ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags30f14
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1emb|AL096761.1|HS754E20A Human DNA sequence from clone RP4-754E2... 44 0.10
2emb|AL671190.10| Mouse DNA sequence from clone RP23-464L12 on ch... 42 0.40
3gb|AY540995.1| Achromobacter xylosoxidans subsp. denitrificans s... 38 6.3
4gb|AC105052.3| Homo sapiens BAC clone RP11-577H5 from 7, complet... 38 6.3
5ref|XM_536803.2| PREDICTED: Canis familiaris similar to Nedd-4-l... 38 6.3
6gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete ... 38 6.3
7emb|CR627444.1| Homo sapiens mRNA; cDNA DKFZp781H1351 (from clon... 38 6.3
8dbj|BA000032.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromo... 38 6.3
9gb|AC091226.3| Drosophila melanogaster 3L BAC RP98-3I13 (Roswell... 38 6.3
10gb|AC069405.6| Drosophila melanogaster 3L BAC RP98-17J20 (Roswel... 38 6.3
11ref|NM_006989.3| Homo sapiens RAS p21 protein activator 4 (RASA4... 38 6.3
12ref|XM_936022.1| PREDICTED: Homo sapiens hypothetical protein FL... 38 6.3
13ref|XM_936021.1| PREDICTED: Homo sapiens hypothetical protein FL... 38 6.3
14ref|XM_936020.1| PREDICTED: Homo sapiens hypothetical protein FL... 38 6.3
15ref|XM_936019.1| PREDICTED: Homo sapiens hypothetical protein FL... 38 6.3
16ref|XM_936018.1| PREDICTED: Homo sapiens hypothetical protein FL... 38 6.3
17ref|XM_936017.1| PREDICTED: Homo sapiens hypothetical protein FL... 38 6.3
18ref|XM_936016.1| PREDICTED: Homo sapiens hypothetical protein FL... 38 6.3
19ref|XM_936013.1| PREDICTED: Homo sapiens hypothetical protein FL... 38 6.3
20ref|XM_936011.1| PREDICTED: Homo sapiens hypothetical protein FL... 38 6.3
21ref|XM_379820.2| PREDICTED: Homo sapiens hypothetical protein FL... 38 6.3
22ref|XM_934306.1| PREDICTED: Homo sapiens hypothetical protein FL... 38 6.3
23ref|XM_934303.1| PREDICTED: Homo sapiens hypothetical protein FL... 38 6.3
24ref|XM_934299.1| PREDICTED: Homo sapiens hypothetical protein FL... 38 6.3
25ref|XM_934295.1| PREDICTED: Homo sapiens hypothetical protein FL... 38 6.3
26ref|XM_934292.1| PREDICTED: Homo sapiens hypothetical protein FL... 38 6.3
27ref|XM_934290.1| PREDICTED: Homo sapiens hypothetical protein FL... 38 6.3
28ref|XM_934285.1| PREDICTED: Homo sapiens hypothetical protein FL... 38 6.3
29ref|XM_934280.1| PREDICTED: Homo sapiens hypothetical protein FL... 38 6.3
30ref|XM_934277.1| PREDICTED: Homo sapiens hypothetical protein FL... 38 6.3
31ref|XM_376602.2| PREDICTED: Homo sapiens hypothetical protein FL... 38 6.3
32gb|AC017116.7| Homo sapiens BAC clone CTD-2518K21 from 7, comple... 38 6.3
33ref|XM_936807.1| PREDICTED: Homo sapiens similar to Ras GTPase-a... 38 6.3
34ref|XM_942990.1| PREDICTED: Homo sapiens similar to Ras GTPase-a... 38 6.3
35gb|DQ360291.1| Mus musculus strain SJL/J C-X3-C chemokine recept... 38 6.3
36ref|NM_008614.2| Mus musculus myelin-associated oligodendrocytic... 38 6.3
37gb|AC093668.4| Homo sapiens BAC clone RP11-514P8 from 7, complet... 38 6.3
38gb|AC004084.1| Homo sapiens BAC clone CTB-158O17 from 7, complet... 38 6.3
39dbj|AK028057.1| Mus musculus adult male cerebellum cDNA, RIKEN f... 38 6.3
40dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 38 6.3
41gb|AC093133.3| Papio anubis clone RP41-57F8, complete sequence 38 6.3
42dbj|AP003514.3| Oryza sativa (japonica cultivar-group) genomic D... 38 6.3
43gb|AF120476.1|AF120475S2 Mus musculus myelin-associated oligoden... 38 6.3
44gb|AC110091.4| Mus musculus BAC clone RP24-87K15 from 9, complet... 38 6.3
45gb|AE003537.3| Drosophila melanogaster chromosome 3L, section 48... 38 6.3
46gb|DQ065837.1| Burkholderia cepacia strain 2a plasmid pIJB1, com... 38 6.3
47dbj|AB011110.2| Homo sapiens mRNA for KIAA0538 protein, partial cds 38 6.3
48dbj|AB007000.1| Myxococcus xanthus MxppcB gene for propionyl-CoA... 38 6.3 
>emb|AL096761.1|HS754E20A Human DNA sequence from clone RP4-754E20 on chromosome 22q13.2,
             complete sequence
          Length = 65201

 Score = 44.1 bits (22), Expect = 0.10
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 29    gaggaaggaggttgtctccatt 50
             ||||||||||||||||||||||
Sbjct: 12935 gaggaaggaggttgtctccatt 12956
to top
>emb|AL671190.10| Mouse DNA sequence from clone RP23-464L12 on chromosome 4, complete
              sequence
          Length = 180239

 Score = 42.1 bits (21), Expect = 0.40
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 28     ggaggaaggaggttgtctcca 48
              |||||||||||||||||||||
Sbjct: 178167 ggaggaaggaggttgtctcca 178187
to top
>gb|AY540995.1| Achromobacter xylosoxidans subsp. denitrificans strain EST4002
            plasmid pEST4011, complete sequence
          Length = 76958

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 5    gaggcgctggccgtgcttgcggg 27
            ||||||||||||||| |||||||
Sbjct: 4953 gaggcgctggccgtgattgcggg 4931
to top
>gb|AC105052.3| Homo sapiens BAC clone RP11-577H5 from 7, complete sequence
          Length = 186465

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 24    cgggggaggaaggaggttg 42
             |||||||||||||||||||
Sbjct: 94020 cgggggaggaaggaggttg 94038
to top
>ref|XM_536803.2| PREDICTED: Canis familiaris similar to Nedd-4-like E3
          ubiquitin-protein ligase WWP2 (WW domain-containing
          protein 2) (Atropin-1 interacting protein 2) (AIP2),
          transcript variant 1 (LOC479672), mRNA
          Length = 2480

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                 
Query: 5  gaggcgctggccgtgcttgcggg 27
          ||||||||||||| |||||||||
Sbjct: 43 gaggcgctggccgagcttgcggg 65
to top
>gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete sequence
          Length = 3806533

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 61      cgggcgcgtccacgcggag 79
               |||||||||||||||||||
Sbjct: 3439007 cgggcgcgtccacgcggag 3438989
to top
>emb|CR627444.1| Homo sapiens mRNA; cDNA DKFZp781H1351 (from clone DKFZp781H1351)
          Length = 3194

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 24   cgggggaggaaggaggttg 42
            |||||||||||||||||||
Sbjct: 2362 cgggggaggaaggaggttg 2344
to top
>dbj|BA000032.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromosome 2, complete sequence
          Length = 1877212

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 7       ggcgctggccgtgcttgcg 25
               |||||||||||||||||||
Sbjct: 1356748 ggcgctggccgtgcttgcg 1356730
to top
>gb|AC091226.3| Drosophila melanogaster 3L BAC RP98-3I13 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 165518

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 83     ctatcaccatcgcctctcgtttc 105
              |||||| ||||||||||||||||
Sbjct: 157824 ctatcagcatcgcctctcgtttc 157802
to top
>gb|AC069405.6| Drosophila melanogaster 3L BAC RP98-17J20 (Roswell Park Cancer
             Institute Drosophila BAC Library) complete sequence
          Length = 167638

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 83    ctatcaccatcgcctctcgtttc 105
             |||||| ||||||||||||||||
Sbjct: 25935 ctatcagcatcgcctctcgtttc 25913
to top
>ref|NM_006989.3| Homo sapiens RAS p21 protein activator 4 (RASA4), mRNA
          Length = 5579

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 24   cgggggaggaaggaggttg 42
            |||||||||||||||||||
Sbjct: 4005 cgggggaggaaggaggttg 3987
to top
>ref|XM_936022.1| PREDICTED: Homo sapiens hypothetical protein FLJ21767, transcript
            variant 24 (FLJ21767), mRNA
          Length = 3360

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 24   cgggggaggaaggaggttg 42
            |||||||||||||||||||
Sbjct: 2825 cgggggaggaaggaggttg 2807
to top
>ref|XM_936021.1| PREDICTED: Homo sapiens hypothetical protein FLJ21767, transcript
            variant 23 (FLJ21767), mRNA
          Length = 3677

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 24   cgggggaggaaggaggttg 42
            |||||||||||||||||||
Sbjct: 3142 cgggggaggaaggaggttg 3124
to top
>ref|XM_936020.1| PREDICTED: Homo sapiens hypothetical protein FLJ21767, transcript
            variant 22 (FLJ21767), mRNA
          Length = 2886

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 24   cgggggaggaaggaggttg 42
            |||||||||||||||||||
Sbjct: 2351 cgggggaggaaggaggttg 2333
to top
>ref|XM_936019.1| PREDICTED: Homo sapiens hypothetical protein FLJ21767, transcript
            variant 21 (FLJ21767), mRNA
          Length = 2697

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 24   cgggggaggaaggaggttg 42
            |||||||||||||||||||
Sbjct: 2162 cgggggaggaaggaggttg 2144
to top
>ref|XM_936018.1| PREDICTED: Homo sapiens hypothetical protein FLJ21767, transcript
            variant 20 (FLJ21767), mRNA
          Length = 3295

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 24   cgggggaggaaggaggttg 42
            |||||||||||||||||||
Sbjct: 2760 cgggggaggaaggaggttg 2742
to top
>ref|XM_936017.1| PREDICTED: Homo sapiens hypothetical protein FLJ21767, transcript
            variant 19 (FLJ21767), mRNA
          Length = 4051

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 24   cgggggaggaaggaggttg 42
            |||||||||||||||||||
Sbjct: 3516 cgggggaggaaggaggttg 3498
to top
>ref|XM_936016.1| PREDICTED: Homo sapiens hypothetical protein FLJ21767, transcript
            variant 18 (FLJ21767), mRNA
          Length = 4441

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 24   cgggggaggaaggaggttg 42
            |||||||||||||||||||
Sbjct: 2356 cgggggaggaaggaggttg 2338
to top
>ref|XM_936013.1| PREDICTED: Homo sapiens hypothetical protein FLJ21767, transcript
            variant 15 (FLJ21767), mRNA
          Length = 2815

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 24   cgggggaggaaggaggttg 42
            |||||||||||||||||||
Sbjct: 2280 cgggggaggaaggaggttg 2262
to top
>ref|XM_936011.1| PREDICTED: Homo sapiens hypothetical protein FLJ21767, transcript
            variant 14 (FLJ21767), mRNA
          Length = 2860

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 24   cgggggaggaaggaggttg 42
            |||||||||||||||||||
Sbjct: 2325 cgggggaggaaggaggttg 2307
to top
>ref|XM_379820.2| PREDICTED: Homo sapiens hypothetical protein FLJ21767, transcript
            variant 2 (FLJ21767), mRNA
          Length = 3751

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 24   cgggggaggaaggaggttg 42
            |||||||||||||||||||
Sbjct: 3216 cgggggaggaaggaggttg 3198
to top
>ref|XM_934306.1| PREDICTED: Homo sapiens hypothetical protein FLJ21767, transcript
            variant 13 (FLJ21767), mRNA
          Length = 3360

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 24   cgggggaggaaggaggttg 42
            |||||||||||||||||||
Sbjct: 2825 cgggggaggaaggaggttg 2807
to top
>ref|XM_934303.1| PREDICTED: Homo sapiens hypothetical protein FLJ21767, transcript
            variant 12 (FLJ21767), mRNA
          Length = 3677

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 24   cgggggaggaaggaggttg 42
            |||||||||||||||||||
Sbjct: 3142 cgggggaggaaggaggttg 3124
to top
>ref|XM_934299.1| PREDICTED: Homo sapiens hypothetical protein FLJ21767, transcript
            variant 11 (FLJ21767), mRNA
          Length = 2886

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 24   cgggggaggaaggaggttg 42
            |||||||||||||||||||
Sbjct: 2351 cgggggaggaaggaggttg 2333
to top
>ref|XM_934295.1| PREDICTED: Homo sapiens hypothetical protein FLJ21767, transcript
            variant 10 (FLJ21767), mRNA
          Length = 2697

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 24   cgggggaggaaggaggttg 42
            |||||||||||||||||||
Sbjct: 2162 cgggggaggaaggaggttg 2144
to top
>ref|XM_934292.1| PREDICTED: Homo sapiens hypothetical protein FLJ21767, transcript
            variant 9 (FLJ21767), mRNA
          Length = 3295

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 24   cgggggaggaaggaggttg 42
            |||||||||||||||||||
Sbjct: 2760 cgggggaggaaggaggttg 2742
to top
>ref|XM_934290.1| PREDICTED: Homo sapiens hypothetical protein FLJ21767, transcript
            variant 8 (FLJ21767), mRNA
          Length = 4051

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 24   cgggggaggaaggaggttg 42
            |||||||||||||||||||
Sbjct: 3516 cgggggaggaaggaggttg 3498
to top
>ref|XM_934285.1| PREDICTED: Homo sapiens hypothetical protein FLJ21767, transcript
            variant 7 (FLJ21767), mRNA
          Length = 4441

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 24   cgggggaggaaggaggttg 42
            |||||||||||||||||||
Sbjct: 2356 cgggggaggaaggaggttg 2338
to top
>ref|XM_934280.1| PREDICTED: Homo sapiens hypothetical protein FLJ21767, transcript
            variant 4 (FLJ21767), mRNA
          Length = 2815

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 24   cgggggaggaaggaggttg 42
            |||||||||||||||||||
Sbjct: 2280 cgggggaggaaggaggttg 2262
to top
>ref|XM_934277.1| PREDICTED: Homo sapiens hypothetical protein FLJ21767, transcript
            variant 3 (FLJ21767), mRNA
          Length = 2860

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 24   cgggggaggaaggaggttg 42
            |||||||||||||||||||
Sbjct: 2325 cgggggaggaaggaggttg 2307
to top
>ref|XM_376602.2| PREDICTED: Homo sapiens hypothetical protein FLJ21767, transcript
            variant 1 (FLJ21767), mRNA
          Length = 3751

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 24   cgggggaggaaggaggttg 42
            |||||||||||||||||||
Sbjct: 3216 cgggggaggaaggaggttg 3198
to top
>gb|AC017116.7| Homo sapiens BAC clone CTD-2518K21 from 7, complete sequence
          Length = 86203

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 24    cgggggaggaaggaggttg 42
             |||||||||||||||||||
Sbjct: 12590 cgggggaggaaggaggttg 12608
to top
>ref|XM_936807.1| PREDICTED: Homo sapiens similar to Ras GTPase-activating protein 4
            (RasGAP-activating-like protein 2) (Calcium-promoted Ras
            inactivator), transcript variant 1 (LOC648426), mRNA
          Length = 2233

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 24   cgggggaggaaggaggttg 42
            |||||||||||||||||||
Sbjct: 1958 cgggggaggaaggaggttg 1940
to top
>ref|XM_942990.1| PREDICTED: Homo sapiens similar to Ras GTPase-activating protein 4
            (RasGAP-activating-like protein 2) (Calcium-promoted Ras
            inactivator), transcript variant 2 (LOC648426), mRNA
          Length = 2307

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 24   cgggggaggaaggaggttg 42
            |||||||||||||||||||
Sbjct: 2032 cgggggaggaaggaggttg 2014
to top
>gb|DQ360291.1| Mus musculus strain SJL/J C-X3-C chemokine receptor 1 (Cx3cr1), C-C motif
              chemokine receptor 8 (Ccr8), ribosomal protein SA (Rpsa),
              and myelin-associated oligodendrocytic basic protein (Mobp)
              genes, complete cds
          Length = 144780

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                         
Query: 25     gggggaggaaggaggttgtctccattt 51
              ||||||||||||||| || ||||||||
Sbjct: 141253 gggggaggaaggaggatgcctccattt 141227
to top
>ref|NM_008614.2| Mus musculus myelin-associated oligodendrocytic basic protein (Mobp),
            transcript variant 1, mRNA
          Length = 3286

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                       
Query: 25   gggggaggaaggaggttgtctccattt 51
            ||||||||||||||| || ||||||||
Sbjct: 1065 gggggaggaaggaggatgcctccattt 1039
to top
>gb|AC093668.4| Homo sapiens BAC clone RP11-514P8 from 7, complete sequence
          Length = 200771

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 24     cgggggaggaaggaggttg 42
              |||||||||||||||||||
Sbjct: 195168 cgggggaggaaggaggttg 195186



 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 24    cgggggaggaaggaggttg 42
             |||||||||||||||||||
Sbjct: 95989 cgggggaggaaggaggttg 96007
to top
>gb|AC004084.1| Homo sapiens BAC clone CTB-158O17 from 7, complete sequence
          Length = 93273

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 24    cgggggaggaaggaggttg 42
             |||||||||||||||||||
Sbjct: 56390 cgggggaggaaggaggttg 56372
to top
>dbj|AK028057.1| Mus musculus adult male cerebellum cDNA, RIKEN full-length enriched
            library, clone:1500035N02 product:myelin-associated
            oligodendrocytic basic protein, full insert sequence
          Length = 3286

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                       
Query: 25   gggggaggaaggaggttgtctccattt 51
            ||||||||||||||| || ||||||||
Sbjct: 1065 gggggaggaaggaggatgcctccattt 1039
to top
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 53      gccgtcgtcgggcgcgtcc 71
               |||||||||||||||||||
Sbjct: 4711755 gccgtcgtcgggcgcgtcc 4711773
to top
>gb|AC093133.3| Papio anubis clone RP41-57F8, complete sequence
          Length = 177993

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 24     cgggggaggaaggaggttg 42
              |||||||||||||||||||
Sbjct: 110746 cgggggaggaaggaggttg 110764
to top
>dbj|AP003514.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0698A06
          Length = 156514

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 53    gccgtcgtcgggcgcgtcc 71
             |||||||||||||||||||
Sbjct: 74354 gccgtcgtcgggcgcgtcc 74372
to top
>gb|AF120476.1|AF120475S2 Mus musculus myelin-associated oligodendrocytic basic proteins MOBP73
            and MOBP81 (Mobp) gene, exons 6 through 7c and complete
            cds, alternatively spliced
          Length = 4865

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                       
Query: 25   gggggaggaaggaggttgtctccattt 51
            ||||||||||||||| || ||||||||
Sbjct: 2756 gggggaggaaggaggatgcctccattt 2730
to top
>gb|AC110091.4| Mus musculus BAC clone RP24-87K15 from 9, complete sequence
          Length = 222792

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                         
Query: 25     gggggaggaaggaggttgtctccattt 51
              ||||||||||||||| || ||||||||
Sbjct: 109054 gggggaggaaggaggatgcctccattt 109028
to top
>gb|AE003537.3| Drosophila melanogaster chromosome 3L, section 48 of 83 of the complete
              sequence
          Length = 282116

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 83     ctatcaccatcgcctctcgtttc 105
              |||||| ||||||||||||||||
Sbjct: 221647 ctatcagcatcgcctctcgtttc 221625
to top
>gb|DQ065837.1| Burkholderia cepacia strain 2a plasmid pIJB1, complete sequence
          Length = 99448

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 5     gaggcgctggccgtgcttgcggg 27
             ||||||||||||||| |||||||
Sbjct: 53755 gaggcgctggccgtgattgcggg 53733
to top
>dbj|AB011110.2| Homo sapiens mRNA for KIAA0538 protein, partial cds
          Length = 5579

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 24   cgggggaggaaggaggttg 42
            |||||||||||||||||||
Sbjct: 4005 cgggggaggaaggaggttg 3987
to top
>dbj|AB007000.1| Myxococcus xanthus MxppcB gene for propionyl-CoA carboxylase,
            complete cds
          Length = 1970

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 14   gccgtgcttgcgggggagg 32
            |||||||||||||||||||
Sbjct: 1668 gccgtgcttgcgggggagg 1650


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 804,486
Number of Sequences: 3902068
Number of extensions: 804486
Number of successful extensions: 61633
Number of sequences better than 10.0: 48
Number of HSP's better than 10.0 without gapping: 48
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 61459
Number of HSP's gapped (non-prelim): 174
length of query: 134
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 113
effective length of database: 17,151,101,840
effective search space: 1938074507920
effective search space used: 1938074507920
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top