-36
 Identities = 123/137 (89%)
 Strand = Plus / Plus

                                                                        
Query: 271  atgattggtcaggttgctggtggtggcaggactgagaagccaatgctgaaggctggtaac 330
            ||||||||||| ||||| |||||||| || || |||||||| ||||| ||||||||||||
Sbjct: 2959 atgattggtcaagttgcaggtggtggaagaacagagaagccgatgctcaaggctggtaac 3018

                                                                        
Query: 331  gcctaccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatg 390
            || ||||||||||||||||||||||| |||| |||||||||||| ||||||||||| |||
Sbjct: 3019 gcataccacaagtaccgtgtgaagagaaactgctggcctaaggttcgtggtgtggctatg 3078

                             
Query: 391  aaccctgttgagcatcc 407
            || || |||||||||||
Sbjct: 3079 aatccagttgagcatcc 3095



to top

>emb|AL022373.1|ATT19K4 Arabidopsis thaliana DNA chromosome 4, BAC clone T19K4 (ESSAII project)
          Length = 106007

 Score =  161 bits (81), Expect = 2e-36
 Identities = 123/137 (89%)
 Strand = Plus / Plus

                                                                          
Query: 271    atgattggtcaggttgctggtggtggcaggactgagaagccaatgctgaaggctggtaac 330
              ||||||||||| ||||| |||||||| || || |||||||| ||||| ||||||||||||
Sbjct: 104861 atgattggtcaagttgcaggtggtggaagaacagagaagccgatgctcaaggctggtaac 104920

                                                                          
Query: 331    gcctaccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatg 390
              || ||||||||||||||||||||||| |||| |||||||||||| ||||||||||| |||
Sbjct: 104921 gcataccacaagtaccgtgtgaagagaaactgctggcctaaggttcgtggtgtggctatg 104980

                               
Query: 391    aaccctgttgagcatcc 407
              || || |||||||||||
Sbjct: 104981 aatccagttgagcatcc 104997



to top

>gb|AF361610.1| Arabidopsis thaliana AT4g36130/F23E13_20 mRNA, complete cds
          Length = 1029

 Score =  161 bits (81), Expect = 2e-36
 Identities = 123/137 (89%)
 Strand = Plus / Plus

                                                                       
Query: 271 atgattggtcaggttgctggtggtggcaggactgagaagccaatgctgaaggctggtaac 330
           ||||||||||| ||||| |||||||| || || |||||||| ||||| ||||||||||||
Sbjct: 541 atgattggtcaagttgcaggtggtggaagaacagagaagccgatgctcaaggctggtaac 600

                                                                       
Query: 331 gcctaccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatg 390
           || ||||||||||||||||||||||| |||| |||||||||||| ||||||||||| |||
Sbjct: 601 gcataccacaagtaccgtgtgaagagaaactgctggcctaaggttcgtggtgtggctatg 660

                            
Query: 391 aaccctgttgagcatcc 407
           || || |||||||||||
Sbjct: 661 aatccagttgagcatcc 677



to top

>gb|AF367335.1| Arabidopsis thaliana AT4g36130/F23E13_20 mRNA, complete cds
          Length = 972

 Score =  161 bits (81), Expect = 2e-36
 Identities = 123/137 (89%)
 Strand = Plus / Plus

                                                                       
Query: 271 atgattggtcaggttgctggtggtggcaggactgagaagccaatgctgaaggctggtaac 330
           ||||||||||| ||||| |||||||| || || |||||||| ||||| ||||||||||||
Sbjct: 541 atgattggtcaagttgcaggtggtggaagaacagagaagccgatgctcaaggctggtaac 600

                                                                       
Query: 331 gcctaccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatg 390
           || ||||||||||||||||||||||| |||| |||||||||||| ||||||||||| |||
Sbjct: 601 gcataccacaagtaccgtgtgaagagaaactgctggcctaaggttcgtggtgtggctatg 660

                            
Query: 391 aaccctgttgagcatcc 407
           || || |||||||||||
Sbjct: 661 aatccagttgagcatcc 677



to top

>gb|AY058221.1| Arabidopsis thaliana AT4g36130/F23E13_20 mRNA, complete cds
          Length = 777

 Score =  161 bits (81), Expect = 2e-36
 Identities = 123/137 (89%)
 Strand = Plus / Plus

                                                                       
Query: 271 atgattggtcaggttgctggtggtggcaggactgagaagccaatgctgaaggctggtaac 330
           ||||||||||| ||||| |||||||| || || |||||||| ||||| ||||||||||||
Sbjct: 493 atgattggtcaagttgcaggtggtggaagaacagagaagccgatgctcaaggctggtaac 552

                                                                       
Query: 331 gcctaccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatg 390
           || ||||||||||||||||||||||| |||| |||||||||||| ||||||||||| |||
Sbjct: 553 gcataccacaagtaccgtgtgaagagaaactgctggcctaaggttcgtggtgtggctatg 612

                            
Query: 391 aaccctgttgagcatcc 407
           || || |||||||||||
Sbjct: 613 aatccagttgagcatcc 629



to top

>emb|BX820018.1|CNS0A8IW Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS61ZG10 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 887

 Score =  161 bits (81), Expect = 2e-36
 Identities = 241/293 (82%), Gaps = 1/293 (0%)
 Strand = Plus / Plus

                                                                       
Query: 116 tctgcaacgtcgagcaccacgtcggcgaccgtggtgtcttcgccagggcctccggtgact 175
           |||||||||||||||| |||||||| || ||||||||| |||| || || || ||||| |
Sbjct: 355 tctgcaacgtcgagcatcacgtcggtgatcgtggtgtcctcgctagagcttctggtgatt 414

                                                                       
Query: 176 acgccatcgtcatcagccacaaccccgacaacggcacctcaaggatcaagctaccctctg 235
           |||||||  | |||   ||||||||  ||| || |||  | ||||| ||| | || || |
Sbjct: 415 acgccatttttatcgctcacaacccttacagcgacactactaggattaagttgccatcgg 474

                                                                       
Query: 236 gtgctaagaagatcgtcccaagcagctgccgtgctatgattggtcaggttgctggtggtg 295
           || | |||||||| ||||||||  | ||| | ||||||||||| || |||||||| ||||
Sbjct: 475 gttcgaagaagattgtcccaagtggatgcagggctatgattggacaagttgctggaggtg 534

                                                                       
Query: 296 gcaggactgagaagccaatgctgaaggctggtaacgcctaccacaagta-ccgtgtgaag 354
           | || ||||||||||| ||||| ||||| || ||||| ||||||||||| ||||||||||
Sbjct: 535 gaagaactgagaagccgatgctcaaggcaggaaacgcgtaccacaagtatccgtgtgaag 594

                                                                
Query: 355 aggaactcctggcctaaggtgcgtggtgtggccatgaaccctgttgagcatcc 407
           |||||||| ||||||||||| ||||||||||| ||||| || || ||||||||
Sbjct: 595 aggaactcatggcctaaggttcgtggtgtggctatgaatccagtggagcatcc 647



to top

>emb|BX818795.1|CNS0A8ZD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB13ZH09 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 878

 Score =  159 bits (80), Expect = 9e-36
 Identities = 239/292 (81%)
 Strand = Plus / Plus

                                                                       
Query: 116 tctgcaacgtcgagcaccacgtcggcgaccgtggtgtcttcgccagggcctccggtgact 175
           |||| ||||||||||| |||||||| || ||||||||| |||| || || || ||||| |
Sbjct: 356 tctgtaacgtcgagcatcacgtcggtgatcgtggtgtcctcgctagagcttctggtgatt 415

                                                                       
Query: 176 acgccatcgtcatcagccacaaccccgacaacggcacctcaaggatcaagctaccctctg 235
           ||||||| || |||   ||||||||  ||| || |||  | ||||| ||| | || || |
Sbjct: 416 acgccattgttatcgctcacaaccctcacagcgacactactaggattaagttgccatcgg 475

                                                                       
Query: 236 gtgctaagaagatcgtcccaagcagctgccgtgctatgattggtcaggttgctggtggtg 295
           || | |||||||| ||||||||  | ||| | ||||||||||| || |||||||| ||||
Sbjct: 476 gttcgaagaagattgtcccaagtggatgcagggctatgattggacaagttgctggaggtg 535

                                                                       
Query: 296 gcaggactgagaagccaatgctgaaggctggtaacgcctaccacaagtaccgtgtgaaga 355
           | || ||||||||||| ||||| ||||| || ||||| ||||||||||||||||||||||
Sbjct: 536 gaagaactgagaagccgatgctcaaggcaggaaacgcgtaccacaagtaccgtgtgaaga 595

                                                               
Query: 356 ggaactcctggcctaaggtgcgtggtgtggccatgaaccctgttgagcatcc 407
           || |||| ||||||||||| |||| |||||| ||||| || || ||||||||
Sbjct: 596 ggcactcatggcctaaggttcgtgttgtggctatgaatccagtggagcatcc 647



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 6   gtcgccgccgngggtatgtacaccggccagttcgtctactgcgg 49
           ||||||||||  |||||||||||||| |||||| | ||||||||
Sbjct: 247 gtcgccgccgtaggtatgtacaccggtcagttcttgtactgcgg 290



to top

>gb|AC006201.4| Arabidopsis thaliana chromosome 2 clone T27K22 map c245, complete
             sequence
          Length = 88149

 Score =  157 bits (79), Expect = 3e-35
 Identities = 145/167 (86%)
 Strand = Plus / Minus

                                                                         
Query: 241   aagaagatcgtcccaagcagctgccgtgctatgattggtcaggttgctggtggtggcagg 300
             |||||||| ||||||||  | ||| | ||||||||||| || |||||||| ||||| || 
Sbjct: 38043 aagaagattgtcccaagtggatgcagggctatgattggacaagttgctggaggtggaaga 37984

                                                                         
Query: 301   actgagaagccaatgctgaaggctggtaacgcctaccacaagtaccgtgtgaagaggaac 360
             ||||||||||| ||||| ||||| || ||||| |||||||||||||||||||||||||||
Sbjct: 37983 actgagaagccgatgctcaaggcaggaaacgcgtaccacaagtaccgtgtgaagaggaac 37924

                                                            
Query: 361   tcctggcctaaggtgcgtggtgtggccatgaaccctgttgagcatcc 407
             || ||||||||||| ||||||||||| ||||| || || ||||||||
Sbjct: 37923 tcatggcctaaggttcgtggtgtggctatgaatccagtggagcatcc 37877



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 58/67 (86%)
 Strand = Plus / Minus

                                                                         
Query: 116   tctgcaacgtcgagcaccacgtcggcgaccgtggtgtcttcgccagggcctccggtgact 175
             |||||||||||||||| |||||||| || ||||||||| |||| || || || ||||| |
Sbjct: 38401 tctgcaacgtcgagcatcacgtcggtgatcgtggtgtcctcgctagagcttctggtgatt 38342

                    
Query: 176   acgccat 182
             |||||||
Sbjct: 38341 acgccat 38335



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                         
Query: 6     gtcgccgccgngggtatgtacaccggccagttcgtctactgcgg 49
             ||||||||||  |||||||||||||| |||||| | ||||||||
Sbjct: 38510 gtcgccgccgaaggtatgtacaccggtcagttcttgtactgcgg 38467



to top

>emb|X64562.1|LERPL2MR L.esculentum mRNA for ribosomal protein L2
          Length = 816

 Score =  153 bits (77), Expect = 5e-34
 Identities = 128/145 (88%)
 Strand = Plus / Plus

                                                                       
Query: 265 cgtgctatgattggtcaggttgctggtggtggcaggactgagaagccaatgctgaaggct 324
           ||||||||||||||||||||||||||||| ||  | |||||||| |||||||| || |||
Sbjct: 492 cgtgctatgattggtcaggttgctggtggagggcgtactgagaaaccaatgcttaaagct 551

                                                                       
Query: 325 ggtaacgcctaccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtg 384
           ||||| || ||||| |||||||||||||||||||||| |||||||||||| |||||||| 
Sbjct: 552 ggtaatgcttaccataagtaccgtgtgaagaggaactgctggcctaaggttcgtggtgtt 611

                                    
Query: 385 gccatgaaccctgttgagcatcccc 409
           || ||||| || || ||||||||||
Sbjct: 612 gctatgaatccagtggagcatcccc 636



to top

>gb|DQ252497.1| Solanum tuberosum clone 068C11 ribosomal protein L2-like mRNA,
           complete cds
          Length = 899

 Score =  153 bits (77), Expect = 5e-34
 Identities = 128/145 (88%)
 Strand = Plus / Plus

                                                                       
Query: 265 cgtgctatgattggtcaggttgctggtggtggcaggactgagaagccaatgctgaaggct 324
           ||||||||||||||||||||||||||||| ||  | |||||||| |||||||| || |||
Sbjct: 538 cgtgctatgattggtcaggttgctggtggaggacgtactgagaaaccaatgcttaaagct 597

                                                                       
Query: 325 ggtaacgcctaccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtg 384
           ||||| || ||||| |||||||||||||||||||||| |||||||||||| |||||||| 
Sbjct: 598 ggtaatgcttaccataagtaccgtgtgaagaggaactgctggcctaaggttcgtggtgtt 657

                                    
Query: 385 gccatgaaccctgttgagcatcccc 409
           || ||||| || || ||||||||||
Sbjct: 658 gctatgaatcccgtggagcatcccc 682



to top

>emb|X62500.1|NTRL2RNA N.tabacum RL2 mRNA for 60S ribosomal protein L2
          Length = 917

 Score =  147 bits (74), Expect = 3e-32
 Identities = 218/266 (81%)
 Strand = Plus / Plus

                                                                       
Query: 142 gaccgtggtgtcttcgccagggcctccggtgactacgccatcgtcatcagccacaacccc 201
           ||||||||||| || ||||||  ||| ||||  || || || ||||| || |||||||||
Sbjct: 371 gaccgtggtgtttttgccaggtgctctggtgcttatgctattgtcattagtcacaacccc 430

                                                                       
Query: 202 gacaacggcacctcaaggatcaagctaccctctggtgctaagaagatcgtcccaagcagc 261
           || ||||| ||| | ||||| ||||| || || ||  | |||||||| ||||| ||  | 
Sbjct: 431 gataacggaaccaccaggattaagctgccttcaggatccaagaagattgtccccagtggg 490

                                                                       
Query: 262 tgccgtgctatgattggtcaggttgctggtggtggcaggactgagaagccaatgctgaag 321
           || |||  |||||||||||| |||||||| || ||  | |||||||| |||||||| |||
Sbjct: 491 tgtcgtcgtatgattggtcaagttgctggaggaggacgtactgagaaaccaatgcttaag 550

                                                                       
Query: 322 gctggtaacgcctaccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggt 381
           || |||||||| |||||||||||||| || |||||||||| |||||| ||||| ||||||
Sbjct: 551 gccggtaacgcataccacaagtaccgggtaaagaggaactgctggcccaaggttcgtggt 610

                                     
Query: 382 gtggccatgaaccctgttgagcatcc 407
           || |||||||||||||| ||||||||
Sbjct: 611 gttgccatgaaccctgtggagcatcc 636



 Score = 44.1 bits (22), Expect = 0.35
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 17  gggtatgtacaccggccagttcgtctactg 46
           |||||||||||| ||||||||||| |||||
Sbjct: 247 gggtatgtacactggccagttcgtttactg 276



to top

>gb|BT013866.1| Lycopersicon esculentum clone 132846R, mRNA sequence
          Length = 983

 Score =  145 bits (73), Expect = 1e-31
 Identities = 121/137 (88%)
 Strand = Plus / Plus

                                                                       
Query: 271 atgattggtcaggttgctggtggtggcaggactgagaagccaatgctgaaggctggtaac 330
           ||||||||||||||||||||||| || || |||||||| |||||||| || |||||||||
Sbjct: 511 atgattggtcaggttgctggtggaggaagaactgagaaaccaatgcttaaagctggtaac 570

                                                                       
Query: 331 gcctaccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatg 390
           || |||||||| ||||| || |||||||||| |||||||||||| |||||||| || |||
Sbjct: 571 gcataccacaaataccgcgttaagaggaactgctggcctaaggttcgtggtgttgctatg 630

                            
Query: 391 aaccctgttgagcatcc 407
           || ||||| ||||||||
Sbjct: 631 aatcctgtggagcatcc 647



to top

>gb|AC135311.13| Medicago truncatula clone mth2-27l9, complete sequence
          Length = 112635

 Score =  145 bits (73), Expect = 1e-31
 Identities = 163/193 (84%)
 Strand = Plus / Minus

                                                                          
Query: 217    aggatcaagctaccctctggtgctaagaagatcgtcccaagcagctgccgtgctatgatt 276
              ||||||||||| || |||||||| |||||||| || |||||    ||| | || ||||||
Sbjct: 107316 aggatcaagcttccatctggtgcaaagaagattgttccaagtgattgcagggccatgatt 107257

                                                                          
Query: 277    ggtcaggttgctggtggtggcaggactgagaagccaatgctgaaggctggtaacgcctac 336
              || || |||||||||||||| || || |||||||||||| ||||||||||||| || |||
Sbjct: 107256 gggcaagttgctggtggtggaagaaccgagaagccaatgttgaaggctggtaatgcttac 107197

                                                                          
Query: 337    cacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaaccct 396
              ||||||| | | |||||||| |||| |||||||||||| |||||||| || ||||| || 
Sbjct: 107196 cacaagttcagagtgaagagaaactgctggcctaaggttcgtggtgttgctatgaatcca 107137

                           
Query: 397    gttgagcatcccc 409
              |||||||||||||
Sbjct: 107136 gttgagcatcccc 107124



to top

>emb|BX827983.1|CNS0A32V Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH41ZD03 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 965

 Score =  143 bits (72), Expect = 5e-31
 Identities = 123/139 (88%), Gaps = 2/139 (1%)
 Strand = Plus / Plus

                                                                       
Query: 271 atgattggtcaggttgctggtggtggcaggactgagaagccaatgctgaaggctggtaac 330
           ||||||||||| ||||| |||||||| || || |||||||| ||||| ||||||||||||
Sbjct: 526 atgattggtcaagttgcaggtggtggaagaacagagaagccgatgctcaaggctggtaac 585

                                                                       
Query: 331 gcctaccacaagtacc--gtgtgaagaggaactcctggcctaaggtgcgtggtgtggcca 388
           || |||||||||||||  |||||||||| |||| |||||||||||| ||||||||||| |
Sbjct: 586 gcataccacaagtacccggtgtgaagagaaactgctggcctaaggttcgtggtgtggcta 645

                              
Query: 389 tgaaccctgttgagcatcc 407
           |||| || |||||||||||
Sbjct: 646 tgaatccagttgagcatcc 664



to top

>gb|DQ316258.1| Litopenaeus vannamei ribosomal protein L8 mRNA, complete cds
          Length = 871

 Score =  127 bits (64), Expect = 3e-26
 Identities = 124/144 (86%)
 Strand = Plus / Plus

                                                                       
Query: 264 ccgtgctatgattggtcaggttgctggtggtggcaggactgagaagccaatgctgaaggc 323
           |||||| |||||||||   ||||||||||||||  | | ||| ||||| || ||||||||
Sbjct: 527 ccgtgccatgattggtattgttgctggtggtggacgtattgacaagcctatcctgaaggc 586

                                                                       
Query: 324 tggtaacgcctaccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgt 383
           ||||   |||||||| |||||  | ||||||||||||| |||||||||||||||||||||
Sbjct: 587 tggtcgtgcctaccataagtatagggtgaagaggaactgctggcctaaggtgcgtggtgt 646

                                   
Query: 384 ggccatgaaccctgttgagcatcc 407
           ||||||||||||||| ||||||||
Sbjct: 647 ggccatgaaccctgtagagcatcc 670



to top

>gb|AF098520.1|AF098520 Drosophila melanogaster ribosomal protein L8 (rpL8) gene, complete
            cds
          Length = 1718

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 70/79 (88%)
 Strand = Plus / Plus

                                                                        
Query: 331  gcctaccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatg 390
            |||||||||||||||   |||||| | |||  ||||||||||||||||||||||||||||
Sbjct: 1331 gcctaccacaagtacaaggtgaagcgcaacagctggcctaaggtgcgtggtgtggccatg 1390

                               
Query: 391  aaccctgttgagcatcccc 409
            ||||| || ||||||||||
Sbjct: 1391 aaccccgtggagcatcccc 1409



 Score = 48.1 bits (24), Expect = 0.022
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                       
Query: 7    tcgccgccgngggtatgtacaccggccagttcgtctactgcgg 49
            ||||| ||| ||| ||| |||||||||||||||| ||||||||
Sbjct: 1008 tcgcccccgagggcatgcacaccggccagttcgtgtactgcgg 1050



to top

>gb|BT014913.1| Drosophila melanogaster RH21963 full insert cDNA
          Length = 2439

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 68/77 (88%)
 Strand = Plus / Plus

                                                                        
Query: 331  gcctaccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatg 390
            |||||||||||||||   |||||| | |||  ||||||||||||||||||||||||||||
Sbjct: 2044 gcctaccacaagtacaaggtgaagcgcaacagctggcctaaggtgcgtggtgtggccatg 2103

                             
Query: 391  aaccctgttgagcatcc 407
            ||||| || ||||||||
Sbjct: 2104 aaccccgtggagcatcc 2120



 Score = 48.1 bits (24), Expect = 0.022
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                       
Query: 7    tcgccgccgngggtatgtacaccggccagttcgtctactgcgg 49
            ||||| ||| ||| ||| |||||||||||||||| ||||||||
Sbjct: 1721 tcgcccccgagggcatgcacaccggccagttcgtgtactgcgg 1763



to top

>gb|AY485337.1| Mamestra brassicae ribosomal protein L8 (rpl8) mRNA, complete cds
          Length = 877

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 86/101 (85%)
 Strand = Plus / Plus

                                                                       
Query: 307 aagccaatgctgaaggctggtaacgcctaccacaagtaccgtgtgaagaggaactcctgg 366
           ||||| || ||||||||||||  ||| ||||||||||||   || ||| | |||| ||||
Sbjct: 570 aagcccatcctgaaggctggtcgcgcataccacaagtacaaagtcaagcgaaactgctgg 629

                                                    
Query: 367 cctaaggtgcgtggtgtggccatgaaccctgttgagcatcc 407
           ||  | |||||||||||||||||||||||||||||||||||
Sbjct: 630 ccatatgtgcgtggtgtggccatgaaccctgttgagcatcc 670



 Score = 40.1 bits (20), Expect = 5.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 22  tgtacaccggccagttcgtctactgcgg 49
           ||||||| |||||||| |||||||||||
Sbjct: 286 tgtacactggccagtttgtctactgcgg 313



to top

>gb|AC011905.4| Drosophila melanogaster 3L BAC RP98-27A3 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 192681

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 68/77 (88%)
 Strand = Plus / Plus

                                                                          
Query: 331    gcctaccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatg 390
              |||||||||||||||   |||||| | |||  ||||||||||||||||||||||||||||
Sbjct: 127237 gcctaccacaagtacaaggtgaagcgcaacagctggcctaaggtgcgtggtgtggccatg 127296

                               
Query: 391    aaccctgttgagcatcc 407
              ||||| || ||||||||
Sbjct: 127297 aaccccgtggagcatcc 127313



 Score = 48.1 bits (24), Expect = 0.022
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                         
Query: 7      tcgccgccgngggtatgtacaccggccagttcgtctactgcgg 49
              ||||| ||| ||| ||| |||||||||||||||| ||||||||
Sbjct: 126914 tcgcccccgagggcatgcacaccggccagttcgtgtactgcgg 126956



to top

>ref|NM_167955.1| Drosophila melanogaster Ribosomal protein L8 CG1263-RB, transcript
           variant B (RpL8), mRNA
          Length = 1264

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 68/77 (88%)
 Strand = Plus / Plus

                                                                       
Query: 331 gcctaccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatg 390
           |||||||||||||||   |||||| | |||  ||||||||||||||||||||||||||||
Sbjct: 765 gcctaccacaagtacaaggtgaagcgcaacagctggcctaaggtgcgtggtgtggccatg 824

                            
Query: 391 aaccctgttgagcatcc 407
           ||||| || ||||||||
Sbjct: 825 aaccccgtggagcatcc 841



 Score = 48.1 bits (24), Expect = 0.022
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactgcgg 49
           ||||| ||| ||| ||| |||||||||||||||| ||||||||
Sbjct: 442 tcgcccccgagggcatgcacaccggccagttcgtgtactgcgg 484



to top

>ref|NM_079987.2| Drosophila melanogaster Ribosomal protein L8 CG1263-RA, transcript
           variant A (RpL8), mRNA
          Length = 1118

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 68/77 (88%)
 Strand = Plus / Plus

                                                                       
Query: 331 gcctaccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatg 390
           |||||||||||||||   |||||| | |||  ||||||||||||||||||||||||||||
Sbjct: 619 gcctaccacaagtacaaggtgaagcgcaacagctggcctaaggtgcgtggtgtggccatg 678

                            
Query: 391 aaccctgttgagcatcc 407
           ||||| || ||||||||
Sbjct: 679 aaccccgtggagcatcc 695



 Score = 48.1 bits (24), Expect = 0.022
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactgcgg 49
           ||||| ||| ||| ||| |||||||||||||||| ||||||||
Sbjct: 296 tcgcccccgagggcatgcacaccggccagttcgtgtactgcgg 338



to top

>gb|AY071342.1| Drosophila melanogaster RE37829 full length cDNA
          Length = 1019

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 68/77 (88%)
 Strand = Plus / Plus

                                                                       
Query: 331 gcctaccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatg 390
           |||||||||||||||   |||||| | |||  ||||||||||||||||||||||||||||
Sbjct: 617 gcctaccacaagtacaaggtgaagcgcaacagctggcctaaggtgcgtggtgtggccatg 676

                            
Query: 391 aaccctgttgagcatcc 407
           ||||| || ||||||||
Sbjct: 677 aaccccgtggagcatcc 693



 Score = 48.1 bits (24), Expect = 0.022
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactgcgg 49
           ||||| ||| ||| ||| |||||||||||||||| ||||||||
Sbjct: 294 tcgcccccgagggcatgcacaccggccagttcgtgtactgcgg 336



to top

>gb|BT022891.1| Drosophila melanogaster IP12501 full insert cDNA
          Length = 1776

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 68/77 (88%)
 Strand = Plus / Plus

                                                                       
Query: 331 gcctaccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatg 390
           |||||||||||||||   |||||| | |||  ||||||||||||||||||||||||||||
Sbjct: 420 gcctaccacaagtacaaggtgaagcgcaacagctggcctaaggtgcgtggtgtggccatg 479

                            
Query: 391 aaccctgttgagcatcc 407
           ||||| || ||||||||
Sbjct: 480 aaccccgtggagcatcc 496



 Score = 48.1 bits (24), Expect = 0.022
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactgcgg 49
           ||||| ||| ||| ||| |||||||||||||||| ||||||||
Sbjct: 97  tcgcccccgagggcatgcacaccggccagttcgtgtactgcgg 139



to top

>gb|AE003475.4| Drosophila melanogaster chromosome 3L, section 9 of 83 of the complete
              sequence
          Length = 301691

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 68/77 (88%)
 Strand = Plus / Plus

                                                                          
Query: 331    gcctaccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatg 390
              |||||||||||||||   |||||| | |||  ||||||||||||||||||||||||||||
Sbjct: 123609 gcctaccacaagtacaaggtgaagcgcaacagctggcctaaggtgcgtggtgtggccatg 123668

                               
Query: 391    aaccctgttgagcatcc 407
              ||||| || ||||||||
Sbjct: 123669 aaccccgtggagcatcc 123685



 Score = 48.1 bits (24), Expect = 0.022
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                         
Query: 7      tcgccgccgngggtatgtacaccggccagttcgtctactgcgg 49
              ||||| ||| ||| ||| |||||||||||||||| ||||||||
Sbjct: 123286 tcgcccccgagggcatgcacaccggccagttcgtgtactgcgg 123328



to top

>gb|DQ440262.1| Aedes aegypti clone AET-322 60S ribosomal protein L2/L8 mRNA,
           complete cds
          Length = 786

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 87/103 (84%)
 Strand = Plus / Plus

                                                                       
Query: 307 aagccaatgctgaaggctggtaacgcctaccacaagtaccgtgtgaagaggaactcctgg 366
           ||||| || ||||||||||||   |||||||||||||||   |||||| | |||| ||||
Sbjct: 529 aagcctatcctgaaggctggtcgtgcctaccacaagtacaaggtgaagcgtaactgctgg 588

                                                      
Query: 367 cctaaggtgcgtggtgtggccatgaaccctgttgagcatcccc 409
           || ||||| |||||||| || |||||||| |||||||||||||
Sbjct: 589 ccaaaggtacgtggtgttgctatgaaccccgttgagcatcccc 631



 Score = 44.1 bits (22), Expect = 0.35
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 9   gccgccgngggtatgtacaccggccagttcgtctactgcgg 49
           |||||||  |||||||||||||| ||||| || ||||||||
Sbjct: 232 gccgccgaaggtatgtacaccggacagtttgtgtactgcgg 272



to top

>emb|CR938631.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA1YD12AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 724

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 87/103 (84%)
 Strand = Plus / Plus

                                                                       
Query: 307 aagccaatgctgaaggctggtaacgcctaccacaagtaccgtgtgaagaggaactcctgg 366
           ||||| || ||||||||||||   |||||||||||||||   |||||| | |||| ||||
Sbjct: 608 aagcctatcctgaaggctggtcgtgcctaccacaagtacaaggtgaagcgtaactgctgg 667

                                                      
Query: 367 cctaaggtgcgtggtgtggccatgaaccctgttgagcatcccc 409
           || ||||| |||||||| || |||||||| |||||||||||||
Sbjct: 668 ccaaaggtacgtggtgttgctatgaaccccgttgagcatcccc 710



 Score = 44.1 bits (22), Expect = 0.35
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 9   gccgccgngggtatgtacaccggccagttcgtctactgcgg 49
           |||||||  |||||||||||||| ||||| || ||||||||
Sbjct: 311 gccgccgaaggtatgtacaccggacagtttgtgtactgcgg 351



to top

>emb|CR938630.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 3-prime end of clone
           KW0AAA1YD12BBM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 701

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 87/103 (84%)
 Strand = Plus / Minus

                                                                       
Query: 307 aagccaatgctgaaggctggtaacgcctaccacaagtaccgtgtgaagaggaactcctgg 366
           ||||| || ||||||||||||   |||||||||||||||   |||||| | |||| ||||
Sbjct: 447 aagcctatcctgaaggctggtcgtgcctaccacaagtacaaggtgaagcgtaactgctgg 388

                                                      
Query: 367 cctaaggtgcgtggtgtggccatgaaccctgttgagcatcccc 409
           || ||||| |||||||| || |||||||| |||||||||||||
Sbjct: 387 ccaaaggtacgtggtgttgctatgaaccccgttgagcatcccc 345



to top

>emb|CR938124.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YJ17AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 817

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 87/103 (84%)
 Strand = Plus / Plus

                                                                       
Query: 307 aagccaatgctgaaggctggtaacgcctaccacaagtaccgtgtgaagaggaactcctgg 366
           ||||| || ||||||||||||   |||||||||||||||   |||||| | |||| ||||
Sbjct: 610 aagcctatcctgaaggctggtcgtgcctaccacaagtacaaggtgaagcgtaactgctgg 669

                                                      
Query: 367 cctaaggtgcgtggtgtggccatgaaccctgttgagcatcccc 409
           || ||||| |||||||| || |||||||| |||||||||||||
Sbjct: 670 ccaaaggtacgtggtgttgctatgaaccccgttgagcatcccc 712



 Score = 44.1 bits (22), Expect = 0.35
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 9   gccgccgngggtatgtacaccggccagttcgtctactgcgg 49
           |||||||  |||||||||||||| ||||| || ||||||||
Sbjct: 313 gccgccgaaggtatgtacaccggacagtttgtgtactgcgg 353



to top

>gb|M99055.1|MQSRPL8X Mosquito ribosomal protein L8 (rpL8) gene exons 1-3, complete cds
          Length = 2231

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 87/103 (84%)
 Strand = Plus / Plus

                                                                        
Query: 307  aagccaatgctgaaggctggtaacgcctaccacaagtaccgtgtgaagaggaactcctgg 366
            |||||||| |||||||| |||   ||||||| |||||||   |||||| | |||| ||||
Sbjct: 1813 aagccaatcctgaaggccggtcgtgcctaccgcaagtacaaggtgaagcgtaactgctgg 1872

                                                       
Query: 367  cctaaggtgcgtggtgtggccatgaaccctgttgagcatcccc 409
            || ||||| ||||||||||| |||||||| |||||||||||||
Sbjct: 1873 ccaaaggtacgtggtgtggctatgaaccccgttgagcatcccc 1915



 Score = 48.1 bits (24), Expect = 0.022
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                       
Query: 7    tcgccgccgngggtatgtacaccggccagttcgtctactgcgg 49
            |||||||||  |||||||||||||| ||||| || ||||||||
Sbjct: 1514 tcgccgccgaaggtatgtacaccggacagtttgtgtactgcgg 1556



to top

>emb|CR937651.1| Single read from an extremity of a cDNA clone made from Aedes
           aegypti total adult females. 5-prime end of clone
           KW0AAB1YJ18AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 765

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 80/94 (85%)
 Strand = Plus / Plus

                                                                       
Query: 316 ctgaaggctggtaacgcctaccacaagtaccgtgtgaagaggaactcctggcctaaggtg 375
           ||||||||||||   |||||||||||||||   |||||| | |||| |||||| ||||| 
Sbjct: 621 ctgaaggctggtcgtgcctaccacaagtacaaggtgaagcgtaactgctggccaaaggta 680

                                             
Query: 376 cgtggtgtggccatgaaccctgttgagcatcccc 409
           |||||||| || |||||||| |||||||||||||
Sbjct: 681 cgtggtgttgctatgaaccccgttgagcatcccc 714



 Score = 44.1 bits (22), Expect = 0.35
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 9   gccgccgngggtatgtacaccggccagttcgtctactgcgg 49
           |||||||  |||||||||||||| ||||| || ||||||||
Sbjct: 315 gccgccgaaggtatgtacaccggacagtttgtgtactgcgg 355



to top

>emb|CR937650.1| Single read from an extremity of a cDNA clone made from Aedes
           aegypti total adult females. 3-prime end of clone
           KW0AAB1YJ18BBM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 616

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 80/94 (85%)
 Strand = Plus / Minus

                                                                       
Query: 316 ctgaaggctggtaacgcctaccacaagtaccgtgtgaagaggaactcctggcctaaggtg 375
           ||||||||||||   |||||||||||||||   |||||| | |||| |||||| ||||| 
Sbjct: 437 ctgaaggctggtcgtgcctaccacaagtacaaggtgaagcgtaactgctggccaaaggta 378

                                             
Query: 376 cgtggtgtggccatgaaccctgttgagcatcccc 409
           |||||||| || |||||||| |||||||||||||
Sbjct: 377 cgtggtgttgctatgaaccccgttgagcatcccc 344



to top

>gb|AF526214.1| Argopecten irradians isolate iolsaicl63ct83cn90 ribosomal protein L
           mRNA, complete cds
          Length = 866

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 103/125 (82%)
 Strand = Plus / Plus

                                                                       
Query: 283 gttgctggtggtggcaggactgagaagccaatgctgaaggctggtaacgcctaccacaag 342
           |||||||| ||||| ||||  || ||||| |||||||||||||||   || |||  ||||
Sbjct: 539 gttgctggaggtggaaggatagacaagcccatgctgaaggctggtcgtgcttacttcaag 598

                                                                       
Query: 343 taccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaaccctgttgag 402
           |||   || |||||||||| ||||||||| || ||||||||||| |||||||| ||||| 
Sbjct: 599 tacaaggtcaagaggaactgctggcctaaagttcgtggtgtggctatgaacccagttgaa 658

                
Query: 403 catcc 407
           |||||
Sbjct: 659 catcc 663



to top

>emb|CT033188.1| Platynereis dumerilii EST IB0AAA25AH04EM1
          Length = 878

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 48/52 (92%)
 Strand = Plus / Plus

                                                               
Query: 358 aactcctggcctaaggtgcgtggtgtggccatgaaccctgttgagcatcccc 409
           |||| |||||| ||||||||||||||||| |||||||| |||||||||||||
Sbjct: 625 aactgctggcccaaggtgcgtggtgtggctatgaaccccgttgagcatcccc 676



to top

>emb|CT033187.1| Platynereis dumerilii EST IB0AAA25AH04FM1
          Length = 823

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 48/52 (92%)
 Strand = Plus / Minus

                                                               
Query: 358 aactcctggcctaaggtgcgtggtgtggccatgaaccctgttgagcatcccc 409
           |||| |||||| ||||||||||||||||| |||||||| |||||||||||||
Sbjct: 254 aactgctggcccaaggtgcgtggtgtggctatgaaccccgttgagcatcccc 203



to top

>gb|AY432072.1| Aedes aegypti ASAP ID: 34485 cytosolic large ribosomal subunit L8
           mRNA sequence
          Length = 1079

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 68/79 (86%)
 Strand = Plus / Plus

                                                                       
Query: 331 gcctaccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatg 390
           |||||||||||||||   |||||| | |||| |||||| ||||| |||||||| || |||
Sbjct: 645 gcctaccacaagtacaaggtgaagcgtaactgctggccaaaggtacgtggtgttgctatg 704

                              
Query: 391 aaccctgttgagcatcccc 409
           ||||| |||||||||||||
Sbjct: 705 aaccccgttgagcatcccc 723



to top

>ref|XM_582676.2| PREDICTED: Bos taurus similar to 60S ribosomal protein L8
           (LOC506251), mRNA
          Length = 833

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 101/123 (82%)
 Strand = Plus / Plus

                                                                       
Query: 286 gctggtggtggcaggactgagaagccaatgctgaaggctggtaacgcctaccacaagtac 345
           ||||| |||||| | | ||| ||||| || |||||||||||  | |||||||||||||| 
Sbjct: 537 gctggaggtggctgcattgacaagcccattctgaaggctggccatgcctaccacaagtat 596

                                                                       
Query: 346 cgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaaccctgttgagcat 405
              |  |||||||||| ||||||   |||||| |||||||||||||||||||| ||||||
Sbjct: 597 aaggcaaagaggaactgctggccactggtgcggggtgtggccatgaaccctgtcgagcat 656

              
Query: 406 ccc 408
           |||
Sbjct: 657 ccc 659



to top

>gb|AY128671.1| Drosophila virilis daughter of sevenless (dos) gene, complete cds
          Length = 8311

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 44/47 (93%)
 Strand = Plus / Plus

                                                          
Query: 363 ctggcctaaggtgcgtggtgtggccatgaaccctgttgagcatcccc 409
           |||||| |||||||||||||| |||||||||||||| ||||||||||
Sbjct: 223 ctggcccaaggtgcgtggtgttgccatgaaccctgtggagcatcccc 269



to top

>emb|CR938453.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA1YN07AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 735

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 68/79 (86%)
 Strand = Plus / Plus

                                                                       
Query: 331 gcctaccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatg 390
           |||||||||||||||   |||||| | |||| |||||| ||||| |||||||| || |||
Sbjct: 646 gcctaccacaagtacaaggtgaagcgtaactgctggccaaaggtacgtggtgttgctatg 705

                              
Query: 391 aaccctgttgagcatcccc 409
           ||||| |||||||||||||
Sbjct: 706 aaccccgttgagcatcccc 724



 Score = 44.1 bits (22), Expect = 0.35
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 9   gccgccgngggtatgtacaccggccagttcgtctactgcgg 49
           |||||||  |||||||||||||| ||||| || ||||||||
Sbjct: 325 gccgccgaaggtatgtacaccggacagtttgtgtactgcgg 365



to top

>emb|CR937938.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YP16AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 816

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 86/103 (83%)
 Strand = Plus / Plus

                                                                       
Query: 307 aagccaatgctgaaggctggtaacgcctaccacaagtaccgtgtgaagaggaactcctgg 366
           ||||| || ||||||||||||   |||||||||||||||   |||||| | |||| ||||
Sbjct: 613 aagcctatcctgaaggctggtcgtgcctaccacaagtacaaggtgaagcgtaactgctgg 672

                                                      
Query: 367 cctaaggtgcgtggtgtggccatgaaccctgttgagcatcccc 409
           || ||||| ||||| || || |||||||| |||||||||||||
Sbjct: 673 ccaaaggtacgtggcgttgctatgaaccccgttgagcatcccc 715



 Score = 44.1 bits (22), Expect = 0.35
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 9   gccgccgngggtatgtacaccggccagttcgtctactgcgg 49
           |||||||  |||||||||||||| ||||| || ||||||||
Sbjct: 316 gccgccgaaggtatgtacaccggacagtttgtgtactgcgg 356



to top

>gb|AY943311.1| Wyeomyia smithii ribosomal protein L8 mRNA, partial cds
          Length = 331

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 86/103 (83%)
 Strand = Plus / Plus

                                                                       
Query: 307 aagccaatgctgaaggctggtaacgcctaccacaagtaccgtgtgaagaggaactcctgg 366
           |||||||| |||| |||||||   || ||||||||||||   |||||| | |||| ||||
Sbjct: 41  aagccaattctgagggctggtcgtgcataccacaagtacaaggtgaagcgtaactgctgg 100

                                                      
Query: 367 cctaaggtgcgtggtgtggccatgaaccctgttgagcatcccc 409
           || || ||||||||||| || |||||||| |||||||||||||
Sbjct: 101 ccgaaagtgcgtggtgttgctatgaaccccgttgagcatcccc 143



to top

>ref|XM_447807.1| Candida glabrata CBS138, CAGL0J02354g partial mRNA
          Length = 765

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 97/118 (82%)
 Strand = Plus / Plus

                                                                       
Query: 284 ttgctggtggtggcaggactgagaagccaatgctgaaggctggtaacgcctaccacaagt 343
           ||||||||||||| || ||||| |||||| || |||||||||||   || | ||||||||
Sbjct: 506 ttgctggtggtggtagaactgacaagccattgttgaaggctggtcgtgctttccacaagt 565

                                                                     
Query: 344 accgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaaccctgttga 401
           ||    ||||||| ||||| ||||| |||   |||||||| |||||||||||||||||
Sbjct: 566 acaagttgaagagaaactcttggccaaagacccgtggtgttgccatgaaccctgttga 623



to top

>emb|AM049012.1| Timarcha balearica partial mRNA for ribosomal protein L8e (rpL8e
           gene)
          Length = 755

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 358 aactcctggcctaaggtgcgtggtgtggccatgaaccctgttgagcatcc 407
           |||| |||||||||||| |||||||| |||||||||||||| ||||||||
Sbjct: 580 aactgctggcctaaggtacgtggtgttgccatgaaccctgtagagcatcc 629



to top

>emb|AM049011.1| Mycetophagus quadripustulatus mRNA for ribosomal protein L8e (rpL8e
           gene)
          Length = 774

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 358 aactcctggcctaaggtgcgtggtgtggccatgaaccctgttgagcatcc 407
           |||| |||||| |||||||||||||| ||||||||||| |||||||||||
Sbjct: 580 aactgctggccaaaggtgcgtggtgttgccatgaaccccgttgagcatcc 629



to top

>emb|CR380956.1| Candida glabrata strain CBS138 chromosome J complete sequence
          Length = 1192501

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 97/118 (82%)
 Strand = Plus / Minus

                                                                          
Query: 284    ttgctggtggtggcaggactgagaagccaatgctgaaggctggtaacgcctaccacaagt 343
              ||||||||||||| || ||||| |||||| || |||||||||||   || | ||||||||
Sbjct: 227918 ttgctggtggtggtagaactgacaagccattgttgaaggctggtcgtgctttccacaagt 227859

                                                                        
Query: 344    accgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaaccctgttga 401
              ||    ||||||| ||||| ||||| |||   |||||||| |||||||||||||||||
Sbjct: 227858 acaagttgaagagaaactcttggccaaagacccgtggtgttgccatgaaccctgttga 227801



to top

>gb|AF164152.1|AF164152 Anopheles gambiae strain M2 ribosomal protein L8 (rpL8) mRNA,
           complete cds
          Length = 937

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 64/74 (86%)
 Strand = Plus / Plus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| ||||||||||||||||| ||||||
Sbjct: 615 taccacaagtacaaggtgaagcgtaactgctggccgaaggtgcgtggtgtggcgatgaac 674

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 675 cccgtcgagcatcc 688



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 9   gccgccgngggtatgtacaccggccagttcgtctactgcgg 49
           |||||||  ||||||||||||||||||||||| ||||||||
Sbjct: 291 gccgccgaaggtatgtacaccggccagttcgtgtactgcgg 331



to top

>gb|DQ206473.1| Platynereis dumerilii isolate TOA23 ribosomal protein 8 large
           subunit mRNA, partial cds
          Length = 385

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 358 aactcctggcctaaggtgcgtggtgtggccatgaaccctgttgagcatcc 407
           |||| |||||| ||||||||||||||||| |||||||| |||||||||||
Sbjct: 328 aactgctggcccaaggtgcgtggtgtggctatgaaccccgttgagcatcc 377



to top

>emb|CT033650.1| Platynereis dumerilii EST IB0AAA16CH07EM1
          Length = 867

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 358 aactcctggcctaaggtgcgtggtgtggccatgaaccctgttgagcatcc 407
           |||| |||||| ||||||||||||||||| |||||||| |||||||||||
Sbjct: 614 aactgctggcccaaggtgcgtggtgtggctatgaaccccgttgagcatcc 663



to top

>emb|CT033649.1| Platynereis dumerilii EST IB0AAA16CH07FM1
          Length = 744

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 358 aactcctggcctaaggtgcgtggtgtggccatgaaccctgttgagcatcc 407
           |||| |||||| ||||||||||||||||| |||||||| |||||||||||
Sbjct: 254 aactgctggcccaaggtgcgtggtgtggctatgaaccccgttgagcatcc 205



to top

>emb|CT033621.1| Platynereis dumerilii EST IB0AAA17BB03EM1
          Length = 884

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 358 aactcctggcctaaggtgcgtggtgtggccatgaaccctgttgagcatcc 407
           |||| |||||| ||||||||||||||||| |||||||| |||||||||||
Sbjct: 616 aactgctggcccaaggtgcgtggtgtggctatgaaccccgttgagcatcc 665



to top

>emb|CT033394.1| Platynereis dumerilii EST IB0AAA21BA08EM1
          Length = 883

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 358 aactcctggcctaaggtgcgtggtgtggccatgaaccctgttgagcatcc 407
           |||| |||||| ||||||||||||||||| |||||||| |||||||||||
Sbjct: 630 aactgctggcccaaggtgcgtggtgtggctatgaaccccgttgagcatcc 679



to top

>emb|CT033393.1| Platynereis dumerilii EST IB0AAA21BA08FM1
          Length = 814

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 358 aactcctggcctaaggtgcgtggtgtggccatgaaccctgttgagcatcc 407
           |||| |||||| ||||||||||||||||| |||||||| |||||||||||
Sbjct: 255 aactgctggcccaaggtgcgtggtgtggctatgaaccccgttgagcatcc 206



to top

>emb|CT033017.1| Platynereis dumerilii EST IB0AAA27DH06EM1
          Length = 868

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 358 aactcctggcctaaggtgcgtggtgtggccatgaaccctgttgagcatcc 407
           |||| |||||| ||||||||||||||||| |||||||| |||||||||||
Sbjct: 616 aactgctggcccaaggtgcgtggtgtggctatgaaccccgttgagcatcc 665



to top

>emb|CT033016.1| Platynereis dumerilii EST IB0AAA27DH06FM1
          Length = 826

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 358 aactcctggcctaaggtgcgtggtgtggccatgaaccctgttgagcatcc 407
           |||| |||||| ||||||||||||||||| |||||||| |||||||||||
Sbjct: 254 aactgctggcccaaggtgcgtggtgtggctatgaaccccgttgagcatcc 205



to top

>emb|CT032883.1| Platynereis dumerilii EST IB0AAA30AD02EM1
          Length = 834

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 358 aactcctggcctaaggtgcgtggtgtggccatgaaccctgttgagcatcc 407
           |||| |||||| ||||||||||||||||| |||||||| |||||||||||
Sbjct: 612 aactgctggcccaaggtgcgtggtgtggctatgaaccccgttgagcatcc 661



to top

>emb|CT032882.1| Platynereis dumerilii EST IB0AAA30AD02FM1
          Length = 838

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 358 aactcctggcctaaggtgcgtggtgtggccatgaaccctgttgagcatcc 407
           |||| |||||| ||||||||||||||||| |||||||| |||||||||||
Sbjct: 255 aactgctggcccaaggtgcgtggtgtggctatgaaccccgttgagcatcc 206



to top

>emb|CT032622.1| Platynereis dumerilii EST IB0AAA35AA08FM1
          Length = 834

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 358 aactcctggcctaaggtgcgtggtgtggccatgaaccctgttgagcatcc 407
           |||| |||||| ||||||||||||||||| |||||||| |||||||||||
Sbjct: 268 aactgctggcccaaggtgcgtggtgtggctatgaaccccgttgagcatcc 219



to top

>emb|CT032614.1| Platynereis dumerilii EST IB0AAA35BC06EM1
          Length = 854

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 358 aactcctggcctaaggtgcgtggtgtggccatgaaccctgttgagcatcc 407
           |||| |||||| ||||||||||||||||| |||||||| |||||||||||
Sbjct: 616 aactgctggcccaaggtgcgtggtgtggctatgaaccccgttgagcatcc 665



to top

>emb|CT032322.1| Platynereis dumerilii EST IB0AAA40CH03EM1
          Length = 759

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 358 aactcctggcctaaggtgcgtggtgtggccatgaaccctgttgagcatcc 407
           |||| |||||| ||||||||||||||||| |||||||| |||||||||||
Sbjct: 613 aactgctggcccaaggtgcgtggtgtggctatgaaccccgttgagcatcc 662



to top

>emb|CT032321.1| Platynereis dumerilii EST IB0AAA40CH03FM1
          Length = 475

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 358 aactcctggcctaaggtgcgtggtgtggccatgaaccctgttgagcatcc 407
           ||||||||||| ||||||||||||| ||| |||||||| |||||||||||
Sbjct: 255 aactcctggcccaaggtgcgtggtgaggctatgaaccccgttgagcatcc 206



to top

>emb|CT032290.1| Platynereis dumerilii EST IB0AAA41CE04EM1
          Length = 869

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 358 aactcctggcctaaggtgcgtggtgtggccatgaaccctgttgagcatcc 407
           |||| |||||| ||||||||||||||||| |||||||| |||||||||||
Sbjct: 614 aactgctggcccaaggtgcgtggtgtggctatgaaccccgttgagcatcc 663



to top

>emb|CT032289.1| Platynereis dumerilii EST IB0AAA41CE04FM1
          Length = 844

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 358 aactcctggcctaaggtgcgtggtgtggccatgaaccctgttgagcatcc 407
           |||| |||||| ||||||||||||||||| |||||||| |||||||||||
Sbjct: 255 aactgctggcccaaggtgcgtggtgtggctatgaaccccgttgagcatcc 206



to top

>emb|CT032278.1| Platynereis dumerilii EST IB0AAA41DB03EM1
          Length = 868

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 358 aactcctggcctaaggtgcgtggtgtggccatgaaccctgttgagcatcc 407
           |||| |||||| ||||||||||||||||| |||||||| |||||||||||
Sbjct: 614 aactgctggcccaaggtgcgtggtgtggctatgaaccccgttgagcatcc 663



to top

>emb|CT032277.1| Platynereis dumerilii EST IB0AAA41DB03FM1
          Length = 822

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 358 aactcctggcctaaggtgcgtggtgtggccatgaaccctgttgagcatcc 407
           |||| |||||| ||||||||||||||||| |||||||| |||||||||||
Sbjct: 255 aactgctggcccaaggtgcgtggtgtggctatgaaccccgttgagcatcc 206



to top

>dbj|AU066544.1| Chlamydomonas sp. HS-5 mRNA for 60S ribosomal protein L2,
           NaCl+paraquat inducible, complete cds, clone:M30
          Length = 987

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 106/130 (81%)
 Strand = Plus / Plus

                                                                       
Query: 280 caggttgctggtggtggcaggactgagaagccaatgctgaaggctggtaacgcctaccac 339
           ||||| ||||| || ||| | ||||||||||| ||||||||||||||   | | ||||||
Sbjct: 515 caggtcgctggcggcggccgtactgagaagccgatgctgaaggctggccgctcgtaccac 574

                                                                       
Query: 340 aagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaaccctgtt 399
           ||||||   |  ||| | |||  |||||| |||||||||||||||||||||||||| || 
Sbjct: 575 aagtacaaggccaagcgtaacagctggccgaaggtgcgtggtgtggccatgaaccccgtg 634

                     
Query: 400 gagcatcccc 409
           ||||| ||||
Sbjct: 635 gagcaccccc 644



to top

>gb|AY919670.1| Pimephales promelas 60S ribosomal protein L8 mRNA, partial cds
          Length = 709

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 51/57 (89%)
 Strand = Plus / Plus

                                                                    
Query: 352 aagaggaactcctggcctaaggtgcgtggtgtggccatgaaccctgttgagcatccc 408
           |||||||||| |||||||   || ||||||||||| |||||||||||||||||||||
Sbjct: 536 aagaggaactgctggcctcgtgtccgtggtgtggctatgaaccctgttgagcatccc 592



to top

>gb|BC102277.1| Bos taurus similar to 60S ribosomal protein L8, mRNA (cDNA clone
           MGC:127227 IMAGE:7945641), complete cds
          Length = 932

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 51/57 (89%)
 Strand = Plus / Plus

                                                                    
Query: 352 aagaggaactcctggcctaaggtgcgtggtgtggccatgaaccctgttgagcatccc 408
           |||||||||| ||||||   |||||| |||||||||||||||||||| |||||||||
Sbjct: 609 aagaggaactgctggccacgggtgcggggtgtggccatgaaccctgtcgagcatccc 665



to top

>gb|AF401561.1| Ictalurus punctatus ribosomal protein L8 mRNA, complete cds
          Length = 821

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 51/57 (89%)
 Strand = Plus / Plus

                                                                    
Query: 352 aagaggaactcctggcctaaggtgcgtggtgtggccatgaaccctgttgagcatccc 408
           |||||||||| |||||||   || ||||||||||| |||||||||||||||||||||
Sbjct: 590 aagaggaactgctggcctcgtgtccgtggtgtggctatgaaccctgttgagcatccc 646



to top

>ref|NM_001034625.1| Bos taurus similar to 60S ribosomal protein L8 (MGC127227), mRNA
          Length = 932

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 51/57 (89%)
 Strand = Plus / Plus

                                                                    
Query: 352 aagaggaactcctggcctaaggtgcgtggtgtggccatgaaccctgttgagcatccc 408
           |||||||||| ||||||   |||||| |||||||||||||||||||| |||||||||
Sbjct: 609 aagaggaactgctggccacgggtgcggggtgtggccatgaaccctgtcgagcatccc 665



to top

>emb|AM049010.1| Meladema coriacea partial mRNA for ribosomal protein L8e (rpL8e
           gene)
          Length = 711

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 47/52 (90%)
 Strand = Plus / Plus

                                                               
Query: 358 aactcctggcctaaggtgcgtggtgtggccatgaaccctgttgagcatcccc 409
           |||| |||||| |||||||| |||||||| |||||||| |||||||||||||
Sbjct: 580 aactgctggccaaaggtgcgcggtgtggctatgaaccccgttgagcatcccc 631



 Score = 40.1 bits (20), Expect = 5.5
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                          
Query: 7   tcgccgccgngggtatgtacaccggccagtt 37
           ||||| ||| ||| |||||||||||||||||
Sbjct: 230 tcgcccccgagggcatgtacaccggccagtt 260



to top

>emb|AM049009.1| Georissus sp. APV-2005 mRNA for ribosomal protein L8e (rpL8e gene)
          Length = 774

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 358 aactcctggcctaaggtgcgtggtgtggccatgaaccctgttgagcatcc 407
           |||| ||||||||||||||||||||| ||||||||||| || || |||||
Sbjct: 580 aactgctggcctaaggtgcgtggtgtcgccatgaacccagtsgarcatcc 629



to top

>ref|XM_962890.1| PREDICTED: Tribolium castaneum similar to CG1263-PA, isoform A
           (LOC656352), mRNA
          Length = 886

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 47/52 (90%)
 Strand = Plus / Plus

                                                               
Query: 358 aactcctggcctaaggtgcgtggtgtggccatgaaccctgttgagcatcccc 409
           |||| ||||||||| || |||||||| ||||||||||| |||||||||||||
Sbjct: 605 aactgctggcctaaagtacgtggtgttgccatgaacccagttgagcatcccc 656



to top

>ref|XM_393671.2| PREDICTED: Apis mellifera similar to ribosomal protein L8
           (LOC410188), mRNA
          Length = 843

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 352 aagaggaactcctggcctaaggtgcgtggtgtggccatgaaccctgttgagcatcc 407
           ||||||||||  ||||||||||| |||||||| || |||||||||||||| |||||
Sbjct: 605 aagaggaactgttggcctaaggttcgtggtgttgctatgaaccctgttgaacatcc 660



to top

>gb|AY190734.1| Pagrus major ribosomal protein L8 mRNA, partial cds
          Length = 688

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 103/127 (81%)
 Strand = Plus / Plus

                                                                       
Query: 282 ggttgctggtggtggcaggactgagaagccaatgctgaaggctggtaacgcctaccacaa 341
           ||||||||| |||||  | | ||| ||||| || || |||||||||   |||||||||||
Sbjct: 531 ggttgctggaggtggtcgtattgacaagcccatcctaaaggctggtcgtgcctaccacaa 590

                                                                       
Query: 342 gtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaaccctgttga 401
           ||||   |  |||||||||| ||||||    || ||||||||||| ||||||||||||||
Sbjct: 591 gtacaaggccaagaggaactgctggccacgtgtccgtggtgtggctatgaaccctgttga 650

                  
Query: 402 gcatccc 408
           |||||||
Sbjct: 651 gcatccc 657



to top

>gb|AY533227.1| Chinchilla lanigera ribosomal protein L8 mRNA, partial cds
          Length = 513

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 100/123 (81%)
 Strand = Plus / Plus

                                                                       
Query: 286 gctggtggtggcaggactgagaagccaatgctgaaggctggtaacgcctaccacaagtac 345
           |||||||||||||| | ||| || || ||  |||||||||| |  |||||||||||||||
Sbjct: 190 gctggtggtggcagaattgataaacctatcttgaaggctggcagagcctaccacaagtac 249

                                                                       
Query: 346 cgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaaccctgttgagcat 405
              |  |||||||||| ||||||    || ||||||||||||||||| ||||| ||||||
Sbjct: 250 aaggcaaagaggaactgctggccacgtgtacgtggtgtggccatgaatcctgtggagcat 309

              
Query: 406 ccc 408
           |||
Sbjct: 310 ccc 312



to top

>dbj|AK175100.1| Ciona intestinalis cDNA, clone:cixxx00151, full insert sequence
          Length = 940

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 34/35 (97%)
 Strand = Plus / Plus

                                              
Query: 373 gtgcgtggtgtggccatgaaccctgttgagcatcc 407
           ||||||||||| |||||||||||||||||||||||
Sbjct: 662 gtgcgtggtgtagccatgaaccctgttgagcatcc 696



to top

>dbj|AK175099.1| Ciona intestinalis cDNA, clone:cixxx00150, full insert sequence
          Length = 940

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 34/35 (97%)
 Strand = Plus / Plus

                                              
Query: 373 gtgcgtggtgtggccatgaaccctgttgagcatcc 407
           ||||||||||| |||||||||||||||||||||||
Sbjct: 662 gtgcgtggtgtagccatgaaccctgttgagcatcc 696



to top

>dbj|AK174301.1| Ciona intestinalis cDNA, clone:cicl028m21, full insert sequence
          Length = 940

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 34/35 (97%)
 Strand = Plus / Plus

                                              
Query: 373 gtgcgtggtgtggccatgaaccctgttgagcatcc 407
           ||||||||||| |||||||||||||||||||||||
Sbjct: 662 gtgcgtggtgtagccatgaaccctgttgagcatcc 696



to top

>gb|DQ213525.1| Taeniopygia guttata clone 0058P0034B06 ribosomal protein L8-like
           mRNA, complete sequence
          Length = 881

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 66/78 (84%)
 Strand = Plus / Plus

                                                                       
Query: 331 gcctaccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatg 390
           |||||||||||||||   |  |||||||||| ||||||    || |||||||||||||||
Sbjct: 603 gcctaccacaagtacaaggccaagaggaactgctggccacgtgtccgtggtgtggccatg 662

                             
Query: 391 aaccctgttgagcatccc 408
           |||||||| |||||||||
Sbjct: 663 aaccctgtggagcatccc 680



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 163 gcctccggtgactacgccatcgtcatcagccacaaccccga 203
           ||||||||  ||||||||| |||||||  ||||||||||||
Sbjct: 435 gcctccgggaactacgccaccgtcatctcccacaaccccga 475



to top

>gb|DQ213524.1| Taeniopygia guttata clone 0058P0020H02 ribosomal protein L8-like
           mRNA, complete sequence
          Length = 903

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 66/78 (84%)
 Strand = Plus / Plus

                                                                       
Query: 331 gcctaccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatg 390
           |||||||||||||||   |  |||||||||| ||||||    || |||||||||||||||
Sbjct: 625 gcctaccacaagtacaaggccaagaggaactgctggccacgtgtccgtggtgtggccatg 684

                             
Query: 391 aaccctgttgagcatccc 408
           |||||||| |||||||||
Sbjct: 685 aaccctgtggagcatccc 702



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 163 gcctccggtgactacgccatcgtcatcagccacaaccccga 203
           ||||||||  ||||||||| |||||||  ||||||||||||
Sbjct: 457 gcctccggcaactacgccaccgtcatctcccacaaccccga 497



to top

>gb|DQ213523.1| Taeniopygia guttata clone 0058P0011G02 ribosomal protein L8-like
           mRNA, complete sequence
          Length = 882

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 66/78 (84%)
 Strand = Plus / Plus

                                                                       
Query: 331 gcctaccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatg 390
           |||||||||||||||   |  |||||||||| ||||||    || |||||||||||||||
Sbjct: 603 gcctaccacaagtacaaggccaagaggaactgctggccacgtgtccgtggtgtggccatg 662

                             
Query: 391 aaccctgttgagcatccc 408
           |||||||| |||||||||
Sbjct: 663 aaccctgtggagcatccc 680



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 163 gcctccggtgactacgccatcgtcatcagccacaaccccga 203
           ||||||||  ||||||||| |||||||  ||||||||||||
Sbjct: 435 gcctccgggaactacgccaccgtcatctcccacaaccccga 475



to top

>gb|DQ213521.1| Taeniopygia guttata clone 0058P0051G10 ribosomal protein L8-like
           mRNA, complete sequence
          Length = 854

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 66/78 (84%)
 Strand = Plus / Plus

                                                                       
Query: 331 gcctaccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatg 390
           |||||||||||||||   |  |||||||||| ||||||    || |||||||||||||||
Sbjct: 577 gcctaccacaagtacaaggccaagaggaactgctggccacgtgtccgtggtgtggccatg 636

                             
Query: 391 aaccctgttgagcatccc 408
           |||||||| |||||||||
Sbjct: 637 aaccctgtggagcatccc 654



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 163 gcctccggtgactacgccatcgtcatcagccacaaccccga 203
           ||||||||  ||||||||| |||||||  ||||||||||||
Sbjct: 409 gcctccgggaactacgccaccgtcatctcccacaaccccga 449



to top

>emb|BX071470.1|CNS09RB6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9AB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1020

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 453 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 394

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 393 cccgtcgagcatcc 380



 Score = 44.1 bits (22), Expect = 0.35
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 21  atgtacaccggccagttcgtctactg 46
           |||||||||||||||||||| |||||
Sbjct: 765 atgtacaccggccagttcgtgtactg 740



to top

>emb|BX071012.1|CNS09QYG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8BE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 828

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 454 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 395

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 394 cccgtcgagcatcc 381



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 780 tcgcggccgagggcatgtacaccggccagttcgtgtactg 741



to top

>emb|BX070207.1|CNS09QC3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC7AG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 469

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 438 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 379

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 378 cccgtcgagcatcc 365



to top

>emb|BX061050.1|CNS09J9Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41CF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 775

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 427 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 368

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 367 cccgtcgagcatcc 354



to top

>emb|BX068769.1|CNS09P85 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53AF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 993

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 457 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 398

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 397 cccgtcgagcatcc 384



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 783 tcgcggccgagggcatgtacaccggccagttcgtgtactg 744



to top

>emb|BX067648.1|CNS09OD0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51BG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 878

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 443 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 384

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 383 cccgtcgagcatcc 370



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 769 tcgcggccgagggcatgtacaccggccagttcgtgtactg 730



to top

>emb|BX067520.1|CNS09O9G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51BA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 525

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 445 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 386

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 385 cccgtcgagcatcc 372



to top

>emb|BX066574.1|CNS09NJ6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5DG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 446 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 387

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 386 cccgtcgagcatcc 373



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 772 tcgcggccgagggcatgtacaccggccagttcgtgtactg 733



to top

>emb|BX066544.1|CNS09NIC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5DF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 447 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 388

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 387 cccgtcgagcatcc 374



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 773 tcgcggccgagggcatgtacaccggccagttcgtgtactg 734



to top

>emb|BX065896.1|CNS09N0C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49DH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 449 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 390

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 389 cccgtcgagcatcc 376



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 776 tcgcggccgagggcatgtacaccggccagttcgtgtactg 737



to top

>emb|BX064864.1|CNS09M7O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48CA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1015

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 434 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 375

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 374 cccgtcgagcatcc 361



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 760 tcgcggccgagggcatgtacaccggccagttcgtgtactg 721



to top

>emb|BX064747.1|CNS09M4F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48BB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 536

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 439 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 380

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 379 cccgtcgagcatcc 366



to top

>emb|BX064211.1|CNS09LPJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46BF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 610

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 446 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 387

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 386 cccgtcgagcatcc 373



to top

>emb|BX063827.1|CNS09LEV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45DE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 457 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 398

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 397 cccgtcgagcatcc 384



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 784 tcgcggccgagggcatgtacaccggccagttcgtgtactg 745



to top

>emb|BX063245.1|CNS09KYP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44DH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 875

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 437 taccacaagtacaaggtgaagcgcaactactggccgaaggtgcgcggtgtggcgatgaac 378

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 377 cccgtcgagcatcc 364



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 763 tcgcggccgagggcatgtacaccggccagttcgtgtactg 724



to top

>emb|BX063171.1|CNS09KWN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44DD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 951

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 453 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 394

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 393 cccgtcgagcatcc 380



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 779 tcgcggccgagggcatgtacaccggccagttcgtgtactg 740



to top

>emb|BX062318.1|CNS09K8Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43CC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 998

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 435 taccacaagtacaaggtgaagcgcaactactggccgaaggtgcgcggtgtggcgatgaac 376

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 375 cccgtcgagcatcc 362



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 761 tcgcggccgagggcatgtacaccggccagttcgtgtactg 722



to top

>emb|BX062038.1|CNS09K16 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43AE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 626

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 378 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 319

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 318 cccgtcgagcatcc 305



to top

>emb|BX061861.1|CNS09JW9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42DE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 947

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 443 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 384

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 383 cccgtcgagcatcc 370



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 769 tcgcggccgagggcatgtacaccggccagttcgtgtactg 730



to top

>emb|BX061503.1|CNS09JMB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42BE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1006

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 451 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 392

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 391 cccgtcgagcatcc 378



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 777 tcgcggccgagggcatgtacaccggccagttcgtgtactg 738



to top

>emb|BX061238.1|CNS09JEY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 878

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 405 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 346

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 345 cccgtcgagcatcc 332



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 731 tcgcggccgagggcatgtacaccggccagttcgtgtactg 692



to top

>emb|BX060724.1|CNS09J0O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41AH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 838

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 443 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 384

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 383 cccgtcgagcatcc 370



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 769 tcgcggccgagggcatgtacaccggccagttcgtgtactg 730



to top

>emb|BX059267.1|CNS09HW7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4AB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 903

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 459 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 400

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 399 cccgtcgagcatcc 386



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 785 tcgcggccgagggcatgtacaccggccagttcgtgtactg 746



to top

>emb|BX059235.1|CNS09HVB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39DH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 984

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 438 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 379

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 378 cccgtcgagcatcc 365



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 764 tcgcggccgagggcatgtacaccggccagttcgtgtactg 725



to top

>emb|BX057044.1|CNS09G6G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC36DC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 783

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 449 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 390

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 389 cccgtcgagcatcc 376



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 775 tcgcggccgagggcatgtacaccggccagttcgtgtactg 736



to top

>emb|BX056961.1|CNS09G45 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC36CG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 831

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 459 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 400

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 399 cccgtcgagcatcc 386



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 785 tcgcggccgagggcatgtacaccggccagttcgtgtactg 746



to top

>emb|BX055189.1|CNS09EQX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC33CH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 845

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 447 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 388

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 387 cccgtcgagcatcc 374



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 774 tcgcggccgagggcatgtacaccggccagttcgtgtactg 735



to top

>emb|BX054843.1|CNS09EHB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC33AG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 904

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 443 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 384

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 383 cccgtcgagcatcc 370



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 769 tcgcggccgagggcatgtacaccggccagttcgtgtactg 730



to top

>emb|BX054769.1|CNS09EF9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC33AC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 604

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 433 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 374

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 373 cccgtcgagcatcc 360



to top

>emb|BX054768.1|CNS09EF8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33AC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 927

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 618 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 677

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 678 cccgtcgagcatcc 691



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 292 tcgcggccgagggcatgtacaccggccagttcgtgtactg 331



to top

>emb|BX053031.1|CNS09D2Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30BG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 521

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 371 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 312

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 311 cccgtcgagcatcc 298



to top

>emb|BX054430.1|CNS09E5U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32CD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 722

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 345 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 286

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 285 cccgtcgagcatcc 272



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 671 tcgcggccgagggcatgtacaccggccagttcgtgtactg 632



to top

>emb|BX054417.1|CNS09E5H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32CC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 912

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 647 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 706

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 707 cccgtcgagcatcc 720



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 318 tcgcggccgagggcatgtacaccggccagttcgtgtactg 357



to top

>emb|BX054379.1|CNS09E4F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32CA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 787

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 446 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 387

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 386 cccgtcgagcatcc 373



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 773 tcgcggccgagggcatgtacaccggccagttcgtgtactg 734



to top

>emb|BX054108.1|CNS09DWW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 466

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 451 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 392

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 391 cccgtcgagcatcc 378



to top

>emb|BX053844.1|CNS09DPK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31DA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 960

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 459 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 400

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 399 cccgtcgagcatcc 386



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 785 tcgcggccgagggcatgtacaccggccagttcgtgtactg 746



to top

>emb|BX053555.1|CNS09DHJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31BB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 877

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 459 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 400

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 399 cccgtcgagcatcc 386



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 785 tcgcggccgagggcatgtacaccggccagttcgtgtactg 746



to top

>emb|BX052540.1|CNS09CPC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3CF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 454 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 395

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 394 cccgtcgagcatcc 381



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| ||||||||||||| |||||| |||||
Sbjct: 780 tcgcggccgagggcatgtacaccggccggttcgtgtactg 741



to top

>emb|BX052387.1|CNS09CL3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3BG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 521

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 455 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 396

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 395 cccgtcgagcatcc 382



to top

>emb|BX051644.1|CNS09C0G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC29AC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 536

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 462 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 403

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 402 cccgtcgagcatcc 389



to top

>emb|BX051423.1|CNS09BUB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC28DA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 873

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 451 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 392

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 391 cccgtcgagcatcc 378



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 778 tcgcggccgagggcatgtacaccggccagttcgtgtactg 739



to top

>emb|BX050118.1|CNS09AU2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC26BE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 536

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 441 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 382

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 381 cccgtcgagcatcc 368



to top

>emb|BX050810.1|CNS09BDA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC27CA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 900

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 449 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 390

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 389 cccgtcgagcatcc 376



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 775 tcgcggccgagggcatgtacaccggccagttcgtgtactg 736



to top

>emb|BX050569.1|CNS09B6L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC27AE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 598

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 431 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 372

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 371 cccgtcgagcatcc 358



to top

>emb|BX049265.1|CNS09A6D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC25AC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 833

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 457 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 398

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 397 cccgtcgagcatcc 384



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 783 tcgcggccgagggcatgtacaccggccagttcgtgtactg 744



to top

>emb|BX048973.1|CNS099Y9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC24CB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 511

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 442 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 383

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 382 cccgtcgagcatcc 369



to top

>emb|BX046434.1|CNS097ZQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC20AD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 975

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 441 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 382

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 381 cccgtcgagcatcc 368



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 767 tcgcggccgagggcatgtacaccggccagttcgtgtactg 728



to top

>emb|BX047425.1|CNS098R9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC21CF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 878

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 463 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 404

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 403 cccgtcgagcatcc 390



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 789 tcgcggccgagggcatgtacaccggccagttcgtgtactg 750



to top

>emb|BX047145.1|CNS098JH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC21AG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 461 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 402

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 401 cccgtcgagcatcc 388



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 787 tcgcggccgagggcatgtacaccggccagttcgtgtactg 748



to top

>emb|BX045582.1|CNS097C2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC19DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 567

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 453 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 394

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 393 cccgtcgagcatcc 380



to top

>emb|BX045137.1|CNS096ZP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC19AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 969

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 441 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 382

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 381 cccgtcgagcatcc 368



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 767 tcgcggccgagggcatgtacaccggccagttcgtgtactg 728



to top

>emb|BX043850.1|CNS095ZY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC16CH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 430 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggctatgaac 371

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 370 cccgtcgagcatcc 357



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 756 tcgcggccgagggcatgtacaccggccagttcgtgtactg 717



to top

>emb|BX043551.1|CNS095RN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC16BA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 840

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 437 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 378

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 377 cccgtcgagcatcc 364



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 763 tcgcggccgagggcatgtacaccggccagttcgtgtactg 724



to top

>emb|BX041268.1|CNS09408 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC12CB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 990

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 462 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 403

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 402 cccgtcgagcatcc 389



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 789 tcgcggccgagggcatgtacaccggccagttcgtgtactg 750



to top

>emb|BX041134.1|CNS093WI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC12BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 438 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 379

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 378 cccgtcgagcatcc 365



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 764 tcgcggccgagggcatgtacaccggccagttcgtgtactg 725



to top

>emb|BX041072.1|CNS093US Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC12BA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 945

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 435 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 376

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 375 cccgtcgagcatcc 362



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 761 tcgcggccgagggcatgtacaccggccagttcgtgtactg 722



to top

>emb|BX040787.1|CNS093MV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC11DC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 975

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 461 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 402

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 401 cccgtcgagcatcc 388



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 787 tcgcggccgagggcatgtacaccggccagttcgtgtactg 748



to top

>emb|BX040786.1|CNS093MU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC11DC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 619 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 678

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 679 cccgtcgagcatcc 692



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 293 tcgcggccgagggcatgtacaccggccagttcgtgtactg 332



to top

>emb|BX039654.1|CNS092RE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC10AC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 953

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 430 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 371

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 370 cccgtcgagcatcc 357



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 756 tcgcggccgagggcatgtacaccggccagttcgtgtactg 717



to top

>emb|BX036687.1|CNS090GZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA8DC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 793

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 438 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 379

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 378 cccgtcgagcatcc 365



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 765 tcgcggccgagggcatgtacaccggccagttcgtgtactg 726



to top

>emb|BX037078.1|CNS090RU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9BE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 810

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 629 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 688

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 689 cccgtcgagcatcc 702



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 303 tcgcggccgagggcatgtacaccggccagttcgtgtactg 342



to top

>emb|BX035978.1|CNS08ZXA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA7CC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 990

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 453 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 394

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 393 cccgtcgagcatcc 380



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 779 tcgcggccgagggcatgtacaccggccagttcgtgtactg 740



to top

>emb|BX034653.1|CNS08YWH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA50CF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 435 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 376

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 375 cccgtcgagcatcc 362



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 761 tcgcggccgagggcatgtacaccggccagttcgtgtactg 722



to top

>emb|BX033967.1|CNS08YDF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA5CF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 751

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 445 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 386

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 385 cccgtcgagcatcc 372



to top

>emb|BX033761.1|CNS08Y7P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA5BE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 990

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 455 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 396

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 395 cccgtcgagcatcc 382



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 781 tcgcggccgagggcatgtacaccggccagttcgtgtactg 742



to top

>emb|BX033234.1|CNS08XT2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49CD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 944

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 435 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 376

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 375 cccgtcgagcatcc 362



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 761 tcgcggccgagggcatgtacaccggccagttcgtgtactg 722



to top

>emb|BX033107.1|CNS08XPJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49BF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 859

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 442 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 383

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 382 cccgtcgagcatcc 369



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 768 tcgcggccgagggcatgtacaccggccagttcgtgtactg 729



to top

>emb|BX032954.1|CNS08XLA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49AF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 950

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 450 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 391

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 390 cccgtcgagcatcc 377



 Score = 44.1 bits (22), Expect = 0.35
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 7   tcgccgccgngggtatgtacaccggccagttcg 39
           |||| |||| ||| |||||||||||||||||||
Sbjct: 776 tcgcggccgagggcatgtacaccggccagttcg 744



to top

>emb|BX032912.1|CNS08XK4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49AD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1012

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 449 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 390

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 389 cccgtcgagcatcc 376



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 775 tcgcggccgagggcatgtacaccggccagttcgtgtactg 736



to top

>emb|BX032378.1|CNS08X5A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA48BA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 640

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 437 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 378

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 377 cccgtcgagcatcc 364



to top

>emb|BX031877.1|CNS08WRD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47CA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 437 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 378

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 377 cccgtcgagcatcc 364



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 763 tcgcggccgagggcatgtacaccggccagttcgtgtactg 724



to top

>emb|BX031828.1|CNS08WQ0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47BG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 917

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 438 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 379

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 378 cccgtcgagcatcc 365



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 764 tcgcggccgagggcatgtacaccggccagttcgtgtactg 725



to top

>emb|BX031537.1|CNS08WHX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 827

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 433 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 374

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 373 cccgtcgagcatcc 360



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 759 tcgcggccgagggcatgtacaccggccagttcgtgtactg 720



to top

>emb|BX030749.1|CNS08VW1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA45DG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 957

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 439 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 380

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 379 cccgtcgagcatcc 366



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 765 tcgcggccgagggcatgtacaccggccagttcgtgtactg 726



to top

>emb|BX031289.1|CNS08WB1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA46CF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 941

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 433 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 374

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 373 cccgtcgagcatcc 360



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 759 tcgcggccgagggcatgtacaccggccagttcgtgtactg 720



to top

>emb|BX030002.1|CNS08VBA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA44DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1023

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 457 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 398

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 397 cccgtcgagcatcc 384



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 783 tcgcggccgagggcatgtacaccggccagttcgtgtactg 744



to top

>emb|BX029262.1|CNS08UQQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA43DA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 811

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 439 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 380

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 379 cccgtcgagcatcc 366



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 765 tcgcggccgagggcatgtacaccggccagttcgtgtactg 726



to top

>emb|BX029602.1|CNS08V06 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA44BA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 872

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 446 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 387

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 386 cccgtcgagcatcc 373



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 772 tcgcggccgagggcatgtacaccggccagttcgtgtactg 733



to top

>emb|BX028637.1|CNS08U9D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA42DB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 882

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 445 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 386

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 385 cccgtcgagcatcc 372



 Score = 46.1 bits (23), Expect = 0.089
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 7   tcgccgccgngggtatgtacaccggccagttcgt 40
           |||| |||| ||| ||||||||||||||||||||
Sbjct: 771 tcgcggccgagggcatgtacaccggccagttcgt 738



to top

>emb|BX022357.1|CNS08PEX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA34BA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 838

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 442 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 383

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 382 cccgtcgagcatcc 369



 Score = 46.1 bits (23), Expect = 0.089
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 7   tcgccgccgngggtatgtacaccggccagttcgt 40
           |||| |||| ||| ||||||||||||||||||||
Sbjct: 769 tcgcggccgagggcatgtacaccggccagttcgt 736



to top

>emb|BX026844.1|CNS08SVK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA40BB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 993

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 453 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 394

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 393 cccgtcgagcatcc 380



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 720 tcgcggccgagggcatgtacaccggccagttcgtgtactg 681



to top

>emb|BX026789.1|CNS08SU1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA40AH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 445 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 386

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 385 cccgtcgagcatcc 372



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 771 tcgcggccgagggcatgtacaccggccagttcgtgtactg 732



to top

>emb|BX025698.1|CNS08RZQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA39BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 988

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 450 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 391

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 390 cccgtcgagcatcc 377



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 776 tcgcggccgagggcatgtacaccggccagttcgtgtactg 737



to top

>emb|BX025349.1|CNS08RQ1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA38DE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 451 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 392

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 391 cccgtcgagcatcc 378



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 777 tcgcggccgagggcatgtacaccggccagttcgtgtactg 738



to top

>emb|BX025079.1|CNS08RIJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA38BG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 967

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 437 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 378

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 377 cccgtcgagcatcc 364



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 763 tcgcggccgagggcatgtacaccggccagttcgtgtactg 724



to top

>emb|BX025073.1|CNS08RID Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA38BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 434 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 375

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 374 cccgtcgagcatcc 361



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 760 tcgcggccgagggcatgtacaccggccagttcgtgtactg 721



to top

>emb|BX025038.1|CNS08RHE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA38BE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 967

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 445 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 386

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 385 cccgtcgagcatcc 372



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 771 tcgcggccgagggcatgtacaccggccagttcgtgtactg 732



to top

>emb|BX025033.1|CNS08RH9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA38BE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 437 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 378

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 377 cccgtcgagcatcc 364



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 763 tcgcggccgagggcatgtacaccggccagttcgtgtactg 724



to top

>emb|BX024670.1|CNS08R76 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA37DA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 797

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 438 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 379

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 378 cccgtcgagcatcc 365



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 764 tcgcggccgagggcatgtacaccggccagttcgtgtactg 725



to top

>emb|BX024145.1|CNS08QSL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA36DD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 881

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 426 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 367

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 366 cccgtcgagcatcc 353



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 752 tcgcggccgagggcatgtacaccggccagttcgtgtactg 713



to top

>emb|BX023815.1|CNS08QJF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA36BE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 896

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 463 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 404

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 403 cccgtcgagcatcc 390



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 789 tcgcggccgagggcatgtacaccggccagttcgtgtactg 750



to top

>emb|BX022223.1|CNS08PB7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA34AB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 982

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 473 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcaatgaac 414

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 413 cccgtcgagcatcc 400



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 800 tcgcggccgagggcatgtacaccggccagttcgtgtactg 761



to top

>emb|BX021031.1|CNS08OE3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA31AE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 885

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 445 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 386

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 385 cccgtcgagcatcc 372



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 712 tcgcggccgagggcatgtacaccggccagttcgtgtactg 673



to top

>emb|BX020305.1|CNS08NTX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA3DF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 982

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 434 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 375

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 374 cccgtcgagcatcc 361



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 760 tcgcggccgagggcatgtacaccggccagttcgtgtactg 721



to top

>emb|BX018974.1|CNS08MSY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA28DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 859

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 439 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 380

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 379 cccgtcgagcatcc 366



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 765 tcgcggccgagggcatgtacaccggccagttcgtgtactg 726



to top

>emb|BX018003.1|CNS08M1Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA27AG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 961

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 442 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 383

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 382 cccgtcgagcatcc 369



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 768 tcgcggccgagggcatgtacaccggccagttcgtgtactg 729



to top

>emb|BX017981.1|CNS08M1D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA27AF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1003

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 438 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 379

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 378 cccgtcgagcatcc 365



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 763 tcgcggccgagggcatgtacaccggccagttcgtgtactg 724



to top

>emb|BX018524.1|CNS08MGG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA28AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 980

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 451 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 392

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 391 cccgtcgagcatcc 378



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 777 tcgcggccgagggcatgtacaccggccagttcgtgtactg 738



to top

>emb|BX018377.1|CNS08MCD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA27DE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1034

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 457 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 398

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 397 cccgtcgagcatcc 384



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 783 tcgcggccgagggcatgtacaccggccagttcgtgtactg 744



to top

>emb|BX017737.1|CNS08LUL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA26DC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 461 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 402

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 401 cccgtcgagcatcc 388



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 787 tcgcggccgagggcatgtacaccggccagttcgtgtactg 748



to top

>emb|BX017331.1|CNS08LJB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA26AD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 850

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 434 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 375

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 374 cccgtcgagcatcc 361



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 760 tcgcggccgagggcatgtacaccggccagttcgtgtactg 721



to top

>emb|BX016524.1|CNS08KWW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24DD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 801

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 530 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 589

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 590 cccgtcgagcatcc 603



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 204 tcgcggccgagggcatgtacaccggccagttcgtgtactg 243



to top

>emb|BX016411.1|CNS08KTR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA24CE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 885

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 465 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 406

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 405 cccgtcgagcatcc 392



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 791 tcgcggccgagggcatgtacaccggccagttcgtgtactg 752



to top

>emb|BX015958.1|CNS08KH6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA23DG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 438 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 379

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 378 cccgtcgagcatcc 365



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 765 tcgcggccgagggcatgtacaccggccagttcgtgtactg 726



to top

>emb|BX014218.1|CNS08J4U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA21BD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 795

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 453 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 394

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 393 cccgtcgagcatcc 380



 Score = 48.1 bits (24), Expect = 0.022
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 12  gccgngggtatgtacaccggccagttcgtctactg 46
           |||| ||| |||||||||||||||||||| |||||
Sbjct: 774 gccgggggcatgtacaccggccagttcgtgtactg 740



to top

>emb|BX013506.1|CNS08IL2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA20BC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 868

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 433 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 374

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 373 cccgtcgagcatcc 360



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 759 tcgcggccgagggcatgtacaccggccagttcgtgtactg 720



to top

>emb|BX013505.1|CNS08IL1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA20BC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 949

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 622 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 681

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 682 cccgtcgagcatcc 695



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 295 tcgcggccgagggcatgtacaccggccagttcgtgtactg 334



to top

>emb|BX013494.1|CNS08IKQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA20BC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 939

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 442 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 383

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 382 cccgtcgagcatcc 369



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 768 tcgcggccgagggcatgtacaccggccagttcgtgtactg 729



to top

>emb|BX012299.1|CNS08HNJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA19CC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 765

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 450 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 391

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 390 cccgtcgagcatcc 377



 Score = 44.1 bits (22), Expect = 0.35
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 21  atgtacaccggccagttcgtctactg 46
           |||||||||||||||||||| |||||
Sbjct: 762 atgtacaccggccagttcgtgtactg 737



to top

>emb|BX010378.1|CNS08G66 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA16CG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 857

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 439 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 380

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 379 cccgtcgagcatcc 366



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 765 tcgcggccgagggcatgtacaccggccagttcgtgtactg 726



to top

>emb|BX010208.1|CNS08G1G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA16BG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 843

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 625 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 684

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 685 cccgtcgagcatcc 698



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 297 tcgcggccgagggcatgtacaccggccagttcgtgtactg 336



to top

>emb|BX009864.1|CNS08FRW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA15DF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 854

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 441 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 382

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 381 cccgtcgagcatcc 368



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 767 tcgcggccgagggcatgtacaccggccagttcgtgtactg 728



to top

>emb|BX009834.1|CNS08FR2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA15DE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 935

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 449 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 390

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 389 cccgtcgagcatcc 376



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 776 tcgcggccgagggcatgtacaccggccagttcgtgtactg 737



to top

>emb|BX008448.1|CNS08EOK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA13DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 510

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 462 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 403

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 402 cccgtcgagcatcc 389



to top

>emb|BX008129.1|CNS08EFP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA13BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 840

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 427 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 368

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 367 cccgtcgagcatcc 354



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 754 tcgcggccgagggcatgtacaccggccagttcgtgtactg 715



to top

>emb|BX008128.1|CNS08EFO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 900

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 604 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 663

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 664 cccgtcgagcatcc 677



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 278 tcgcggccgagggcatgtacaccggccagttcgtgtactg 317



to top

>emb|BX007575.1|CNS08E0B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA12CE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 445 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 386

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 385 cccgtcgagcatcc 372



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 771 tcgcggccgagggcatgtacaccggccagttcgtgtactg 732



to top

>emb|BX007182.1|CNS08DPE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA12AB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 749

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 319 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 260

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 259 cccgtcgagcatcc 246



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 646 tcgcggccgagggcatgtacaccggccagttcgtgtactg 607



to top

>emb|BX006812.1|CNS08DF4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA11BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 483

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 286 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 227

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 226 cccgtcgagcatcc 213



to top

>emb|BX006811.1|CNS08DF3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA11BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 658

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 483 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 542

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 543 cccgtcgagcatcc 556



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 157 tcgcggccgagggcatgtacaccggccagttcgtgtactg 196



to top

>emb|BX005817.1|CNS08CNH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA10AA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 872

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 449 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 390

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 389 cccgtcgagcatcc 376



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 775 tcgcggccgagggcatgtacaccggccagttcgtgtactg 736



to top

>emb|BX005504.1|CNS08CES Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA1AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 662

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 457 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 398

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 397 cccgtcgagcatcc 384



to top

>gb|AY957563.1| Oncorhynchus mykiss ribosomal protein L8 mRNA, partial cds
          Length = 672

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 66/78 (84%)
 Strand = Plus / Plus

                                                                       
Query: 331 gcctaccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatg 390
           |||||||||||||||   |  ||||||||||| |||||    || |||||||||||||||
Sbjct: 519 gcctaccacaagtacaaggccaagaggaactcatggccacgtgtccgtggtgtggccatg 578

                             
Query: 391 aaccctgttgagcatccc 408
            |||||||||||||||||
Sbjct: 579 gaccctgttgagcatccc 596



to top

>gb|AY168762.1| Branchiostoma belcheri tsingtaunese ribosomal protein L8 mRNA,
           complete cds
          Length = 477

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 33/34 (97%)
 Strand = Plus / Plus

                                             
Query: 376 cgtggtgtggccatgaaccctgttgagcatcccc 409
           ||||||||||| ||||||||||||||||||||||
Sbjct: 214 cgtggtgtggctatgaaccctgttgagcatcccc 247



to top

>ref|XM_315817.2| Anopheles gambiae str. PEST ENSANGP00000010416
           (ENSANGG00000007927), mRNA
          Length = 1093

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 654 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 713

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 714 cccgtcgagcatcc 727



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 328 tcgcggccgagggcatgtacaccggccagttcgtgtactg 367



to top

>emb|CT032253.1| Platynereis dumerilii EST IB0AAA42BC10FM1
          Length = 778

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 358 aactcctggcctaaggtgcgtggtgtggccatgaaccctgttgagcatcc 407
           |||| |||||| ||||||||||||||||  |||||||| |||||||||||
Sbjct: 267 aactgctggcccaaggtgcgtggtgtggttatgaaccccgttgagcatcc 218



to top

>gb|BC059473.1| Danio rerio ribosomal protein L8, mRNA (cDNA clone MGC:73105
           IMAGE:4786513), complete cds
          Length = 841

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 32/33 (96%)
 Strand = Plus / Plus

                                            
Query: 376 cgtggtgtggccatgaaccctgttgagcatccc 408
           ||||||||||| |||||||||||||||||||||
Sbjct: 613 cgtggtgtggctatgaaccctgttgagcatccc 645



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 25  acaccggccagttcgtctactgcgg 49
           |||||||||||||| ||||||||||
Sbjct: 263 acaccggccagttcatctactgcgg 287



to top

>ref|NM_200713.1| Danio rerio ribosomal protein L8 (rpl8), mRNA
          Length = 841

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 32/33 (96%)
 Strand = Plus / Plus

                                            
Query: 376 cgtggtgtggccatgaaccctgttgagcatccc 408
           ||||||||||| |||||||||||||||||||||
Sbjct: 613 cgtggtgtggctatgaaccctgttgagcatccc 645



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 25  acaccggccagttcgtctactgcgg 49
           |||||||||||||| ||||||||||
Sbjct: 263 acaccggccagttcatctactgcgg 287



to top

>emb|BX067521.1|CNS09O9H Single read from an extremity of a full-length cDNA clone made
          from Anopheles gambiae total adult females. 5-PRIME end
          of clone FK0AAC51BA03 of strain 6-9 of Anopheles
          gambiae (African malaria mosquito)
          Length = 101

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                  
Query: 7  tcgccgccgngggtatgtacaccggccagttcgtctactg 46
          ||||||||| ||| |||||||||||||||||||| |||||
Sbjct: 8  tcgccgccgagggcatgtacaccggccagttcgtgtactg 47



to top

>emb|BX050252.1|CNS09AXS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC26CE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 754

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 62/73 (84%)
 Strand = Plus / Plus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||| |||||||| ||||||
Sbjct: 620 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaac 679

                        
Query: 394 cctgttgagcatc 406
           || || |||||||
Sbjct: 680 cccgtcgagcatc 692



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 294 tcgcggccgagggcatgtacaccggccagttcgtgtactg 333



to top

>emb|BX046386.1|CNS097YE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC20AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 868

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                       
Query: 335 accacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaacc 394
           |||||||||||   |||||| | |||| |||||| |||||||| |||||||| |||||||
Sbjct: 432 accacaagtacaaggtgaagcgcaactgctggccgaaggtgcgcggtgtggcgatgaacc 373

                        
Query: 395 ctgttgagcatcc 407
           | || ||||||||
Sbjct: 372 ccgtcgagcatcc 360



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| || ||||||||||||||||| |||||
Sbjct: 629 tcgcggccgagggcatttacaccggccagttcgtgtactg 590



to top

>gb|BC065432.1| Danio rerio ribosomal protein L8, mRNA (cDNA clone MGC:77641
           IMAGE:6996953), complete cds
          Length = 892

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 32/33 (96%)
 Strand = Plus / Plus

                                            
Query: 376 cgtggtgtggccatgaaccctgttgagcatccc 408
           ||||||||||| |||||||||||||||||||||
Sbjct: 610 cgtggtgtggctatgaaccctgttgagcatccc 642



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 25  acaccggccagttcgtctactgcgg 49
           |||||||||||||| ||||||||||
Sbjct: 260 acaccggccagttcatctactgcgg 284



to top

>gb|DQ213522.1| Taeniopygia guttata clone 0061P0021C08 ribosomal protein L8-like
           mRNA, complete sequence
          Length = 878

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                           
Query: 377 gtggtgtggccatgaaccctgttgagcatccc 408
           |||||||||||||||||||||| |||||||||
Sbjct: 648 gtggtgtggccatgaaccctgtggagcatccc 679



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 163 gcctccggtgactacgccatcgtcatcagccacaaccccga 203
           ||||||||  ||||||||| |||||||  ||||||||||||
Sbjct: 433 gcctccgggaactacgccaccgtcatctcccacaaccccga 473



to top

>gb|AY857413.1| Suberites domuncula L2/L8 mRNA, partial cds
          Length = 717

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 100/124 (80%)
 Strand = Plus / Plus

                                                                       
Query: 286 gctggtggtggcaggactgagaagccaatgctgaaggctggtaacgcctaccacaagtac 345
           ||||||||||| |||| ||| || || |||||||| |||||    || ||||| ||||||
Sbjct: 508 gctggtggtggaaggattgacaaacctatgctgaaagctggacgggcttaccataagtac 567

                                                                       
Query: 346 cgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaaccctgttgagcat 405
              || |||||||||| ||||||    || ||||||||||| ||||||||||| ||||||
Sbjct: 568 aaggtcaagaggaactgctggccatgtgttcgtggtgtggctatgaaccctgtggagcat 627

               
Query: 406 cccc 409
           ||||
Sbjct: 628 cccc 631



to top

>ref|NM_075539.2| Caenorhabditis elegans Ribosomal Protein, Large subunit family
           member (rpl-2) (rpl-2) mRNA, complete cds
          Length = 843

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                       
Query: 114 catctgcaacgtcgagcaccacgtcggcgaccgtggtgtcttcgccagggcctccggtga 173
           |||||||||||||||| || |   ||| |||||||| ||| ||||| | ||||| ||| |
Sbjct: 347 catctgcaacgtcgagaacaagtccggagaccgtggagtcatcgcccgtgcctctggtaa 406

                                           
Query: 174 ctacgccatcgtcatcagccacaaccccgaca 205
           |||||||| |||||||  ||||||||| ||||
Sbjct: 407 ctacgccaccgtcatcgcccacaacccagaca 438



to top

>ref|NM_001026174.2| Caenorhabditis elegans B0250.3 (B0250.3) mRNA, complete cds
          Length = 540

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                       
Query: 114 catctgcaacgtcgagcaccacgtcggcgaccgtggtgtcttcgccagggcctccggtga 173
           |||||||||||||||| || |   ||| |||||||| ||| ||||| | ||||| ||| |
Sbjct: 93  catctgcaacgtcgagaacaagtccggagaccgtggagtcatcgcccgtgcctctggtaa 152

                                           
Query: 174 ctacgccatcgtcatcagccacaaccccgaca 205
           |||||||| |||||||  ||||||||| ||||
Sbjct: 153 ctacgccaccgtcatcgcccacaacccagaca 184



to top

>dbj|AK060350.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-008-F06, full
           insert sequence
          Length = 864

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 116 tctgcaacgtcgagcaccacgtcggcgaccgtggtgtcttcgccagggcctccggtgact 175
           ||||||||||||||  | | ||||||||||| |||||||| ||| | ||||| |||||||
Sbjct: 358 tctgcaacgtcgaggccaaggtcggcgaccgcggtgtctttgcccgtgcctcgggtgact 417

               
Query: 176 acgc 179
           ||||
Sbjct: 418 acgc 421



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                
Query: 373 gtgcgtggtgtggccatgaaccctgttgagcatcccc 409
           ||||||||||||||||||||||| || ||||| ||||
Sbjct: 615 gtgcgtggtgtggccatgaaccccgtggagcaccccc 651



to top

>ref|NM_114978.1| Arabidopsis thaliana structural constituent of ribosome AT3G51190
           mRNA, complete cds
          Length = 783

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 111/139 (79%)
 Strand = Plus / Plus

                                                                       
Query: 271 atgattggtcaggttgctggtggtggcaggactgagaagccaatgctgaaggctggtaac 330
           |||||||| || ||||| ||||| || || || ||||||||| | || |||||||| || 
Sbjct: 496 atgattgggcaagttgcaggtggaggaagaacagagaagccatttctcaaggctggaaat 555

                                                                       
Query: 331 gcctaccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatg 390
           || ||||||||||||   | |||||||||||  ||||||   || |||||||| || |||
Sbjct: 556 gcataccacaagtacaaagcgaagaggaactgttggcctgttgtacgtggtgttgcgatg 615

                              
Query: 391 aaccctgttgagcatcccc 409
           ||||| || || |||||||
Sbjct: 616 aacccagtggaacatcccc 634



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 71/86 (82%)
 Strand = Plus / Plus

                                                                       
Query: 100 cctgagggaggcgtcatctgcaacgtcgagcaccacgtcggcgaccgtggtgtcttcgcc 159
           ||||||||||  || ||||| ||||| |||| ||| ||||| ||||||||||   |||| 
Sbjct: 325 cctgagggagctgttatctgtaacgttgagctccatgtcggtgaccgtggtgctctcgct 384

                                     
Query: 160 agggcctccggtgactacgccatcgt 185
           ||||| || ||||| |||||||||||
Sbjct: 385 agggcttctggtgattacgccatcgt 410



to top

>ref|XM_453766.1| Kluyveromyces lactis NRRL Y-1140, KLLA0D16027g predicted mRNA
          Length = 765

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 78/95 (82%)
 Strand = Plus / Plus

                                                                       
Query: 307 aagccaatgctgaaggctggtaacgcctaccacaagtaccgtgtgaagaggaactcctgg 366
           |||||| || |||||||||||   || | |||||||||| | || ||||| ||||| |||
Sbjct: 529 aagccattgttgaaggctggtcgtgctttccacaagtacagagtcaagagaaactcttgg 588

                                              
Query: 367 cctaaggtgcgtggtgtggccatgaaccctgttga 401
           || |||   |||||||| |||||||||||||||||
Sbjct: 589 ccaaagactcgtggtgttgccatgaaccctgttga 623



to top

>emb|CR382124.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome D of strain NRRL Y-1140
               of Kluyveromyces lactis
          Length = 1715506

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 78/95 (82%)
 Strand = Plus / Minus

                                                                           
Query: 307     aagccaatgctgaaggctggtaacgcctaccacaagtaccgtgtgaagaggaactcctgg 366
               |||||| || |||||||||||   || | |||||||||| | || ||||| ||||| |||
Sbjct: 1350687 aagccattgttgaaggctggtcgtgctttccacaagtacagagtcaagagaaactcttgg 1350628

                                                  
Query: 367     cctaaggtgcgtggtgtggccatgaaccctgttga 401
               || |||   |||||||| |||||||||||||||||
Sbjct: 1350627 ccaaagactcgtggtgttgccatgaaccctgttga 1350593



to top

>emb|AL132980.3|ATF24M12 Arabidopsis thaliana DNA chromosome 3, BAC clone F24M12
          Length = 129516

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 111/139 (79%)
 Strand = Plus / Minus

                                                                         
Query: 271   atgattggtcaggttgctggtggtggcaggactgagaagccaatgctgaaggctggtaac 330
             |||||||| || ||||| ||||| || || || ||||||||| | || |||||||| || 
Sbjct: 76218 atgattgggcaagttgcaggtggaggaagaacagagaagccatttctcaaggctggaaat 76159

                                                                         
Query: 331   gcctaccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatg 390
             || ||||||||||||   | |||||||||||  ||||||   || |||||||| || |||
Sbjct: 76158 gcataccacaagtacaaagcgaagaggaactgttggcctgttgtacgtggtgttgcgatg 76099

                                
Query: 391   aaccctgttgagcatcccc 409
             ||||| || || |||||||
Sbjct: 76098 aacccagtggaacatcccc 76080



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 71/86 (82%)
 Strand = Plus / Minus

                                                                         
Query: 100   cctgagggaggcgtcatctgcaacgtcgagcaccacgtcggcgaccgtggtgtcttcgcc 159
             ||||||||||  || ||||| ||||| |||| ||| ||||| ||||||||||   |||| 
Sbjct: 76548 cctgagggagctgttatctgtaacgttgagctccatgtcggtgaccgtggtgctctcgct 76489

                                       
Query: 160   agggcctccggtgactacgccatcgt 185
             ||||| || ||||| |||||||||||
Sbjct: 76488 agggcttctggtgattacgccatcgt 76463



to top

>gb|DQ056619.1| Arabidopsis thaliana 60S ribosomal protein L8 (At3g51190) mRNA,
           complete cds
          Length = 783

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 111/139 (79%)
 Strand = Plus / Plus

                                                                       
Query: 271 atgattggtcaggttgctggtggtggcaggactgagaagccaatgctgaaggctggtaac 330
           |||||||| || ||||| ||||| || || || ||||||||| | || |||||||| || 
Sbjct: 496 atgattgggcaagttgcaggtggaggaagaacagagaagccacttctcaaggctggaaat 555

                                                                       
Query: 331 gcctaccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatg 390
           || ||||||||||||   | |||||||||||  ||||||   || |||||||| || |||
Sbjct: 556 gcataccacaagtacaaagcgaagaggaactgttggcctgttgtacgtggtgttgcgatg 615

                              
Query: 391 aaccctgttgagcatcccc 409
           ||||| || || |||||||
Sbjct: 616 aacccagtggaacatcccc 634



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 71/86 (82%)
 Strand = Plus / Plus

                                                                       
Query: 100 cctgagggaggcgtcatctgcaacgtcgagcaccacgtcggcgaccgtggtgtcttcgcc 159
           ||||||||||  || ||||| ||||| |||| ||| ||||| ||||||||||   |||| 
Sbjct: 325 cctgagggagctgttatctgtaacgttgagctccatgtcggtgaccgtggtgctctcgct 384

                                     
Query: 160 agggcctccggtgactacgccatcgt 185
           ||||| || ||||| |||||||||||
Sbjct: 385 agggcttctggtgattacgccatcgt 410



to top

>gb|DQ206502.1| Priapulus caudatus isolate TOA23 ribosomal protein 8 large subunit
           mRNA, partial cds
          Length = 385

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 75/91 (82%)
 Strand = Plus / Plus

                                                                       
Query: 317 tgaaggctggtaacgcctaccacaagtaccgtgtgaagaggaactcctggcctaaggtgc 376
           ||||||| ||||  || ||||||||||||   |||||| | |||| ||||||||| ||| 
Sbjct: 287 tgaaggcaggtagagcataccacaagtacaaggtgaagcgtaactgctggcctaaagtga 346

                                          
Query: 377 gtggtgtggccatgaaccctgttgagcatcc 407
           | ||||| |||||||| || |||||||||||
Sbjct: 347 gaggtgttgccatgaatcccgttgagcatcc 377



to top

>gb|BC043017.1| Mus musculus ribosomal protein L8, mRNA (cDNA clone MGC:57885
           IMAGE:5684024), complete cds
          Length = 861

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 65/78 (83%)
 Strand = Plus / Plus

                                                                       
Query: 331 gcctaccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatg 390
           |||||||||||||||   |  |||||||||| ||||||    ||||| ||||||||||||
Sbjct: 570 gcctaccacaagtacaaggcaaagaggaactgctggccacgtgtgcggggtgtggccatg 629

                             
Query: 391 aaccctgttgagcatccc 408
           || ||||| |||||||||
Sbjct: 630 aatcctgtggagcatccc 647



to top

>ref|NM_012053.1| Mus musculus ribosomal protein L8 (Rpl8), mRNA
          Length = 842

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 65/78 (83%)
 Strand = Plus / Plus

                                                                       
Query: 331 gcctaccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatg 390
           |||||||||||||||   |  |||||||||| ||||||    ||||| ||||||||||||
Sbjct: 574 gcctaccacaagtacaaggcaaagaggaactgctggccacgtgtgcggggtgtggccatg 633

                             
Query: 391 aaccctgttgagcatccc 408
           || ||||| |||||||||
Sbjct: 634 aatcctgtggagcatccc 651



to top

>emb|BX060935.1|CNS09J6J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41CB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 988

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 62/74 (83%)
 Strand = Plus / Plus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| ||||||  ||||||| |||||||| ||||||
Sbjct: 617 taccacaagtacaaggtgaagcgcaactgctggccggaggtgcgcggtgtggcgatgaac 676

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 677 cccgtcgagcatcc 690



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 290 tcgcggccgagggcatgtacaccggccagttcgtgtactg 329



to top

>emb|BX063741.1|CNS09LCH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45DA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1014

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 62/74 (83%)
 Strand = Plus / Minus

                                                                       
Query: 334 taccacaagtaccgtgtgaagaggaactcctggcctaaggtgcgtggtgtggccatgaac 393
           ||||||||||||   |||||| | |||| |||||| |||||||  |||||||| ||||||
Sbjct: 454 taccacaagtacaaggtgaagcgcaactgctggccgaaggtgcacggtgtggcgatgaac 395

                         
Query: 394 cctgttgagcatcc 407
           || || ||||||||
Sbjct: 394 cccgtcgagcatcc 381



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 7   tcgccgccgngggtatgtacaccggccagttcgtctactg 46
           |||| |||| ||| |||||||||||||||||||| |||||
Sbjct: 780 tcgcggccgagggcatgtacaccggccagttcgtgtactg 741


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,595,559
Number of Sequences: 3902068
Number of extensions: 2595559
Number of successful extensions: 54154
Number of sequences better than 10.0: 778
Number of HSP's better than 10.0 without gapping: 775
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 52570
Number of HSP's gapped (non-prelim): 1541
length of query: 409
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 387
effective length of database: 17,147,199,772
effective search space: 6635966311764
effective search space used: 6635966311764
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top