ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags30f06
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AB213316.1| Lolium perenne Lpck2a-1 mRNA for casein protein ... 829 0.0
2dbj|AB036788.1| Oryza sativa (indica cultivar-group) Kasalath OS... 615 e-173
3dbj|AB036787.1| Oryza sativa (japonica cultivar-group) Nipponbar... 615 e-173
4emb|Y11526.1|ZMCK2 Z.mays mRNA for casein kinase II alpha subunit 591 e-165
5gb|AY106259.1| Zea mays PCO082342 mRNA sequence 591 e-165
6gb|BT024107.1| Zea mays clone EL01N0520F10 mRNA sequence 575 e-161
7ref|NM_194133.2| Oryza sativa (japonica cultivar-group), mRNA 496 e-137
8dbj|AK070271.1| Oryza sativa (japonica cultivar-group) cDNA clon... 488 e-134
9ref|XM_469865.1| Oryza sativa (japonica cultivar-group), mRNA 480 e-132
10dbj|AB213317.1| Lolium perenne Lpck2a-2 mRNA for casein protein ... 480 e-132
11gb|AF042199.1|AF042199 Oryza sativa casein kinase mRNA, partial cds 472 e-130
12dbj|AB052133.1| Triticum aestivum tck2a mRNA for casein kinase I... 464 e-127
13gb|BT016803.1| Zea mays clone Contig636 mRNA sequence 369 7e-99
14gb|AF239819.1| Zea mays protein kinase CK2 catalytic subunit CK2... 365 1e-97
15gb|AF271237.1|AF271237 Zea mays casein kinase II alpha subunit m... 361 2e-96
16emb|X61387.1|ZMACK2 Z.mays ZMACK2 mRNA for casein kinase II alph... 361 2e-96
17gb|AY109433.1| Zea mays CL1074_1 mRNA sequence 333 4e-88
18emb|AJ251895.1|BVU251895 Beta vulgaris mRNA for protein kinase 2... 295 9e-77
19dbj|AB077051.1| Nicotiana tabacum NtCK2a2 mRNA for casein kinase... 260 5e-66
20dbj|AB077050.1| Nicotiana tabacum NtCK2a1 mRNA for casein kinase... 260 5e-66
21gb|BT012909.1| Lycopersicon esculentum clone 114027F, mRNA sequence 256 8e-65
22gb|AF517838.1| Lilium davidii CK2 catalytic alpha subunit mRNA, ... 252 1e-63
23emb|AJ437635.1|NTA437635 Nicotiana tabacum mRNA for protein kina... 252 1e-63
24dbj|AB077052.1| Nicotiana tabacum NtCK2a3 mRNA for casein kinase... 252 1e-63
25emb|AJ438263.1|NTA438263 Nicotiana tabacum mRNA for protein kina... 246 7e-62
26gb|AF374474.1|AF374474 Nicotiana tabacum CK2 alpha subunit (CK2A... 246 7e-62
27emb|AJ438264.1|NTA438264 Nicotiana tabacum mRNA for protein kina... 238 2e-59
28ref|NM_114860.2| Arabidopsis thaliana CKA2; kinase AT3G50000 (CK... 182 9e-43
29ref|NM_126138.2| Arabidopsis thaliana CKA1; kinase AT5G67380 (CK... 182 9e-43
30ref|NM_001037088.1| Arabidopsis thaliana CKA1; kinase AT5G67380 ... 182 9e-43
31gb|BT000888.1| Arabidopsis thaliana clone C105364 Casein kinase ... 182 9e-43
32gb|AF370308.1| Arabidopsis thaliana putative casein kinase II, a... 182 9e-43
33gb|AF386966.1|AF386966 Arabidopsis thaliana casein kinase II alp... 182 9e-43
34emb|BX824158.1|CNS0A5PM Arabidopsis thaliana Full-length cDNA Co... 182 9e-43
35gb|BT002141.1| Arabidopsis thaliana casein kinase II alpha subun... 182 9e-43
36emb|BX820898.1|CNS0A9LL Arabidopsis thaliana Full-length cDNA Co... 178 1e-41
37dbj|D10247.1|ATHCK2B Arabidopsis thaliana ATPK15D mRNA for casei... 176 6e-41
38ref|NM_127871.3| Arabidopsis thaliana ATP binding / casein kinas... 170 4e-39
39gb|AY536852.1| Arabidopsis thaliana putative casein kinase II ca... 170 4e-39
40gb|AY081478.1| Arabidopsis thaliana putative casein kinase II ca... 170 4e-39
41gb|AY062631.1| Arabidopsis thaliana putative casein kinase II ca... 170 4e-39
42ref|NM_201789.1| Arabidopsis thaliana ATP binding / casein kinas... 165 2e-37
43ref|NM_127872.2| Arabidopsis thaliana ATP binding / casein kinas... 165 2e-37
44gb|AY062954.1| Arabidopsis thaliana putative casein kinase II ca... 165 2e-37
45gb|AY035088.1| Arabidopsis thaliana putative casein kinase II ca... 165 2e-37
46emb|BX819262.1|CNS0A8ZG Arabidopsis thaliana Full-length cDNA Co... 165 2e-37
47emb|BX820723.1|CNS0A7WO Arabidopsis thaliana Full-length cDNA Co... 165 2e-37
48gb|AY087736.1| Arabidopsis thaliana clone 38084 mRNA, complete s... 165 2e-37
49dbj|D29696.1|RICYK8 Oryza sativa mRNA, partial homologous to cas... 159 1e-35
50dbj|D10246.1|ATHCK2A Arabidopsis thaliana ATPK12D mRNA for casei... 147 5e-32
51dbj|AK058359.1| Oryza sativa (japonica cultivar-group) cDNA clon... 143 8e-31
52emb|BX821292.1|CNS0A99K Arabidopsis thaliana Full-length cDNA Co... 141 3e-30
53gb|DQ157464.1| Oryza sativa (indica cultivar-group) strain Supha... 139 1e-29
54gb|DQ157463.1| Oryza sativa (indica cultivar-group) strain KDML ... 139 1e-29
55gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 139 1e-29
56gb|AC090713.6| Oryza sativa chromosome 3 BAC OSJNBa0002J24 genom... 139 1e-29
57dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 139 1e-29
58dbj|AB036786.1| Oryza sativa (indica cultivar-group) Kasalath OS... 139 1e-29
59dbj|AB036785.1| Oryza sativa (japonica cultivar-group) Nipponbar... 139 1e-29
60gb|AC084282.6| Oryza sativa chromosome 3 BAC OSJNBb0048A17 genom... 137 5e-29
61ref|XM_507072.1| PREDICTED Oryza sativa (japonica cultivar-group... 135 2e-28
62dbj|AK120259.1| Oryza sativa (japonica cultivar-group) cDNA clon... 135 2e-28
63dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 109 1e-20
64dbj|AP005244.3| Oryza sativa (japonica cultivar-group) genomic D... 109 1e-20
65emb|AJ420786.1|SAL420786 Sinapis alba mRNA for chloroplast casei... 107 4e-20
66emb|Y11649.1|ZMPKCK2AL Zea mays gene encoding protein kinase CK2... 98 4e-17
67ref|NM_060410.2| Caenorhabditis elegans protein KINase family me... 92 3e-15
68gb|AF067211.2| Caenorhabditis elegans cosmid B0205, complete seq... 92 3e-15
69gb|J05274.1|CELCKINII C.elegans casein kinase II-alpha gene, com... 92 3e-15
70gb|AC144765.19| Medicago truncatula clone mth2-35o11, complete s... 86 2e-13
71gb|AC137703.42| Medicago truncatula clone mth2-11d24, complete s... 86 2e-13
72dbj|AP006092.1| Lotus japonicus genomic DNA, chromosome 4, clone... 86 2e-13
73gb|AC004401.3| Arabidopsis thaliana chromosome 2 clone F21P24 ma... 84 6e-13
74gb|BC072324.1| Xenopus laevis hypothetical protein MGC83125, mRN... 82 3e-12
75gb|BC072167.1| Xenopus laevis alpha subunit of casein kinase II,... 80 1e-11
76emb|CT025308.2| Xenopus tropicalis finished cDNA, clone TNeu098g04 80 1e-11
77emb|X62375.2|XLCKIIA Xenopus laevis mRNA for alpha subunit of ca... 80 1e-11
78ref|XM_752234.1| Ustilago maydis 521 hypothetical protein (UM011... 78 4e-11
79ref|XM_948210.1| Theileria annulata strain Ankara casein kinase ... 78 4e-11
80emb|AL132978.1|ATF3A4 Arabidopsis thaliana DNA chromosome 3, BAC... 78 4e-11
81emb|AJ315847.1|TAN315847 Theileria annulata ckII alpha gene for ... 78 4e-11
82ref|XM_865068.1| PREDICTED: Bos taurus similar to casein kinase ... 76 2e-10
83ref|XM_571600.1| Cryptococcus neoformans var. neoformans JEC21 p... 76 2e-10
84gb|AC132214.1| Genomic sequence for Oryza sativa, Nipponbare str... 76 2e-10
85gb|BC112816.1| Bos taurus casein kinase 2, alpha 1 polypeptide, ... 76 2e-10
86ref|NM_174635.2| Bos taurus casein kinase 2, alpha 1 polypeptide... 76 2e-10
87gb|AC105928.2| Oryza sativa (japonica cultivar-group) chromosome... 76 2e-10
88dbj|AB007645.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 76 2e-10
89emb|X54962.1|BTPCK1A B.taurus pCK1 mRNA for casein kinase II alp... 76 2e-10
90gb|M93665.1|BOVCAKINII Cow casein kinase II alpha subunit mRNA, ... 76 2e-10
91gb|BC059309.1| Xenopus laevis cDNA clone IMAGE:4960119, containi... 74 6e-10
92gb|AE017346.1| Cryptococcus neoformans var. neoformans JEC21 chr... 72 2e-09
93gb|DQ029118.1| Caenorhabditis remanei casein kinase II alpha sub... 72 2e-09
94ref|XM_469876.1| Oryza sativa (japonica cultivar-group), mRNA 70 1e-08
95gb|BC060742.1| Mus musculus casein kinase II, alpha 1 polypeptid... 70 1e-08
96gb|BC026149.1| Mus musculus casein kinase II, alpha 1 polypeptid... 70 1e-08
97ref|NM_007788.2| Mus musculus casein kinase II, alpha 1 polypept... 70 1e-08
98ref|XM_454135.1| Kluyveromyces lactis NRRL Y-1140, KLLA0E04136g ... 70 1e-08
99ref|XM_759202.1| Theileria parva strain Muguga chromosome 4 case... 70 1e-08
100emb|CR382125.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso... 70 1e-08
101dbj|AK146032.1| Mus musculus 14 days embryo liver cDNA, RIKEN fu... 70 1e-08
102dbj|AK158077.1| Mus musculus adult inner ear cDNA, RIKEN full-le... 70 1e-08
103dbj|AK031617.1| Mus musculus 13 days embryo male testis cDNA, RI... 70 1e-08
104dbj|AK011501.1| Mus musculus 10 days embryo whole body cDNA, RIK... 70 1e-08
105dbj|AK120812.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 1e-08
106gb|AC114588.9| Mus musculus chromosome 1, clone RP23-363M8, comp... 70 1e-08
107gb|BC089343.1| Mus musculus casein kinase II, alpha 1 polypeptid... 70 1e-08
108gb|U51866.1|MMU51866 Mus musculus casein kinase II alpha subunit... 70 1e-08
109gb|U17112.1|MMU17112 Mus musculus casein kinase II alpha subunit... 70 1e-08
110emb|X82233.1|MMGMCK2AC M.musculus gMCK2alphaC pseudogene 70 1e-08
111gb|M92084.1|THECKIIAS Theileria parva casein kinase II alpha sub... 70 1e-08
112ref|XM_361153.1| Magnaporthe grisea 70-15 hypothetical protein (... 68 4e-08
113ref|XM_514812.1| PREDICTED: Pan troglodytes similar to casein ki... 66 2e-07
114ref|NM_001002242.1| Gallus gallus casein kinase II alpha subunit... 66 2e-07
115gb|BC050036.1| Homo sapiens casein kinase 2, alpha 1 polypeptide... 66 2e-07
116gb|BT019792.1| Homo sapiens casein kinase 2, alpha 1 polypeptide... 66 2e-07
117ref|XM_417444.1| PREDICTED: Gallus gallus similar to casein kina... 66 2e-07
118ref|NM_177560.2| Homo sapiens casein kinase 2, alpha 1 polypepti... 66 2e-07
119ref|NM_177559.2| Homo sapiens casein kinase 2, alpha 1 polypepti... 66 2e-07
120ref|NM_001895.3| Homo sapiens casein kinase 2, alpha 1 polypepti... 66 2e-07
121ref|XM_534375.2| PREDICTED: Canis familiaris similar to casein k... 66 2e-07
122ref|XM_856724.1| PREDICTED: Canis familiaris similar to casein k... 66 2e-07
123ref|XM_845486.1| PREDICTED: Canis familiaris similar to casein k... 66 2e-07
124emb|X64692.1|HSCKPSEU H.sapiens casein kinase II (alpha subunit)... 66 2e-07
125gb|AY112721.1| Homo sapiens casein kinase II alpha subunit mRNA,... 66 2e-07
126gb|AC023946.5| Homo sapiens chromosome 11, clone RP11-567I13, co... 66 2e-07
127emb|CR590205.1| full-length cDNA clone CS0DL006YJ05 of B cells (... 66 2e-07
128ref|NR_002207.1| Homo sapiens casein kinase 2, alpha 1 polypepti... 66 2e-07
129gb|AY335731.1| Synthetic construct Homo sapiens casein kinase 2,... 66 2e-07
130gb|DQ354583.1| Homo sapiens casein kinase 2 alpha isoform mRNA, ... 66 2e-07
131gb|AY888226.1| Synthetic construct Homo sapiens clone FLH020226.... 66 2e-07
132gb|BC011668.2| Homo sapiens casein kinase 2, alpha 1 polypeptide... 66 2e-07
133gb|BC071167.1| Homo sapiens casein kinase 2, alpha 1 polypeptide... 66 2e-07
134gb|BC053532.1| Homo sapiens casein kinase 2, alpha 1 polypeptide... 66 2e-07
135gb|BC002615.2| Homo sapiens casein kinase 2, alpha 1 polypeptide... 66 2e-07
136emb|X70251.1|HSCKIIAL Homo sapiens CKII-alpha gene 66 2e-07
137gb|J02853.1|HUMCKIA Homo sapiens casein kinase II alpha subunit ... 66 2e-07
138gb|S53149.1| Homo sapiens casein kinase II-alpha subunit mRNA, c... 66 2e-07
139gb|M59456.1|CHKCLIIAS Chicken casein kinase II alpha subunit mRN... 66 2e-07
140gb|M55265.1|HUMACKII Human casein kinase II alpha subunit mRNA, ... 66 2e-07
141ref|XM_637801.1| Dictyostelium discoideum casein kinase II alpha... 64 6e-07
142ref|XM_694737.1| PREDICTED: Danio rerio similar to Ck2a1 protein... 64 6e-07
143ref|NM_001012691.1| Gallus gallus casein kinase 2, alpha prime p... 64 6e-07
144gb|M59457.1|CHKCKIIASA Chicken casein kinase II alpha' subunit m... 64 6e-07
145gb|L05535.1|DDICK2AS Dictyostelium discoideum casein kinase II a... 64 6e-07
146emb|CR937926.1| Single read from an extremity of a cDNA clone ma... 62 2e-06
147emb|CR937925.1| Single read from an extremity of a cDNA clone ma... 62 2e-06
148dbj|AK108187.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 2e-06
149ref|XM_653997.1| Aspergillus nidulans FGSC A4 casein kinase II s... 58 4e-05
150gb|AY558299.1| Saccharomyces cerevisiae clone FLH111276.01X YIL0... 58 4e-05
151emb|Z46861.1|SC9905 S.cerevisiae chromosome IX cosmid 9905 and l... 58 4e-05
152emb|CR859932.1| Pongo pygmaeus mRNA; cDNA DKFZp469K1920 (from cl... 58 4e-05
153gb|M22473.1|YSCCSKAS Yeast (S.cerevisiae) casein kinase II alpha... 58 4e-05
154ref|XM_535282.2| PREDICTED: Canis familiaris similar to Casein k... 56 1e-04
155gb|S56527.1| CK-II=casein kinase-II alpha subunit [rabbits, vasc... 56 1e-04
156gb|M98451.1|RABCKA2AB Oryctolagus cuniculus casein kinase-II alp... 56 1e-04
157gb|BC047143.1| Mus musculus cDNA clone IMAGE:6396398 54 6e-04
158ref|NM_009974.2| Mus musculus casein kinase II, alpha 2, polypep... 54 6e-04
159ref|XM_992182.1| PREDICTED: Mus musculus casein kinase II, alpha... 54 6e-04
160ref|XM_991797.1| PREDICTED: Mus musculus casein kinase II, alpha... 54 6e-04
161emb|AJ001420.1|MMCK2ALPH Mus musculus mRNA for CK2 alpha subunit 54 6e-04
162dbj|AK002927.1| Mus musculus adult male kidney cDNA, RIKEN full-... 54 6e-04
163dbj|AK076042.1| Mus musculus 10 days embryo whole body cDNA, RIK... 54 6e-04
164ref|NG_001359.1| Mus musculus casein kinase II, alpha 1 polypept... 54 6e-04
165dbj|AK030035.1| Mus musculus adult male testis cDNA, RIKEN full-... 54 6e-04
166gb|AC154515.2| Mus musculus BAC clone RP24-81I13 from chromosome... 54 6e-04
167gb|BC057862.1| Mus musculus casein kinase II, alpha 2, polypepti... 54 6e-04
168gb|AF012251.1|AF012251 Mus musculus casein kinase II, alpha prim... 54 6e-04
169dbj|AP006432.1| Lotus japonicus genomic DNA, chromosome 4, clone... 54 6e-04
170gb|M96173.1|MUSGHCK Mouse casein kinase II-alpha pseudogene 54 6e-04
171emb|CR962127.1| Medicago truncatula chromosome 5 clone mth2-181n... 52 0.002
172emb|AL049761.11|HSDJ863C7 Human DNA sequence from clone RP5-863C... 52 0.002
173gb|S72393.1| CSNK2A1=casein kinase II (CKII) subunit alpha [huma... 52 0.002
174dbj|AK013008.1| Mus musculus 10, 11 days embryo whole body cDNA,... 52 0.002
175gb|AC102555.11| Mus musculus chromosome 8, clone RP23-163N19, co... 52 0.002
176ref|NM_174636.2| Bos taurus casein kinase 2, alpha prime polypep... 52 0.002
177gb|AC165414.9| Mus musculus chromosome 8, clone RP23-424A21, com... 52 0.002
178emb|AL831735.10| Mouse DNA sequence from clone RP23-452D3 on chr... 52 0.002
179emb|X69951.1|HSCKIIA H.sapiens gene for casein kinase II alpha s... 52 0.002
180dbj|D17712.1|BOVPCK2A Bovine pCK2 mRNA for casein kinase II alph... 52 0.002
181gb|AY723867.1| Saccharomyces cerevisiae clone FLH006291.01X YOR0... 50 0.009
182ref|XM_742194.1| Aspergillus fumigatus Af293 casein kinase (Afu8... 50 0.009
183emb|Z74969.1|SCYOR061W S.cerevisiae chromosome XV reading frame ... 50 0.009
184emb|Z70678.1|SCXV55KB S.cerevisiae chromosome XV DNA, 54.7 kb re... 50 0.009
185ref|NM_168986.1| Drosophila melanogaster Casein kinase II subun... 50 0.009
186ref|NM_168985.1| Drosophila melanogaster Casein kinase II subun... 50 0.009
187ref|NM_080179.4| Drosophila melanogaster Casein kinase II subun... 50 0.009
188gb|AY069553.1| Drosophila melanogaster LD27706 full length cDNA 50 0.009
189gb|AC010663.6| Drosophila melanogaster 3L BAC RP98-17M18 (Roswel... 50 0.009
190gb|AC117276.7| Drosophila melanogaster 3 BAC RP98-29A7 (Roswell ... 50 0.009
191dbj|AK059258.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.009
192gb|AE002786.2| Drosophila melanogaster chromosome 3L, section 81... 50 0.009
193gb|M33759.1|YSCCKA2 S.cerevisiae casein kinase-II alpha' subunit... 50 0.009
194gb|M16534.1|DROCSKA D.melanogaster casein kinase II alpha subuni... 50 0.009
195gb|AY816076.1| Schistosoma japonicum SJCHGC01351 protein mRNA, c... 48 0.035
196ref|NM_053824.1| Rattus norvegicus casein kinase II, alpha 1 pol... 48 0.035
197emb|AL116068.1|CNS01CWC Botrytis cinerea strain T4 cDNA library 48 0.035
198emb|AL112276.1|CNS019Z0 Botrytis cinerea strain T4 cDNA library 48 0.035
199ref|XM_226237.3| PREDICTED: Rattus norvegicus casein kinase II, ... 48 0.035
200ref|XM_315576.2| Anopheles gambiae str. PEST ENSANGP00000017774 ... 48 0.035
201gb|BC091130.1| Rattus norvegicus casein kinase II, alpha 1 polyp... 48 0.035
202gb|L15618.1|RATCK2ALPH Rat casein kinase II alpha subunit (CK2) ... 48 0.035
203ref|XM_511002.1| PREDICTED: Pan troglodytes LOC454131 (LOC454131... 46 0.14
204gb|BT019793.1| Synthetic construct Homo sapiens casein kinase 2,... 46 0.14
205gb|BC008812.2| Homo sapiens casein kinase 2, alpha prime polypep... 46 0.14
206ref|NM_001896.2| Homo sapiens casein kinase 2, alpha prime polyp... 46 0.14
207gb|AY335742.1| Synthetic construct Homo sapiens casein kinase 2,... 46 0.14
208gb|AC009107.11| Homo sapiens chromosome 16 clone RP11-459F6, com... 46 0.14
209gb|AC026771.6| Homo sapiens chromosome 16 clone CTB-134F13, comp... 46 0.14
210gb|AY890815.1| Synthetic construct Homo sapiens clone FLH009443.... 46 0.14
211gb|M55268.1|HUMA1CKII Human casein kinase II alpha' subunit mRNA... 46 0.14
212gb|AC111110.21| Mus musculus chromosome 1, clone RP23-201B13, co... 44 0.55
213gb|AC117076.3| Dictyostelium discoideum chromosome 2 map 3323568... 44 0.55
214emb|Z98559.1|SPAC23C11 S.pombe chromosome I cosmid c23C11 44 0.55
215emb|X74275.1|SPCKIIA S.pombe mRNA for casein kinase II alpha sub... 44 0.55
216ref|NM_001019073.1| Schizosaccharomyces pombe 972h- hypothetical... 44 0.55
217gb|L29508.1|YSPCKICAAA Schizosaccharomyces pombe casein kinase I... 44 0.55
218gb|BC044403.1| Danio rerio casein kinase 2 alpha 1, mRNA (cDNA c... 42 2.2
219gb|BC067595.1| Danio rerio cDNA clone IMAGE:6519793, containing ... 42 2.2
220ref|XM_380853.1| Gibberella zeae PH-1 chromosome 1 KC2A_NEUCR Ca... 42 2.2
221gb|CP000089.1| Dechloromonas aromatica RCB, complete genome 42 2.2
222dbj|AB206394.1| Bombyx mori BmCK2a mRNA for casein kinase 2 alph... 42 2.2
223gb|AY052172.1| Drosophila simulans isolate sim8 CKII-alpha gene,... 42 2.2
224gb|AY052171.1| Drosophila simulans isolate sim7 CKII-alpha gene,... 42 2.2
225gb|AY052170.1| Drosophila simulans isolate sim6 CKII-alpha gene,... 42 2.2
226gb|AY052169.1| Drosophila simulans isolate sim5 CKII-alpha gene,... 42 2.2
227gb|AY052168.1| Drosophila simulans isolate sim4 CKII-alpha gene,... 42 2.2
228gb|AY052167.1| Drosophila simulans isolate sim3 CKII-alpha gene,... 42 2.2
229gb|AY052166.1| Drosophila simulans isolate sim2 CKII-alpha gene,... 42 2.2
230gb|AY052165.1| Drosophila simulans isolate sim1 CKII-alpha gene,... 42 2.2
231ref|XM_696871.1| PREDICTED: Danio rerio hypothetical protein LOC... 42 2.2
232gb|S76875.1| casein kinase 2 alpha subunit=protein kinase [Danio... 42 2.2
233ref|NM_131252.1| Danio rerio casein kinase 2 alpha 1 (ck2a1), mRNA 42 2.2
234dbj|AB024599.1| Hemicentrotus pulcherrimus mRNA for CK2 alpha su... 42 2.2
235gb|AY596298.1| Haloarcula marismortui ATCC 43049 chromosome II, ... 40 8.6
236gb|BC065457.1| Danio rerio taube nuss-like, mRNA (cDNA clone MGC... 40 8.6
237gb|BC049422.1| Danio rerio taube nuss-like, mRNA (cDNA clone MGC... 40 8.6
238gb|AC158990.2| Mus musculus BAC clone RP23-416E18 from chromosom... 40 8.6
239ref|XM_959890.1| Neurospora crassa OR74A hypothetical protein ( ... 40 8.6
240ref|XM_330559.1| Neurospora crassa OR74A hypothetical protein ( ... 40 8.6
241emb|BX842637.1| Neurospora crassa DNA linkage group I cosmid con... 40 8.6
242gb|AE016828.2| Coxiella burnetii RSA 493, complete genome 40 8.6
243gb|AC112243.5| Homo sapiens BAC clone RP11-517M22 from 4, comple... 40 8.6
244gb|AF494376.1| Neurospora crassa casein kinase II alpha subunit ... 40 8.6
245gb|AC090152.4| Homo sapiens chromosome 8, clone RP11-554M1, comp... 40 8.6
246ref|NM_200286.1| Danio rerio taube nuss-like (tbnl), mRNA 40 8.6
247gb|AC097488.2| Homo sapiens BAC clone RP11-218C23 from 4, comple... 40 8.6
248gb|AC068234.8| Homo sapiens chromosome 17, clone RP11-290H9, com... 40 8.6
249ref|XM_685099.1| PREDICTED: Danio rerio similar to Tbnl protein ... 40 8.6
250ref|XM_702616.1| PREDICTED: Danio rerio similar to RIKEN cDNA 17... 40 8.6
251ref|XM_702586.1| PREDICTED: Danio rerio similar to RIKEN cDNA 17... 40 8.6
252emb|CR388562.1| Gallus gallus finished cDNA, clone ChEST676k5 40 8.6
253emb|AL111841.1|CNS019MX Botrytis cinerea strain T4 cDNA library 40 8.6
254ref|XM_623394.1| PREDICTED: Apis mellifera similar to casein kin... 40 8.6
255ref|XM_623345.1| PREDICTED: Apis mellifera similar to casein kin... 40 8.6
256ref|XM_393260.2| PREDICTED: Apis mellifera similar to casein kin... 40 8.6
257gb|L28832.1|HUM3INGRN Homo sapiens integrin beta-3 subunit gene,... 40 8.6
258gb|AC084013.5| Homo sapiens BAC clone RP11-169I13 from 2, comple... 40 8.6
259emb|AL513406.1|CNS07EFT Human DNA sequence chromosome 8 of Homo ... 40 8.6
260emb|AJ749949.1| Francisella tularensis subsp. tularensis SCHU S4... 40 8.6
261emb|BX001041.6| Zebrafish DNA sequence from clone CH211-62M7, co... 40 8.6

>dbj|AB213316.1| Lolium perenne Lpck2a-1 mRNA for casein protein kinase 2 alpha
            subunit, complete cds
          Length = 1629

 Score =  829 bits (418), Expect = 0.0
 Identities = 541/582 (92%)
 Strand = Plus / Plus

                                                                        
Query: 1    agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
            ||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||
Sbjct: 696  agccccataatgttatgatagatcatgagcttcgaaaacttcgcttgatagactggggcc 755

                                                                        
Query: 61   tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttca 120
            |||| ||||| |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 756  tggccgagttctaccatccaggcaaagaatacaatgtccgtgttgcttcaaggtatttca 815

                                                                        
Query: 121  agggacctgaacttctagttgatttgcaagattacgattattctctggacatgtggagcc 180
            |||||||||||||||| |||||||||||||||||||| || |||||||||||||||||||
Sbjct: 816  agggacctgaacttcttgttgatttgcaagattacgactactctctggacatgtggagcc 875

                                                                        
Query: 181  ttgggtgcatgtttgctgggatgatcttccgcaaggagccattcttctatggccatgata 240
            |||||||||||||||| |||||||| || || ||||||||||||||||||||||||||||
Sbjct: 876  ttgggtgcatgtttgccgggatgatatttcggaaggagccattcttctatggccatgata 935

                                                                        
Query: 241  accatgaccaacttgtgaaaattgcgaaggtacttggaacagacagcctgaatgcttact 300
            |||| |||||||||||||||||||| ||||| |||||||||||  | ||||||||||| |
Sbjct: 936  accacgaccaacttgtgaaaattgcaaaggtgcttggaacagatgggctgaatgcttatt 995

                                                                        
Query: 301  taaagaagtaccaccttgagcttgaccctcagcttgaacatcttgttggaaggcacagta 360
            | || ||||||||| |||||||||||||||| |||||||| |||||||||||||| || |
Sbjct: 996  tgaaaaagtaccacattgagcttgaccctcaccttgaacaccttgttggaaggcatagca 1055

                                                                        
Query: 361  gaaaaccctggtcaaagttcattaatgctgataaccagcatctagtatctcccgaggcca 420
            |||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||
Sbjct: 1056 gaaaaccctggtcaaagttcatcaatgctgataaccagcatctagtatcccccgaggcca 1115

                                                                        
Query: 421  tagattttctcgataagcttcttcgctatgatcaccaagataggctcactgctcgtgaag 480
            |||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||
Sbjct: 1116 tagattttctcgataagcttctccgctatgatcaccaagataggctcactgcgcgtgaag 1175

                                                                        
Query: 481  ctatggcgcatccatacttccttcaagtgagagcagcggagaacagcagggcacgaccgc 540
            |||||||||||||||||||||| ||||||| ||||||||| ||||||||| | ||||| |
Sbjct: 1176 ctatggcgcatccatacttcctccaagtgaaagcagcggaaaacagcaggtcgcgaccac 1235

                                                      
Query: 541  aatgacattgagtgtgcaccgtgcaaagtggagcagttgcta 582
            ||| ||||| ||| |||||||||  |||||||||||||||||
Sbjct: 1236 aataacattcagtctgcaccgtgttaagtggagcagttgcta 1277



to top

>dbj|AB036788.1| Oryza sativa (indica cultivar-group) Kasalath OSCKA2 mRNA for casein
            kinase II alpha subunit, complete cds
          Length = 1474

 Score =  615 bits (310), Expect = e-173
 Identities = 489/546 (89%), Gaps = 2/546 (0%)
 Strand = Plus / Plus

                                                                        
Query: 1    agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
            ||||||| ||||||||||| |||||||| || ||||||||||| ||||||||||||||||
Sbjct: 742  agccccacaatgttatgatagatcatgagctccgaaaacttcgattgatagactggggcc 801

                                                                        
Query: 61   tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttca 120
            |||| ||||| || |||||||| |||||||| ||||| ||||||||||||||||||||||
Sbjct: 802  tggctgagttctatcatccagggaaggaatataatgttcgtgttgcttcaaggtatttca 861

                                                                        
Query: 121  agggacctgaacttctagttgatttgcaagattacgattattctctggacatgtggagcc 180
            |||| ||||| ||||| ||||||||||||||||| ||||||||| |||||||||||||||
Sbjct: 862  aggggcctgagcttcttgttgatttgcaagattatgattattctttggacatgtggagcc 921

                                                                        
Query: 181  ttgggtgcatgtttgctgggatgatcttccgcaaggagccattcttctatggccatgata 240
            |||| |||||||||||||||||||| |||||||||||||||||||||||||| |||||||
Sbjct: 922  ttggttgcatgtttgctgggatgatattccgcaaggagccattcttctatggtcatgata 981

                                                                        
Query: 241  accatgaccaacttgtgaaaattgcgaaggtacttggaacagacagc-ctgaatgcttac 299
            ||||||| |||||||| || || || ||||||||||||||||| ||| || |||||||| 
Sbjct: 982  accatgatcaacttgtcaagatcgcaaaggtacttggaacaga-agcactaaatgcttat 1040

                                                                        
Query: 300  ttaaagaagtaccaccttgagcttgaccctcagcttgaacatcttgttggaaggcacagt 359
            || || ||||||||  |||||||||| ||||||||||||  ||||||||| ||||| |||
Sbjct: 1041 ttgaacaagtaccatattgagcttgatcctcagcttgaagctcttgttgggaggcatagt 1100

                                                                        
Query: 360  agaaaaccctggtcaaagttcattaatgctgataaccagcatctagtatctcccgaggcc 419
            |||||||| ||||| || |||||||||||||||||||| |||||||||||||| ||||| 
Sbjct: 1101 agaaaaccatggtcgaaattcattaatgctgataaccaacatctagtatctcctgaggct 1160

                                                                        
Query: 420  atagattttctcgataagcttcttcgctatgatcaccaagataggctcactgctcgtgaa 479
             |||||||||| ||||||||||| || |||||||||||||||||||||||||| ||||||
Sbjct: 1161 gtagattttcttgataagcttctacgttatgatcaccaagataggctcactgcacgtgaa 1220

                                                                        
Query: 480  gctatggcgcatccatacttccttcaagtgagagcagcggagaacagcagggcacgaccg 539
            |||||||| ||||| |||||||| ||||||||||| || || || ||||| |||||||| 
Sbjct: 1221 gctatggcacatccgtacttcctccaagtgagagctgcagaaaatagcagagcacgacca 1280

                  
Query: 540  caatga 545
            ||||||
Sbjct: 1281 caatga 1286



to top

>dbj|AB036787.1| Oryza sativa (japonica cultivar-group) Nipponbare OSCKA2 mRNA for
            casein kinase II alpha subunit, complete cds
          Length = 1474

 Score =  615 bits (310), Expect = e-173
 Identities = 489/546 (89%), Gaps = 2/546 (0%)
 Strand = Plus / Plus

                                                                        
Query: 1    agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
            ||||||| ||||||||||| |||||||| || ||||||||||| ||||||||||||||||
Sbjct: 742  agccccacaatgttatgatagatcatgagctccgaaaacttcgattgatagactggggcc 801

                                                                        
Query: 61   tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttca 120
            |||| ||||| || |||||||| |||||||| ||||| ||||||||||||||||||||||
Sbjct: 802  tggctgagttctatcatccagggaaggaatataatgttcgtgttgcttcaaggtatttca 861

                                                                        
Query: 121  agggacctgaacttctagttgatttgcaagattacgattattctctggacatgtggagcc 180
            |||| ||||| ||||| ||||||||||||||||| ||||||||| |||||||||||||||
Sbjct: 862  aggggcctgagcttcttgttgatttgcaagattatgattattctttggacatgtggagcc 921

                                                                        
Query: 181  ttgggtgcatgtttgctgggatgatcttccgcaaggagccattcttctatggccatgata 240
            |||| |||||||||||||||||||| |||||||||||||||||||||||||| |||||||
Sbjct: 922  ttggttgcatgtttgctgggatgatattccgcaaggagccattcttctatggtcatgata 981

                                                                        
Query: 241  accatgaccaacttgtgaaaattgcgaaggtacttggaacagacagc-ctgaatgcttac 299
            ||||||| |||||||| || || || ||||||||||||||||| ||| || |||||||| 
Sbjct: 982  accatgatcaacttgtcaagatcgcaaaggtacttggaacaga-agcactaaatgcttat 1040

                                                                        
Query: 300  ttaaagaagtaccaccttgagcttgaccctcagcttgaacatcttgttggaaggcacagt 359
            || || ||||||||  |||||||||| ||||||||||||  ||||||||| ||||| |||
Sbjct: 1041 ttgaacaagtaccatattgagcttgatcctcagcttgaagctcttgttgggaggcatagt 1100

                                                                        
Query: 360  agaaaaccctggtcaaagttcattaatgctgataaccagcatctagtatctcccgaggcc 419
            |||||||| ||||| || |||||||||||||||||||| |||||||||||||| ||||| 
Sbjct: 1101 agaaaaccatggtcgaaattcattaatgctgataaccaacatctagtatctcctgaggct 1160

                                                                        
Query: 420  atagattttctcgataagcttcttcgctatgatcaccaagataggctcactgctcgtgaa 479
             |||||||||| ||||||||||| || |||||||||||||||||||||||||| ||||||
Sbjct: 1161 gtagattttcttgataagcttctacgttatgatcaccaagataggctcactgcacgtgaa 1220

                                                                        
Query: 480  gctatggcgcatccatacttccttcaagtgagagcagcggagaacagcagggcacgaccg 539
            |||||||| ||||| |||||||| ||||||||||| || || || ||||| |||||||| 
Sbjct: 1221 gctatggcacatccgtacttcctccaagtgagagctgcagaaaatagcagagcacgacca 1280

                  
Query: 540  caatga 545
            ||||||
Sbjct: 1281 caatga 1286



to top

>emb|Y11526.1|ZMCK2 Z.mays mRNA for casein kinase II alpha subunit
          Length = 1388

 Score =  591 bits (298), Expect = e-165
 Identities = 469/526 (89%)
 Strand = Plus / Plus

                                                                        
Query: 1    agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
            ||||||||||||| ||||| ||||| || ||||| |||||||| ||||||||||||||| 
Sbjct: 480  agccccataatgtaatgatagatcacgagcttcgcaaacttcggttgatagactggggct 539

                                                                        
Query: 61   tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttca 120
            | || |||||||||||||||||||||||||| |||||||| ||||| || ||||||||||
Sbjct: 540  tagctgagttttaccatccaggcaaggaatataatgtccgcgttgcatcgaggtatttca 599

                                                                        
Query: 121  agggacctgaacttctagttgatttgcaagattacgattattctctggacatgtggagcc 180
            ||||||||||||| || |||||||| ||||| || ||||||||| ||||||||||||| |
Sbjct: 600  agggacctgaactccttgttgatttacaagactatgattattctttggacatgtggagtc 659

                                                                        
Query: 181  ttgggtgcatgtttgctgggatgatcttccgcaaggagccattcttctatggccatgata 240
            |||| |||||||||||||| ||||| || |||||||| |||||||| ||||||||||| |
Sbjct: 660  ttggttgcatgtttgctggaatgatatttcgcaaggaaccattcttttatggccatgaca 719

                                                                        
Query: 241  accatgaccaacttgtgaaaattgcgaaggtacttggaacagacagcctgaatgcttact 300
            ||||||||||||||||||| ||||| ||||| |||||||||||  |  |||||||||| |
Sbjct: 720  accatgaccaacttgtgaagattgcaaaggtccttggaacagatgggttgaatgcttatt 779

                                                                        
Query: 301  taaagaagtaccaccttgagcttgaccctcagcttgaacatcttgttggaaggcacagta 360
            | || ||||| ||| ||||||| |||||||| ||||||  ||||||||||||||| ||||
Sbjct: 780  tgaacaagtatcacattgagctggaccctcaacttgaagctcttgttggaaggcatagta 839

                                                                        
Query: 361  gaaaaccctggtcaaagttcattaatgctgataaccagcatctagtatctcccgaggcca 420
            |||||||||||||||||||||| |||||||||||||| ||||||||||| || |||||||
Sbjct: 840  gaaaaccctggtcaaagttcatgaatgctgataaccaacatctagtatcacctgaggcca 899

                                                                        
Query: 421  tagattttctcgataagcttcttcgctatgatcaccaagataggctcactgctcgtgaag 480
            ||||||||||||||||||| || ||||||||||||||||||||||||||||| |||||||
Sbjct: 900  tagattttctcgataagctcctgcgctatgatcaccaagataggctcactgcacgtgaag 959

                                                          
Query: 481  ctatggcgcatccatacttccttcaagtgagagcagcggagaacag 526
            ||||||| ||||| |||||||| ||||| ||||| | |||||||||
Sbjct: 960  ctatggcacatccctacttcctccaagtcagagctgtggagaacag 1005



to top

>gb|AY106259.1| Zea mays PCO082342 mRNA sequence
          Length = 1669

 Score =  591 bits (298), Expect = e-165
 Identities = 469/526 (89%)
 Strand = Plus / Plus

                                                                        
Query: 1    agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
            ||||||||||||| ||||| ||||| || ||||| |||||||| ||||||||||||||| 
Sbjct: 768  agccccataatgtaatgatagatcacgagcttcgcaaacttcggttgatagactggggct 827

                                                                        
Query: 61   tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttca 120
            | || |||||||||||||||||||||||||| |||||||| ||||| || ||||||||||
Sbjct: 828  tagctgagttttaccatccaggcaaggaatataatgtccgcgttgcatcgaggtatttca 887

                                                                        
Query: 121  agggacctgaacttctagttgatttgcaagattacgattattctctggacatgtggagcc 180
            ||||||||||||| || |||||||| ||||| || ||||||||| ||||||||||||| |
Sbjct: 888  agggacctgaactccttgttgatttacaagactatgattattctttggacatgtggagtc 947

                                                                        
Query: 181  ttgggtgcatgtttgctgggatgatcttccgcaaggagccattcttctatggccatgata 240
            |||| |||||||||||||| ||||| || |||||||| |||||||| ||||||||||| |
Sbjct: 948  ttggttgcatgtttgctggaatgatatttcgcaaggaaccattcttttatggccatgaca 1007

                                                                        
Query: 241  accatgaccaacttgtgaaaattgcgaaggtacttggaacagacagcctgaatgcttact 300
            ||||||||||||||||||| ||||| ||||| |||||||||||  |  |||||||||| |
Sbjct: 1008 accatgaccaacttgtgaagattgcaaaggtccttggaacagatgggttgaatgcttatt 1067

                                                                        
Query: 301  taaagaagtaccaccttgagcttgaccctcagcttgaacatcttgttggaaggcacagta 360
            | || ||||| ||| ||||||| |||||||| ||||||  ||||||||||||||| ||||
Sbjct: 1068 tgaacaagtatcacattgagctggaccctcaacttgaagctcttgttggaaggcatagta 1127

                                                                        
Query: 361  gaaaaccctggtcaaagttcattaatgctgataaccagcatctagtatctcccgaggcca 420
            |||||||||||||||||||||| |||||||||||||| ||||||||||| || |||||||
Sbjct: 1128 gaaaaccctggtcaaagttcatgaatgctgataaccaacatctagtatcacctgaggcca 1187

                                                                        
Query: 421  tagattttctcgataagcttcttcgctatgatcaccaagataggctcactgctcgtgaag 480
            ||||||||||||||||||| || ||||||||||||||||||||||||||||| |||||||
Sbjct: 1188 tagattttctcgataagctcctgcgctatgatcaccaagataggctcactgcacgtgaag 1247

                                                          
Query: 481  ctatggcgcatccatacttccttcaagtgagagcagcggagaacag 526
            ||||||| ||||| |||||||| ||||| ||||| | |||||||||
Sbjct: 1248 ctatggcacatccctacttcctccaagtcagagctgtggagaacag 1293



to top

>gb|BT024107.1| Zea mays clone EL01N0520F10 mRNA sequence
          Length = 1569

 Score =  575 bits (290), Expect = e-161
 Identities = 467/526 (88%)
 Strand = Plus / Plus

                                                                        
Query: 1    agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
            ||||||||||||| ||||| |||||||| |||||||||||||| ||||||||||||||| 
Sbjct: 684  agccccataatgtaatgatagatcatgagcttcgaaaacttcggttgatagactggggct 743

                                                                        
Query: 61   tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttca 120
            | || ||||| ||||||||||||||||||||||||||||||||||| || ||||||||||
Sbjct: 744  tagctgagttctaccatccaggcaaggaatacaatgtccgtgttgcatcgaggtatttca 803

                                                                        
Query: 121  agggacctgaacttctagttgatttgcaagattacgattattctctggacatgtggagcc 180
            ||||||||||||| || |||||||| ||||| || ||||||||| | ||||||||||| |
Sbjct: 804  agggacctgaactccttgttgatttacaagactatgattattctttagacatgtggagtc 863

                                                                        
Query: 181  ttgggtgcatgtttgctgggatgatcttccgcaaggagccattcttctatggccatgata 240
            |||| |||||||||||||| ||||| || |||||||| |||||||| ||||||||||| |
Sbjct: 864  ttggttgcatgtttgctggaatgatatttcgcaaggaaccattcttttatggccatgaca 923

                                                                        
Query: 241  accatgaccaacttgtgaaaattgcgaaggtacttggaacagacagcctgaatgcttact 300
            ||||||||||||||||||| ||||| ||||| |||||||||||  | |||||| |||| |
Sbjct: 924  accatgaccaacttgtgaagattgcaaaggtccttggaacagatgggctgaattcttatt 983

                                                                        
Query: 301  taaagaagtaccaccttgagcttgaccctcagcttgaacatcttgttggaaggcacagta 360
            | || ||||||||| ||||||| |||||||| ||||||  ||||||||||||||| ||||
Sbjct: 984  tgaacaagtaccacattgagctggaccctcaacttgaagctcttgttggaaggcatagta 1043

                                                                        
Query: 361  gaaaaccctggtcaaagttcattaatgctgataaccagcatctagtatctcccgaggcca 420
            ||||||||||||  |||||||| |||| ||||||||| ||||||||||| || |||||||
Sbjct: 1044 gaaaaccctggttgaagttcatgaatggtgataaccaacatctagtatcacctgaggcca 1103

                                                                        
Query: 421  tagattttctcgataagcttcttcgctatgatcaccaagataggctcactgctcgtgaag 480
            ||||||||||||||||||| || ||||||||||||||||| ||||| ||||| || ||||
Sbjct: 1104 tagattttctcgataagctcctgcgctatgatcaccaagacaggcttactgcacgggaag 1163

                                                          
Query: 481  ctatggcgcatccatacttccttcaagtgagagcagcggagaacag 526
            ||||||| ||||| |||||||||||||| ||||| | |||||||||
Sbjct: 1164 ctatggcacatccctacttccttcaagtcagagctgtggagaacag 1209



to top

>ref|NM_194133.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1484

 Score =  496 bits (250), Expect = e-137
 Identities = 451/518 (87%)
 Strand = Plus / Plus

                                                                        
Query: 9    aatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctggcggag 68
            ||||||||||| ||||| || ||||||||||| || || |||||||||||||| || || 
Sbjct: 682  aatgttatgatagatcacgagcttcgaaaactccgattaatagactggggccttgctgaa 741

                                                                        
Query: 69   ttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttcaagggacct 128
            || ||||| || ||||||||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 742  ttctaccaccctggcaaggaatataatgtccgtgttgcttcaaggtacttcaagggacct 801

                                                                        
Query: 129  gaacttctagttgatttgcaagattacgattattctctggacatgtggagccttgggtgc 188
            || ||||| ||||| ||||||||||| || || ||| ||||||||||||| ||||| |||
Sbjct: 802  gagcttcttgttgacttgcaagattatgactactctttggacatgtggagtcttggttgc 861

                                                                        
Query: 189  atgtttgctgggatgatcttccgcaaggagccattcttctatggccatgataaccatgac 248
            ||||||||||| ||||||||||||||||||||||| |||||||| ||||| |||||||| 
Sbjct: 862  atgtttgctggaatgatcttccgcaaggagccatttttctatggtcatgacaaccatgat 921

                                                                        
Query: 249  caacttgtgaaaattgcgaaggtacttggaacagacagcctgaatgcttacttaaagaag 308
            |||||||| || || || ||||||||||| ||||||||||||||| | ||||| || |||
Sbjct: 922  caacttgttaagatcgcaaaggtacttgggacagacagcctgaattcatacttgaacaag 981

                                                                        
Query: 309  taccaccttgagcttgaccctcagcttgaacatcttgttggaaggcacagtagaaaaccc 368
            ||||   ||||||||||||| |||||||||   || |||||||||||||| || ||||| 
Sbjct: 982  taccgtattgagcttgacccacagcttgaagccctcgttggaaggcacagcaggaaacct 1041

                                                                        
Query: 369  tggtcaaagttcattaatgctgataaccagcatctagtatctcccgaggccatagatttt 428
            ||||||||||| ||||||||||| ||||| ||||||||||| || |||||||| ||||| 
Sbjct: 1042 tggtcaaagtttattaatgctgacaaccaacatctagtatccccagaggccatcgatttc 1101

                                                                        
Query: 429  ctcgataagcttcttcgctatgatcaccaagataggctcactgctcgtgaagctatggcg 488
            || || ||||||||||||||||||||||| ||||| || ||||| |||||||||||||| 
Sbjct: 1102 cttgacaagcttcttcgctatgatcaccaggatagacttactgcacgtgaagctatggca 1161

                                                  
Query: 489  catccatacttccttcaagtgagagcagcggagaacag 526
            || |||||||| || |||||||| || |||||||||||
Sbjct: 1162 cacccatactttctccaagtgagggctgcggagaacag 1199



to top

>dbj|AK070271.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023047E06, full
            insert sequence
          Length = 1485

 Score =  488 bits (246), Expect = e-134
 Identities = 450/518 (86%)
 Strand = Plus / Plus

                                                                        
Query: 9    aatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctggcggag 68
            ||||||||||| ||||| || ||||||||||| || || |||||||||||||| || || 
Sbjct: 683  aatgttatgatagatcacgagcttcgaaaactccgattaatagactggggccttgctgaa 742

                                                                        
Query: 69   ttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttcaagggacct 128
            || ||||| || ||||||||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 743  ttctaccaccctggcaaggaatataatgtccgtgttgcttcaaggtacttcaagggacct 802

                                                                        
Query: 129  gaacttctagttgatttgcaagattacgattattctctggacatgtggagccttgggtgc 188
            || ||||| ||||| ||||||||||| || || ||| ||||||||||||| ||||| |||
Sbjct: 803  gagcttcttgttgacttgcaagattatgactactctttggacatgtggagtcttggttgc 862

                                                                        
Query: 189  atgtttgctgggatgatcttccgcaaggagccattcttctatggccatgataaccatgac 248
            ||||||||||| ||||||||||||||||||||| | |||||||| ||||| |||||||| 
Sbjct: 863  atgtttgctggaatgatcttccgcaaggagccaattttctatggtcatgacaaccatgat 922

                                                                        
Query: 249  caacttgtgaaaattgcgaaggtacttggaacagacagcctgaatgcttacttaaagaag 308
            |||||||| || || || ||||||||||| ||||||||||||||| | ||||| || |||
Sbjct: 923  caacttgttaagatcgcaaaggtacttgggacagacagcctgaattcatacttgaacaag 982

                                                                        
Query: 309  taccaccttgagcttgaccctcagcttgaacatcttgttggaaggcacagtagaaaaccc 368
            ||||   ||||||||||||| |||||||||   || |||||||||||||| || ||||| 
Sbjct: 983  taccgtattgagcttgacccacagcttgaagccctcgttggaaggcacagcaggaaacct 1042

                                                                        
Query: 369  tggtcaaagttcattaatgctgataaccagcatctagtatctcccgaggccatagatttt 428
            ||||||||||| ||||||||||| ||||| ||||||||||| || |||||||| ||||| 
Sbjct: 1043 tggtcaaagtttattaatgctgacaaccaacatctagtatccccagaggccatcgatttc 1102

                                                                        
Query: 429  ctcgataagcttcttcgctatgatcaccaagataggctcactgctcgtgaagctatggcg 488
            || || ||||||||||||||||||||||| ||||| || ||||| |||||||||||||| 
Sbjct: 1103 cttgacaagcttcttcgctatgatcaccaggatagacttactgcacgtgaagctatggca 1162

                                                  
Query: 489  catccatacttccttcaagtgagagcagcggagaacag 526
            || |||||||| || |||||||| || |||||||||||
Sbjct: 1163 cacccatactttctccaagtgagggctgcggagaacag 1200



to top

>ref|XM_469865.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 642

 Score =  480 bits (242), Expect = e-132
 Identities = 388/434 (89%), Gaps = 2/434 (0%)
 Strand = Plus / Plus

                                                                       
Query: 113 gtatttcaagggacctgaacttctagttgatttgcaagattacgattattctctggacat 172
           |||||||||||| ||||| ||||| ||||||||||||||||| ||||||||| |||||||
Sbjct: 22  gtatttcaaggggcctgagcttcttgttgatttgcaagattatgattattctttggacat 81

                                                                       
Query: 173 gtggagccttgggtgcatgtttgctgggatgatcttccgcaaggagccattcttctatgg 232
           |||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 82  gtggagccttggttgcatgtttgctgggatgatattccgcaaggagccattcttctatgg 141

                                                                       
Query: 233 ccatgataaccatgaccaacttgtgaaaattgcgaaggtacttggaacagacagc-ctga 291
            |||||||||||||| |||||||| || || || ||||||||||||||||| ||| || |
Sbjct: 142 tcatgataaccatgatcaacttgtcaagatcgcaaaggtacttggaacaga-agcactaa 200

                                                                       
Query: 292 atgcttacttaaagaagtaccaccttgagcttgaccctcagcttgaacatcttgttggaa 351
           ||||||| || || ||||||||  |||||||||| ||||||||||||  ||||||||| |
Sbjct: 201 atgcttatttgaacaagtaccatattgagcttgatcctcagcttgaagctcttgttggga 260

                                                                       
Query: 352 ggcacagtagaaaaccctggtcaaagttcattaatgctgataaccagcatctagtatctc 411
           |||| ||||||||||| ||||| || |||||||||||||||||||| |||||||||||||
Sbjct: 261 ggcatagtagaaaaccatggtcgaaattcattaatgctgataaccaacatctagtatctc 320

                                                                       
Query: 412 ccgaggccatagattttctcgataagcttcttcgctatgatcaccaagataggctcactg 471
           | |||||  |||||||||| ||||||||||| || |||||||||||||||||||||||||
Sbjct: 321 ctgaggctgtagattttcttgataagcttctacgttatgatcaccaagataggctcactg 380

                                                                       
Query: 472 ctcgtgaagctatggcgcatccatacttccttcaagtgagagcagcggagaacagcaggg 531
           | |||||||||||||| ||||| |||||||| ||||||||||| || || || ||||| |
Sbjct: 381 cacgtgaagctatggcacatccgtacttcctccaagtgagagctgcagaaaatagcagag 440

                         
Query: 532 cacgaccgcaatga 545
           ||||||| ||||||
Sbjct: 441 cacgaccacaatga 454



to top

>dbj|AB213317.1| Lolium perenne Lpck2a-2 mRNA for casein protein kinase 2 alpha
            subunit, complete cds
          Length = 1472

 Score =  480 bits (242), Expect = e-132
 Identities = 458/530 (86%)
 Strand = Plus / Plus

                                                                        
Query: 1    agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
            ||||||| ||||||||||| |||||||| || || ||||| ||  | |||||||||||||
Sbjct: 612  agccccacaatgttatgatagatcatgagctccggaaactccgtctaatagactggggcc 671

                                                                        
Query: 61   tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttca 120
            | || || || |||||||| ||||||||||| |||||||||||||| |||||||| ||||
Sbjct: 672  ttgctgaattctaccatcctggcaaggaatataatgtccgtgttgcatcaaggtacttca 731

                                                                        
Query: 121  agggacctgaacttctagttgatttgcaagattacgattattctctggacatgtggagcc 180
            |||||||||| ||||| ||||| || ||||| || ||||| ||| ||||||||||||| |
Sbjct: 732  agggacctgagcttcttgttgacttacaagactatgattactctttggacatgtggagtc 791

                                                                        
Query: 181  ttgggtgcatgtttgctgggatgatcttccgcaaggagccattcttctatggccatgata 240
            |||| ||||||||||| || ||||| ||||||||||||||||| ||||||||||||||||
Sbjct: 792  ttggctgcatgtttgcaggaatgatattccgcaaggagccatttttctatggccatgata 851

                                                                        
Query: 241  accatgaccaacttgtgaaaattgcgaaggtacttggaacagacagcctgaatgcttact 300
            ||||||| |||||||| || ||||| |||||||||||||||||  | || ||||||||||
Sbjct: 852  accatgatcaacttgttaagattgcaaaggtacttggaacagatgggctaaatgcttact 911

                                                                        
Query: 301  taaagaagtaccaccttgagcttgaccctcagcttgaacatcttgttggaaggcacagta 360
            | || |||||||   ||||||| |||||||||||||||   ||||||||||||||||| |
Sbjct: 912  tgaacaagtaccgaattgagctcgaccctcagcttgaagcccttgttggaaggcacagca 971

                                                                        
Query: 361  gaaaaccctggtcaaagttcattaatgctgataaccagcatctagtatctcccgaggcca 420
            | ||||| ||||||||||| |||||||| || ||||||||||| ||||| || ||||| |
Sbjct: 972  ggaaaccttggtcaaagtttattaatgcggacaaccagcatcttgtatcccctgaggcta 1031

                                                                        
Query: 421  tagattttctcgataagcttcttcgctatgatcaccaagataggctcactgctcgtgaag 480
            ||||||| || || |||||||| |||||||||||||| |||||||| ||||| |||||||
Sbjct: 1032 tagatttccttgacaagcttctgcgctatgatcaccaggataggctaactgcacgtgaag 1091

                                                              
Query: 481  ctatggcgcatccatacttccttcaagtgagagcagcggagaacagcagg 530
            ||||||| |||||||||||||| || ||||| || || || |||||||||
Sbjct: 1092 ctatggcacatccatacttcctccaggtgagggccgcagaaaacagcagg 1141



to top

>gb|AF042199.1|AF042199 Oryza sativa casein kinase mRNA, partial cds
          Length = 819

 Score =  472 bits (238), Expect = e-130
 Identities = 448/518 (86%)
 Strand = Plus / Plus

                                                                       
Query: 9   aatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctggcggag 68
           ||||||||||| ||||| || ||||||||||| || || |||||||||||||| || || 
Sbjct: 11  aatgttatgatagatcacgagcttcgaaaactccgattaatagactggggccttgctgaa 70

                                                                       
Query: 69  ttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttcaagggacct 128
           || ||||| || ||||||||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 71  ttctaccaccctggcaaggaatataatgtccgtgttgcttcaaggtacttcaagggacct 130

                                                                       
Query: 129 gaacttctagttgatttgcaagattacgattattctctggacatgtggagccttgggtgc 188
           || ||||| ||||| ||||||||||| || || ||| ||||||||||||| ||||| |||
Sbjct: 131 gagcttcttgttgacttgcaagattatgactactctttggacatgtggagtcttggttgc 190

                                                                       
Query: 189 atgtttgctgggatgatcttccgcaaggagccattcttctatggccatgataaccatgac 248
           ||||||||||| ||||||||||||||||||||||| |||||||| ||||| |||||||| 
Sbjct: 191 atgtttgctggaatgatcttccgcaaggagccatttttctatggtcatgacaaccatgat 250

                                                                       
Query: 249 caacttgtgaaaattgcgaaggtacttggaacagacagcctgaatgcttacttaaagaag 308
           |||||||| || || || ||||||||||| ||||||||||||||| | ||||| || |||
Sbjct: 251 caacttgttaagatcgcaaaggtacttgggacagacagcctgaattcatacttgaacaag 310

                                                                       
Query: 309 taccaccttgagcttgaccctcagcttgaacatcttgttggaaggcacagtagaaaaccc 368
           ||||   ||||||||||||| |||||||||   || |||||||||||||| || ||||| 
Sbjct: 311 taccgtattgagcttgacccacagcttgaagccctcgttggaaggcacagcaggaaacct 370

                                                                       
Query: 369 tggtcaaagttcattaatgctgataaccagcatctagtatctcccgaggccatagatttt 428
           ||||| ||||| ||||||||||| ||||| ||||||||||| || || ||||| ||||| 
Sbjct: 371 tggtccaagtttattaatgctgacaaccaacatctagtatccccagaagccatcgatttc 430

                                                                       
Query: 429 ctcgataagcttcttcgctatgatcaccaagataggctcactgctcgtgaagctatggcg 488
           || || ||||||||||||||||||||||| ||||| || ||||| |||||||||||||| 
Sbjct: 431 cttgacaagcttcttcgctatgatcaccaggatagacttactgcacgtgaagctatggca 490

                                                 
Query: 489 catccatacttccttcaagtgagagcagcggagaacag 526
           || |||||||| || |||| ||| || |||||||||||
Sbjct: 491 cacccatactttctccaagggagggctgcggagaacag 528



to top

>dbj|AB052133.1| Triticum aestivum tck2a mRNA for casein kinase II alpha, complete cds
          Length = 1531

 Score =  464 bits (234), Expect = e-127
 Identities = 450/522 (86%)
 Strand = Plus / Plus

                                                                        
Query: 9    aatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctggcggag 68
            ||||||||||| |||||||| ||||||||||| || || |||||||||||||| || || 
Sbjct: 650  aatgttatgatagatcatgagcttcgaaaactccggttaatagactggggccttgctgaa 709

                                                                        
Query: 69   ttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttcaagggacct 128
            || |||||||| || ||||| || || || |||||||| |||||||| ||||||||||||
Sbjct: 710  ttctaccatcctggaaaggagtataacgttcgtgttgcatcaaggtacttcaagggacct 769

                                                                        
Query: 129  gaacttctagttgatttgcaagattacgattattctctggacatgtggagccttgggtgc 188
            || ||||| ||||| |||||||||||||| || ||| ||||||||||||| ||||| |||
Sbjct: 770  gagcttcttgttgacttgcaagattacgactactctttggacatgtggagtcttggctgc 829

                                                                        
Query: 189  atgtttgctgggatgatcttccgcaaggagccattcttctatggccatgataaccatgac 248
            ||||||||||| ||||| ||||||||||| ||||| || ||||||||||| |||||||| 
Sbjct: 830  atgtttgctggaatgatattccgcaaggaaccatttttttatggccatgacaaccatgat 889

                                                                        
Query: 249  caacttgtgaaaattgcgaaggtacttggaacagacagcctgaatgcttacttaaagaag 308
            |||||||| |||||||  |||||||||||||||||  | || |||| ||| || || |||
Sbjct: 890  caacttgttaaaattgaaaaggtacttggaacagatgggctaaatgtttatttgaacaag 949

                                                                        
Query: 309  taccaccttgagcttgaccctcagcttgaacatcttgttggaaggcacagtagaaaaccc 368
            |||    |||||||||||||||||||||||   || |||||||||||||| |||||||||
Sbjct: 950  tacagaattgagcttgaccctcagcttgaagccctcgttggaaggcacagcagaaaaccc 1009

                                                                        
Query: 369  tggtcaaagttcattaatgctgataaccagcatctagtatctcccgaggccatagatttt 428
            ||||| ||||| || ||||| || ||||||||||||||||| || |||||||||||||| 
Sbjct: 1010 tggtcgaagtttatcaatgcagacaaccagcatctagtatcccctgaggccatagatttc 1069

                                                                        
Query: 429  ctcgataagcttcttcgctatgatcaccaagataggctcactgctcgtgaagctatggcg 488
            || ||||||||||| |||||||||||||| ||||||||||| || |||||||||||||| 
Sbjct: 1070 cttgataagcttctgcgctatgatcaccaggataggctcaccgcacgtgaagctatggca 1129

                                                      
Query: 489  catccatacttccttcaagtgagagcagcggagaacagcagg 530
            |||||||||||||| || ||||| || || || |||||||||
Sbjct: 1130 catccatacttcctccaggtgagggctgccgaaaacagcagg 1171



to top

>gb|BT016803.1| Zea mays clone Contig636 mRNA sequence
          Length = 1570

 Score =  369 bits (186), Expect = 7e-99
 Identities = 444/530 (83%)
 Strand = Plus / Plus

                                                                        
Query: 1    agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
            ||||||| ||||||||||| |||||||| ||||| ||||| ||  |||||||||||||||
Sbjct: 660  agccccacaatgttatgatagatcatgagcttcggaaactccggctgatagactggggcc 719

                                                                        
Query: 61   tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttca 120
            | || || || || ||||| ||||||||||| |||||||||||||| || ||||| ||||
Sbjct: 720  ttgctgaattctatcatcctggcaaggaatataatgtccgtgttgcctccaggtacttca 779

                                                                        
Query: 121  agggacctgaacttctagttgatttgcaagattacgattattctctggacatgtggagcc 180
            |||| ||||| ||||| ||||| ||||||||||| ||||| ||||||||||||||||| |
Sbjct: 780  agggtcctgagcttcttgttgacttgcaagattatgattactctctggacatgtggagtc 839

                                                                        
Query: 181  ttgggtgcatgtttgctgggatgatcttccgcaaggagccattcttctatggccatgata 240
            | || |||||||||||||| ||||| || || ||||||||||| || || || ||||| |
Sbjct: 840  tgggctgcatgtttgctggaatgatttttcgtaaggagccatttttttacggtcatgaca 899

                                                                        
Query: 241  accatgaccaacttgtgaaaattgcgaaggtacttggaacagacagcctgaatgcttact 300
            ||||||| |||||||| || || || |||||||||||||||||  | |||||||  || |
Sbjct: 900  accatgatcaacttgttaagatagccaaggtacttggaacagatgggctgaatgtctatt 959

                                                                        
Query: 301  taaagaagtaccaccttgagcttgaccctcagcttgaacatcttgttggaaggcacagta 360
            | || ||||||    ||||||||||||||||||| |||   |||||||||||||| || |
Sbjct: 960  tgaacaagtacagaattgagcttgaccctcagctcgaagcccttgttggaaggcatagca 1019

                                                                        
Query: 361  gaaaaccctggtcaaagttcattaatgctgataaccagcatctagtatctcccgaggcca 420
            | ||||||||| ||||||| |||||||| || ||||| || ||||| ||||  |||||||
Sbjct: 1020 ggaaaccctggacaaagtttattaatgcagacaaccaacacctagtgtctcatgaggcca 1079

                                                                        
Query: 421  tagattttctcgataagcttcttcgctatgatcaccaagataggctcactgctcgtgaag 480
            ||||||| ||||| |||||| | || |||||||| || || ||||| ||||| |||||||
Sbjct: 1080 tagatttcctcgacaagcttttgcgttatgatcatcaggacaggcttactgcacgtgaag 1139

                                                              
Query: 481  ctatggcgcatccatacttccttcaagtgagagcagcggagaacagcagg 530
            ||||| | || ||||||||||  |||||||| || || ||||||||||||
Sbjct: 1140 ctatgacacacccatacttccaacaagtgagggctgcagagaacagcagg 1189



to top

>gb|AF239819.1| Zea mays protein kinase CK2 catalytic subunit CK2 alpha-3 mRNA,
            complete cds
          Length = 1540

 Score =  365 bits (184), Expect = 1e-97
 Identities = 442/528 (83%)
 Strand = Plus / Plus

                                                                        
Query: 1    agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
            ||||||| ||||||||||| ||||| || ||||| ||||| ||  |||||||||||||||
Sbjct: 634  agccccacaatgttatgatagatcacgagcttcggaaactccggctgatagactggggcc 693

                                                                        
Query: 61   tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttca 120
            | || || || || ||||| ||||||||||| |||||||||||||| || ||||| ||||
Sbjct: 694  ttgctgaattctatcatcctggcaaggaatataatgtccgtgttgcctccaggtacttca 753

                                                                        
Query: 121  agggacctgaacttctagttgatttgcaagattacgattattctctggacatgtggagcc 180
            |||| ||||| ||||| ||||| ||||||||||| ||||| ||||||||||||||||| |
Sbjct: 754  agggtcctgagcttcttgttgacttgcaagattatgattactctctggacatgtggagtc 813

                                                                        
Query: 181  ttgggtgcatgtttgctgggatgatcttccgcaaggagccattcttctatggccatgata 240
            | || |||||||||||||| ||||| || || ||||||||||| || || || ||||| |
Sbjct: 814  tgggctgcatgtttgctggaatgatttttcgtaaggagccatttttttacggtcatgaca 873

                                                                        
Query: 241  accatgaccaacttgtgaaaattgcgaaggtacttggaacagacagcctgaatgcttact 300
            ||||||| |||||||| || || || |||||||||||||||||  | |||||||  || |
Sbjct: 874  accatgatcaacttgttaagatagccaaggtacttggaacagatgggctgaatgtctatt 933

                                                                        
Query: 301  taaagaagtaccaccttgagcttgaccctcagcttgaacatcttgttggaaggcacagta 360
            | || ||||||    ||||||||||||||||||| |||   |||||||||||||| || |
Sbjct: 934  tgaacaagtacagaattgagcttgaccctcagctcgaagcccttgttggaaggcatagca 993

                                                                        
Query: 361  gaaaaccctggtcaaagttcattaatgctgataaccagcatctagtatctcccgaggcca 420
            | ||||||||| ||||||| |||||||| || ||||| || ||||| ||||  |||||||
Sbjct: 994  ggaaaccctggacaaagtttattaatgcagacaaccaacacctagtgtctcatgaggcca 1053

                                                                        
Query: 421  tagattttctcgataagcttcttcgctatgatcaccaagataggctcactgctcgtgaag 480
            ||||||||||||| |||||| | || |||||||| || || ||||| ||||| |||||||
Sbjct: 1054 tagattttctcgacaagcttttgcgttatgatcatcaggacaggcttactgcacgtgaag 1113

                                                            
Query: 481  ctatggcgcatccatacttccttcaagtgagagcagcggagaacagca 528
            ||||| | || ||||||||||  |||||||| || || ||||||||||
Sbjct: 1114 ctatgacacacccatacttccaacaagtgagggctgcagagaacagca 1161



to top

>gb|AF271237.1|AF271237 Zea mays casein kinase II alpha subunit mRNA, complete cds
          Length = 1170

 Score =  361 bits (182), Expect = 2e-96
 Identities = 443/530 (83%)
 Strand = Plus / Plus

                                                                        
Query: 1    agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
            ||||||| ||||||||||| |||||||| ||||| ||||| ||  ||||||||||||| |
Sbjct: 494  agccccacaatgttatgatagatcatgagcttcggaaactccggctgatagactggggtc 553

                                                                        
Query: 61   tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttca 120
            | || || || || ||||| ||||||||||| |||||||||||||| || ||||| ||||
Sbjct: 554  ttgctgaattctatcatcctggcaaggaatataatgtccgtgttgcatccaggtacttca 613

                                                                        
Query: 121  agggacctgaacttctagttgatttgcaagattacgattattctctggacatgtggagcc 180
            |||| ||||| ||||| ||||| ||||||||||| ||||| ||| ||||||||||||| |
Sbjct: 614  aggggcctgagcttcttgttgacttgcaagattatgattactctttggacatgtggagtc 673

                                                                        
Query: 181  ttgggtgcatgtttgctgggatgatcttccgcaaggagccattcttctatggccatgata 240
            | || |||||||||||||||||||| || || ||||| ||||| ||||| || ||||| |
Sbjct: 674  tgggctgcatgtttgctgggatgatttttcgtaaggaaccatttttctacgggcatgaca 733

                                                                        
Query: 241  accatgaccaacttgtgaaaattgcgaaggtacttggaacagacagcctgaatgcttact 300
            ||||||| |||||||| || || || ||||||||||| |||||  | ||||||| ||| |
Sbjct: 734  accatgatcaacttgttaagatagccaaggtacttgggacagatgggctgaatgtttatt 793

                                                                        
Query: 301  taaagaagtaccaccttgagcttgaccctcagcttgaacatcttgttggaaggcacagta 360
            | || ||||||    |||||||||||||||||||||||   || ||||||||||| || |
Sbjct: 794  tgaacaagtacagaattgagcttgaccctcagcttgaagccctcgttggaaggcatagca 853

                                                                        
Query: 361  gaaaaccctggtcaaagttcattaatgctgataaccagcatctagtatctcccgaggcca 420
            | |||||||||| |||||| || || || ||||||||||| ||||| ||||| |||||||
Sbjct: 854  ggaaaccctggttaaagtttatgaacgcagataaccagcacctagtgtctcctgaggcca 913

                                                                        
Query: 421  tagattttctcgataagcttcttcgctatgatcaccaagataggctcactgctcgtgaag 480
            ||||||| || || |||||| | || |||||||| || || ||||| ||||| | |||||
Sbjct: 914  tagatttccttgacaagcttttgcgttatgatcatcaggagaggcttactgcacttgaag 973

                                                              
Query: 481  ctatggcgcatccatacttccttcaagtgagagcagcggagaacagcagg 530
            ||||| |||| || |||||||  ||||||||||| || ||||||||||||
Sbjct: 974  ctatgacgcacccgtacttccaacaagtgagagccgctgagaacagcagg 1023



to top

>emb|X61387.1|ZMACK2 Z.mays ZMACK2 mRNA for casein kinase II alpha subunit
          Length = 1169

 Score =  361 bits (182), Expect = 2e-96
 Identities = 443/530 (83%)
 Strand = Plus / Plus

                                                                        
Query: 1    agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
            ||||||| ||||||||||| |||||||| ||||| ||||| ||  ||||||||||||| |
Sbjct: 493  agccccacaatgttatgatagatcatgagcttcggaaactccggctgatagactggggtc 552

                                                                        
Query: 61   tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttca 120
            | || || || || ||||| ||||||||||| |||||||||||||| || ||||| ||||
Sbjct: 553  ttgctgaattctatcatcctggcaaggaatataatgtccgtgttgcatccaggtacttca 612

                                                                        
Query: 121  agggacctgaacttctagttgatttgcaagattacgattattctctggacatgtggagcc 180
            |||| ||||| ||||| ||||| ||||||||||| ||||| ||| ||||||||||||| |
Sbjct: 613  aggggcctgagcttcttgttgacttgcaagattatgattactctttggacatgtggagtc 672

                                                                        
Query: 181  ttgggtgcatgtttgctgggatgatcttccgcaaggagccattcttctatggccatgata 240
            | || |||||||||||||||||||| || || ||||| ||||| ||||| || ||||| |
Sbjct: 673  tgggctgcatgtttgctgggatgatttttcgtaaggaaccatttttctacgggcatgaca 732

                                                                        
Query: 241  accatgaccaacttgtgaaaattgcgaaggtacttggaacagacagcctgaatgcttact 300
            ||||||| |||||||| || || || ||||||||||| |||||  | ||||||| ||| |
Sbjct: 733  accatgatcaacttgttaagatagccaaggtacttgggacagatgggctgaatgtttatt 792

                                                                        
Query: 301  taaagaagtaccaccttgagcttgaccctcagcttgaacatcttgttggaaggcacagta 360
            | || ||||||    |||||||||||||||||||||||   || ||||||||||| || |
Sbjct: 793  tgaacaagtacagaattgagcttgaccctcagcttgaagccctcgttggaaggcatagca 852

                                                                        
Query: 361  gaaaaccctggtcaaagttcattaatgctgataaccagcatctagtatctcccgaggcca 420
            | |||||||||| |||||| || || || ||||||||||| ||||| ||||| |||||||
Sbjct: 853  ggaaaccctggttaaagtttatgaacgcagataaccagcacctagtgtctcctgaggcca 912

                                                                        
Query: 421  tagattttctcgataagcttcttcgctatgatcaccaagataggctcactgctcgtgaag 480
            ||||||| || || |||||| | || |||||||| || || ||||| ||||| | |||||
Sbjct: 913  tagatttccttgacaagcttttgcgttatgatcatcaggagaggcttactgcacttgaag 972

                                                              
Query: 481  ctatggcgcatccatacttccttcaagtgagagcagcggagaacagcagg 530
            ||||| |||| || |||||||  ||||||||||| || ||||||||||||
Sbjct: 973  ctatgacgcacccgtacttccaacaagtgagagccgctgagaacagcagg 1022



to top

>gb|AY109433.1| Zea mays CL1074_1 mRNA sequence
          Length = 1537

 Score =  333 bits (168), Expect = 4e-88
 Identities = 438/530 (82%)
 Strand = Plus / Plus

                                                                        
Query: 1    agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
            ||||||| ||||||||||| |||||||| ||||| ||||| ||  ||||||||||||| |
Sbjct: 635  agccccacaatgttatgatagatcatgagcttcggaaactccggctgatagactggggtc 694

                                                                        
Query: 61   tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttca 120
            | || || || || ||||| ||||||||||| |||||||||||||| || ||||| ||||
Sbjct: 695  ttgctgaattctatcatcctggcaaggaatataatgtccgtgttgcatccaggtacttca 754

                                                                        
Query: 121  agggacctgaacttctagttgatttgcaagattacgattattctctggacatgtggagcc 180
            |||| ||||| ||||| ||||| ||||||||||| ||||| ||| ||||||||||||| |
Sbjct: 755  aggggcctgagcttcttgttgacttgcaagattatgattactctttggacatgtggagtc 814

                                                                        
Query: 181  ttgggtgcatgtttgctgggatgatcttccgcaaggagccattcttctatggccatgata 240
            | || |||||||||||||| ||||  || || |||||||||     ||| || ||||| |
Sbjct: 815  tgggctgcatgtttgctggaatganttttcgtaaggagccannnnnctacgggcatgaca 874

                                                                        
Query: 241  accatgaccaacttgtgaaaattgcgaaggtacttggaacagacagcctgaatgcttact 300
            ||||||| |||||||| || || || |||||||||||||||||  | |||||||  || |
Sbjct: 875  accatgatcaacttgttaagatagccaaggtacttggaacagatgggctgaatgtctatt 934

                                                                        
Query: 301  taaagaagtaccaccttgagcttgaccctcagcttgaacatcttgttggaaggcacagta 360
            | || ||||||    ||||||||||||||||||| |||   |||||||||||||| || |
Sbjct: 935  tgaacaagtacagaattgagcttgaccctcagctcgaagcccttgttggaaggcatagca 994

                                                                        
Query: 361  gaaaaccctggtcaaagttcattaatgctgataaccagcatctagtatctcccgaggcca 420
            | ||||||||| ||||||| |||||||| || ||||| || ||||| ||||  |||||||
Sbjct: 995  ggaaaccctggacaaagtttattaatgcagacaaccaacacctagtgtctcatgaggcca 1054

                                                                        
Query: 421  tagattttctcgataagcttcttcgctatgatcaccaagataggctcactgctcgtgaag 480
            ||||||| ||||| |||||| | || |||||||| || || ||||| ||||| |||||||
Sbjct: 1055 tagatttcctcgacaagcttttgcgttatgatcatcaggacaggcttactgcacgtgaag 1114

                                                              
Query: 481  ctatggcgcatccatacttccttcaagtgagagcagcggagaacagcagg 530
            ||||| | || ||||||||||  |||||||| || || ||||||||||||
Sbjct: 1115 ctatgacacacccatacttccaacaagtgagggctgcagagaacagcagg 1164



to top

>emb|AJ251895.1|BVU251895 Beta vulgaris mRNA for protein kinase 2 (cka2 gene)
          Length = 1527

 Score =  295 bits (149), Expect = 9e-77
 Identities = 356/425 (83%)
 Strand = Plus / Plus

                                                                        
Query: 48   atagactggggcctggcggagttttaccatccaggcaaggaatacaatgtccgtgttgct 107
            ||||| ||||| ||||| ||||| ||||||||||| |||||||||||||| ||||| |||
Sbjct: 706  atagattggggtctggcagagttctaccatccagggaaggaatacaatgttcgtgtggct 765

                                                                        
Query: 108  tcaaggtatttcaagggacctgaacttctagttgatttgcaagattacgattattctctg 167
            || || || || ||||| || |||||||| |||||||| ||||| || || |||||  ||
Sbjct: 766  tcgagatactttaaggggccggaacttcttgttgatttacaagactatgactattccttg 825

                                                                        
Query: 168  gacatgtggagccttgggtgcatgtttgctgggatgatcttccgcaaggagccattcttc 227
            ||||||||||||||||| |||||||||||||||||||| ||||| || || |||||||||
Sbjct: 826  gacatgtggagccttggttgcatgtttgctgggatgattttccggaaagaaccattcttc 885

                                                                        
Query: 228  tatggccatgataaccatgaccaacttgtgaaaattgcgaaggtacttggaacagacagc 287
            ||||| ||||| |||||||| || ||||| |||||||| |||||||||||||||||    
Sbjct: 886  tatggtcatgacaaccatgatcagcttgttaaaattgctaaggtacttggaacagatgaa 945

                                                                        
Query: 288  ctgaatgcttacttaaagaagtaccaccttgagcttgaccctcagcttgaacatcttgtt 347
            ||||||||||| || || ||||| ||  | |||||||| ||||| |||||   |||||||
Sbjct: 946  ctgaatgcttatttgaacaagtatcatttggagcttgatcctcaacttgatgctcttgtt 1005

                                                                        
Query: 348  ggaaggcacagtagaaaaccctggtcaaagttcattaatgctgataaccagcatctagta 407
            ||||||||||| || || || |||||||  ||  ||||| | ||||| |||||| |||| 
Sbjct: 1006 ggaaggcacagcaggaagccatggtcaagatttgttaatccggataatcagcatttagtt 1065

                                                                        
Query: 408  tctcccgaggccatagattttctcgataagcttcttcgctatgatcaccaagataggctc 467
            || || ||||| || || ||||| |||||||||||||||||||| ||||| |||||||| 
Sbjct: 1066 tcccctgaggctattgactttcttgataagcttcttcgctatgaccaccaggataggctt 1125

                 
Query: 468  actgc 472
            |||||
Sbjct: 1126 actgc 1130



to top

>dbj|AB077051.1| Nicotiana tabacum NtCK2a2 mRNA for casein kinase 2 catalytic
           subunit, complete cds
          Length = 1453

 Score =  260 bits (131), Expect = 5e-66
 Identities = 245/283 (86%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           ||||||||||||||||||| || ||||| || || || |||||||||||||| ||||| |
Sbjct: 674 agccccataatgttatgatagaccatgaactgcggaatcttcgcttgatagattggggtc 733

                                                                       
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttca 120
           | || || |||||||||||||| || ||||| |||||||||||||||||||| || ||||
Sbjct: 734 ttgctgaattttaccatccagggaaagaatataatgtccgtgttgcttcaagatacttca 793

                                                                       
Query: 121 agggacctgaacttctagttgatttgcaagattacgattattctctggacatgtggagcc 180
           |||| ||||||||||||||||| |||||||| || || |||||| |||||||||||||||
Sbjct: 794 agggccctgaacttctagttgacttgcaagactatgactattctttggacatgtggagcc 853

                                                                       
Query: 181 ttgggtgcatgtttgctgggatgatcttccgcaaggagccattcttctatggccatgata 240
           |||| ||||||||||| || |||||||| |||||||| || ||||| ||||| |||||||
Sbjct: 854 ttggctgcatgtttgcaggaatgatctttcgcaaggaacctttcttttatggtcatgata 913

                                                      
Query: 241 accatgaccaacttgtgaaaattgcgaaggtacttggaacaga 283
           | || || || || || |||||||| ||||||||||| |||||
Sbjct: 914 atcaggatcagctcgtcaaaattgcaaaggtacttgggacaga 956



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 92/110 (83%)
 Strand = Plus / Plus

                                                                        
Query: 345  gttggaaggcacagtagaaaaccctggtcaaagttcattaatgctgataaccagcatcta 404
            ||||| || |||||||| || || ||||| || || |||||||| || || |||||||||
Sbjct: 1018 gttgggagacacagtaggaagccatggtccaaatttattaatgcagacaatcagcatcta 1077

                                                              
Query: 405  gtatctcccgaggccatagattttctcgataagcttcttcgctatgatca 454
            || || || ||||| ||||||||||| || ||||||||||| ||||||||
Sbjct: 1078 gtgtcaccagaggctatagattttcttgacaagcttcttcgttatgatca 1127



to top

>dbj|AB077050.1| Nicotiana tabacum NtCK2a1 mRNA for casein kinase 2 catalytic
           subunit, complete cds
          Length = 1374

 Score =  260 bits (131), Expect = 5e-66
 Identities = 245/283 (86%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           ||||||||||||||||||| || ||||| || || || |||||||||||||| ||||| |
Sbjct: 596 agccccataatgttatgatagaccatgaactgcggaagcttcgcttgatagattggggtc 655

                                                                       
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttca 120
           | || || |||||||||||||| || ||||| |||||||||||||||||||| || ||||
Sbjct: 656 ttgctgaattttaccatccagggaaagaatataatgtccgtgttgcttcaagatacttca 715

                                                                       
Query: 121 agggacctgaacttctagttgatttgcaagattacgattattctctggacatgtggagcc 180
           |||| ||||||||||||||||| |||||||| || || |||||| |||||||||||||||
Sbjct: 716 agggccctgaacttctagttgacttgcaagactatgactattctttggacatgtggagcc 775

                                                                       
Query: 181 ttgggtgcatgtttgctgggatgatcttccgcaaggagccattcttctatggccatgata 240
           |||| ||||||||||| || |||||||| |||||||| || ||||| ||||| |||||||
Sbjct: 776 ttggctgcatgtttgcaggaatgatctttcgcaaggaacctttcttttatggtcatgata 835

                                                      
Query: 241 accatgaccaacttgtgaaaattgcgaaggtacttggaacaga 283
           | || || || || || |||||||| ||||||||||| |||||
Sbjct: 836 atcaggatcagctcgtcaaaattgcaaaggtacttgggacaga 878



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 92/110 (83%)
 Strand = Plus / Plus

                                                                        
Query: 345  gttggaaggcacagtagaaaaccctggtcaaagttcattaatgctgataaccagcatcta 404
            ||||| || |||||||| || || ||||| || || |||||||| || || |||||||||
Sbjct: 940  gttgggagacacagtaggaagccatggtccaaatttattaatgcagacaatcagcatcta 999

                                                              
Query: 405  gtatctcccgaggccatagattttctcgataagcttcttcgctatgatca 454
            || || || ||||| ||||||||||| || ||||||||||| ||||||||
Sbjct: 1000 gtgtcaccagaggctatagattttcttgacaagcttcttcgttatgatca 1049



to top

>gb|BT012909.1| Lycopersicon esculentum clone 114027F, mRNA sequence
          Length = 1574

 Score =  256 bits (129), Expect = 8e-65
 Identities = 360/437 (82%)
 Strand = Plus / Plus

                                                                        
Query: 6    cataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctggcg 65
            ||||| |||||||| || ||||| || || || |||||||||||||| ||||| || || 
Sbjct: 711  cataacgttatgatagaccatgaactgcggaagcttcgcttgatagattggggtcttgcc 770

                                                                        
Query: 66   gagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttcaaggga 125
            || |||||||| ||||| |||||||| ||||| ||||| |||||||| || |||||||| 
Sbjct: 771  gaattttaccacccagggaaggaatataatgttcgtgtggcttcaagatacttcaagggc 830

                                                                        
Query: 126  cctgaacttctagttgatttgcaagattacgattattctctggacatgtggagccttggg 185
            ||||||||||||||||| |||||||| || || |||||| ||||||||||||||||||| 
Sbjct: 831  cctgaacttctagttgacttgcaagactatgactattctttggacatgtggagccttggc 890

                                                                        
Query: 186  tgcatgtttgctgggatgatcttccgcaaggagccattcttctatggccatgataaccat 245
            ||||||||||| || ||||| ||||||||||| || ||||| |||||||||||||| || 
Sbjct: 891  tgcatgtttgcaggaatgattttccgcaaggaacctttcttttatggccatgataatcag 950

                                                                        
Query: 246  gaccaacttgtgaaaattgcgaaggtacttggaacagacagcctgaatgcttacttaaag 305
            || || || || |||||||| ||||||||||| |||||     ||||||| |||||  | 
Sbjct: 951  gatcagctcgtcaaaattgcaaaggtacttgggacagatgagttgaatgcgtacttgcac 1010

                                                                        
Query: 306  aagtaccaccttgagcttgaccctcagcttgaacatcttgttggaaggcacagtagaaaa 365
            ||||| || || |||||||| |||||||| ||   | | ||||| || |||||||| || 
Sbjct: 1011 aagtatcaactagagcttgatcctcagctagaggctatggttgggagacacagtaggaag 1070

                                                                        
Query: 366  ccctggtcaaagttcattaatgctgataaccagcatctagtatctcccgaggccatagat 425
            || ||||| || || |||||||| || || ||||||||||| || || ||||| ||||||
Sbjct: 1071 ccgtggtccaaatttattaatgcagacaatcagcatctagtgtcaccggaggctatagat 1130

                             
Query: 426  tttctcgataagcttct 442
            | ||| || ||||||||
Sbjct: 1131 tatcttgacaagcttct 1147



to top

>gb|AF517838.1| Lilium davidii CK2 catalytic alpha subunit mRNA, complete cds
          Length = 1480

 Score =  252 bits (127), Expect = 1e-63
 Identities = 238/275 (86%)
 Strand = Plus / Plus

                                                                       
Query: 9   aatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctggcggag 68
           ||||||||||| |||||||| ||||| || ||||| || ||||||||||| || || |||
Sbjct: 603 aatgttatgatagatcatgagcttcgtaagcttcgtttaatagactggggacttgctgag 662

                                                                       
Query: 69  ttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttcaagggacct 128
           ||||||||||| |||||||| || ||||| |||||||||||||| ||||||||||| |||
Sbjct: 663 ttttaccatcctggcaaggagtataatgttcgtgttgcttcaagatatttcaagggtcct 722

                                                                       
Query: 129 gaacttctagttgatttgcaagattacgattattctctggacatgtggagccttgggtgc 188
           ||||| || ||||||||||||||||| || |||||  |||| |||||||||||||| |||
Sbjct: 723 gaactccttgttgatttgcaagattatgactattccttggatatgtggagccttggatgc 782

                                                                       
Query: 189 atgtttgctgggatgatcttccgcaaggagccattcttctatggccatgataaccatgac 248
           ||||||||||| ||||| || |||||||| || || || || |||||||| |||||||| 
Sbjct: 783 atgtttgctggaatgatatttcgcaaggaaccctttttttacggccatgacaaccatgat 842

                                              
Query: 249 caacttgtgaaaattgcgaaggtacttggaacaga 283
           || ||||| |||||||| |||||||||||| ||||
Sbjct: 843 cagcttgttaaaattgccaaggtacttggagcaga 877



 Score =  176 bits (89), Expect = 6e-41
 Identities = 182/213 (85%)
 Strand = Plus / Plus

                                                                        
Query: 318  gagcttgaccctcagcttgaacatcttgttggaaggcacagtagaaaaccctggtcaaag 377
            ||||||||||| ||||||||   |||||| |||||||||||  | ||||| ||||| |||
Sbjct: 912  gagcttgacccacagcttgatgctcttgtcggaaggcacagccggaaaccttggtctaag 971

                                                                        
Query: 378  ttcattaatgctgataaccagcatctagtatctcccgaggccatagattttctcgataag 437
            || |||||||| ||||||||||||||||| ||||| ||||| ||||||||||| || |||
Sbjct: 972  tttattaatgcggataaccagcatctagtttctccagaggcaatagattttcttgacaag 1031

                                                                        
Query: 438  cttcttcgctatgatcaccaagataggctcactgctcgtgaagctatggcgcatccatac 497
            |||||||| |||||||| || ||| | || ||||| || ||||| ||| | |||||||| 
Sbjct: 1032 cttcttcgatatgatcatcaggatcgacttactgcacgagaagcaatgacacatccatat 1091

                                             
Query: 498  ttccttcaagtgagagcagcggagaacagcagg 530
            |||||||| ||||||||||| ||||||||||||
Sbjct: 1092 ttccttcaggtgagagcagcagagaacagcagg 1124



to top

>emb|AJ437635.1|NTA437635 Nicotiana tabacum mRNA for protein kinase CK2 alpha subunit (ck2A1
           gene)
          Length = 1356

 Score =  252 bits (127), Expect = 1e-63
 Identities = 244/283 (86%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           ||||||||||||||||||| || ||||| || || || |||||||||||||| ||||| |
Sbjct: 656 agccccataatgttatgatagaccatgaactgcggaagcttcgcttgatagattggggtc 715

                                                                       
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttca 120
           | || || |||||||||||||| || || || |||||||||||||||||||| || ||||
Sbjct: 716 ttgctgaattttaccatccagggaaagagtataatgtccgtgttgcttcaagatacttca 775

                                                                       
Query: 121 agggacctgaacttctagttgatttgcaagattacgattattctctggacatgtggagcc 180
           |||| ||||||||||||||||| |||||||| || || |||||| |||||||||||||||
Sbjct: 776 agggccctgaacttctagttgacttgcaagactatgactattctttggacatgtggagcc 835

                                                                       
Query: 181 ttgggtgcatgtttgctgggatgatcttccgcaaggagccattcttctatggccatgata 240
           |||| ||||||||||| || |||||||| |||||||| || ||||| ||||| |||||||
Sbjct: 836 ttggctgcatgtttgcaggaatgatctttcgcaaggaacctttcttttatggtcatgata 895

                                                      
Query: 241 accatgaccaacttgtgaaaattgcgaaggtacttggaacaga 283
           | || || || || || |||||||| ||||||||||| |||||
Sbjct: 896 atcaggatcagctcgtcaaaattgcaaaggtacttgggacaga 938



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 92/110 (83%)
 Strand = Plus / Plus

                                                                        
Query: 345  gttggaaggcacagtagaaaaccctggtcaaagttcattaatgctgataaccagcatcta 404
            ||||| || |||||||| || || ||||| || || |||||||| || || |||||||||
Sbjct: 1000 gttgggagacacagtaggaagccatggtccaaatttattaatgcagacaatcagcatcta 1059

                                                              
Query: 405  gtatctcccgaggccatagattttctcgataagcttcttcgctatgatca 454
            || || || ||||| ||||||||||| || ||||||||||| ||||||||
Sbjct: 1060 gtgtcaccagaggctatagattttcttgacaagcttcttcgttatgatca 1109



to top

>dbj|AB077052.1| Nicotiana tabacum NtCK2a3 mRNA for casein kinase 2 catalytic
           subunit, partial cds
          Length = 1101

 Score =  252 bits (127), Expect = 1e-63
 Identities = 244/283 (86%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           ||||||||||||||||||| || ||||| || || || |||||||||||||| ||||| |
Sbjct: 395 agccccataatgttatgatagaccatgaactgcggaagcttcgcttgatagattggggtc 454

                                                                       
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttca 120
           | || || |||||||||||||| || || || |||||||||||||||||||| || ||||
Sbjct: 455 ttgctgaattttaccatccagggaaagagtataatgtccgtgttgcttcaagatacttca 514

                                                                       
Query: 121 agggacctgaacttctagttgatttgcaagattacgattattctctggacatgtggagcc 180
           |||| ||||||||||||||||| |||||||| || || |||||| |||||||||||||||
Sbjct: 515 agggccctgaacttctagttgacttgcaagactatgactattctttggacatgtggagcc 574

                                                                       
Query: 181 ttgggtgcatgtttgctgggatgatcttccgcaaggagccattcttctatggccatgata 240
           |||| ||||||||||| || |||||||| |||||||| || ||||| ||||| |||||||
Sbjct: 575 ttggctgcatgtttgcaggaatgatctttcgcaaggaacctttcttttatggtcatgata 634

                                                      
Query: 241 accatgaccaacttgtgaaaattgcgaaggtacttggaacaga 283
           | || || || || || |||||||| ||||||||||| |||||
Sbjct: 635 atcaggatcagctcgtcaaaattgcaaaggtacttgggacaga 677



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 92/110 (83%)
 Strand = Plus / Plus

                                                                       
Query: 345 gttggaaggcacagtagaaaaccctggtcaaagttcattaatgctgataaccagcatcta 404
           ||||| || |||||||| || || ||||| || || |||||||| || || |||||||||
Sbjct: 739 gttgggagacacagtaggaagccatggtccaaatttattaatgcagacaatcagcatcta 798

                                                             
Query: 405 gtatctcccgaggccatagattttctcgataagcttcttcgctatgatca 454
           || || || ||||| ||||||||||| || ||||||||||| ||||||||
Sbjct: 799 gtgtcaccagaggctatagattttcttgacaagcttcttcgttatgatca 848



to top

>emb|AJ438263.1|NTA438263 Nicotiana tabacum mRNA for protein kinase CK2 alpha chain (ck2A3
            gene)
          Length = 1665

 Score =  246 bits (124), Expect = 7e-62
 Identities = 241/280 (86%)
 Strand = Plus / Plus

                                                                        
Query: 1    agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
            |||| |||||||||||||| || |||||  | || || |||||||||||||||||||| |
Sbjct: 725  agccacataatgttatgatagaccatgaattgcggaagcttcgcttgatagactggggtc 784

                                                                        
Query: 61   tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttca 120
            | || || |||||||||||||| |||||||| ||||| ||||| |||||||| || ||||
Sbjct: 785  ttgctgaattttaccatccaggaaaggaatataatgttcgtgtggcttcaagatacttca 844

                                                                        
Query: 121  agggacctgaacttctagttgatttgcaagattacgattattctctggacatgtggagcc 180
            |||| ||||||||||| ||||| |||||||| || || |||||| ||||||||||||| |
Sbjct: 845  agggccctgaacttcttgttgacttgcaagactatgactattctttggacatgtggagtc 904

                                                                        
Query: 181  ttgggtgcatgtttgctgggatgatcttccgcaaggagccattcttctatggccatgata 240
            |||| ||||||||||| || ||||| ||||||||||| || ||||| ||||| |||||||
Sbjct: 905  ttggatgcatgtttgcaggaatgattttccgcaaggaacctttcttttatggtcatgata 964

                                                    
Query: 241  accatgaccaacttgtgaaaattgcgaaggtacttggaac 280
            |||| || || ||||| |||||||| ||||||||||||||
Sbjct: 965  accaggatcagcttgtcaaaattgctaaggtacttggaac 1004



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 148/186 (79%)
 Strand = Plus / Plus

                                                                        
Query: 345  gttggaaggcacagtagaaaaccctggtcaaagttcattaatgctgataaccagcatcta 404
            ||||| || |||||||| || || ||||| || || || ||||| ||||| |||||| ||
Sbjct: 1069 gttgggagacacagtaggaagccatggtccaaatttataaatgcagataatcagcattta 1128

                                                                        
Query: 405  gtatctcccgaggccatagattttctcgataagcttcttcgctatgatcaccaagatagg 464
            || || || ||||| ||||||||||| || |||||||| || ||||| || || ||||| 
Sbjct: 1129 gtgtcgccagaggctatagattttcttgacaagcttctccgttatgaccatcaggataga 1188

                                                                        
Query: 465  ctcactgctcgtgaagctatggcgcatccatacttccttcaagtgagagcagcggagaac 524
            || || ||  | ||||| ||||| ||||| || ||||| |||||||| || || ||||| 
Sbjct: 1189 cttacagcaagagaagcaatggcccatccttatttcctgcaagtgagggctgcagagaat 1248

                  
Query: 525  agcagg 530
            ||||||
Sbjct: 1249 agcagg 1254



to top

>gb|AF374474.1|AF374474 Nicotiana tabacum CK2 alpha subunit (CK2A) mRNA, complete cds
          Length = 1525

 Score =  246 bits (124), Expect = 7e-62
 Identities = 241/280 (86%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           |||| |||||||||||||| || |||||  | || || |||||||||||||||||||| |
Sbjct: 666 agccacataatgttatgatagaccatgaattgcggaagcttcgcttgatagactggggtc 725

                                                                       
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttca 120
           | || || |||||||||||||| |||||||| ||||| ||||| |||||||| || ||||
Sbjct: 726 ttgctgaattttaccatccaggaaaggaatataatgttcgtgtggcttcaagatacttca 785

                                                                       
Query: 121 agggacctgaacttctagttgatttgcaagattacgattattctctggacatgtggagcc 180
           |||| ||||||||||| ||||| |||||||| || || |||||| ||||||||||||| |
Sbjct: 786 agggccctgaacttcttgttgacttgcaagactatgactattctttggacatgtggagtc 845

                                                                       
Query: 181 ttgggtgcatgtttgctgggatgatcttccgcaaggagccattcttctatggccatgata 240
           |||| ||||||||||| || ||||| ||||||||||| || ||||| ||||| |||||||
Sbjct: 846 ttggatgcatgtttgcaggaatgattttccgcaaggaacctttcttttatggtcatgata 905

                                                   
Query: 241 accatgaccaacttgtgaaaattgcgaaggtacttggaac 280
           |||| || || ||||| |||||||| ||||||||||||||
Sbjct: 906 accaggatcagcttgtcaaaattgctaaggtacttggaac 945



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 148/186 (79%)
 Strand = Plus / Plus

                                                                        
Query: 345  gttggaaggcacagtagaaaaccctggtcaaagttcattaatgctgataaccagcatcta 404
            ||||| || |||||||| || || ||||| || || || ||||| ||||| |||||| ||
Sbjct: 1010 gttgggagacacagtaggaagccatggtccaaatttataaatgcagataatcagcattta 1069

                                                                        
Query: 405  gtatctcccgaggccatagattttctcgataagcttcttcgctatgatcaccaagatagg 464
            || || || ||||| ||||||||||| || |||||||| || ||||| || || ||||| 
Sbjct: 1070 gtgtcgccagaggctatagattttcttgacaagcttctccgttatgaccatcaggataga 1129

                                                                        
Query: 465  ctcactgctcgtgaagctatggcgcatccatacttccttcaagtgagagcagcggagaac 524
            || || ||  | ||||| ||||| ||||| || ||||| |||||||| || || ||||| 
Sbjct: 1130 cttacagcaagagaagcaatggcccatccttatttcctgcaagtgagggctgcagagaat 1189

                  
Query: 525  agcagg 530
            ||||||
Sbjct: 1190 agcagg 1195



to top

>emb|AJ438264.1|NTA438264 Nicotiana tabacum mRNA for protein kinase CK2 alpha chain (ck2A2
            gene)
          Length = 1720

 Score =  238 bits (120), Expect = 2e-59
 Identities = 240/280 (85%)
 Strand = Plus / Plus

                                                                        
Query: 1    agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
            |||| |||||||||||||| || |||||  | || || |||||||||||||||||||| |
Sbjct: 730  agccacataatgttatgatagaccatgaattgcggaagcttcgcttgatagactggggtc 789

                                                                        
Query: 61   tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttca 120
            | || || |||||||||||||| |||||||| ||||| ||||| |||||||| || ||||
Sbjct: 790  ttgctgaattttaccatccaggaaaggaatataatgttcgtgtggcttcaagatacttca 849

                                                                        
Query: 121  agggacctgaacttctagttgatttgcaagattacgattattctctggacatgtggagcc 180
            |||| || |||||||| ||||| |||||||| || || |||||| ||||||||||||| |
Sbjct: 850  agggcccggaacttcttgttgacttgcaagactatgactattctttggacatgtggagtc 909

                                                                        
Query: 181  ttgggtgcatgtttgctgggatgatcttccgcaaggagccattcttctatggccatgata 240
            |||| ||||||||||| || ||||| ||||| ||||| || ||||||||||| |||||||
Sbjct: 910  ttggatgcatgtttgcaggaatgattttccggaaggaacctttcttctatggtcatgata 969

                                                    
Query: 241  accatgaccaacttgtgaaaattgcgaaggtacttggaac 280
            |||| || || ||||| |||||||| ||||||||||||||
Sbjct: 970  accaggatcagcttgtcaaaattgctaaggtacttggaac 1009



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 148/186 (79%)
 Strand = Plus / Plus

                                                                        
Query: 345  gttggaaggcacagtagaaaaccctggtcaaagttcattaatgctgataaccagcatcta 404
            ||||| || |||||||| || || ||||| || || || ||||| ||||| |||||| ||
Sbjct: 1074 gttgggagacacagtaggaagccatggtccaaatttataaatgcagataatcagcattta 1133

                                                                        
Query: 405  gtatctcccgaggccatagattttctcgataagcttcttcgctatgatcaccaagatagg 464
            || || || ||||| ||||||||||| || |||||||| || ||||| || || ||||| 
Sbjct: 1134 gtgtcgccagaggctatagattttcttgacaagcttctccgttatgaccatcaggataga 1193

                                                                        
Query: 465  ctcactgctcgtgaagctatggcgcatccatacttccttcaagtgagagcagcggagaac 524
            || || ||  | ||||| ||||| ||||| || ||||| |||||||| || || ||||| 
Sbjct: 1194 cttacagcaagagaagcaatggcccatccttatttcctgcaagtgagggctgcagagaat 1253

                  
Query: 525  agcagg 530
            ||||||
Sbjct: 1254 agcagg 1259



to top

>ref|NM_114860.2| Arabidopsis thaliana CKA2; kinase AT3G50000 (CKA2) mRNA, complete
           cds
          Length = 1364

 Score =  182 bits (92), Expect = 9e-43
 Identities = 227/272 (83%)
 Strand = Plus / Plus

                                                                       
Query: 9   aatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctggcggag 68
           ||||| ||||| || ||||| || || ||||||||| | ||||| ||||| || || |||
Sbjct: 676 aatgtcatgatcgaccatgagctgcgcaaacttcgcctaatagattggggtctcgctgag 735

                                                                       
Query: 69  ttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttcaagggacct 128
           ||||| ||||| || || || ||||| |||||||| || ||||| || ||||| || || 
Sbjct: 736 ttttatcatcctggaaaagagtacaacgtccgtgtggcctcaagatacttcaaaggtccc 795

                                                                       
Query: 129 gaacttctagttgatttgcaagattacgattattctctggacatgtggagccttgggtgc 188
           ||||||||||||||||| || || || || |||||  |||||||||||||||| || |||
Sbjct: 796 gaacttctagttgatttacaggactatgactattccttggacatgtggagcctcggttgc 855

                                                                       
Query: 189 atgtttgctgggatgatcttccgcaaggagccattcttctatggccatgataaccatgac 248
           ||||||||||||||||| ||||||||||| || ||||||||||||||||| ||||| || 
Sbjct: 856 atgtttgctgggatgatattccgcaaggaacctttcttctatggccatgacaaccaggat 915

                                           
Query: 249 caacttgtgaaaattgcgaaggtacttggaac 280
           || || || |||||||| |||||||| |||||
Sbjct: 916 cagctcgtcaaaattgccaaggtactcggaac 947



to top

>ref|NM_126138.2| Arabidopsis thaliana CKA1; kinase AT5G67380 (CKA1) transcript variant
            AT5G67380.1 mRNA, complete cds
          Length = 1422

 Score =  182 bits (92), Expect = 9e-43
 Identities = 368/460 (80%)
 Strand = Plus / Plus

                                                                        
Query: 1    agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
            |||| ||||||||||||||||| ||||| || || || |||||  | ||||| ||||| |
Sbjct: 688  agcctcataatgttatgattgaccatgagctgcgtaagcttcgtcttatagattggggtc 747

                                                                        
Query: 61   tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttca 120
            | || ||||||||||| || || || || || |||||||||||||| ||||| |||||||
Sbjct: 748  ttgctgagttttaccaccctggaaaagagtataatgtccgtgttgcctcaagatatttca 807

                                                                        
Query: 121  agggacctgaacttctagttgatttgcaagattacgattattctctggacatgtggagcc 180
            |||||||||||||||| || || |||||||| || || |||||  |||| |||||||| |
Sbjct: 808  agggacctgaacttcttgtggacttgcaagactatgactattcattggatatgtggagtc 867

                                                                        
Query: 181  ttgggtgcatgtttgctgggatgatcttccgcaaggagccattcttctatggccatgata 240
            |||| || |||||||| |||||||| ||||| ||||| || |||||||| |||||||| |
Sbjct: 868  ttggctgtatgtttgcagggatgatattccgtaaggaacctttcttctacggccatgaca 927

                                                                        
Query: 241  accatgaccaacttgtgaaaattgcgaaggtacttggaacagacagcctgaatgcttact 300
            |||| || || || |||||||| || ||||| ||||| || |||    ||||||||||  
Sbjct: 928  accaggatcagctagtgaaaatcgccaaggtgcttgggactgacgaattgaatgcttatc 987

                                                                        
Query: 301  taaagaagtaccaccttgagcttgaccctcagcttgaacatcttgttggaaggcacagta 360
            | || ||||||||  | || ||||| || || || |||   ||||||||  |||| || |
Sbjct: 988  tgaacaagtaccagttagaacttgatccacaactggaagcacttgttgggcggcatagca 1047

                                                                        
Query: 361  gaaaaccctggtcaaagttcattaatgctgataaccagcatctagtatctcccgaggcca 420
            | ||||| ||||| || ||||| || || || || |||||  |||| || |||||||| |
Sbjct: 1048 ggaaaccttggtccaaattcatcaacgcagacaatcagcacttagtttcacccgaggcga 1107

                                                    
Query: 421  tagattttctcgataagcttcttcgctatgatcaccaaga 460
            | ||||| ||||| ||||| ||||| |||||||| |||||
Sbjct: 1108 ttgatttcctcgacaagctacttcggtatgatcatcaaga 1147



to top

>ref|NM_001037088.1| Arabidopsis thaliana CKA1; kinase AT5G67380 (CKA1) transcript variant
            AT5G67380.2 mRNA, complete cds
          Length = 1346

 Score =  182 bits (92), Expect = 9e-43
 Identities = 368/460 (80%)
 Strand = Plus / Plus

                                                                        
Query: 1    agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
            |||| ||||||||||||||||| ||||| || || || |||||  | ||||| ||||| |
Sbjct: 612  agcctcataatgttatgattgaccatgagctgcgtaagcttcgtcttatagattggggtc 671

                                                                        
Query: 61   tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttca 120
            | || ||||||||||| || || || || || |||||||||||||| ||||| |||||||
Sbjct: 672  ttgctgagttttaccaccctggaaaagagtataatgtccgtgttgcctcaagatatttca 731

                                                                        
Query: 121  agggacctgaacttctagttgatttgcaagattacgattattctctggacatgtggagcc 180
            |||||||||||||||| || || |||||||| || || |||||  |||| |||||||| |
Sbjct: 732  agggacctgaacttcttgtggacttgcaagactatgactattcattggatatgtggagtc 791

                                                                        
Query: 181  ttgggtgcatgtttgctgggatgatcttccgcaaggagccattcttctatggccatgata 240
            |||| || |||||||| |||||||| ||||| ||||| || |||||||| |||||||| |
Sbjct: 792  ttggctgtatgtttgcagggatgatattccgtaaggaacctttcttctacggccatgaca 851

                                                                        
Query: 241  accatgaccaacttgtgaaaattgcgaaggtacttggaacagacagcctgaatgcttact 300
            |||| || || || |||||||| || ||||| ||||| || |||    ||||||||||  
Sbjct: 852  accaggatcagctagtgaaaatcgccaaggtgcttgggactgacgaattgaatgcttatc 911

                                                                        
Query: 301  taaagaagtaccaccttgagcttgaccctcagcttgaacatcttgttggaaggcacagta 360
            | || ||||||||  | || ||||| || || || |||   ||||||||  |||| || |
Sbjct: 912  tgaacaagtaccagttagaacttgatccacaactggaagcacttgttgggcggcatagca 971

                                                                        
Query: 361  gaaaaccctggtcaaagttcattaatgctgataaccagcatctagtatctcccgaggcca 420
            | ||||| ||||| || ||||| || || || || |||||  |||| || |||||||| |
Sbjct: 972  ggaaaccttggtccaaattcatcaacgcagacaatcagcacttagtttcacccgaggcga 1031

                                                    
Query: 421  tagattttctcgataagcttcttcgctatgatcaccaaga 460
            | ||||| ||||| ||||| ||||| |||||||| |||||
Sbjct: 1032 ttgatttcctcgacaagctacttcggtatgatcatcaaga 1071



to top

>gb|BT000888.1| Arabidopsis thaliana clone C105364 Casein kinase II, alpha chain 2
           (CK II) (At3g50000) mRNA, complete cds
          Length = 1243

 Score =  182 bits (92), Expect = 9e-43
 Identities = 227/272 (83%)
 Strand = Plus / Plus

                                                                       
Query: 9   aatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctggcggag 68
           ||||| ||||| || ||||| || || ||||||||| | ||||| ||||| || || |||
Sbjct: 676 aatgtcatgatcgaccatgagctgcgcaaacttcgcctaatagattggggtctcgctgag 735

                                                                       
Query: 69  ttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttcaagggacct 128
           ||||| ||||| || || || ||||| |||||||| || ||||| || ||||| || || 
Sbjct: 736 ttttatcatcctggaaaagagtacaacgtccgtgtggcctcaagatacttcaaaggtccc 795

                                                                       
Query: 129 gaacttctagttgatttgcaagattacgattattctctggacatgtggagccttgggtgc 188
           ||||||||||||||||| || || || || |||||  |||||||||||||||| || |||
Sbjct: 796 gaacttctagttgatttacaggactatgactattccttggacatgtggagcctcggttgc 855

                                                                       
Query: 189 atgtttgctgggatgatcttccgcaaggagccattcttctatggccatgataaccatgac 248
           ||||||||||||||||| ||||||||||| || ||||||||||||||||| ||||| || 
Sbjct: 856 atgtttgctgggatgatattccgcaaggaacctttcttctatggccatgacaaccaggat 915

                                           
Query: 249 caacttgtgaaaattgcgaaggtacttggaac 280
           || || || |||||||| |||||||| |||||
Sbjct: 916 cagctcgtcaaaattgccaaggtactcggaac 947



to top

>gb|AF370308.1| Arabidopsis thaliana putative casein kinase II, alpha chain 2 CK II
           (At3g50000) mRNA, partial cds
          Length = 1318

 Score =  182 bits (92), Expect = 9e-43
 Identities = 227/272 (83%)
 Strand = Plus / Plus

                                                                       
Query: 9   aatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctggcggag 68
           ||||| ||||| || ||||| || || ||||||||| | ||||| ||||| || || |||
Sbjct: 626 aatgtcatgatcgaccatgagctgcgcaaacttcgcctaatagattggggtctcgctgag 685

                                                                       
Query: 69  ttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttcaagggacct 128
           ||||| ||||| || || || ||||| |||||||| || ||||| || ||||| || || 
Sbjct: 686 ttttatcatcctggaaaagagtacaacgtccgtgtggcctcaagatacttcaaaggtccc 745

                                                                       
Query: 129 gaacttctagttgatttgcaagattacgattattctctggacatgtggagccttgggtgc 188
           ||||||||||||||||| || || || || |||||  |||||||||||||||| || |||
Sbjct: 746 gaacttctagttgatttacaggactatgactattccttggacatgtggagcctcggttgc 805

                                                                       
Query: 189 atgtttgctgggatgatcttccgcaaggagccattcttctatggccatgataaccatgac 248
           ||||||||||||||||| ||||||||||| || ||||||||||||||||| ||||| || 
Sbjct: 806 atgtttgctgggatgatattccgcaaggaacctttcttctatggccatgacaaccaggat 865

                                           
Query: 249 caacttgtgaaaattgcgaaggtacttggaac 280
           || || || |||||||| |||||||| |||||
Sbjct: 866 cagctcgtcaaaattgccaaggtactcggaac 897



to top

>gb|AF386966.1|AF386966 Arabidopsis thaliana casein kinase II alpha subunit (K8K14.10) mRNA,
            complete cds
          Length = 1466

 Score =  182 bits (92), Expect = 9e-43
 Identities = 368/460 (80%)
 Strand = Plus / Plus

                                                                        
Query: 1    agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
            |||| ||||||||||||||||| ||||| || || || |||||  | ||||| ||||| |
Sbjct: 752  agcctcataatgttatgattgaccatgagctgcgtaagcttcgtcttatagattggggtc 811

                                                                        
Query: 61   tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttca 120
            | || ||||||||||| || || || || || |||||||||||||| ||||| |||||||
Sbjct: 812  ttgctgagttttaccaccctggaaaagagtataatgtccgtgttgcctcaagatatttca 871

                                                                        
Query: 121  agggacctgaacttctagttgatttgcaagattacgattattctctggacatgtggagcc 180
            |||||||||||||||| || || |||||||| || || |||||  |||| |||||||| |
Sbjct: 872  agggacctgaacttcttgtggacttgcaagactatgactattcattggatatgtggagtc 931

                                                                        
Query: 181  ttgggtgcatgtttgctgggatgatcttccgcaaggagccattcttctatggccatgata 240
            |||| || |||||||| |||||||| ||||| ||||| || |||||||| |||||||| |
Sbjct: 932  ttggctgtatgtttgcagggatgatattccgtaaggaacctttcttctacggccatgaca 991

                                                                        
Query: 241  accatgaccaacttgtgaaaattgcgaaggtacttggaacagacagcctgaatgcttact 300
            |||| || || || |||||||| || ||||| ||||| || |||    ||||||||||  
Sbjct: 992  accaggatcagctagtgaaaatcgccaaggtgcttgggactgacgaattgaatgcttatc 1051

                                                                        
Query: 301  taaagaagtaccaccttgagcttgaccctcagcttgaacatcttgttggaaggcacagta 360
            | || ||||||||  | || ||||| || || || |||   ||||||||  |||| || |
Sbjct: 1052 tgaacaagtaccagttagaacttgatccacaactggaagcacttgttgggcggcatagca 1111

                                                                        
Query: 361  gaaaaccctggtcaaagttcattaatgctgataaccagcatctagtatctcccgaggcca 420
            | ||||| ||||| || ||||| || || || || |||||  |||| || |||||||| |
Sbjct: 1112 ggaaaccttggtccaaattcatcaacgcagacaatcagcacttagtttcacccgaggcga 1171

                                                    
Query: 421  tagattttctcgataagcttcttcgctatgatcaccaaga 460
            | ||||| ||||| ||||| ||||| |||||||| |||||
Sbjct: 1172 ttgatttcctcgacaagctacttcggtatgatcatcaaga 1211



to top

>emb|BX824158.1|CNS0A5PM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH26ZH07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1246

 Score =  182 bits (92), Expect = 9e-43
 Identities = 227/272 (83%)
 Strand = Plus / Plus

                                                                       
Query: 9   aatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctggcggag 68
           ||||| ||||| || ||||| || || ||||||||| | ||||| ||||| || || |||
Sbjct: 596 aatgtcatgatcgaccatgagctgcgcaaacttcgcctaatagattggggtctcgctgag 655

                                                                       
Query: 69  ttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttcaagggacct 128
           ||||| ||||| || || || ||||| |||||||| || ||||| || ||||| || || 
Sbjct: 656 ttttatcatcctggaaaagagtacaacgtccgtgtggcctcaagatacttcaaaggtccc 715

                                                                       
Query: 129 gaacttctagttgatttgcaagattacgattattctctggacatgtggagccttgggtgc 188
           ||||||||||||||||| || || || || |||||  |||||||||||||||| || |||
Sbjct: 716 gaacttctagttgatttacaggactatgactattccttggacatgtggagcctcggttgc 775

                                                                       
Query: 189 atgtttgctgggatgatcttccgcaaggagccattcttctatggccatgataaccatgac 248
           ||||||||||||||||| ||||||||||| || ||||||||||||||||| ||||| || 
Sbjct: 776 atgtttgctgggatgatattccgcaaggaacctttcttctatggccatgacaaccaggat 835

                                           
Query: 249 caacttgtgaaaattgcgaaggtacttggaac 280
           || || || |||||||| |||||||| |||||
Sbjct: 836 cagctcgtcaaaattgccaaggtactcggaac 867



to top

>gb|BT002141.1| Arabidopsis thaliana casein kinase II alpha subunit (At5g67380)
           mRNA, complete cds
          Length = 700

 Score =  182 bits (92), Expect = 9e-43
 Identities = 368/460 (80%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           |||| ||||||||||||||||| ||||| || || || |||||  | ||||| ||||| |
Sbjct: 17  agcctcataatgttatgattgaccatgagctgcgtaagcttcgtcttatagattggggtc 76

                                                                       
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttca 120
           | || ||||||||||| || || || || || |||||||||||||| ||||| |||||||
Sbjct: 77  ttgctgagttttaccaccctggaaaagagtataatgtccgtgttgcctcaagatatttca 136

                                                                       
Query: 121 agggacctgaacttctagttgatttgcaagattacgattattctctggacatgtggagcc 180
           |||||||||||||||| || || |||||||| || || |||||  |||| |||||||| |
Sbjct: 137 agggacctgaacttcttgtggacttgcaagactatgactattcattggatatgtggagtc 196

                                                                       
Query: 181 ttgggtgcatgtttgctgggatgatcttccgcaaggagccattcttctatggccatgata 240
           |||| || |||||||| |||||||| ||||| ||||| || |||||||| |||||||| |
Sbjct: 197 ttggctgtatgtttgcagggatgatattccgtaaggaacctttcttctacggccatgaca 256

                                                                       
Query: 241 accatgaccaacttgtgaaaattgcgaaggtacttggaacagacagcctgaatgcttact 300
           |||| || || || |||||||| || ||||| ||||| || |||    ||||||||||  
Sbjct: 257 accaggatcagctagtgaaaatcgccaaggtgcttgggactgacgaattgaatgcttatc 316

                                                                       
Query: 301 taaagaagtaccaccttgagcttgaccctcagcttgaacatcttgttggaaggcacagta 360
           | || ||||||||  | || ||||| || || || |||   ||||||||  |||| || |
Sbjct: 317 tgaacaagtaccagttagaacttgatccacaactggaagcacttgttgggcggcatagca 376

                                                                       
Query: 361 gaaaaccctggtcaaagttcattaatgctgataaccagcatctagtatctcccgaggcca 420
           | ||||| ||||| || ||||| || || || || |||||  |||| || |||||||| |
Sbjct: 377 ggaaaccttggtccaaattcatcaacgcagacaatcagcacttagtttcacccgaggcga 436

                                                   
Query: 421 tagattttctcgataagcttcttcgctatgatcaccaaga 460
           | ||||| ||||| ||||| ||||| |||||||| |||||
Sbjct: 437 ttgatttcctcgacaagctacttcggtatgatcatcaaga 476



to top

>emb|BX820898.1|CNS0A9LL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH7ZB08 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1405

 Score =  178 bits (90), Expect = 1e-41
 Identities = 231/278 (83%)
 Strand = Plus / Plus

                                                                       
Query: 6   cataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctggcg 65
           |||||||| ||||||||||| || |  ||||||||||| || || ||||||||  |||| 
Sbjct: 712 cataatgtcatgattgatcacgagcagcgaaaacttcgtttaattgactggggtttggca 771

                                                                       
Query: 66  gagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttcaaggga 125
           || || || ||||| || || ||||||||||||||||||||||||||||| || ||||| 
Sbjct: 772 gaattctatcatcctgggaaagaatacaatgtccgtgttgcttcaaggtactttaagggt 831

                                                                       
Query: 126 cctgaacttctagttgatttgcaagattacgattattctctggacatgtggagccttggg 185
           || || || || || ||||| || || || ||||||||  | ||| | ||||| ||||||
Sbjct: 832 ccagagctgctggtggatttacaggactatgattattccttagacctatggagtcttggg 891

                                                                       
Query: 186 tgcatgtttgctgggatgatcttccgcaaggagccattcttctatggccatgataaccat 245
           || ||||||||||| ||||| |||||||||||||| ||||| ||||||||||| ||| ||
Sbjct: 892 tgtatgtttgctggaatgatattccgcaaggagccgttcttttatggccatgacaactat 951

                                                 
Query: 246 gaccaacttgtgaaaattgcgaaggtacttggaacaga 283
           || ||| | || |||||||||||||| |||||||||||
Sbjct: 952 gatcaattggtcaaaattgcgaaggtgcttggaacaga 989



to top

>dbj|D10247.1|ATHCK2B Arabidopsis thaliana ATPK15D mRNA for casein kinase II catalytic
           subunit, complete cds
          Length = 1293

 Score =  176 bits (89), Expect = 6e-41
 Identities = 206/245 (84%)
 Strand = Plus / Plus

                                                                       
Query: 36  aaacttcgcttgatagactggggcctggcggagttttaccatccaggcaaggaatacaat 95
           ||||||||| | ||||| ||||| || || |||||||| ||||| || || || ||||| 
Sbjct: 643 aaacttcgcctaatagattggggtctcgctgagttttatcatcctggaaaagagtacaac 702

                                                                       
Query: 96  gtccgtgttgcttcaaggtatttcaagggacctgaacttctagttgatttgcaagattac 155
           |||||||| || ||||| || ||||| || || ||||||||||||||||| || || || 
Sbjct: 703 gtccgtgtggcctcaagatacttcaaaggtcccgaacttctagttgatttacaggactat 762

                                                                       
Query: 156 gattattctctggacatgtggagccttgggtgcatgtttgctgggatgatcttccgcaag 215
           || |||||  |||||||||||||||| || |||||||||||||||||||| |||||||||
Sbjct: 763 gactattccttggacatgtggagcctcggttgcatgtttgctgggatgatattccgcaag 822

                                                                       
Query: 216 gagccattcttctatggccatgataaccatgaccaacttgtgaaaattgcgaaggtactt 275
           || || ||||||||||||||||| ||||| || || || || |||||||| |||||||| 
Sbjct: 823 gaacctttcttctatggccatgacaaccaggatcagctcgtcaaaattgccaaggtactc 882

                
Query: 276 ggaac 280
           |||||
Sbjct: 883 ggaac 887



to top

>ref|NM_127871.3| Arabidopsis thaliana ATP binding / casein kinase/ kinase/ protein
            kinase/ protein serine/threonine kinase/ protein-tyrosine
            kinase AT2G23070 mRNA, complete cds
          Length = 1516

 Score =  170 bits (86), Expect = 4e-39
 Identities = 230/278 (82%)
 Strand = Plus / Plus

                                                                        
Query: 6    cataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctggcg 65
            |||||||| ||||||||||| || |  ||||||||||| || || ||||||||  |||| 
Sbjct: 784  cataatgtcatgattgatcacgagcagcgaaaacttcgtttaattgactggggtttggca 843

                                                                        
Query: 66   gagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttcaaggga 125
            || || || ||||| || || ||||||||||||||||||||||||||||| || ||||| 
Sbjct: 844  gaattctatcatcctgggaaagaatacaatgtccgtgttgcttcaaggtactttaagggt 903

                                                                        
Query: 126  cctgaacttctagttgatttgcaagattacgattattctctggacatgtggagccttggg 185
            || || || || || ||||| || || || ||||||||  | ||| | ||||| ||||||
Sbjct: 904  ccagagctgctggtggatttacaggactatgattattccttagacctatggagtcttggg 963

                                                                        
Query: 186  tgcatgtttgctgggatgatcttccgcaaggagccattcttctatggccatgataaccat 245
            || ||||||||||| ||||| |||||||||||||| ||||| ||||||||||| ||| ||
Sbjct: 964  tgtatgtttgctggaatgatattccgcaaggagccgttcttttatggccatgacaactat 1023

                                                  
Query: 246  gaccaacttgtgaaaattgcgaaggtacttggaacaga 283
            || ||| | || |||||||||||||| ||||| |||||
Sbjct: 1024 gatcaattggtcaaaattgcgaaggtgcttggcacaga 1061



to top

>gb|AY536852.1| Arabidopsis thaliana putative casein kinase II catalytic alpha
           subunit (At2g23070) mRNA, partial cds
          Length = 679

 Score =  170 bits (86), Expect = 4e-39
 Identities = 230/278 (82%)
 Strand = Plus / Plus

                                                                       
Query: 6   cataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctggcg 65
           |||||||| ||||||||||| || |  ||||||||||| || || ||||||||  |||| 
Sbjct: 161 cataatgtcatgattgatcacgagcagcgaaaacttcgtttaattgactggggtttggca 220

                                                                       
Query: 66  gagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttcaaggga 125
           || || || ||||| || || ||||||||||||||||||||||||||||| || ||||| 
Sbjct: 221 gaattctatcatcctgggaaagaatacaatgtccgtgttgcttcaaggtactttaagggt 280

                                                                       
Query: 126 cctgaacttctagttgatttgcaagattacgattattctctggacatgtggagccttggg 185
           || || || || || ||||| || || || ||||||||  | ||| | ||||| ||||||
Sbjct: 281 ccagagctgctggtggatttacaggactatgattattccttagacctatggagtcttggg 340

                                                                       
Query: 186 tgcatgtttgctgggatgatcttccgcaaggagccattcttctatggccatgataaccat 245
           || ||||||||||| ||||| |||||||||||||| ||||| ||||||||||| ||| ||
Sbjct: 341 tgtatgtttgctggaatgatattccgcaaggagccgttcttttatggccatgacaactat 400

                                                 
Query: 246 gaccaacttgtgaaaattgcgaaggtacttggaacaga 283
           || ||| | || |||||||||||||| ||||| |||||
Sbjct: 401 gatcaattggtcaaaattgcgaaggtgcttggcacaga 438



to top

>gb|AY081478.1| Arabidopsis thaliana putative casein kinase II catalytic (alpha)
            subunit (At2g23070) mRNA, complete cds
          Length = 1402

 Score =  170 bits (86), Expect = 4e-39
 Identities = 230/278 (82%)
 Strand = Plus / Plus

                                                                        
Query: 6    cataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctggcg 65
            |||||||| ||||||||||| || |  ||||||||||| || || ||||||||  |||| 
Sbjct: 757  cataatgtcatgattgatcacgagcagcgaaaacttcgtttaattgactggggtttggca 816

                                                                        
Query: 66   gagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttcaaggga 125
            || || || ||||| || || ||||||||||||||||||||||||||||| || ||||| 
Sbjct: 817  gaattctatcatcctgggaaagaatacaatgtccgtgttgcttcaaggtactttaagggt 876

                                                                        
Query: 126  cctgaacttctagttgatttgcaagattacgattattctctggacatgtggagccttggg 185
            || || || || || ||||| || || || ||||||||  | ||| | ||||| ||||||
Sbjct: 877  ccagagctgctggtggatttacaggactatgattattccttagacctatggagtcttggg 936

                                                                        
Query: 186  tgcatgtttgctgggatgatcttccgcaaggagccattcttctatggccatgataaccat 245
            || ||||||||||| ||||| |||||||||||||| ||||| ||||||||||| ||| ||
Sbjct: 937  tgtatgtttgctggaatgatattccgcaaggagccgttcttttatggccatgacaactat 996

                                                  
Query: 246  gaccaacttgtgaaaattgcgaaggtacttggaacaga 283
            || ||| | || |||||||||||||| ||||| |||||
Sbjct: 997  gatcaattggtcaaaattgcgaaggtgcttggcacaga 1034



to top

>gb|AY062631.1| Arabidopsis thaliana putative casein kinase II catalytic (alpha)
            subunit (At2g23070; F21P24.13) mRNA, complete cds
          Length = 1501

 Score =  170 bits (86), Expect = 4e-39
 Identities = 230/278 (82%)
 Strand = Plus / Plus

                                                                        
Query: 6    cataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctggcg 65
            |||||||| ||||||||||| || |  ||||||||||| || || ||||||||  |||| 
Sbjct: 784  cataatgtcatgattgatcacgagcagcgaaaacttcgtttaattgactggggtttggca 843

                                                                        
Query: 66   gagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttcaaggga 125
            || || || ||||| || || ||||||||||||||||||||||||||||| || ||||| 
Sbjct: 844  gaattctatcatcctgggaaagaatacaatgtccgtgttgcttcaaggtactttaagggt 903

                                                                        
Query: 126  cctgaacttctagttgatttgcaagattacgattattctctggacatgtggagccttggg 185
            || || || || || ||||| || || || ||||||||  | ||| | ||||| ||||||
Sbjct: 904  ccagagctgctggtggatttacaggactatgattattccttagacctatggagtcttggg 963

                                                                        
Query: 186  tgcatgtttgctgggatgatcttccgcaaggagccattcttctatggccatgataaccat 245
            || ||||||||||| ||||| |||||||||||||| ||||| ||||||||||| ||| ||
Sbjct: 964  tgtatgtttgctggaatgatattccgcaaggagccgttcttttatggccatgacaactat 1023

                                                  
Query: 246  gaccaacttgtgaaaattgcgaaggtacttggaacaga 283
            || ||| | || |||||||||||||| ||||| |||||
Sbjct: 1024 gatcaattggtcaaaattgcgaaggtgcttggcacaga 1061



to top

>ref|NM_201789.1| Arabidopsis thaliana ATP binding / casein kinase/ kinase/ protein
           kinase/ protein serine/threonine kinase/
           protein-tyrosine kinase AT2G23080 transcript variant
           AT2G23080.2 mRNA, complete cds
          Length = 1292

 Score =  165 bits (83), Expect = 2e-37
 Identities = 224/271 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           |||| |||||||| ||||| |||||| | || || ||||||||  ||||||| |||||||
Sbjct: 565 agcctcataatgtcatgatagatcatcagctgcgtaaacttcgtctgatagattggggcc 624

                                                                       
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttca 120
           | || |||||||||||||| || || || || ||||| || || || || || || ||||
Sbjct: 625 ttgctgagttttaccatcccggaaaagagtataatgttcgcgtggcctcgagatacttca 684

                                                                       
Query: 121 agggacctgaacttctagttgatttgcaagattacgattattctctggacatgtggagcc 180
           |||| || || ||| |||||||| | || ||||| || |||||| | ||||||||||| |
Sbjct: 685 agggtcccgagcttttagttgatctacaggattatgactattctttagacatgtggagtc 744

                                                                       
Query: 181 ttgggtgcatgtttgctgggatgatcttccgcaaggagccattcttctatggccatgata 240
           |||| |||||||||||||| ||||| ||||| ||||| || ||||| |||||||||||||
Sbjct: 745 ttggttgcatgtttgctggcatgatattccgtaaggaaccgttcttttatggccatgata 804

                                          
Query: 241 accatgaccaacttgtgaaaattgcgaaggt 271
           | ||||| |||||||| |||||||| |||||
Sbjct: 805 atcatgatcaacttgtcaaaattgccaaggt 835



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                  
Query: 423  gattttctcgataagcttcttcgctatgatcaccaaga 460
            ||||||||||||||||||||||  |||||||| |||||
Sbjct: 1058 gattttctcgataagcttcttcagtatgatcatcaaga 1095



to top

>ref|NM_127872.2| Arabidopsis thaliana ATP binding / casein kinase/ kinase/ protein
           kinase/ protein serine/threonine kinase/
           protein-tyrosine kinase AT2G23080 transcript variant
           AT2G23080.1 mRNA, complete cds
          Length = 1303

 Score =  165 bits (83), Expect = 2e-37
 Identities = 224/271 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           |||| |||||||| ||||| |||||| | || || ||||||||  ||||||| |||||||
Sbjct: 565 agcctcataatgtcatgatagatcatcagctgcgtaaacttcgtctgatagattggggcc 624

                                                                       
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttca 120
           | || |||||||||||||| || || || || ||||| || || || || || || ||||
Sbjct: 625 ttgctgagttttaccatcccggaaaagagtataatgttcgcgtggcctcgagatacttca 684

                                                                       
Query: 121 agggacctgaacttctagttgatttgcaagattacgattattctctggacatgtggagcc 180
           |||| || || ||| |||||||| | || ||||| || |||||| | ||||||||||| |
Sbjct: 685 agggtcccgagcttttagttgatctacaggattatgactattctttagacatgtggagtc 744

                                                                       
Query: 181 ttgggtgcatgtttgctgggatgatcttccgcaaggagccattcttctatggccatgata 240
           |||| |||||||||||||| ||||| ||||| ||||| || ||||| |||||||||||||
Sbjct: 745 ttggttgcatgtttgctggcatgatattccgtaaggaaccgttcttttatggccatgata 804

                                          
Query: 241 accatgaccaacttgtgaaaattgcgaaggt 271
           | ||||| |||||||| |||||||| |||||
Sbjct: 805 atcatgatcaacttgtcaaaattgccaaggt 835



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                           
Query: 414  gaggccatagattttctcgataagcttcttcgctatgatcaccaaga 460
            ||||| || ||||||||||||||||||||||  |||||||| |||||
Sbjct: 978  gaggcaattgattttctcgataagcttcttcagtatgatcatcaaga 1024



to top

>gb|AY062954.1| Arabidopsis thaliana putative casein kinase II catalytic alpha
           subunit (At2g23080) mRNA, complete cds
          Length = 1033

 Score =  165 bits (83), Expect = 2e-37
 Identities = 224/271 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           |||| |||||||| ||||| |||||| | || || ||||||||  ||||||| |||||||
Sbjct: 458 agcctcataatgtcatgatagatcatcagctgcgtaaacttcgtctgatagattggggcc 517

                                                                       
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttca 120
           | || |||||||||||||| || || || || ||||| || || || || || || ||||
Sbjct: 518 ttgctgagttttaccatcccggaaaagagtataatgttcgcgtggcctcgagatacttca 577

                                                                       
Query: 121 agggacctgaacttctagttgatttgcaagattacgattattctctggacatgtggagcc 180
           |||| || || ||| |||||||| | || ||||| || |||||| | ||||||||||| |
Sbjct: 578 agggtcccgagcttttagttgatctacaggattatgactattctttagacatgtggagtc 637

                                                                       
Query: 181 ttgggtgcatgtttgctgggatgatcttccgcaaggagccattcttctatggccatgata 240
           |||| |||||||||||||| ||||| ||||| ||||| || ||||| |||||||||||||
Sbjct: 638 ttggttgcatgtttgctggcatgatattccgtaaggaaccgttcttttatggccatgata 697

                                          
Query: 241 accatgaccaacttgtgaaaattgcgaaggt 271
           | ||||| |||||||| |||||||| |||||
Sbjct: 698 atcatgatcaacttgtcaaaattgccaaggt 728



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 414 gaggccatagattttctcgataagcttcttcgctatgatcaccaaga 460
           ||||| || ||||||||||||||||||||||  |||||||| |||||
Sbjct: 871 gaggcaattgattttctcgataagcttcttcagtatgatcatcaaga 917



to top

>gb|AY035088.1| Arabidopsis thaliana putative casein kinase II catalytic alpha
           subunit (At2g23080) mRNA, complete cds
          Length = 1324

 Score =  165 bits (83), Expect = 2e-37
 Identities = 224/271 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           |||| |||||||| ||||| |||||| | || || ||||||||  ||||||| |||||||
Sbjct: 565 agcctcataatgtcatgatagatcatcagctgcgtaaacttcgtctgatagattggggcc 624

                                                                       
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttca 120
           | || |||||||||||||| || || || || ||||| || || || || || || ||||
Sbjct: 625 ttgctgagttttaccatcccggaaaagagtataatgttcgcgtggcctcgagatacttca 684

                                                                       
Query: 121 agggacctgaacttctagttgatttgcaagattacgattattctctggacatgtggagcc 180
           |||| || || ||| |||||||| | || ||||| || |||||| | ||||||||||| |
Sbjct: 685 agggtcccgagcttttagttgatctacaggattatgactattctttagacatgtggagtc 744

                                                                       
Query: 181 ttgggtgcatgtttgctgggatgatcttccgcaaggagccattcttctatggccatgata 240
           |||| |||||||||||||| ||||| ||||| ||||| || ||||| |||||||||||||
Sbjct: 745 ttggttgcatgtttgctggcatgatattccgtaaggaaccgttcttttatggccatgata 804

                                          
Query: 241 accatgaccaacttgtgaaaattgcgaaggt 271
           | ||||| |||||||| |||||||| |||||
Sbjct: 805 atcatgatcaacttgtcaaaattgccaaggt 835



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                           
Query: 414  gaggccatagattttctcgataagcttcttcgctatgatcaccaaga 460
            ||||| || ||||||||||||||||||||||  |||||||| |||||
Sbjct: 978  gaggcaattgattttctcgataagcttcttcagtatgatcatcaaga 1024



to top

>emb|BX819262.1|CNS0A8ZG Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB61ZB06 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1290

 Score =  165 bits (83), Expect = 2e-37
 Identities = 224/271 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           |||| |||||||| ||||| |||||| | || || ||||||||  ||||||| |||||||
Sbjct: 563 agcctcataatgtcatgatagatcatcagctgcgtaaacttcgtctgatagattggggcc 622

                                                                       
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttca 120
           | || |||||||||||||| || || || || ||||| || || || || || || ||||
Sbjct: 623 ttgctgagttttaccatcccggaaaagagtataatgttcgcgtggcctcgagatacttca 682

                                                                       
Query: 121 agggacctgaacttctagttgatttgcaagattacgattattctctggacatgtggagcc 180
           |||| || || ||| |||||||| | || ||||| || |||||| | ||||||||||| |
Sbjct: 683 agggtcccgagcttttagttgatctacaggattatgactattctttagacatgtggagtc 742

                                                                       
Query: 181 ttgggtgcatgtttgctgggatgatcttccgcaaggagccattcttctatggccatgata 240
           |||| |||||||||||||| ||||| ||||| ||||| || ||||| |||||||||||||
Sbjct: 743 ttggttgcatgtttgctggcatgatattccgtaaggaaccgttcttttatggccatgata 802

                                          
Query: 241 accatgaccaacttgtgaaaattgcgaaggt 271
           | ||||| |||||||| |||||||| |||||
Sbjct: 803 atcatgatcaacttgtcaaaattgccaaggt 833



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                  
Query: 423  gattttctcgataagcttcttcgctatgatcaccaaga 460
            ||||||||||||||||||||||  |||||||| |||||
Sbjct: 1056 gattttctcgataagcttcttcagtatgatcatcaaga 1093



to top

>emb|BX820723.1|CNS0A7WO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH63ZA09 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1157

 Score =  165 bits (83), Expect = 2e-37
 Identities = 224/271 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           |||| |||||||| ||||| |||||| | || || ||||||||  ||||||| |||||||
Sbjct: 516 agcctcataatgtcatgatagatcatcagctgcgtaaacttcgtctgatagattggggcc 575

                                                                       
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttca 120
           | || |||||||||||||| || || || || ||||| || || || || || || ||||
Sbjct: 576 ttgctgagttttaccatcccggaaaagagtataatgttcgcgtggcctcgagatacttca 635

                                                                       
Query: 121 agggacctgaacttctagttgatttgcaagattacgattattctctggacatgtggagcc 180
           |||| || || ||| |||||||| | || ||||| || |||||| | ||||||||||| |
Sbjct: 636 agggtcccgagcttttagttgatctacaggattatgactattctttagacatgtggagtc 695

                                                                       
Query: 181 ttgggtgcatgtttgctgggatgatcttccgcaaggagccattcttctatggccatgata 240
           |||| |||||||||||||| ||||| ||||| ||||| || ||||| |||||||||||||
Sbjct: 696 ttggttgcatgtttgctggcatgatattccgtaaggaaccgttcttttatggccatgata 755

                                          
Query: 241 accatgaccaacttgtgaaaattgcgaaggt 271
           | ||||| |||||||| |||||||| |||||
Sbjct: 756 atcatgatcaacttgtcaaaattgccaaggt 786



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 414 gaggccatagattttctcgataagcttcttcgctatgatcaccaaga 460
           ||||| || ||||||||||||||||||||||  |||||||| |||||
Sbjct: 929 gaggcaattgattttctcgataagcttcttcagtatgatcatcaaga 975



to top

>gb|AY087736.1| Arabidopsis thaliana clone 38084 mRNA, complete sequence
          Length = 1182

 Score =  165 bits (83), Expect = 2e-37
 Identities = 224/271 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           |||| |||||||| ||||| |||||| | || || ||||||||  ||||||| |||||||
Sbjct: 540 agcctcataatgtcatgatagatcatcagctgcgtaaacttcgtctgatagattggggcc 599

                                                                       
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttca 120
           | || |||||||||||||| || || || || ||||| || || || || || || ||||
Sbjct: 600 ttgctgagttttaccatcccggaaaagagtataatgttcgcgtggcctcgagatacttca 659

                                                                       
Query: 121 agggacctgaacttctagttgatttgcaagattacgattattctctggacatgtggagcc 180
           |||| || || ||| |||||||| | || ||||| || |||||| | ||||||||||| |
Sbjct: 660 agggtcccgagcttttagttgatctacaggattatgactattctttagacatgtggagtc 719

                                                                       
Query: 181 ttgggtgcatgtttgctgggatgatcttccgcaaggagccattcttctatggccatgata 240
           |||| |||||||||||||| ||||| ||||| ||||| || ||||| |||||||||||||
Sbjct: 720 ttggttgcatgtttgctggcatgatattccgtaaggaaccgttcttttatggccatgata 779

                                          
Query: 241 accatgaccaacttgtgaaaattgcgaaggt 271
           | ||||| |||||||| |||||||| |||||
Sbjct: 780 atcatgatcaacttgtcaaaattgccaaggt 810



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 414 gaggccatagattttctcgataagcttcttcgctatgatcaccaaga 460
           ||||| || ||||||||||||||||||||||  |||||||| |||||
Sbjct: 953 gaggcaattgattttctcgataagcttcttcagtatgatcatcaaga 999



to top

>dbj|D29696.1|RICYK8 Oryza sativa mRNA, partial homologous to casein kinase II-alpha
           gene
          Length = 341

 Score =  159 bits (80), Expect = 1e-35
 Identities = 142/163 (87%)
 Strand = Plus / Plus

                                                                       
Query: 364 aaccctggtcaaagttcattaatgctgataaccagcatctagtatctcccgaggccatag 423
           |||| ||||||||||| || |||||||| ||||| ||||||||||| || |||||||| |
Sbjct: 3   aaccttggtcaaagtttatnaatgctgacaaccaacatctagtatccccagaggccatcg 62

                                                                       
Query: 424 attttctcgataagcttcttcgctatgatcaccaagataggctcactgctcgtgaagcta 483
           |||| || || ||||||||||||||||||||||| ||||| || ||||| ||||||||||
Sbjct: 63  atttccttgacaagcttcttcgctatgatcaccaggatagacttactgcacgtgaagcta 122

                                                      
Query: 484 tggcgcatccatacttccttcaagtgagagcagcggagaacag 526
           |||| || |||||||| || |||||||| || |||||||||||
Sbjct: 123 tggcacacccatactttctccaagtgagggctgcggagaacag 165



to top

>dbj|D10246.1|ATHCK2A Arabidopsis thaliana ATPK12D mRNA for casein kinase II catalytic
           subunit, complete cds
          Length = 1402

 Score =  147 bits (74), Expect = 5e-32
 Identities = 215/262 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           |||| ||||||||||||||||| ||||| || || || |||||  | ||||| ||||| |
Sbjct: 626 agcctcataatgttatgattgaccatgagctgcgtaagcttcgtcttatagattggggtc 685

                                                                       
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttca 120
           | || ||||||||||| || || || || || |||||||||||||  ||||| |||||||
Sbjct: 686 ttgctgagttttaccaccctggaaaagagtataatgtccgtgttgtctcaagatatttca 745

                                                                       
Query: 121 agggacctgaacttctagttgatttgcaagattacgattattctctggacatgtggagcc 180
           |||||||||||||||| || || |||||||| || || |||||  |||| |||||||| |
Sbjct: 746 agggacctgaacttcttgtggacttgcaagactatgactattcattggatatgtggagtc 805

                                                                       
Query: 181 ttgggtgcatgtttgctgggatgatcttccgcaaggagccattcttctatggccatgata 240
           |||| || |||||||| ||| || | ||||| ||||| || |||||||| |||||||| |
Sbjct: 806 ttggctgtatgtttgcagggttgttattccgtaaggaacctttcttctacggccatgaca 865

                                 
Query: 241 accatgaccaacttgtgaaaat 262
           |||| || || || ||||||||
Sbjct: 866 accaggatcagctagtgaaaat 887



to top

>dbj|AK058359.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-F03, full
           insert sequence
          Length = 918

 Score =  143 bits (72), Expect = 8e-31
 Identities = 225/276 (81%)
 Strand = Plus / Plus

                                                                       
Query: 9   aatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctggcggag 68
           |||||||||||||| ||||| || || || |||||||| || || ||||| || || |||
Sbjct: 167 aatgttatgattgaccatgaactccgcaagcttcgcttaattgattggggacttgctgag 226

                                                                       
Query: 69  ttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttcaagggacct 128
           |||||   |||||  || || |||||||| || ||||| ||||| || ||||| || |||
Sbjct: 227 ttttattttccagagaaagagtacaatgttcgggttgcctcaagatacttcaaagggcct 286

                                                                       
Query: 129 gaacttctagttgatttgcaagattacgattattctctggacatgtggagccttgggtgc 188
           ||| | || ||||| || |||  ||| || || ||| | ||||||||||||||||| || 
Sbjct: 287 gaattgctggttgacttccaaagttatgactactctttagacatgtggagccttggctgt 346

                                                                       
Query: 189 atgtttgctgggatgatcttccgcaaggagccattcttctatggccatgataaccatgac 248
           ||||||||||| ||||| || |||||||| ||||||||||||||||| ||||||||||||
Sbjct: 347 atgtttgctggaatgatatttcgcaaggaaccattcttctatggccacgataaccatgac 406

                                               
Query: 249 caacttgtgaaaattgcgaaggtacttggaacagac 284
           || ||||| ||||| || ||||| || || ||||||
Sbjct: 407 cagcttgtcaaaatagccaaggttctaggtacagac 442



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 86/102 (84%)
 Strand = Plus / Plus

                                                                       
Query: 398 gcatctagtatctcccgaggccatagattttctcgataagcttcttcgctatgatcacca 457
           |||||| || ||||| ||||| || |||||||| ||||| ||| ||||||  || |||||
Sbjct: 556 gcatcttgtctctccagaggctattgattttcttgataaacttattcgcttcgaccacca 615

                                                     
Query: 458 agataggctcactgctcgtgaagctatggcgcatccatactt 499
            || ||||| || ||||||||||||||||||||||| |||||
Sbjct: 616 tgacaggctgaccgctcgtgaagctatggcgcatccctactt 657



to top

>emb|BX821292.1|CNS0A99K Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL32ZC02 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 1399

 Score =  141 bits (71), Expect = 3e-30
 Identities = 191/231 (82%)
 Strand = Plus / Plus

                                                                       
Query: 6   cataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctggcg 65
           |||||||| ||||||||||| || |  ||||||||||| || || ||||||||  |||| 
Sbjct: 726 cataatgtcatgattgatcacgagcagcgaaaacttcgtttaattgactggggtttggca 785

                                                                       
Query: 66  gagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttcaaggga 125
           || || || ||||| || || ||||||||||||||||||||||||||||| || ||||| 
Sbjct: 786 gaattctatcatcctgggaaagaatacaatgtccgtgttgcttcaaggtactttaagggt 845

                                                                       
Query: 126 cctgaacttctagttgatttgcaagattacgattattctctggacatgtggagccttggg 185
           || || || || || ||||| || || || ||||||||  | ||| | ||||| ||||||
Sbjct: 846 ccagagctgctggtggatttacaggactatgattattccttagacctatggagtcttggg 905

                                                              
Query: 186 tgcatgtttgctgggatgatcttccgcaaggagccattcttctatggccat 236
           || ||||||||||| ||||| |||||||||||||| ||||| |||||||||
Sbjct: 906 tgtatgtttgctggaatgatattccgcaaggagccgttcttttatggccat 956



to top

>gb|DQ157464.1| Oryza sativa (indica cultivar-group) strain Suphan Buri 1 Hd6 gene,
            complete cds
          Length = 6832

 Score =  139 bits (70), Expect = 1e-29
 Identities = 103/114 (90%)
 Strand = Plus / Plus

                                                                        
Query: 1    agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
            ||||||| ||||||||||| |||||||| || ||||||||||| ||||||||||||||||
Sbjct: 3666 agccccacaatgttatgatagatcatgagctccgaaaacttcgattgatagactggggcc 3725

                                                                  
Query: 61   tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggt 114
            |||| ||||| || |||||||| |||||||| ||||| ||||||||||||||||
Sbjct: 3726 tggctgagttctatcatccagggaaggaatataatgttcgtgttgcttcaaggt 3779



 Score =  137 bits (69), Expect = 5e-29
 Identities = 87/93 (93%)
 Strand = Plus / Plus

                                                                        
Query: 111  aggtatttcaagggacctgaacttctagttgatttgcaagattacgattattctctggac 170
            |||||||||||||| ||||| ||||| ||||||||||||||||| ||||||||| |||||
Sbjct: 4348 aggtatttcaaggggcctgagcttcttgttgatttgcaagattatgattattctttggac 4407

                                             
Query: 171  atgtggagccttgggtgcatgtttgctgggatg 203
            |||||||||||||| ||||||||||||||||||
Sbjct: 4408 atgtggagccttggttgcatgtttgctgggatg 4440



 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 62/66 (93%)
 Strand = Plus / Plus

                                                                        
Query: 421  tagattttctcgataagcttcttcgctatgatcaccaagataggctcactgctcgtgaag 480
            |||||||||| ||||||||||| || |||||||||||||||||||||||||| |||||||
Sbjct: 5489 tagattttcttgataagcttctacgttatgatcaccaagataggctcactgcacgtgaag 5548

                  
Query: 481  ctatgg 486
            ||||||
Sbjct: 5549 ctatgg 5554



 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 61/67 (91%)
 Strand = Plus / Plus

                                                                        
Query: 351  aggcacagtagaaaaccctggtcaaagttcattaatgctgataaccagcatctagtatct 410
            ||||| ||||||||||| ||||| || |||||||||||||||||||| ||||||||||||
Sbjct: 5343 aggcatagtagaaaaccatggtcgaaattcattaatgctgataaccaacatctagtatct 5402

                   
Query: 411  cccgagg 417
            || ||||
Sbjct: 5403 cctgagg 5409



 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 48/50 (96%)
 Strand = Plus / Plus

                                                              
Query: 207  ttccgcaaggagccattcttctatggccatgataaccatgaccaacttgt 256
            |||||||||||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 4561 ttccgcaaggagccattcttctatggtcatgataaccatgatcaacttgt 4610



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 72/83 (86%), Gaps = 2/83 (2%)
 Strand = Plus / Plus

                                                                        
Query: 268  aggtacttggaacagacagc-ctgaatgcttacttaaagaagtaccaccttgagcttgac 326
            |||||||||||||||| ||| || |||||||| || || ||||||||  |||||||||| 
Sbjct: 5184 aggtacttggaacaga-agcactaaatgcttatttgaacaagtaccatattgagcttgat 5242

                                   
Query: 327  cctcagcttgaacatcttgttgg 349
            ||||||||||||  |||||||||
Sbjct: 5243 cctcagcttgaagctcttgttgg 5265



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                     
Query: 489  catccatacttccttcaagtgagagcagcggagaacagcagggcacgaccgcaatga 545
            ||||| |||||||| ||||||||||| || || || ||||| |||||||| ||||||
Sbjct: 6214 catccgtacttcctccaagtgagagctgcagaaaatagcagagcacgaccacaatga 6270



to top

>gb|DQ157463.1| Oryza sativa (indica cultivar-group) strain KDML 105 Hd6 gene,
            complete cds
          Length = 6833

 Score =  139 bits (70), Expect = 1e-29
 Identities = 103/114 (90%)
 Strand = Plus / Plus

                                                                        
Query: 1    agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
            ||||||| ||||||||||| |||||||| || ||||||||||| ||||||||||||||||
Sbjct: 3667 agccccacaatgttatgatagatcatgagctccgaaaacttcgattgatagactggggcc 3726

                                                                  
Query: 61   tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggt 114
            |||| ||||| || |||||||| |||||||| ||||| ||||||||||||||||
Sbjct: 3727 tggctgagttctatcatccagggaaggaatataatgttcgtgttgcttcaaggt 3780



 Score =  137 bits (69), Expect = 5e-29
 Identities = 87/93 (93%)
 Strand = Plus / Plus

                                                                        
Query: 111  aggtatttcaagggacctgaacttctagttgatttgcaagattacgattattctctggac 170
            |||||||||||||| ||||| ||||| ||||||||||||||||| ||||||||| |||||
Sbjct: 4350 aggtatttcaaggggcctgagcttcttgttgatttgcaagattatgattattctttggac 4409

                                             
Query: 171  atgtggagccttgggtgcatgtttgctgggatg 203
            |||||||||||||| ||||||||||||||||||
Sbjct: 4410 atgtggagccttggttgcatgtttgctgggatg 4442



 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 62/66 (93%)
 Strand = Plus / Plus

                                                                        
Query: 421  tagattttctcgataagcttcttcgctatgatcaccaagataggctcactgctcgtgaag 480
            |||||||||| ||||||||||| || |||||||||||||||||||||||||| |||||||
Sbjct: 5490 tagattttcttgataagcttctacgttatgatcaccaagataggctcactgcacgtgaag 5549

                  
Query: 481  ctatgg 486
            ||||||
Sbjct: 5550 ctatgg 5555



 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 61/67 (91%)
 Strand = Plus / Plus

                                                                        
Query: 351  aggcacagtagaaaaccctggtcaaagttcattaatgctgataaccagcatctagtatct 410
            ||||| ||||||||||| ||||| || |||||||||||||||||||| ||||||||||||
Sbjct: 5343 aggcatagtagaaaaccatggtcgaaattcattaatgctgataaccaacatctagtatct 5402

                   
Query: 411  cccgagg 417
            || ||||
Sbjct: 5403 cctgagg 5409



 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 48/50 (96%)
 Strand = Plus / Plus

                                                              
Query: 207  ttccgcaaggagccattcttctatggccatgataaccatgaccaacttgt 256
            |||||||||||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 4563 ttccgcaaggagccattcttctatggtcatgataaccatgatcaacttgt 4612



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 72/83 (86%), Gaps = 2/83 (2%)
 Strand = Plus / Plus

                                                                        
Query: 268  aggtacttggaacagacagc-ctgaatgcttacttaaagaagtaccaccttgagcttgac 326
            |||||||||||||||| ||| || |||||||| || || ||||||||  |||||||||| 
Sbjct: 5184 aggtacttggaacaga-agcactaaatgcttatttgaacaagtaccatattgagcttgat 5242

                                   
Query: 327  cctcagcttgaacatcttgttgg 349
            ||||||||||||  |||||||||
Sbjct: 5243 cctcagcttgaagctcttgttgg 5265



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                     
Query: 489  catccatacttccttcaagtgagagcagcggagaacagcagggcacgaccgcaatga 545
            ||||| |||||||| ||||||||||| || || || ||||| |||||||| ||||||
Sbjct: 6215 catccgtacttcctccaagtgagagctgcagaaaatagcagagcacgaccacaatga 6271



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  139 bits (70), Expect = 1e-29
 Identities = 103/114 (90%)
 Strand = Plus / Minus

                                                                            
Query: 1        agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
                ||||||| ||||||||||| |||||||| || ||||||||||| ||||||||||||||||
Sbjct: 31207685 agccccacaatgttatgatagatcatgagctccgaaaacttcgattgatagactggggcc 31207626

                                                                      
Query: 61       tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggt 114
                |||| ||||| || |||||||| |||||||| ||||| ||||||||||||||||
Sbjct: 31207625 tggctgagttctatcatccagggaaggaatataatgttcgtgttgcttcaaggt 31207572



 Score =  137 bits (69), Expect = 5e-29
 Identities = 87/93 (93%)
 Strand = Plus / Minus

                                                                            
Query: 111      aggtatttcaagggacctgaacttctagttgatttgcaagattacgattattctctggac 170
                |||||||||||||| ||||| ||||| ||||||||||||||||| ||||||||| |||||
Sbjct: 31207002 aggtatttcaaggggcctgagcttcttgttgatttgcaagattatgattattctttggac 31206943

                                                 
Query: 171      atgtggagccttgggtgcatgtttgctgggatg 203
                |||||||||||||| ||||||||||||||||||
Sbjct: 31206942 atgtggagccttggttgcatgtttgctgggatg 31206910



 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 62/66 (93%)
 Strand = Plus / Minus

                                                                            
Query: 421      tagattttctcgataagcttcttcgctatgatcaccaagataggctcactgctcgtgaag 480
                |||||||||| ||||||||||| || |||||||||||||||||||||||||| |||||||
Sbjct: 31205860 tagattttcttgataagcttctacgttatgatcaccaagataggctcactgcacgtgaag 31205801

                      
Query: 481      ctatgg 486
                ||||||
Sbjct: 31205800 ctatgg 31205795



 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 61/67 (91%)
 Strand = Plus / Minus

                                                                            
Query: 351      aggcacagtagaaaaccctggtcaaagttcattaatgctgataaccagcatctagtatct 410
                ||||| ||||||||||| ||||| || |||||||||||||||||||| ||||||||||||
Sbjct: 31206007 aggcatagtagaaaaccatggtcgaaattcattaatgctgataaccaacatctagtatct 31205948

                       
Query: 411      cccgagg 417
                || ||||
Sbjct: 31205947 cctgagg 31205941



 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 48/50 (96%)
 Strand = Plus / Minus

                                                                  
Query: 207      ttccgcaaggagccattcttctatggccatgataaccatgaccaacttgt 256
                |||||||||||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 31206789 ttccgcaaggagccattcttctatggtcatgataaccatgatcaacttgt 31206740



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                           
Query: 210     cgcaaggagccattcttctatggccatgataaccatgaccaacttgtgaaaattgcgaag 269
               |||||||| ||||||||||||||||| |||||||||||||| ||||| ||||| || |||
Sbjct: 5585367 cgcaaggaaccattcttctatggccacgataaccatgaccagcttgtcaaaatagccaag 5585308

                 
Query: 270     gt 271
               ||
Sbjct: 5585307 gt 5585306



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                            
Query: 120      aagggacctgaacttctagttgatttgcaagattacgattattctctggacatgtggagc 179
                ||||| ||||||||||| || ||||||| |||||| ||||| ||  ||||  ||||||||
Sbjct: 31265247 aagggccctgaacttcttgtggatttgctagattatgattactcgttggatttgtggagc 31265306

                                 
Query: 180      cttgggtgcatgtttgc 196
                ||||| |||||||||||
Sbjct: 31265307 cttggttgcatgtttgc 31265323



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 72/83 (86%), Gaps = 2/83 (2%)
 Strand = Plus / Minus

                                                                            
Query: 268      aggtacttggaacagacagc-ctgaatgcttacttaaagaagtaccaccttgagcttgac 326
                |||||||||||||||| ||| || |||||||| || || ||||||||  |||||||||| 
Sbjct: 31206166 aggtacttggaacaga-agcactaaatgcttatttgaacaagtaccatattgagcttgat 31206108

                                       
Query: 327      cctcagcttgaacatcttgttgg 349
                ||||||||||||  |||||||||
Sbjct: 31206107 cctcagcttgaagctcttgttgg 31206085



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                         
Query: 489      catccatacttccttcaagtgagagcagcggagaacagcagggcacgaccgcaatga 545
                ||||| |||||||| ||||||||||| || || || ||||| |||||||| ||||||
Sbjct: 31205135 catccgtacttcctccaagtgagagctgcagaaaatagcagagcacgaccacaatga 31205079



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                               
Query: 168     gacatgtggagccttgggtgcatgtttgctgg 199
               ||||||||||||||||| || |||||||||||
Sbjct: 5585531 gacatgtggagccttggctgtatgtttgctgg 5585500



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 54/64 (84%)
 Strand = Plus / Minus

                                                                           
Query: 423     gattttctcgataagcttcttcgctatgatcaccaagataggctcactgctcgtgaagct 482
               |||||||| ||||| ||| ||||||  || ||||| || ||||| || ||||||||||||
Sbjct: 5584815 gattttcttgataaacttattcgcttcgaccaccatgacaggctgaccgctcgtgaagct 5584756

                   
Query: 483     atgg 486
               ||||
Sbjct: 5584755 atgg 5584752



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                       
Query: 315      cttgagcttgaccctcagcttgaacatcttgttggaagg 353
                |||||||||||||| |||||||||   ||||||||||||
Sbjct: 31265860 cttgagcttgacccgcagcttgaaagacttgttggaagg 31265898



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                           
Query: 9       aatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctggcggag 68
               |||||||||||||| ||||| || || || |||||||| || || ||||| || || |||
Sbjct: 5586123 aatgttatgattgaccatgaactccgcaagcttcgcttaattgattggggacttgctgag 5586064

                    
Query: 69      tttta 73
               |||||
Sbjct: 5586063 tttta 5586059



to top

>gb|AC090713.6| Oryza sativa chromosome 3 BAC OSJNBa0002J24 genomic sequence, complete
             sequence
          Length = 146022

 Score =  139 bits (70), Expect = 1e-29
 Identities = 103/114 (90%)
 Strand = Plus / Minus

                                                                         
Query: 1     agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
             ||||||| ||||||||||| |||||||| || ||||||||||| ||||||||||||||||
Sbjct: 14926 agccccacaatgttatgatagatcatgagctccgaaaacttcgattgatagactggggcc 14867

                                                                   
Query: 61    tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggt 114
             |||| ||||| || |||||||| |||||||| ||||| ||||||||||||||||
Sbjct: 14866 tggctgagttctatcatccagggaaggaatataatgttcgtgttgcttcaaggt 14813



 Score =  137 bits (69), Expect = 5e-29
 Identities = 87/93 (93%)
 Strand = Plus / Minus

                                                                         
Query: 111   aggtatttcaagggacctgaacttctagttgatttgcaagattacgattattctctggac 170
             |||||||||||||| ||||| ||||| ||||||||||||||||| ||||||||| |||||
Sbjct: 14243 aggtatttcaaggggcctgagcttcttgttgatttgcaagattatgattattctttggac 14184

                                              
Query: 171   atgtggagccttgggtgcatgtttgctgggatg 203
             |||||||||||||| ||||||||||||||||||
Sbjct: 14183 atgtggagccttggttgcatgtttgctgggatg 14151



 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 62/66 (93%)
 Strand = Plus / Minus

                                                                         
Query: 421   tagattttctcgataagcttcttcgctatgatcaccaagataggctcactgctcgtgaag 480
             |||||||||| ||||||||||| || |||||||||||||||||||||||||| |||||||
Sbjct: 13101 tagattttcttgataagcttctacgttatgatcaccaagataggctcactgcacgtgaag 13042

                   
Query: 481   ctatgg 486
             ||||||
Sbjct: 13041 ctatgg 13036



 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 61/67 (91%)
 Strand = Plus / Minus

                                                                         
Query: 351   aggcacagtagaaaaccctggtcaaagttcattaatgctgataaccagcatctagtatct 410
             ||||| ||||||||||| ||||| || |||||||||||||||||||| ||||||||||||
Sbjct: 13248 aggcatagtagaaaaccatggtcgaaattcattaatgctgataaccaacatctagtatct 13189

                    
Query: 411   cccgagg 417
             || ||||
Sbjct: 13188 cctgagg 13182



 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 48/50 (96%)
 Strand = Plus / Minus

                                                               
Query: 207   ttccgcaaggagccattcttctatggccatgataaccatgaccaacttgt 256
             |||||||||||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 14030 ttccgcaaggagccattcttctatggtcatgataaccatgatcaacttgt 13981



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                         
Query: 120   aagggacctgaacttctagttgatttgcaagattacgattattctctggacatgtggagc 179
             ||||| ||||||||||| || ||||||| |||||| ||||| ||  ||||  ||||||||
Sbjct: 72488 aagggccctgaacttcttgtggatttgctagattatgattactcgttggatttgtggagc 72547

                              
Query: 180   cttgggtgcatgtttgc 196
             ||||| |||||||||||
Sbjct: 72548 cttggttgcatgtttgc 72564



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 72/83 (86%), Gaps = 2/83 (2%)
 Strand = Plus / Minus

                                                                         
Query: 268   aggtacttggaacagacagc-ctgaatgcttacttaaagaagtaccaccttgagcttgac 326
             |||||||||||||||| ||| || |||||||| || || ||||||||  |||||||||| 
Sbjct: 13407 aggtacttggaacaga-agcactaaatgcttatttgaacaagtaccatattgagcttgat 13349

                                    
Query: 327   cctcagcttgaacatcttgttgg 349
             ||||||||||||  |||||||||
Sbjct: 13348 cctcagcttgaagctcttgttgg 13326



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                      
Query: 489   catccatacttccttcaagtgagagcagcggagaacagcagggcacgaccgcaatga 545
             ||||| |||||||| ||||||||||| || || || ||||| |||||||| ||||||
Sbjct: 12376 catccgtacttcctccaagtgagagctgcagaaaatagcagagcacgaccacaatga 12320



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                    
Query: 315   cttgagcttgaccctcagcttgaacatcttgttggaagg 353
             |||||||||||||| |||||||||   ||||||||||||
Sbjct: 73101 cttgagcttgacccgcagcttgaaagacttgttggaagg 73139



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  139 bits (70), Expect = 1e-29
 Identities = 103/114 (90%)
 Strand = Plus / Minus

                                                                            
Query: 1        agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
                ||||||| ||||||||||| |||||||| || ||||||||||| ||||||||||||||||
Sbjct: 31298201 agccccacaatgttatgatagatcatgagctccgaaaacttcgattgatagactggggcc 31298142

                                                                      
Query: 61       tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggt 114
                |||| ||||| || |||||||| |||||||| ||||| ||||||||||||||||
Sbjct: 31298141 tggctgagttctatcatccagggaaggaatataatgttcgtgttgcttcaaggt 31298088



 Score =  137 bits (69), Expect = 5e-29
 Identities = 87/93 (93%)
 Strand = Plus / Minus

                                                                            
Query: 111      aggtatttcaagggacctgaacttctagttgatttgcaagattacgattattctctggac 170
                |||||||||||||| ||||| ||||| ||||||||||||||||| ||||||||| |||||
Sbjct: 31297518 aggtatttcaaggggcctgagcttcttgttgatttgcaagattatgattattctttggac 31297459

                                                 
Query: 171      atgtggagccttgggtgcatgtttgctgggatg 203
                |||||||||||||| ||||||||||||||||||
Sbjct: 31297458 atgtggagccttggttgcatgtttgctgggatg 31297426



 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 62/66 (93%)
 Strand = Plus / Minus

                                                                            
Query: 421      tagattttctcgataagcttcttcgctatgatcaccaagataggctcactgctcgtgaag 480
                |||||||||| ||||||||||| || |||||||||||||||||||||||||| |||||||
Sbjct: 31296376 tagattttcttgataagcttctacgttatgatcaccaagataggctcactgcacgtgaag 31296317

                      
Query: 481      ctatgg 486
                ||||||
Sbjct: 31296316 ctatgg 31296311



 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 61/67 (91%)
 Strand = Plus / Minus

                                                                            
Query: 351      aggcacagtagaaaaccctggtcaaagttcattaatgctgataaccagcatctagtatct 410
                ||||| ||||||||||| ||||| || |||||||||||||||||||| ||||||||||||
Sbjct: 31296523 aggcatagtagaaaaccatggtcgaaattcattaatgctgataaccaacatctagtatct 31296464

                       
Query: 411      cccgagg 417
                || ||||
Sbjct: 31296463 cctgagg 31296457



 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 48/50 (96%)
 Strand = Plus / Minus

                                                                  
Query: 207      ttccgcaaggagccattcttctatggccatgataaccatgaccaacttgt 256
                |||||||||||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 31297305 ttccgcaaggagccattcttctatggtcatgataaccatgatcaacttgt 31297256



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                           
Query: 210     cgcaaggagccattcttctatggccatgataaccatgaccaacttgtgaaaattgcgaag 269
               |||||||| ||||||||||||||||| |||||||||||||| ||||| ||||| || |||
Sbjct: 5584582 cgcaaggaaccattcttctatggccacgataaccatgaccagcttgtcaaaatagccaag 5584523

                 
Query: 270     gt 271
               ||
Sbjct: 5584522 gt 5584521



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                            
Query: 120      aagggacctgaacttctagttgatttgcaagattacgattattctctggacatgtggagc 179
                ||||| ||||||||||| || ||||||| |||||| ||||| ||  ||||  ||||||||
Sbjct: 31355763 aagggccctgaacttcttgtggatttgctagattatgattactcgttggatttgtggagc 31355822

                                 
Query: 180      cttgggtgcatgtttgc 196
                ||||| |||||||||||
Sbjct: 31355823 cttggttgcatgtttgc 31355839



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 72/83 (86%), Gaps = 2/83 (2%)
 Strand = Plus / Minus

                                                                            
Query: 268      aggtacttggaacagacagc-ctgaatgcttacttaaagaagtaccaccttgagcttgac 326
                |||||||||||||||| ||| || |||||||| || || ||||||||  |||||||||| 
Sbjct: 31296682 aggtacttggaacaga-agcactaaatgcttatttgaacaagtaccatattgagcttgat 31296624

                                       
Query: 327      cctcagcttgaacatcttgttgg 349
                ||||||||||||  |||||||||
Sbjct: 31296623 cctcagcttgaagctcttgttgg 31296601



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                         
Query: 489      catccatacttccttcaagtgagagcagcggagaacagcagggcacgaccgcaatga 545
                ||||| |||||||| ||||||||||| || || || ||||| |||||||| ||||||
Sbjct: 31295651 catccgtacttcctccaagtgagagctgcagaaaatagcagagcacgaccacaatga 31295595



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                               
Query: 168     gacatgtggagccttgggtgcatgtttgctgg 199
               ||||||||||||||||| || |||||||||||
Sbjct: 5584746 gacatgtggagccttggctgtatgtttgctgg 5584715



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 54/64 (84%)
 Strand = Plus / Minus

                                                                           
Query: 423     gattttctcgataagcttcttcgctatgatcaccaagataggctcactgctcgtgaagct 482
               |||||||| ||||| ||| ||||||  || ||||| || ||||| || ||||||||||||
Sbjct: 5584030 gattttcttgataaacttattcgcttcgaccaccatgacaggctgaccgctcgtgaagct 5583971

                   
Query: 483     atgg 486
               ||||
Sbjct: 5583970 atgg 5583967



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                       
Query: 315      cttgagcttgaccctcagcttgaacatcttgttggaagg 353
                |||||||||||||| |||||||||   ||||||||||||
Sbjct: 31356376 cttgagcttgacccgcagcttgaaagacttgttggaagg 31356414



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                           
Query: 9       aatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctggcggag 68
               |||||||||||||| ||||| || || || |||||||| || || ||||| || || |||
Sbjct: 5585338 aatgttatgattgaccatgaactccgcaagcttcgcttaattgattggggacttgctgag 5585279

                    
Query: 69      tttta 73
               |||||
Sbjct: 5585278 tttta 5585274



to top

>dbj|AB036786.1| Oryza sativa (indica cultivar-group) Kasalath OSCKA2 gene for casein
            kinase II alpha subunit, complete cds
          Length = 6930

 Score =  139 bits (70), Expect = 1e-29
 Identities = 103/114 (90%)
 Strand = Plus / Plus

                                                                        
Query: 1    agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
            ||||||| ||||||||||| |||||||| || ||||||||||| ||||||||||||||||
Sbjct: 3668 agccccacaatgttatgatagatcatgagctccgaaaacttcgattgatagactggggcc 3727

                                                                  
Query: 61   tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggt 114
            |||| ||||| || |||||||| |||||||| ||||| ||||||||||||||||
Sbjct: 3728 tggctgagttctatcatccagggaaggaatataatgttcgtgttgcttcaaggt 3781



 Score =  137 bits (69), Expect = 5e-29
 Identities = 87/93 (93%)
 Strand = Plus / Plus

                                                                        
Query: 111  aggtatttcaagggacctgaacttctagttgatttgcaagattacgattattctctggac 170
            |||||||||||||| ||||| ||||| ||||||||||||||||| ||||||||| |||||
Sbjct: 4351 aggtatttcaaggggcctgagcttcttgttgatttgcaagattatgattattctttggac 4410

                                             
Query: 171  atgtggagccttgggtgcatgtttgctgggatg 203
            |||||||||||||| ||||||||||||||||||
Sbjct: 4411 atgtggagccttggttgcatgtttgctgggatg 4443



 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 62/66 (93%)
 Strand = Plus / Plus

                                                                        
Query: 421  tagattttctcgataagcttcttcgctatgatcaccaagataggctcactgctcgtgaag 480
            |||||||||| ||||||||||| || |||||||||||||||||||||||||| |||||||
Sbjct: 5494 tagattttcttgataagcttctacgttatgatcaccaagataggctcactgcacgtgaag 5553

                  
Query: 481  ctatgg 486
            ||||||
Sbjct: 5554 ctatgg 5559



 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 61/67 (91%)
 Strand = Plus / Plus

                                                                        
Query: 351  aggcacagtagaaaaccctggtcaaagttcattaatgctgataaccagcatctagtatct 410
            ||||| ||||||||||| ||||| || |||||||||||||||||||| ||||||||||||
Sbjct: 5347 aggcatagtagaaaaccatggtcgaaattcattaatgctgataaccaacatctagtatct 5406

                   
Query: 411  cccgagg 417
            || ||||
Sbjct: 5407 cctgagg 5413



 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 48/50 (96%)
 Strand = Plus / Plus

                                                              
Query: 207  ttccgcaaggagccattcttctatggccatgataaccatgaccaacttgt 256
            |||||||||||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 4564 ttccgcaaggagccattcttctatggtcatgataaccatgatcaacttgt 4613



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 72/83 (86%), Gaps = 2/83 (2%)
 Strand = Plus / Plus

                                                                        
Query: 268  aggtacttggaacagacagc-ctgaatgcttacttaaagaagtaccaccttgagcttgac 326
            |||||||||||||||| ||| || |||||||| || || ||||||||  |||||||||| 
Sbjct: 5188 aggtacttggaacaga-agcactaaatgcttatttgaacaagtaccatattgagcttgat 5246

                                   
Query: 327  cctcagcttgaacatcttgttgg 349
            ||||||||||||  |||||||||
Sbjct: 5247 cctcagcttgaagctcttgttgg 5269



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                     
Query: 489  catccatacttccttcaagtgagagcagcggagaacagcagggcacgaccgcaatga 545
            ||||| |||||||| ||||||||||| || || || ||||| |||||||| ||||||
Sbjct: 6219 catccgtacttcctccaagtgagagctgcagaaaatagcagagcacgaccacaatga 6275



to top

>dbj|AB036785.1| Oryza sativa (japonica cultivar-group) Nipponbare OSCKA2 gene for
            casein kinase II alpha subunit, complete cds
          Length = 6929

 Score =  139 bits (70), Expect = 1e-29
 Identities = 103/114 (90%)
 Strand = Plus / Plus

                                                                        
Query: 1    agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
            ||||||| ||||||||||| |||||||| || ||||||||||| ||||||||||||||||
Sbjct: 3668 agccccacaatgttatgatagatcatgagctccgaaaacttcgattgatagactggggcc 3727

                                                                  
Query: 61   tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggt 114
            |||| ||||| || |||||||| |||||||| ||||| ||||||||||||||||
Sbjct: 3728 tggctgagttctatcatccagggaaggaatataatgttcgtgttgcttcaaggt 3781



 Score =  137 bits (69), Expect = 5e-29
 Identities = 87/93 (93%)
 Strand = Plus / Plus

                                                                        
Query: 111  aggtatttcaagggacctgaacttctagttgatttgcaagattacgattattctctggac 170
            |||||||||||||| ||||| ||||| ||||||||||||||||| ||||||||| |||||
Sbjct: 4351 aggtatttcaaggggcctgagcttcttgttgatttgcaagattatgattattctttggac 4410

                                             
Query: 171  atgtggagccttgggtgcatgtttgctgggatg 203
            |||||||||||||| ||||||||||||||||||
Sbjct: 4411 atgtggagccttggttgcatgtttgctgggatg 4443



 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 62/66 (93%)
 Strand = Plus / Plus

                                                                        
Query: 421  tagattttctcgataagcttcttcgctatgatcaccaagataggctcactgctcgtgaag 480
            |||||||||| ||||||||||| || |||||||||||||||||||||||||| |||||||
Sbjct: 5493 tagattttcttgataagcttctacgttatgatcaccaagataggctcactgcacgtgaag 5552

                  
Query: 481  ctatgg 486
            ||||||
Sbjct: 5553 ctatgg 5558



 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 61/67 (91%)
 Strand = Plus / Plus

                                                                        
Query: 351  aggcacagtagaaaaccctggtcaaagttcattaatgctgataaccagcatctagtatct 410
            ||||| ||||||||||| ||||| || |||||||||||||||||||| ||||||||||||
Sbjct: 5346 aggcatagtagaaaaccatggtcgaaattcattaatgctgataaccaacatctagtatct 5405

                   
Query: 411  cccgagg 417
            || ||||
Sbjct: 5406 cctgagg 5412



 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 48/50 (96%)
 Strand = Plus / Plus

                                                              
Query: 207  ttccgcaaggagccattcttctatggccatgataaccatgaccaacttgt 256
            |||||||||||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 4564 ttccgcaaggagccattcttctatggtcatgataaccatgatcaacttgt 4613



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 72/83 (86%), Gaps = 2/83 (2%)
 Strand = Plus / Plus

                                                                        
Query: 268  aggtacttggaacagacagc-ctgaatgcttacttaaagaagtaccaccttgagcttgac 326
            |||||||||||||||| ||| || |||||||| || || ||||||||  |||||||||| 
Sbjct: 5187 aggtacttggaacaga-agcactaaatgcttatttgaacaagtaccatattgagcttgat 5245

                                   
Query: 327  cctcagcttgaacatcttgttgg 349
            ||||||||||||  |||||||||
Sbjct: 5246 cctcagcttgaagctcttgttgg 5268



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                     
Query: 489  catccatacttccttcaagtgagagcagcggagaacagcagggcacgaccgcaatga 545
            ||||| |||||||| ||||||||||| || || || ||||| |||||||| ||||||
Sbjct: 6218 catccgtacttcctccaagtgagagctgcagaaaatagcagagcacgaccacaatga 6274



to top

>gb|AC084282.6| Oryza sativa chromosome 3 BAC OSJNBb0048A17 genomic sequence, complete
              sequence
          Length = 128017

 Score =  137 bits (69), Expect = 5e-29
 Identities = 87/93 (93%)
 Strand = Plus / Minus

                                                                          
Query: 111    aggtatttcaagggacctgaacttctagttgatttgcaagattacgattattctctggac 170
              |||||||||||||| ||||| ||||| ||||||||||||||||| ||||||||| |||||
Sbjct: 127636 aggtatttcaaggggcctgagcttcttgttgatttgcaagattatgattattctttggac 127577

                                               
Query: 171    atgtggagccttgggtgcatgtttgctgggatg 203
              |||||||||||||| ||||||||||||||||||
Sbjct: 127576 atgtggagccttggttgcatgtttgctgggatg 127544



 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 62/66 (93%)
 Strand = Plus / Minus

                                                                          
Query: 421    tagattttctcgataagcttcttcgctatgatcaccaagataggctcactgctcgtgaag 480
              |||||||||| ||||||||||| || |||||||||||||||||||||||||| |||||||
Sbjct: 126494 tagattttcttgataagcttctacgttatgatcaccaagataggctcactgcacgtgaag 126435

                    
Query: 481    ctatgg 486
              ||||||
Sbjct: 126434 ctatgg 126429



 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 61/67 (91%)
 Strand = Plus / Minus

                                                                          
Query: 351    aggcacagtagaaaaccctggtcaaagttcattaatgctgataaccagcatctagtatct 410
              ||||| ||||||||||| ||||| || |||||||||||||||||||| ||||||||||||
Sbjct: 126641 aggcatagtagaaaaccatggtcgaaattcattaatgctgataaccaacatctagtatct 126582

                     
Query: 411    cccgagg 417
              || ||||
Sbjct: 126581 cctgagg 126575



 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 48/50 (96%)
 Strand = Plus / Minus

                                                                
Query: 207    ttccgcaaggagccattcttctatggccatgataaccatgaccaacttgt 256
              |||||||||||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 127423 ttccgcaaggagccattcttctatggtcatgataaccatgatcaacttgt 127374



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 72/83 (86%), Gaps = 2/83 (2%)
 Strand = Plus / Minus

                                                                          
Query: 268    aggtacttggaacagacagc-ctgaatgcttacttaaagaagtaccaccttgagcttgac 326
              |||||||||||||||| ||| || |||||||| || || ||||||||  |||||||||| 
Sbjct: 126800 aggtacttggaacaga-agcactaaatgcttatttgaacaagtaccatattgagcttgat 126742

                                     
Query: 327    cctcagcttgaacatcttgttgg 349
              ||||||||||||  |||||||||
Sbjct: 126741 cctcagcttgaagctcttgttgg 126719



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                       
Query: 489    catccatacttccttcaagtgagagcagcggagaacagcagggcacgaccgcaatga 545
              ||||| |||||||| ||||||||||| || || || ||||| |||||||| ||||||
Sbjct: 125769 catccgtacttcctccaagtgagagctgcagaaaatagcagagcacgaccacaatga 125713



to top

>ref|XM_507072.1| PREDICTED Oryza sativa (japonica cultivar-group), OSJNBa0002J24.2
           patrial mRNA
          Length = 797

 Score =  135 bits (68), Expect = 2e-28
 Identities = 101/112 (90%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           ||||||| ||||||||||| |||||||| || ||||||||||| ||||||||||||||||
Sbjct: 686 agccccacaatgttatgatagatcatgagctccgaaaacttcgattgatagactggggcc 745

                                                               
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaag 112
           |||| ||||| || |||||||| |||||||| ||||| ||||||||||||||
Sbjct: 746 tggctgagttctatcatccagggaaggaatataatgttcgtgttgcttcaag 797



to top

>dbj|AK120259.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013046C24, full
           insert sequence
          Length = 1449

 Score =  135 bits (68), Expect = 2e-28
 Identities = 224/276 (81%)
 Strand = Plus / Plus

                                                                       
Query: 9   aatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctggcggag 68
           |||||||||||||| ||||| || || || |||||||| || || ||||| || || |||
Sbjct: 698 aatgttatgattgaccatgaactccgcaagcttcgcttaattgattggggacttgctgag 757

                                                                       
Query: 69  ttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttcaagggacct 128
           |||||   |||||  || || |||||||| || ||||| ||||| || ||||| || |||
Sbjct: 758 ttttattttccagagaaagagtacaatgttcgggttgcctcaagatacttcaaagggcct 817

                                                                       
Query: 129 gaacttctagttgatttgcaagattacgattattctctggacatgtggagccttgggtgc 188
           ||| | || ||||| || |||  ||| || || ||| | ||||||||||||||||| || 
Sbjct: 818 gaattgctggttgacttccaaagttatgactactctttagacatgtggagccttggctgt 877

                                                                       
Query: 189 atgtttgctgggatgatcttccgcaaggagccattcttctatggccatgataaccatgac 248
           ||||||||||| || || || |||||||| ||||||||||||||||| ||||||||||||
Sbjct: 878 atgtttgctggaataatatttcgcaaggaaccattcttctatggccacgataaccatgac 937

                                               
Query: 249 caacttgtgaaaattgcgaaggtacttggaacagac 284
           || ||||| ||||| || ||||| || || ||||||
Sbjct: 938 cagcttgtcaaaatagccaaggttctaggtacagac 973



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 86/102 (84%)
 Strand = Plus / Plus

                                                                        
Query: 398  gcatctagtatctcccgaggccatagattttctcgataagcttcttcgctatgatcacca 457
            |||||| || ||||| ||||| || |||||||| ||||| ||| ||||||  || |||||
Sbjct: 1087 gcatcttgtctctccagaggctattgattttcttgataaacttattcgcttcgaccacca 1146

                                                      
Query: 458  agataggctcactgctcgtgaagctatggcgcatccatactt 499
             || ||||| || ||||||||||||||||||||||| |||||
Sbjct: 1147 tgacaggctgaccgctcgtgaagctatggcgcatccctactt 1188



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7,
              complete sequence
          Length = 29644043

 Score =  109 bits (55), Expect = 1e-20
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                          
Query: 9      aatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctggcggag 68
              ||||||||||| ||||| || ||||||||||| || || |||||||||||||| || || 
Sbjct: 800725 aatgttatgatagatcacgagcttcgaaaactccgattaatagactggggccttgctgaa 800666

                                                             
Query: 69     ttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggta 115
              || ||||| || ||||||||||| |||||||||||||||||||||||
Sbjct: 800665 ttctaccaccctggcaaggaatataatgtccgtgttgcttcaaggta 800619



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 79/89 (88%)
 Strand = Plus / Minus

                                                                          
Query: 111    aggtatttcaagggacctgaacttctagttgatttgcaagattacgattattctctggac 170
              ||||| |||||||||||||| ||||| ||||| ||||||||||| || || ||| |||||
Sbjct: 800235 aggtacttcaagggacctgagcttcttgttgacttgcaagattatgactactctttggac 800176

                                           
Query: 171    atgtggagccttgggtgcatgtttgctgg 199
              |||||||| ||||| ||||||||||||||
Sbjct: 800175 atgtggagtcttggttgcatgtttgctgg 800147



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 64/72 (88%)
 Strand = Plus / Minus

                                                                          
Query: 415    aggccatagattttctcgataagcttcttcgctatgatcaccaagataggctcactgctc 474
              ||||||| ||||| || || ||||||||||||||||||||||| ||||| || ||||| |
Sbjct: 799188 aggccatcgatttccttgacaagcttcttcgctatgatcaccaggatagacttactgcac 799129

                          
Query: 475    gtgaagctatgg 486
              ||||||||||||
Sbjct: 799128 gtgaagctatgg 799117



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 50/54 (92%)
 Strand = Plus / Minus

                                                                    
Query: 203    gatcttccgcaaggagccattcttctatggccatgataaccatgaccaacttgt 256
              ||||||||||||||||||||| |||||||| ||||| |||||||| ||||||||
Sbjct: 800023 gatcttccgcaaggagccatttttctatggtcatgacaaccatgatcaacttgt 799970



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                          
Query: 268    aggtacttggaacagacagcctgaatgcttacttaaagaagtaccaccttgagcttgacc 327
              |||||||||| ||||||||||||||| | ||||| || |||||||   ||||||||||||
Sbjct: 799518 aggtacttgggacagacagcctgaattcatacttgaacaagtaccgtattgagcttgacc 799459

                         
Query: 328    ctcagcttgaa 338
              | |||||||||
Sbjct: 799458 cacagcttgaa 799448



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                         
Query: 351    aggcacagtagaaaaccctggtcaaagttcattaatgctgataaccagcatctagtatc 409
              |||||||| || ||||| ||||||||||| ||||||||||| ||||| |||||||||||
Sbjct: 799347 aggcacagcaggaaaccttggtcaaagtttattaatgctgacaaccaacatctagtatc 799289



to top

>dbj|AP005244.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
              clone:OJ1513_F02
          Length = 126845

 Score =  109 bits (55), Expect = 1e-20
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                          
Query: 9      aatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctggcggag 68
              ||||||||||| ||||| || ||||||||||| || || |||||||||||||| || || 
Sbjct: 120532 aatgttatgatagatcacgagcttcgaaaactccgattaatagactggggccttgctgaa 120473

                                                             
Query: 69     ttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggta 115
              || ||||| || ||||||||||| |||||||||||||||||||||||
Sbjct: 120472 ttctaccaccctggcaaggaatataatgtccgtgttgcttcaaggta 120426



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 79/89 (88%)
 Strand = Plus / Minus

                                                                          
Query: 111    aggtatttcaagggacctgaacttctagttgatttgcaagattacgattattctctggac 170
              ||||| |||||||||||||| ||||| ||||| ||||||||||| || || ||| |||||
Sbjct: 120042 aggtacttcaagggacctgagcttcttgttgacttgcaagattatgactactctttggac 119983

                                           
Query: 171    atgtggagccttgggtgcatgtttgctgg 199
              |||||||| ||||| ||||||||||||||
Sbjct: 119982 atgtggagtcttggttgcatgtttgctgg 119954



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 64/72 (88%)
 Strand = Plus / Minus

                                                                          
Query: 415    aggccatagattttctcgataagcttcttcgctatgatcaccaagataggctcactgctc 474
              ||||||| ||||| || || ||||||||||||||||||||||| ||||| || ||||| |
Sbjct: 118995 aggccatcgatttccttgacaagcttcttcgctatgatcaccaggatagacttactgcac 118936

                          
Query: 475    gtgaagctatgg 486
              ||||||||||||
Sbjct: 118935 gtgaagctatgg 118924



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 50/54 (92%)
 Strand = Plus / Minus

                                                                    
Query: 203    gatcttccgcaaggagccattcttctatggccatgataaccatgaccaacttgt 256
              ||||||||||||||||||||| |||||||| ||||| |||||||| ||||||||
Sbjct: 119830 gatcttccgcaaggagccatttttctatggtcatgacaaccatgatcaacttgt 119777



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                          
Query: 268    aggtacttggaacagacagcctgaatgcttacttaaagaagtaccaccttgagcttgacc 327
              |||||||||| ||||||||||||||| | ||||| || |||||||   ||||||||||||
Sbjct: 119325 aggtacttgggacagacagcctgaattcatacttgaacaagtaccgtattgagcttgacc 119266

                         
Query: 328    ctcagcttgaa 338
              | |||||||||
Sbjct: 119265 cacagcttgaa 119255



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                         
Query: 351    aggcacagtagaaaaccctggtcaaagttcattaatgctgataaccagcatctagtatc 409
              |||||||| || ||||| ||||||||||| ||||||||||| ||||| |||||||||||
Sbjct: 119154 aggcacagcaggaaaccttggtcaaagtttattaatgctgacaaccaacatctagtatc 119096



to top

>emb|AJ420786.1|SAL420786 Sinapis alba mRNA for chloroplast casein kinase II alpha subunit
            (cpck2a gene)
          Length = 1490

 Score =  107 bits (54), Expect = 4e-20
 Identities = 222/278 (79%)
 Strand = Plus / Plus

                                                                        
Query: 6    cataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctggcg 65
            |||||||||||||||||||| || |  || || || ||||| || ||||||||  |||| 
Sbjct: 755  cataatgttatgattgatcacgagcaacggaagctacgcttaatcgactggggtttggca 814

                                                                        
Query: 66   gagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttcaaggga 125
            ||||| |||||||| || || ||||||||||| |||||||||||||| || || || || 
Sbjct: 815  gagttctaccatcctgggaaagaatacaatgttcgtgttgcttcaagatactttaaaggt 874

                                                                        
Query: 126  cctgaacttctagttgatttgcaagattacgattattctctggacatgtggagccttggg 185
            || || || || || |||||    || || || |||||  | ||| ||||||| ||||| 
Sbjct: 875  ccagagctgctggtggatttaatggactatgactattccttagacttgtggagtcttggc 934

                                                                        
Query: 186  tgcatgtttgctgggatgatcttccgcaaggagccattcttctatggccatgataaccat 245
            || ||||||||||| ||||| ||||||||||| || ||||| ||||| ||||| ||| ||
Sbjct: 935  tgtatgtttgctggaatgatattccgcaaggaacccttcttttatggtcatgacaactat 994

                                                  
Query: 246  gaccaacttgtgaaaattgcgaaggtacttggaacaga 283
            || ||| | || ||||| || ||||||||||| |||||
Sbjct: 995  gatcaattggtcaaaatcgcaaaggtacttggcacaga 1032



to top

>emb|Y11649.1|ZMPKCK2AL Zea mays gene encoding protein kinase CK2 alpha subunit
          Length = 7516

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 82/93 (88%)
 Strand = Plus / Plus

                                                                        
Query: 111  aggtatttcaagggacctgaacttctagttgatttgcaagattacgattattctctggac 170
            ||||| |||||||| ||||| ||||| ||||| ||||||||||| ||||| ||| |||||
Sbjct: 5269 aggtacttcaaggggcctgagcttcttgttgacttgcaagattatgattactctttggac 5328

                                             
Query: 171  atgtggagccttgggtgcatgtttgctgggatg 203
            |||||||| || || ||||||||||||||||||
Sbjct: 5329 atgtggagtctgggctgcatgtttgctgggatg 5361



 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 98/115 (85%)
 Strand = Plus / Plus

                                                                        
Query: 1    agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
            ||||||| ||||||||||| |||||||| ||||| ||||| ||  ||||||||||||| |
Sbjct: 5097 agccccacaatgttatgatagatcatgagcttcggaaactccggctgatagactggggtc 5156

                                                                   
Query: 61   tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggta 115
            | || || || || ||||| ||||||||||| |||||||||||||| || |||||
Sbjct: 5157 ttgctgaattctatcatcctggcaaggaatataatgtccgtgttgcatccaggta 5211



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 60/72 (83%)
 Strand = Plus / Plus

                                                                        
Query: 415  aggccatagattttctcgataagcttcttcgctatgatcaccaagataggctcactgctc 474
            ||||||||||||| || || |||||| | || |||||||| || || ||||| ||||| |
Sbjct: 6001 aggccatagatttccttgacaagcttttgcgttatgatcatcaggagaggcttactgcac 6060

                        
Query: 475  gtgaagctatgg 486
             |||||||||||
Sbjct: 6061 ttgaagctatgg 6072



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                    
Query: 316  ttgagcttgaccctcagcttgaacatcttgttggaaggca 355
            |||||||||||||||||||||||   || |||||||||||
Sbjct: 5707 ttgagcttgaccctcagcttgaagccctcgttggaaggca 5746



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 47/55 (85%)
 Strand = Plus / Plus

                                                                   
Query: 363  aaaccctggtcaaagttcattaatgctgataaccagcatctagtatctcccgagg 417
            |||||||||| |||||| || || || ||||||||||| ||||| ||||| ||||
Sbjct: 5851 aaaccctggttaaagtttatgaacgcagataaccagcacctagtgtctcctgagg 5905



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                
Query: 495  tacttccttcaagtgagagcagcggagaacagcagg 530
            |||||||  ||||||||||| || ||||||||||||
Sbjct: 6157 tacttccaacaagtgagagccgctgagaacagcagg 6192



to top

>ref|NM_060410.2| Caenorhabditis elegans protein KINase family member (kin-3) (kin-3)
           mRNA, complete cds
          Length = 1473

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 124/150 (82%)
 Strand = Plus / Plus

                                                                       
Query: 93  aatgtccgtgttgcttcaaggtatttcaagggacctgaacttctagttgatttgcaagat 152
           ||||| ||||||||||| || |||||||||||||| || ||||| || ||||  |||  |
Sbjct: 583 aatgttcgtgttgcttctagatatttcaagggacccgagcttcttgtcgattatcaatgt 642

                                                                       
Query: 153 tacgattattctctggacatgtggagccttgggtgcatgtttgctgggatgatcttccgc 212
           |||||||||||  |||| ||||||||  | || |||||||| ||| | ||||||||| | 
Sbjct: 643 tacgattattcgttggatatgtggagtttgggatgcatgttggctagtatgatcttcagg 702

                                         
Query: 213 aaggagccattcttctatggccatgataac 242
           ||||| ||||||||| | ||||||||||||
Sbjct: 703 aaggaaccattcttccacggccatgataac 732



to top

>gb|AF067211.2| Caenorhabditis elegans cosmid B0205, complete sequence
          Length = 40951

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 124/150 (82%)
 Strand = Plus / Plus

                                                                         
Query: 93    aatgtccgtgttgcttcaaggtatttcaagggacctgaacttctagttgatttgcaagat 152
             ||||| ||||||||||| || |||||||||||||| || ||||| || ||||  |||  |
Sbjct: 29036 aatgttcgtgttgcttctagatatttcaagggacccgagcttcttgtcgattatcaatgt 29095

                                                                         
Query: 153   tacgattattctctggacatgtggagccttgggtgcatgtttgctgggatgatcttccgc 212
             |||||||||||  |||| ||||||||  | || |||||||| ||| | ||||||||| | 
Sbjct: 29096 tacgattattcgttggatatgtggagtttgggatgcatgttggctagtatgatcttcagg 29155

                                           
Query: 213   aaggagccattcttctatggccatgataac 242
             ||||| ||||||||| | ||||||||||||
Sbjct: 29156 aaggaaccattcttccacggccatgataac 29185



to top

>gb|J05274.1|CELCKINII C.elegans casein kinase II-alpha gene, complete cds
          Length = 3180

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 124/150 (82%)
 Strand = Plus / Plus

                                                                        
Query: 93   aatgtccgtgttgcttcaaggtatttcaagggacctgaacttctagttgatttgcaagat 152
            ||||| ||||||||||| || |||||||||||||| || ||||| || ||||  |||  |
Sbjct: 1222 aatgttcgtgttgcttctagatatttcaagggacccgagcttcttgtcgattatcaatgt 1281

                                                                        
Query: 153  tacgattattctctggacatgtggagccttgggtgcatgtttgctgggatgatcttccgc 212
            |||||||||||  |||| ||||||||  | || |||||||| ||| | ||||||||| | 
Sbjct: 1282 tacgattattcgttggatatgtggagtttgggatgcatgttggctagtatgatcttcagg 1341

                                          
Query: 213  aaggagccattcttctatggccatgataac 242
            ||||| ||||||||| | ||||||||||||
Sbjct: 1342 aaggaaccattcttccacggccatgataac 1371



to top

>gb|AC144765.19| Medicago truncatula clone mth2-35o11, complete sequence
          Length = 130836

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 91/107 (85%)
 Strand = Plus / Minus

                                                                         
Query: 9     aatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctggcggag 68
             ||||||||||| ||||||||  | |||||||| ||||||||||| ||||| || || || 
Sbjct: 82221 aatgttatgatagatcatgaattgcgaaaactccgcttgatagattggggtcttgctgaa 82162

                                                            
Query: 69    ttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggta 115
             ||||| ||||| || |||||||| ||||| ||||| |||||||||||
Sbjct: 82161 ttttatcatcctgggaaggaatataatgttcgtgtggcttcaaggta 82115



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 68/77 (88%)
 Strand = Plus / Minus

                                                                         
Query: 120   aagggacctgaacttctagttgatttgcaagattacgattattctctggacatgtggagc 179
             ||||| |||||||||||||||||||||||||| || ||||| ||  | ||||||||||||
Sbjct: 80966 aagggccctgaacttctagttgatttgcaagactatgattactcattagacatgtggagc 80907

                              
Query: 180   cttgggtgcatgtttgc 196
             ||||| || ||||||||
Sbjct: 80906 cttggctgtatgtttgc 80890



to top

>gb|AC137703.42| Medicago truncatula clone mth2-11d24, complete sequence
          Length = 127446

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 91/107 (85%)
 Strand = Plus / Plus

                                                                          
Query: 9      aatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctggcggag 68
              ||||||||||| ||||||||  | |||||||| ||||||||||| ||||| || || || 
Sbjct: 119418 aatgttatgatagatcatgaattgcgaaaactccgcttgatagattggggtcttgctgaa 119477

                                                             
Query: 69     ttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggta 115
              ||||| ||||| || |||||||| ||||| ||||| |||||||||||
Sbjct: 119478 ttttatcatcctgggaaggaatataatgttcgtgtggcttcaaggta 119524



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 68/77 (88%)
 Strand = Plus / Plus

                                                                          
Query: 120    aagggacctgaacttctagttgatttgcaagattacgattattctctggacatgtggagc 179
              ||||| |||||||||||||||||||||||||| || ||||| ||  | ||||||||||||
Sbjct: 120673 aagggccctgaacttctagttgatttgcaagactatgattactcattagacatgtggagc 120732

                               
Query: 180    cttgggtgcatgtttgc 196
              ||||| || ||||||||
Sbjct: 120733 cttggctgtatgtttgc 120749



to top

>dbj|AP006092.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT21D16, TM0157b,
            complete sequence
          Length = 28160

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 97/115 (84%)
 Strand = Plus / Plus

                                                                        
Query: 1    agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
            |||| |||||||| ||||| ||||||||  |||  ||||||||||||||||| ||||| |
Sbjct: 9362 agcctcataatgtaatgatcgatcatgaatttcataaacttcgcttgatagattggggtc 9421

                                                                   
Query: 61   tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggta 115
            | || || ||||| ||||| || |||||||| ||||| ||||| |||||||||||
Sbjct: 9422 ttgctgaattttatcatcctggaaaggaatataatgttcgtgtggcttcaaggta 9476



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Plus

                                                                         
Query: 120   aagggacctgaacttctagttgatttgcaagattacgattattctctggacatgtggagc 179
             ||||| |||||||||||||| ||||||||||| || || || ||  | ||||||||||||
Sbjct: 10894 aagggccctgaacttctagtagatttgcaagactatgactactcattagacatgtggagc 10953

                                 
Query: 180   cttgggtgcatgtttgctgg 199
             || || ||||||||||||||
Sbjct: 10954 ctgggttgcatgtttgctgg 10973



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                         
Query: 423   gattttctcgataagcttcttcgctatgatcaccaagataggct 466
             |||||||| |||||||||||||| ||||| ||||| || |||||
Sbjct: 12321 gattttcttgataagcttcttcgatatgaccaccaggacaggct 12364



to top

>gb|AC004401.3| Arabidopsis thaliana chromosome 2 clone F21P24 map CIC06C07, complete
             sequence
          Length = 94038

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 93/110 (84%)
 Strand = Plus / Minus

                                                                         
Query: 6     cataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctggcg 65
             |||||||| ||||||||||| || |  ||||||||||| || || ||||||||  |||| 
Sbjct: 57016 cataatgtcatgattgatcacgagcagcgaaaacttcgtttaattgactggggtttggca 56957

                                                               
Query: 66    gagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggta 115
             || || || ||||| || || |||||||||||||||||||||||||||||
Sbjct: 56956 gaattctatcatcctgggaaagaatacaatgtccgtgttgcttcaaggta 56907



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 58/66 (87%)
 Strand = Plus / Plus

                                                                         
Query: 207   ttccgcaaggagccattcttctatggccatgataaccatgaccaacttgtgaaaattgcg 266
             ||||| ||||| || ||||| |||||||||||||| ||||| |||||||| |||||||| 
Sbjct: 60151 ttccgtaaggaaccgttcttttatggccatgataatcatgatcaacttgtcaaaattgcc 60210

                   
Query: 267   aaggta 272
             ||||||
Sbjct: 60211 aaggta 60216



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                         
Query: 207   ttccgcaaggagccattcttctatggccatgataaccatgaccaacttgtgaaaattgcg 266
             |||||||||||||| ||||| ||||||||||| ||| |||| ||| | || |||||||||
Sbjct: 56474 ttccgcaaggagccgttcttttatggccatgacaactatgatcaattggtcaaaattgcg 56415

                   
Query: 267   aaggta 272
             ||||||
Sbjct: 56414 aaggta 56409



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                         
Query: 117   ttcaagggacctgaacttctagttgatttgcaagattacgattattctctggacatgtgg 176
             |||||||| || || ||| |||||||| | || ||||| || |||||| | |||||||||
Sbjct: 59929 ttcaagggtcccgagcttttagttgatctacaggattatgactattctttagacatgtgg 59988

                                    
Query: 177   agccttgggtgcatgtttgctgg 199
             || ||||| ||||||||||||||
Sbjct: 59989 agtcttggttgcatgtttgctgg 60011



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 67/79 (84%)
 Strand = Plus / Plus

                                                                         
Query: 1     agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
             |||| |||||||| ||||| |||||| | || || ||||||||  ||||||| |||||||
Sbjct: 59660 agcctcataatgtcatgatagatcatcagctgcgtaaacttcgtctgatagattggggcc 59719

                                
Query: 61    tggcggagttttaccatcc 79
             | || ||||||||||||||
Sbjct: 59720 ttgctgagttttaccatcc 59738



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                   
Query: 423   gattttctcgataagcttcttcgctatgatcaccaaga 460
             ||||||||||||||||||||||  |||||||| |||||
Sbjct: 60645 gattttctcgataagcttcttcagtatgatcatcaaga 60682



to top

>gb|BC072324.1| Xenopus laevis hypothetical protein MGC83125, mRNA (cDNA clone
           MGC:83125 IMAGE:6318214), complete cds
          Length = 2601

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 73/81 (90%), Gaps = 2/81 (2%)
 Strand = Plus / Plus

                                                                       
Query: 45  ttgatagactggggcctggcggagttttaccatccaggca-aggaatacaatgtccgtgt 103
           ||||||||||||||| |||| |||||||||||||| |||| ||||||| |||||||||||
Sbjct: 580 ttgatagactggggcttggcagagttttaccatcc-ggcacaggaatataatgtccgtgt 638

                                
Query: 104 tgcttcaaggtatttcaaggg 124
           ||| ||| | |||||||||||
Sbjct: 639 tgcatcacgatatttcaaggg 659



to top

>gb|BC072167.1| Xenopus laevis alpha subunit of casein kinase II, mRNA (cDNA clone
           MGC:80222 IMAGE:4971090), complete cds
          Length = 2350

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 178/224 (79%)
 Strand = Plus / Plus

                                                                       
Query: 48  atagactggggcctggcggagttttaccatccaggcaaggaatacaatgtccgtgttgct 107
           |||||||||||| |||| || || ||||| |||||  |||| ||||||||||||||||||
Sbjct: 691 atagactggggcttggccgaattctaccacccaggacaggagtacaatgtccgtgttgct 750

                                                                       
Query: 108 tcaaggtatttcaagggacctgaacttctagttgatttgcaagattacgattattctctg 167
           ||  | || |||||||| || || || || || ||||  |||   ||||| ||    |||
Sbjct: 751 tcccgatacttcaaggggccggagctgcttgtggattaccaaatgtacgactacagcctg 810

                                                                       
Query: 168 gacatgtggagccttgggtgcatgtttgctgggatgatcttccgcaaggagccattcttc 227
           |||||||||||||| ||||||||| | ||  | ||||| ||| | || |||||||| |||
Sbjct: 811 gacatgtggagcctggggtgcatgctggccagtatgattttcagaaaagagccatttttc 870

                                                       
Query: 228 tatggccatgataaccatgaccaacttgtgaaaattgcgaaggt 271
            |||||||||||||| | ||||| || |||| ||| ||||||||
Sbjct: 871 catggccatgataactacgaccagctggtgagaatagcgaaggt 914



to top

>emb|CT025308.2| Xenopus tropicalis finished cDNA, clone TNeu098g04
          Length = 1591

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Plus

                                                                       
Query: 45  ttgatagactggggcctggcggagttttaccatccaggcaaggaatacaatgtccgtgtt 104
           ||||||||||||||| |||| ||||||||||||||||   ||||||| ||||||||||| 
Sbjct: 555 ttgatagactggggcttggcagagttttaccatccagcacaggaatataatgtccgtgta 614

                               
Query: 105 gcttcaaggtatttcaaggg 124
           || ||| | |||||||||||
Sbjct: 615 gcatcacgatatttcaaggg 634



to top

>emb|X62375.2|XLCKIIA Xenopus laevis mRNA for alpha subunit of casein kinase II
          Length = 1179

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 178/224 (79%)
 Strand = Plus / Plus

                                                                       
Query: 48  atagactggggcctggcggagttttaccatccaggcaaggaatacaatgtccgtgttgct 107
           |||||||||||| |||| || || ||||| |||||  |||| ||||||||||||||||||
Sbjct: 520 atagactggggcttggccgaattctaccacccaggacaggagtacaatgtccgtgttgct 579

                                                                       
Query: 108 tcaaggtatttcaagggacctgaacttctagttgatttgcaagattacgattattctctg 167
           ||  | || |||||||| || || || || || ||||  |||   ||||| ||    |||
Sbjct: 580 tcccgatacttcaaggggccggagctgcttgtggattaccaaatgtacgactacagcctg 639

                                                                       
Query: 168 gacatgtggagccttgggtgcatgtttgctgggatgatcttccgcaaggagccattcttc 227
           |||||||||||||| ||||||||| | ||  | ||||| ||| | || |||||||| |||
Sbjct: 640 gacatgtggagcctggggtgcatgctggccagtatgattttcagaaaagagccatttttc 699

                                                       
Query: 228 tatggccatgataaccatgaccaacttgtgaaaattgcgaaggt 271
            |||||||||||||| | ||||| || |||| ||| ||||||||
Sbjct: 700 catggccatgataactacgaccagctggtgagaatagcgaaggt 743



to top

>ref|XM_752234.1| Ustilago maydis 521 hypothetical protein (UM01180.1) partial mRNA
          Length = 1029

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 93/111 (83%)
 Strand = Plus / Plus

                                                                       
Query: 117 ttcaagggacctgaacttctagttgatttgcaagattacgattattctctggacatgtgg 176
           ||||||||||||||||| || || || || ||||| ||||| ||||| || || ||||||
Sbjct: 598 ttcaagggacctgaactgctggtcgacttccaagagtacgactattcgctcgatatgtgg 657

                                                              
Query: 177 agccttgggtgcatgtttgctgggatgatcttccgcaaggagccattcttc 227
           ||  | || |||||||||||  | |||||||||||||||||||| ||||||
Sbjct: 658 agtttgggatgcatgtttgccagcatgatcttccgcaaggagcctttcttc 708



to top

>ref|XM_948210.1| Theileria annulata strain Ankara casein kinase II alpha subunit
            (TA10630) partial mRNA
          Length = 1263

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Plus

                                                                        
Query: 213  aaggagccattcttctatggccatgataaccatgaccaacttgtgaaaattgcgaaggta 272
            ||||||||||| ||||| |||||||||||| ||||||| ||||||||||| || || |||
Sbjct: 949  aaggagccatttttctacggccatgataactatgaccagcttgtgaaaatagccaaagta 1008

                       
Query: 273  cttggaacaga 283
            || ||||||||
Sbjct: 1009 ctaggaacaga 1019



to top

>emb|AL132978.1|ATF3A4 Arabidopsis thaliana DNA chromosome 3, BAC clone F3A4
          Length = 108158

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 66/75 (88%)
 Strand = Plus / Plus

                                                                         
Query: 129   gaacttctagttgatttgcaagattacgattattctctggacatgtggagccttgggtgc 188
             ||||||||||||||||| || || || || |||||  |||||||||||||||| || |||
Sbjct: 33178 gaacttctagttgatttacaggactatgactattccttggacatgtggagcctcggttgc 33237

                            
Query: 189   atgtttgctgggatg 203
             |||||||||||||||
Sbjct: 33238 atgtttgctgggatg 33252



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 57/66 (86%)
 Strand = Plus / Plus

                                                                         
Query: 207   ttccgcaaggagccattcttctatggccatgataaccatgaccaacttgtgaaaattgcg 266
             ||||||||||| || ||||||||||||||||| ||||| || || || || |||||||| 
Sbjct: 33376 ttccgcaaggaacctttcttctatggccatgacaaccaggatcagctcgtcaaaattgcc 33435

                   
Query: 267   aaggta 272
             ||||||
Sbjct: 33436 aaggta 33441



to top

>emb|AJ315847.1|TAN315847 Theileria annulata ckII alpha gene for casein kinase II alpha
          Length = 2179

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Plus

                                                                        
Query: 213  aaggagccattcttctatggccatgataaccatgaccaacttgtgaaaattgcgaaggta 272
            ||||||||||| ||||| |||||||||||| ||||||| ||||||||||| || || |||
Sbjct: 1537 aaggagccatttttctacggccatgataactatgaccagcttgtgaaaatagccaaagta 1596

                       
Query: 273  cttggaacaga 283
            || ||||||||
Sbjct: 1597 ctaggaacaga 1607



to top

>ref|XM_865068.1| PREDICTED: Bos taurus similar to casein kinase II, alpha 1
           polypeptide (LOC613871), mRNA
          Length = 759

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 107/130 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           ||||||||||||| |||||||||||||| |   |||| || ||  | |||||||||||  
Sbjct: 464 agccccataatgtcatgattgatcatgagcacagaaagctacggctaatagactggggtt 523

                                                                       
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttca 120
           |||| |||||||||||||| ||| | ||||| |||||||| ||||||||  | |||||||
Sbjct: 524 tggctgagttttaccatcctggccaagaatataatgtccgagttgcttcccgatatttca 583

                     
Query: 121 agggacctga 130
           | || |||||
Sbjct: 584 aaggtcctga 593



to top

>ref|XM_571600.1| Cryptococcus neoformans var. neoformans JEC21 protein kinase CK2
           (CNF02800) partial mRNA
          Length = 1307

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 119/146 (81%)
 Strand = Plus / Plus

                                                                       
Query: 66  gagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttcaaggga 125
           |||||||||||||| |||| ||||||||| || ||||| |||||||| |||||||| |||
Sbjct: 687 gagttttaccatcctggcacggaatacaacgtgcgtgtggcttcaagatatttcaaagga 746

                                                                       
Query: 126 cctgaacttctagttgatttgcaagattacgattattctctggacatgtggagccttggg 185
           || ||  |  | || ||||| ||||| ||||||||   | |||| ||||||||| | |||
Sbjct: 747 ccagagttattggtcgattttcaagaatacgattacagtttggatatgtggagcttaggg 806

                                     
Query: 186 tgcatgtttgctgggatgatcttccg 211
           |||||||| ||| | ||||| |||||
Sbjct: 807 tgcatgttcgctagcatgattttccg 832



to top

>gb|AC132214.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
              OSJNBa0040M05, from chromosome 3, complete sequence
          Length = 153126

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                          
Query: 210    cgcaaggagccattcttctatggccatgataaccatgaccaacttgtgaaaattgcgaag 269
              |||||||| ||||||||||||||||| |||||||||||||| ||||| ||||| || |||
Sbjct: 128899 cgcaaggaaccattcttctatggccacgataaccatgaccagcttgtcaaaatagccaag 128840

                
Query: 270    gt 271
              ||
Sbjct: 128839 gt 128838



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                              
Query: 168    gacatgtggagccttgggtgcatgtttgctgg 199
              ||||||||||||||||| || |||||||||||
Sbjct: 129063 gacatgtggagccttggctgtatgtttgctgg 129032



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 54/64 (84%)
 Strand = Plus / Minus

                                                                          
Query: 423    gattttctcgataagcttcttcgctatgatcaccaagataggctcactgctcgtgaagct 482
              |||||||| ||||| ||| ||||||  || ||||| || ||||| || ||||||||||||
Sbjct: 128347 gattttcttgataaacttattcgcttcgaccaccatgacaggctgaccgctcgtgaagct 128288

                  
Query: 483    atgg 486
              ||||
Sbjct: 128287 atgg 128284



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                          
Query: 9      aatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctggcggag 68
              |||||||||||||| ||||| || || || |||||||| || || ||||| || || |||
Sbjct: 129655 aatgttatgattgaccatgaactccgcaagcttcgcttaattgattggggacttgctgag 129596

                   
Query: 69     tttta 73
              |||||
Sbjct: 129595 tttta 129591



to top

>gb|BC112816.1| Bos taurus casein kinase 2, alpha 1 polypeptide, mRNA (cDNA clone
           MGC:137728 IMAGE:8174637), complete cds
          Length = 2328

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 107/130 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           ||||||||||||| |||||||||||||| |   |||| || ||  | |||||||||||  
Sbjct: 704 agccccataatgtcatgattgatcatgagcacagaaagctacggctaatagactggggtt 763

                                                                       
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttca 120
           |||| |||||||||||||| ||| | ||||| |||||||| ||||||||  | |||||||
Sbjct: 764 tggctgagttttaccatcctggccaagaatataatgtccgagttgcttcccgatatttca 823

                     
Query: 121 agggacctga 130
           | || |||||
Sbjct: 824 aaggtcctga 833



to top

>ref|NM_174635.2| Bos taurus casein kinase 2, alpha 1 polypeptide (CSNK2A1), mRNA
          Length = 2328

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 107/130 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           ||||||||||||| |||||||||||||| |   |||| || ||  | |||||||||||  
Sbjct: 704 agccccataatgtcatgattgatcatgagcacagaaagctacggctaatagactggggtt 763

                                                                       
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttca 120
           |||| |||||||||||||| ||| | ||||| |||||||| ||||||||  | |||||||
Sbjct: 764 tggctgagttttaccatcctggccaagaatataatgtccgagttgcttcccgatatttca 823

                     
Query: 121 agggacctga 130
           | || |||||
Sbjct: 824 aaggtcctga 833



to top

>gb|AC105928.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone
             OSJNBa0014O06, complete sequence
          Length = 168031

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                         
Query: 210   cgcaaggagccattcttctatggccatgataaccatgaccaacttgtgaaaattgcgaag 269
             |||||||| ||||||||||||||||| |||||||||||||| ||||| ||||| || |||
Sbjct: 49066 cgcaaggaaccattcttctatggccacgataaccatgaccagcttgtcaaaatagccaag 49007

               
Query: 270   gt 271
             ||
Sbjct: 49006 gt 49005



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                             
Query: 168   gacatgtggagccttgggtgcatgtttgctgg 199
             ||||||||||||||||| || |||||||||||
Sbjct: 49230 gacatgtggagccttggctgtatgtttgctgg 49199



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 54/64 (84%)
 Strand = Plus / Minus

                                                                         
Query: 423   gattttctcgataagcttcttcgctatgatcaccaagataggctcactgctcgtgaagct 482
             |||||||| ||||| ||| ||||||  || ||||| || ||||| || ||||||||||||
Sbjct: 48514 gattttcttgataaacttattcgcttcgaccaccatgacaggctgaccgctcgtgaagct 48455

                 
Query: 483   atgg 486
             ||||
Sbjct: 48454 atgg 48451



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                         
Query: 9     aatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctggcggag 68
             |||||||||||||| ||||| || || || |||||||| || || ||||| || || |||
Sbjct: 49822 aatgttatgattgaccatgaactccgcaagcttcgcttaattgattggggacttgctgag 49763

                  
Query: 69    tttta 73
             |||||
Sbjct: 49762 tttta 49758



to top

>dbj|AB007645.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K8K14
          Length = 72698

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                         
Query: 114   tatttcaagggacctgaacttctagttgatttgcaagattacgattattctctggacatg 173
             ||||||||||||||||||||||| || || |||||||| || || |||||  |||| |||
Sbjct: 33930 tatttcaagggacctgaacttcttgtggacttgcaagactatgactattcattggatatg 33871

                                           
Query: 174   tggagccttgggtgcatgtttgctgggatg 203
             ||||| ||||| || |||||||| ||||||
Sbjct: 33870 tggagtcttggctgtatgtttgcagggatg 33841



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 96/116 (82%)
 Strand = Plus / Minus

                                                                         
Query: 1     agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
             |||| ||||||||||||||||| ||||| || || || |||||  | ||||| ||||| |
Sbjct: 34130 agcctcataatgttatgattgaccatgagctgcgtaagcttcgtcttatagattggggtc 34071

                                                                     
Query: 61    tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtat 116
             | || ||||||||||| || || || || || |||||||||||||| |||||||||
Sbjct: 34070 ttgctgagttttaccaccctggaaaagagtataatgtccgtgttgcctcaaggtat 34015



to top

>emb|X54962.1|BTPCK1A B.taurus pCK1 mRNA for casein kinase II alpha subunit
          Length = 1545

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 107/130 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           ||||||||||||| |||||||||||||| |   |||| || ||  | |||||||||||  
Sbjct: 668 agccccataatgtcatgattgatcatgagcacagaaagctacggctaatagactggggtt 727

                                                                       
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttca 120
           |||| |||||||||||||| ||| | ||||| |||||||| ||||||||  | |||||||
Sbjct: 728 tggctgagttttaccatcctggccaagaatataatgtccgagttgcttcccgatatttca 787

                     
Query: 121 agggacctga 130
           | || |||||
Sbjct: 788 aaggtcctga 797



to top

>gb|M93665.1|BOVCAKINII Cow casein kinase II alpha subunit mRNA, complete cds
          Length = 1488

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 107/130 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           ||||||||||||| |||||||||||||| |   |||| || ||  | |||||||||||  
Sbjct: 604 agccccataatgtcatgattgatcatgagcacagaaagctacggctaatagactggggtt 663

                                                                       
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttca 120
           |||| |||||||||||||| ||| | ||||| |||||||| ||||||||  | |||||||
Sbjct: 664 tggctgagttttaccatcctggccaagaatataatgtccgagttgcttcccgatatttca 723

                     
Query: 121 agggacctga 130
           | || |||||
Sbjct: 724 aaggtcctga 733



to top

>gb|BC059309.1| Xenopus laevis cDNA clone IMAGE:4960119, containing frame-shift
           errors
          Length = 4344

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 76/89 (85%)
 Strand = Plus / Plus

                                                                       
Query: 45  ttgatagactggggcctggcggagttttaccatccaggcaaggaatacaatgtccgtgtt 104
           ||||||||||||||| |||| || |||||||||||||   ||||||| ||||||||||| 
Sbjct: 597 ttgatagactggggcttggcagaattttaccatccagcacaggaatataatgtccgtgta 656

                                        
Query: 105 gcttcaaggtatttcaagggacctgaact 133
           || ||| | ||||||||||| || |||||
Sbjct: 657 gcatcacgatatttcaagggccccgaact 685



to top

>gb|AE017346.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 6, complete
              sequence
          Length = 1438950

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 105/128 (82%)
 Strand = Plus / Minus

                                                                          
Query: 66     gagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttcaaggga 125
              |||||||||||||| |||| ||||||||| || ||||| |||||||| |||||||| |||
Sbjct: 801378 gagttttaccatcctggcacggaatacaacgtgcgtgtggcttcaagatatttcaaagga 801319

                                                                          
Query: 126    cctgaacttctagttgatttgcaagattacgattattctctggacatgtggagccttggg 185
              || ||  |  | || ||||| ||||| ||||||||   | |||| ||||||||| | |||
Sbjct: 801318 ccagagttattggtcgattttcaagaatacgattacagtttggatatgtggagcttaggg 801259

                      
Query: 186    tgcatgtt 193
              ||||||||
Sbjct: 801258 tgcatgtt 801251



to top

>gb|DQ029118.1| Caenorhabditis remanei casein kinase II alpha subunit mRNA, partial
           cds
          Length = 634

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 123/152 (80%)
 Strand = Plus / Plus

                                                                       
Query: 90  tacaatgtccgtgttgcttcaaggtatttcaagggacctgaacttctagttgatttgcaa 149
           |||||||||||||| |||||||| |||||||| ||||| |||||||| ||||| |  |||
Sbjct: 224 tacaatgtccgtgtcgcttcaagatatttcaaaggaccagaacttctcgttgactaccaa 283

                                                                       
Query: 150 gattacgattattctctggacatgtggagccttgggtgcatgtttgctgggatgatcttc 209
              |||||||||||  |||| ||||||||  | || || ||||| ||  | |||||||||
Sbjct: 284 tgctacgattattccttggatatgtggagtttgggatgtatgttggccagcatgatcttc 343

                                           
Query: 210 cgcaaggagccattcttctatggccatgataa 241
            | |||||||| |||||| |||| || |||||
Sbjct: 344 agaaaggagccgttcttccatggacacgataa 375



to top

>ref|XM_469876.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1455

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 80/95 (84%)
 Strand = Plus / Plus

                                                                       
Query: 102 gttgcttcaaggtatttcaagggacctgaacttctagttgatttgcaagattacgattat 161
           ||||||||||| | ||  ||||| ||||||||||| || ||||||| |||||| ||||| 
Sbjct: 808 gttgcttcaagatcttataagggccctgaacttcttgtggatttgctagattatgattac 867

                                              
Query: 162 tctctggacatgtggagccttgggtgcatgtttgc 196
           ||  ||||  ||||||||||||| |||||||||||
Sbjct: 868 tcgttggatttgtggagccttggttgcatgtttgc 902



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                  
Query: 315  cttgagcttgaccctcagcttgaacatcttgttggaag 352
            |||||||||||||| |||||||||   |||||||||||
Sbjct: 1021 cttgagcttgacccgcagcttgaaagacttgttggaag 1058



to top

>gb|BC060742.1| Mus musculus casein kinase II, alpha 1 polypeptide, mRNA (cDNA
           clone MGC:68201 IMAGE:4945773), complete cds
          Length = 4213

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 89/107 (83%)
 Strand = Plus / Plus

                                                                       
Query: 3   ccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctg 62
           ||||||||||| |||||||||||||| |   |||| |||||  | |||||||||||  | 
Sbjct: 691 ccccataatgtcatgattgatcatgagcacagaaagcttcggctaatagactggggttta 750

                                                          
Query: 63  gcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           || |||||||||||||||||| | || || |||||||| ||||||||
Sbjct: 751 gctgagttttaccatccaggccaagagtataatgtccgagttgcttc 797



to top

>gb|BC026149.1| Mus musculus casein kinase II, alpha 1 polypeptide, mRNA (cDNA
           clone MGC:13987 IMAGE:4188101), complete cds
          Length = 4119

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 89/107 (83%)
 Strand = Plus / Plus

                                                                       
Query: 3   ccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctg 62
           ||||||||||| |||||||||||||| |   |||| |||||  | |||||||||||  | 
Sbjct: 640 ccccataatgtcatgattgatcatgagcacagaaagcttcggctaatagactggggttta 699

                                                          
Query: 63  gcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           || |||||||||||||||||| | || || |||||||| ||||||||
Sbjct: 700 gctgagttttaccatccaggccaagagtataatgtccgagttgcttc 746



to top

>ref|NM_007788.2| Mus musculus casein kinase II, alpha 1 polypeptide (Csnk2a1), mRNA
          Length = 4119

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 89/107 (83%)
 Strand = Plus / Plus

                                                                       
Query: 3   ccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctg 62
           ||||||||||| |||||||||||||| |   |||| |||||  | |||||||||||  | 
Sbjct: 640 ccccataatgtcatgattgatcatgagcacagaaagcttcggctaatagactggggttta 699

                                                          
Query: 63  gcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           || |||||||||||||||||| | || || |||||||| ||||||||
Sbjct: 700 gctgagttttaccatccaggccaagagtataatgtccgagttgcttc 746



to top

>ref|XM_454135.1| Kluyveromyces lactis NRRL Y-1140, KLLA0E04136g predicted mRNA
          Length = 1122

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                      
Query: 86  ggaatacaatgtccgtgttgcttcaaggtatttcaagggacctgaacttctagttgatt 144
           ||||||||||||||| ||||| ||||| | ||||||||| || ||||||||||||||||
Sbjct: 675 ggaatacaatgtccgcgttgcgtcaagatttttcaagggcccagaacttctagttgatt 733



to top

>ref|XM_759202.1| Theileria parva strain Muguga chromosome 4 casein kinase II subunit
            alpha (TP04_0659) partial mRNA
          Length = 1289

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 62/71 (87%)
 Strand = Plus / Plus

                                                                        
Query: 213  aaggagccattcttctatggccatgataaccatgaccaacttgtgaaaattgcgaaggta 272
            ||||||||||| |||||||| ||||||||| |||| || || |||||||| || ||||||
Sbjct: 949  aaggagccatttttctatggtcatgataactatgatcagctggtgaaaatagccaaggta 1008

                       
Query: 273  cttggaacaga 283
            || ||||||||
Sbjct: 1009 ctaggaacaga 1019



to top

>emb|CR382125.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome E of strain NRRL
              Y-1140 of Kluyveromyces lactis
          Length = 2234072

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                         
Query: 86     ggaatacaatgtccgtgttgcttcaaggtatttcaagggacctgaacttctagttgatt 144
              ||||||||||||||| ||||| ||||| | ||||||||| || ||||||||||||||||
Sbjct: 383548 ggaatacaatgtccgcgttgcgtcaagatttttcaagggcccagaacttctagttgatt 383606



to top

>dbj|AK146032.1| Mus musculus 14 days embryo liver cDNA, RIKEN full-length enriched
           library, clone:I530025D17 product:casein kinase II,
           alpha 1 polypeptide, full insert sequence
          Length = 2650

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 89/107 (83%)
 Strand = Plus / Plus

                                                                       
Query: 3   ccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctg 62
           ||||||||||| |||||||||||||| |   |||| |||||  | |||||||||||  | 
Sbjct: 695 ccccataatgtcatgattgatcatgagcacagaaagcttcggctaatagactggggttta 754

                                                          
Query: 63  gcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           || |||||||||||||||||| | || || |||||||| ||||||||
Sbjct: 755 gctgagttttaccatccaggccaagagtataatgtccgagttgcttc 801



to top

>dbj|AK158077.1| Mus musculus adult inner ear cDNA, RIKEN full-length enriched
           library, clone:F930026L10 product:casein kinase II,
           alpha 1 polypeptide, full insert sequence
          Length = 1511

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 89/107 (83%)
 Strand = Plus / Plus

                                                                       
Query: 3   ccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctg 62
           ||||||||||| |||||||||||||| |   |||| |||||  | |||||||||||  | 
Sbjct: 666 ccccataatgtcatgattgatcatgagcacagaaagcttcggctaatagactggggttta 725

                                                          
Query: 63  gcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           || |||||||||||||||||| | || || |||||||| ||||||||
Sbjct: 726 gctgagttttaccatccaggccaagagtataatgtccgagttgcttc 772



to top

>dbj|AK031617.1| Mus musculus 13 days embryo male testis cDNA, RIKEN full-length
           enriched library, clone:6030461M12 product:casein kinase
           II, alpha 1 polypeptide, full insert sequence
          Length = 1359

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 89/107 (83%)
 Strand = Plus / Plus

                                                                       
Query: 3   ccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctg 62
           ||||||||||| |||||||||||||| |   |||| |||||  | |||||||||||  | 
Sbjct: 701 ccccataatgtcatgattgatcatgagcacagaaagcttcggctaatagactggggttta 760

                                                          
Query: 63  gcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           || |||||||||||||||||| | || || |||||||| ||||||||
Sbjct: 761 gctgagttttaccatccaggccaagagtataatgtccgagttgcttc 807



to top

>dbj|AK011501.1| Mus musculus 10 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2610021E14 product:casein kinase
           II, alpha 1 polypeptide, full insert sequence
          Length = 1304

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 89/107 (83%)
 Strand = Plus / Plus

                                                                       
Query: 3   ccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctg 62
           ||||||||||| |||||||||||||| |   |||| |||||  | |||||||||||  | 
Sbjct: 642 ccccataatgtcatgattgatcatgagcacagaaagcttcggctaatagactggggttta 701

                                                          
Query: 63  gcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           || |||||||||||||||||| | || || |||||||| ||||||||
Sbjct: 702 gctgagttttaccatccaggccaagagtataatgtccgagttgcttc 748



to top

>dbj|AK120812.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023014H13, full
           insert sequence
          Length = 1518

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 80/95 (84%)
 Strand = Plus / Plus

                                                                       
Query: 102 gttgcttcaaggtatttcaagggacctgaacttctagttgatttgcaagattacgattat 161
           ||||||||||| | ||  ||||| ||||||||||| || ||||||| |||||| ||||| 
Sbjct: 868 gttgcttcaagatcttataagggccctgaacttcttgtggatttgctagattatgattac 927

                                              
Query: 162 tctctggacatgtggagccttgggtgcatgtttgc 196
           ||  ||||  ||||||||||||| |||||||||||
Sbjct: 928 tcgttggatttgtggagccttggttgcatgtttgc 962



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                  
Query: 315  cttgagcttgaccctcagcttgaacatcttgttggaag 352
            |||||||||||||| |||||||||   |||||||||||
Sbjct: 1081 cttgagcttgacccgcagcttgaaagacttgttggaag 1118



to top

>gb|AC114588.9| Mus musculus chromosome 1, clone RP23-363M8, complete sequence
          Length = 167497

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                         
Query: 3     ccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctg 62
             ||||||||||| |||||||||||||| |   |||| |||||  | |||||||||||  | 
Sbjct: 97615 ccccataatgtcatgattgatcatgagcacagaaagcttcggctaatagactggggttta 97556

                                                            
Query: 63    gcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
             || |||||||||||||||||| | || || |||||||| ||||||||
Sbjct: 97555 gctgagttttaccatccaggccaagagtataatgtccgagttgcttc 97509



to top

>gb|BC089343.1| Mus musculus casein kinase II, alpha 1 polypeptide, mRNA (cDNA
           clone MGC:102141 IMAGE:30360017), complete cds
          Length = 2606

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 89/107 (83%)
 Strand = Plus / Plus

                                                                       
Query: 3   ccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctg 62
           ||||||||||| |||||||||||||| |   |||| |||||  | |||||||||||  | 
Sbjct: 614 ccccataatgtcatgattgatcatgagcacagaaagcttcggctaatagactggggttta 673

                                                          
Query: 63  gcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           || |||||||||||||||||| | || || |||||||| ||||||||
Sbjct: 674 gctgagttttaccatccaggccaagagtataatgtccgagttgcttc 720



to top

>gb|U51866.1|MMU51866 Mus musculus casein kinase II alpha subunit mRNA, complete cds
          Length = 1552

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 89/107 (83%)
 Strand = Plus / Plus

                                                                       
Query: 3   ccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctg 62
           ||||||||||| |||||||||||||| |   |||| |||||  | |||||||||||  | 
Sbjct: 678 ccccataatgtcatgattgatcatgagcacagaaagcttcggctaatagactggggttta 737

                                                          
Query: 63  gcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           || |||||||||||||||||| | || || |||||||| ||||||||
Sbjct: 738 gctgagttttaccatccaggccaagagtataatgtccgagttgcttc 784



to top

>gb|U17112.1|MMU17112 Mus musculus casein kinase II alpha subunit (CKIIA) mRNA, complete
           cds
          Length = 1176

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 89/107 (83%)
 Strand = Plus / Plus

                                                                       
Query: 3   ccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctg 62
           ||||||||||| |||||||||||||| |   |||| |||||  | |||||||||||  | 
Sbjct: 475 ccccataatgtcatgattgatcatgagcacagaaagcttcggctaatagactggggttta 534

                                                          
Query: 63  gcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           || |||||||||||||||||| | || || |||||||| ||||||||
Sbjct: 535 gctgagttttaccatccaggccaagagtataatgtccgagttgcttc 581



to top

>emb|X82233.1|MMGMCK2AC M.musculus gMCK2alphaC pseudogene
          Length = 1829

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 89/107 (83%)
 Strand = Plus / Plus

                                                                       
Query: 3   ccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctg 62
           ||||||||||| |||||||||||||| |   |||| |||||  | |||||||||||  | 
Sbjct: 704 ccccataatgtcatgattgatcatgagcacagaaagcttcggctaatagactggggttta 763

                                                          
Query: 63  gcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           || |||||||||||||||||| | || || |||||||| ||||||||
Sbjct: 764 gctgagttttaccatccaggccaagagtataatgtccgagttgcttc 810



to top

>gb|M92084.1|THECKIIAS Theileria parva casein kinase II alpha subunit gene, complete cds
          Length = 1561

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 62/71 (87%)
 Strand = Plus / Plus

                                                                        
Query: 213  aaggagccattcttctatggccatgataaccatgaccaacttgtgaaaattgcgaaggta 272
            ||||||||||| |||||||| ||||||||| |||| || || |||||||| || ||||||
Sbjct: 1022 aaggagccatttttctatggtcatgataactatgatcagctggtgaaaatagccaaggta 1081

                       
Query: 273  cttggaacaga 283
            || ||||||||
Sbjct: 1082 ctaggaacaga 1092



to top

>ref|XM_361153.1| Magnaporthe grisea 70-15 hypothetical protein (MG03696.4) partial
           mRNA
          Length = 1017

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 145/182 (79%)
 Strand = Plus / Plus

                                                                       
Query: 46  tgatagactggggcctggcggagttttaccatccaggcaaggaatacaatgtccgtgttg 105
           |||| |||||||| ||||| ||||| ||||| || ||||  || |||||||||||||| |
Sbjct: 497 tgatcgactggggtctggccgagttctaccacccgggcactgagtacaatgtccgtgtgg 556

                                                                       
Query: 106 cttcaaggtatttcaagggacctgaacttctagttgatttgcaagattacgattattctc 165
           | ||  | ||||||||||| || || || || || ||||  ||||| |||||||| || |
Sbjct: 557 catctcgctatttcaagggccccgagctgctggtcgattatcaagagtacgattactcgc 616

                                                                       
Query: 166 tggacatgtggagccttgggtgcatgtttgctgggatgatcttccgcaaggagccattct 225
           | ||||||||||| || ||    |||||||||   ||||||||||||||||| || ||||
Sbjct: 617 tcgacatgtggagtctcggagctatgtttgcttcaatgatcttccgcaaggaacccttct 676

             
Query: 226 tc 227
           ||
Sbjct: 677 tc 678



to top

>ref|XM_514812.1| PREDICTED: Pan troglodytes similar to casein kinase II alpha
           subunit (LOC458448), mRNA
          Length = 960

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 90/109 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           ||||||||||||| |||||||||||||| |   |||| || ||  | |||||||||||  
Sbjct: 329 agccccataatgtcatgattgatcatgagcacagaaagctacgactaatagactggggtt 388

                                                            
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           |||| |||||||| ||||| ||| | ||||| |||||||| ||||||||
Sbjct: 389 tggctgagttttatcatcctggccaagaatataatgtccgagttgcttc 437



to top

>ref|NM_001002242.1| Gallus gallus casein kinase II alpha subunit (CSNK2A1), mRNA
          Length = 1513

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 161/201 (80%), Gaps = 2/201 (0%)
 Strand = Plus / Plus

                                                                       
Query: 48  atagactggggcctggcggagttttaccatccaggcaaggaatacaatgtccgtgttgct 107
           ||||| |||||  |||| ||||| || || || ||| |||| ||||||||| | || |||
Sbjct: 658 atagattggggtttggctgagttctatcaccctggccaggagtacaatgtcagagtggct 717

                                                                       
Query: 108 tcaaggtatttcaagggacctgaacttctagttgatttgcaagat-tacgattattctct 166
           || || |||||||| ||||||||||| || || ||||  || ||| || |||||   |||
Sbjct: 718 tccagatatttcaaaggacctgaactccttgtagattatca-gatgtatgattacagtct 776

                                                                       
Query: 167 ggacatgtggagccttgggtgcatgtttgctgggatgatcttccgcaaggagccattctt 226
           ||| ||||||||| | || |||||||| ||| | ||||| ||||| ||||||||||| ||
Sbjct: 777 ggatatgtggagcttgggttgcatgttggctagtatgatattccgaaaggagccattttt 836

                                
Query: 227 ctatggccatgataaccatga 247
           | |||||||||| ||| ||||
Sbjct: 837 ccatggccatgacaactatga 857



to top

>gb|BC050036.1| Homo sapiens casein kinase 2, alpha 1 polypeptide, mRNA (cDNA clone
           MGC:51015 IMAGE:5298655), complete cds
          Length = 2622

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 90/109 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           ||||||||||||| |||||||||||||| |   |||| || ||  | |||||||||||  
Sbjct: 640 agccccataatgtcatgattgatcatgagcacagaaagctacgactaatagactggggtt 699

                                                            
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           |||| |||||||| ||||| ||| | ||||| |||||||| ||||||||
Sbjct: 700 tggctgagttttatcatcctggccaagaatataatgtccgagttgcttc 748



to top

>gb|BT019792.1| Homo sapiens casein kinase 2, alpha 1 polypeptide mRNA, complete
           cds
          Length = 1176

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 90/109 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           ||||||||||||| |||||||||||||| |   |||| || ||  | |||||||||||  
Sbjct: 473 agccccataatgtcatgattgatcatgagcacagaaagctacgactaatagactggggtt 532

                                                            
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           |||| |||||||| ||||| ||| | ||||| |||||||| ||||||||
Sbjct: 533 tggctgagttttatcatcctggccaagaatataatgtccgagttgcttc 581



to top

>ref|XM_417444.1| PREDICTED: Gallus gallus similar to casein kinase II (EC 2.7.1.-)
           alpha chain - chicken (LOC419271), mRNA
          Length = 1617

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 161/201 (80%), Gaps = 2/201 (0%)
 Strand = Plus / Plus

                                                                       
Query: 48  atagactggggcctggcggagttttaccatccaggcaaggaatacaatgtccgtgttgct 107
           ||||| |||||  |||| ||||| || || || ||| |||| ||||||||| | || |||
Sbjct: 777 atagattggggtttggctgagttctatcaccctggccaggagtacaatgtcagagtggct 836

                                                                       
Query: 108 tcaaggtatttcaagggacctgaacttctagttgatttgcaagat-tacgattattctct 166
           || || |||||||| ||||||||||| || || ||||  || ||| || |||||   |||
Sbjct: 837 tccagatatttcaaaggacctgaactccttgtagattatca-gatgtatgattacagtct 895

                                                                       
Query: 167 ggacatgtggagccttgggtgcatgtttgctgggatgatcttccgcaaggagccattctt 226
           ||| ||||||||| | || |||||||| ||| | ||||| ||||| ||||||||||| ||
Sbjct: 896 ggatatgtggagcttgggttgcatgttggctagtatgatattccgaaaggagccattttt 955

                                
Query: 227 ctatggccatgataaccatga 247
           | |||||||||| ||| ||||
Sbjct: 956 ccatggccatgacaactatga 976



to top

>ref|NM_177560.2| Homo sapiens casein kinase 2, alpha 1 polypeptide (CSNK2A1),
           transcript variant 3, mRNA
          Length = 2522

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 90/109 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           ||||||||||||| |||||||||||||| |   |||| || ||  | |||||||||||  
Sbjct: 539 agccccataatgtcatgattgatcatgagcacagaaagctacgactaatagactggggtt 598

                                                            
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           |||| |||||||| ||||| ||| | ||||| |||||||| ||||||||
Sbjct: 599 tggctgagttttatcatcctggccaagaatataatgtccgagttgcttc 647



to top

>ref|NM_177559.2| Homo sapiens casein kinase 2, alpha 1 polypeptide (CSNK2A1),
           transcript variant 1, mRNA
          Length = 2849

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 90/109 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           ||||||||||||| |||||||||||||| |   |||| || ||  | |||||||||||  
Sbjct: 866 agccccataatgtcatgattgatcatgagcacagaaagctacgactaatagactggggtt 925

                                                            
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           |||| |||||||| ||||| ||| | ||||| |||||||| ||||||||
Sbjct: 926 tggctgagttttatcatcctggccaagaatataatgtccgagttgcttc 974



to top

>ref|NM_001895.3| Homo sapiens casein kinase 2, alpha 1 polypeptide (CSNK2A1),
           transcript variant 2, mRNA
          Length = 2732

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 90/109 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           ||||||||||||| |||||||||||||| |   |||| || ||  | |||||||||||  
Sbjct: 749 agccccataatgtcatgattgatcatgagcacagaaagctacgactaatagactggggtt 808

                                                            
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           |||| |||||||| ||||| ||| | ||||| |||||||| ||||||||
Sbjct: 809 tggctgagttttatcatcctggccaagaatataatgtccgagttgcttc 857



to top

>ref|XM_534375.2| PREDICTED: Canis familiaris similar to casein kinase II alpha 1
           subunit isoform a, transcript variant 1 (LOC477185),
           mRNA
          Length = 1485

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 90/109 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           ||||||||||||| |||||||||||||| |   |||| || ||  | |||||||||||  
Sbjct: 579 agccccataatgtcatgattgatcatgagcacagaaagctacgactaatagactggggtt 638

                                                            
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           |||| |||||||||||||| ||| | ||||| |||||| | ||||||||
Sbjct: 639 tggctgagttttaccatcctggccaagaatataatgtcagagttgcttc 687



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 201 atgatcttccgcaaggagccattcttctatggccatga 238
           ||||||||||| ||||||||||| ||| |||| |||||
Sbjct: 779 atgatcttccggaaggagccatttttccatggacatga 816



to top

>ref|XM_856724.1| PREDICTED: Canis familiaris similar to casein kinase II alpha 1
           subunit isoform a, transcript variant 3 (LOC477185),
           mRNA
          Length = 1011

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 90/109 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           ||||||||||||| |||||||||||||| |   |||| || ||  | |||||||||||  
Sbjct: 579 agccccataatgtcatgattgatcatgagcacagaaagctacgactaatagactggggtt 638

                                                            
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           |||| |||||||||||||| ||| | ||||| |||||| | ||||||||
Sbjct: 639 tggctgagttttaccatcctggccaagaatataatgtcagagttgcttc 687



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 201 atgatcttccgcaaggagccattcttctatggccatga 238
           ||||||||||| ||||||||||| ||| |||| |||||
Sbjct: 779 atgatcttccggaaggagccatttttccatggacatga 816



to top

>ref|XM_845486.1| PREDICTED: Canis familiaris similar to casein kinase II alpha 1
           subunit isoform a, transcript variant 2 (LOC477185),
           mRNA
          Length = 3704

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 90/109 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           ||||||||||||| |||||||||||||| |   |||| || ||  | |||||||||||  
Sbjct: 579 agccccataatgtcatgattgatcatgagcacagaaagctacgactaatagactggggtt 638

                                                            
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           |||| |||||||||||||| ||| | ||||| |||||| | ||||||||
Sbjct: 639 tggctgagttttaccatcctggccaagaatataatgtcagagttgcttc 687



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 201 atgatcttccgcaaggagccattcttctatggccatga 238
           ||||||||||| ||||||||||| ||| |||| |||||
Sbjct: 779 atgatcttccggaaggagccatttttccatggacatga 816



to top

>emb|X64692.1|HSCKPSEU H.sapiens casein kinase II (alpha subunit) pseudogene sequence
          Length = 4320

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 90/109 (82%)
 Strand = Plus / Plus

                                                                        
Query: 1    agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
            ||||||||||||| |||||||||||||| |   |||| || ||  | |||||||||||  
Sbjct: 1710 agccccataatgtcatgattgatcatgagcacagaaagctacgactaatagactggggtt 1769

                                                             
Query: 61   tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
            |||| |||||||| ||||| ||| | ||||| |||||||| ||||||||
Sbjct: 1770 tggctgagttttatcatcctggccaagaatataatgtccgagttgcttc 1818



to top

>gb|AY112721.1| Homo sapiens casein kinase II alpha subunit mRNA, complete cds
          Length = 1416

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 90/109 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           ||||||||||||| |||||||||||||| |   |||| || ||  | |||||||||||  
Sbjct: 711 agccccataatgtcatgattgatcatgagcacagaaagctacgactaatagactgggggt 770

                                                            
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           |||| |||||||| ||||| ||| | ||||| |||||||| ||||||||
Sbjct: 771 tggctgagttttatcatcctggccaagaatataatgtccgagttgcttc 819



to top

>gb|AC023946.5| Homo sapiens chromosome 11, clone RP11-567I13, complete sequence
          Length = 187380

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 90/109 (82%)
 Strand = Plus / Plus

                                                                          
Query: 1      agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
              ||||||||||||| |||||||||||||| |   |||| || ||  | |||||||||||  
Sbjct: 151288 agccccataatgtcatgattgatcatgagcacagaaagctacgactaatagactggggtt 151347

                                                               
Query: 61     tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
              |||| |||||||| ||||| ||| | ||||| |||||||| ||||||||
Sbjct: 151348 tggctgagttttatcatcctggccaagaatataatgtccgagttgcttc 151396



to top

>emb|CR590205.1| full-length cDNA clone CS0DL006YJ05 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 996

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 90/109 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           ||||||||||||| |||||||||||||| |   |||| || ||  | |||||||||||  
Sbjct: 118 agccccataatgtcatgattgatcatgagcacagaaagctacgactaatagactggggtt 177

                                                            
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           |||| |||||||| ||||| ||| | ||||| |||||||| ||||||||
Sbjct: 178 tggctgagttttatcatcctggccaagaatataatgtccgagttgcttc 226



to top

>ref|NR_002207.1| Homo sapiens casein kinase 2, alpha 1 polypeptide pseudogene
           (CSNK2A1P) on chromosome 11
          Length = 1584

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 90/109 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           ||||||||||||| |||||||||||||| |   |||| || ||  | |||||||||||  
Sbjct: 711 agccccataatgtcatgattgatcatgagcacagaaagctacgactaatagactggggtt 770

                                                            
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           |||| |||||||| ||||| ||| | ||||| |||||||| ||||||||
Sbjct: 771 tggctgagttttatcatcctggccaagaatataatgtccgagttgcttc 819



to top

>gb|AY335731.1| Synthetic construct Homo sapiens casein kinase 2, alpha 1
           polypeptide (CSNK2A1) mRNA, partial cds
          Length = 1176

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 90/109 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           ||||||||||||| |||||||||||||| |   |||| || ||  | |||||||||||  
Sbjct: 473 agccccataatgtcatgattgatcatgagcacagaaagctacgactaatagactggggtt 532

                                                            
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           |||| |||||||| ||||| ||| | ||||| |||||||| ||||||||
Sbjct: 533 tggctgagttttatcatcctggccaagaatataatgtccgagttgcttc 581



to top

>gb|DQ354583.1| Homo sapiens casein kinase 2 alpha isoform mRNA, complete cds
          Length = 1507

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 90/109 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           ||||||||||||| |||||||||||||| |   |||| || ||  | |||||||||||  
Sbjct: 615 agccccataatgtcatgattgatcatgagcacagaaagctacgactaatagactggggtt 674

                                                            
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           |||| |||||||| ||||| ||| | ||||| |||||||| ||||||||
Sbjct: 675 tggctgagttttatcatcctggccaagaatataatgtccgagttgcttc 723



to top

>gb|AY888226.1| Synthetic construct Homo sapiens clone FLH020226.01X casein kinase
           2 alpha 1 polypeptide (CSNK2A1) mRNA, complete cds
          Length = 1176

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 90/109 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           ||||||||||||| |||||||||||||| |   |||| || ||  | |||||||||||  
Sbjct: 473 agccccataatgtcatgattgatcatgagcacagaaagctacgactaatagactggggtt 532

                                                            
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           |||| |||||||| ||||| ||| | ||||| |||||||| ||||||||
Sbjct: 533 tggctgagttttatcatcctggccaagaatataatgtccgagttgcttc 581



to top

>gb|BC011668.2| Homo sapiens casein kinase 2, alpha 1 polypeptide, transcript
           variant 2, mRNA (cDNA clone MGC:15232 IMAGE:4121882),
           complete cds
          Length = 1499

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 90/109 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           ||||||||||||| |||||||||||||| |   |||| || ||  | |||||||||||  
Sbjct: 621 agccccataatgtcatgattgatcatgagcacagaaagctacgactaatagactggggtt 680

                                                            
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           |||| |||||||| ||||| ||| | ||||| |||||||| ||||||||
Sbjct: 681 tggctgagttttatcatcctggccaagaatataatgtccgagttgcttc 729



to top

>gb|BC071167.1| Homo sapiens casein kinase 2, alpha 1 polypeptide, transcript
           variant 2, mRNA (cDNA clone MGC:88038 IMAGE:5772615),
           complete cds
          Length = 2494

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 90/109 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           ||||||||||||| |||||||||||||| |   |||| || ||  | |||||||||||  
Sbjct: 480 agccccataatgtcatgattgatcatgagcacagaaagctacgactaatagactggggtt 539

                                                            
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           |||| |||||||| ||||| ||| | ||||| |||||||| ||||||||
Sbjct: 540 tggctgagttttatcatcctggccaagaatataatgtccgagttgcttc 588



to top

>gb|BC053532.1| Homo sapiens casein kinase 2, alpha 1 polypeptide, transcript
           variant 2, mRNA (cDNA clone MGC:61540 IMAGE:3908058),
           complete cds
          Length = 2551

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 90/109 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           ||||||||||||| |||||||||||||| |   |||| || ||  | |||||||||||  
Sbjct: 568 agccccataatgtcatgattgatcatgagcacagaaagctacgactaatagactggggtt 627

                                                            
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           |||| |||||||| ||||| ||| | ||||| |||||||| ||||||||
Sbjct: 628 tggctgagttttatcatcctggccaagaatataatgtccgagttgcttc 676



to top

>gb|BC002615.2| Homo sapiens casein kinase 2, alpha 1 polypeptide, mRNA (cDNA clone
           IMAGE:3140817), containing frame-shift errors
          Length = 1524

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 90/109 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           ||||||||||||| |||||||||||||| |   |||| || ||  | |||||||||||  
Sbjct: 621 agccccataatgtcatgattgatcatgagcacagaaagctacgactaatagactggggtt 680

                                                            
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           |||| |||||||| ||||| ||| | ||||| |||||||| ||||||||
Sbjct: 681 tggctgagttttatcatcctggccaagaatataatgtccgagttgcttc 729



to top

>emb|X70251.1|HSCKIIAL Homo sapiens CKII-alpha gene
          Length = 1250

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 90/109 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           ||||||||||||| |||||||||||||| |   |||| || ||  | |||||||||||  
Sbjct: 513 agccccataatgtcatgattgatcatgagcacagaaagctacgactaatagactggggtt 572

                                                            
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           |||| |||||||| ||||| ||| | ||||| |||||||| ||||||||
Sbjct: 573 tggctgagttttatcatcctggccaagaatataatgtccgagttgcttc 621



to top

>gb|J02853.1|HUMCKIA Homo sapiens casein kinase II alpha subunit mRNA, complete cds
          Length = 2178

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 90/109 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           ||||||||||||| |||||||||||||| |   |||| || ||  | |||||||||||  
Sbjct: 626 agccccataatgtcatgattgatcatgagcacagaaagctacgactaatagactggggtt 685

                                                            
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           |||| |||||||| ||||| ||| | ||||| |||||||| ||||||||
Sbjct: 686 tggctgagttttatcatcctggccaagaatataatgtccgagttgcttc 734



to top

>gb|S53149.1| Homo sapiens casein kinase II-alpha subunit mRNA, complete cds
          Length = 2015

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 90/109 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           ||||||||||||| |||||||||||||| |   |||| || ||  | |||||||||||  
Sbjct: 626 agccccataatgtcatgattgatcatgagcacagaaagctacgactaatagactggggtt 685

                                                            
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           |||| |||||||| ||||| ||| | ||||| |||||||| ||||||||
Sbjct: 686 tggctgagttttatcatcctggccaagaatataatgtccgagttgcttc 734



to top

>gb|M59456.1|CHKCLIIAS Chicken casein kinase II alpha subunit mRNA, complete cds
          Length = 1513

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 161/201 (80%), Gaps = 2/201 (0%)
 Strand = Plus / Plus

                                                                       
Query: 48  atagactggggcctggcggagttttaccatccaggcaaggaatacaatgtccgtgttgct 107
           ||||| |||||  |||| ||||| || || || ||| |||| ||||||||| | || |||
Sbjct: 658 atagattggggtttggctgagttctatcaccctggccaggagtacaatgtcagagtggct 717

                                                                       
Query: 108 tcaaggtatttcaagggacctgaacttctagttgatttgcaagat-tacgattattctct 166
           || || |||||||| ||||||||||| || || ||||  || ||| || |||||   |||
Sbjct: 718 tccagatatttcaaaggacctgaactccttgtagattatca-gatgtatgattacagtct 776

                                                                       
Query: 167 ggacatgtggagccttgggtgcatgtttgctgggatgatcttccgcaaggagccattctt 226
           ||| ||||||||| | || |||||||| ||| | ||||| ||||| ||||||||||| ||
Sbjct: 777 ggatatgtggagcttgggttgcatgttggctagtatgatattccgaaaggagccattttt 836

                                
Query: 227 ctatggccatgataaccatga 247
           | |||||||||| ||| ||||
Sbjct: 837 ccatggccatgacaactatga 857



to top

>gb|M55265.1|HUMACKII Human casein kinase II alpha subunit mRNA, complete cds
          Length = 2195

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 90/109 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           ||||||||||||| |||||||||||||| |   |||| || ||  | |||||||||||  
Sbjct: 621 agccccataatgtcatgattgatcatgagcacagaaagctacgactaatagactggggtt 680

                                                            
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           |||| |||||||| ||||| ||| | ||||| |||||||| ||||||||
Sbjct: 681 tggctgagttttatcatcctggccaagaatataatgtccgagttgcttc 729



to top

>ref|XM_637801.1| Dictyostelium discoideum casein kinase II alpha chain (DDB0185025),
           partial mRNA
          Length = 1014

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 86/104 (82%)
 Strand = Plus / Plus

                                                                       
Query: 138 gttgatttgcaagattacgattattctctggacatgtggagccttgggtgcatgtttgct 197
           |||||| || ||||||| ||||||  ||| || |||||||| ||||| || |||||||||
Sbjct: 634 gttgatatggaagattatgattatagtcttgatatgtggagtcttggttgtatgtttgct 693

                                                       
Query: 198 gggatgatcttccgcaaggagccattcttctatggccatgataa 241
           || ||| ||||||  || || ||||||||| |||| ||||||||
Sbjct: 694 ggtatgctcttccaaaaagatccattcttccatggtcatgataa 737



to top

>ref|XM_694737.1| PREDICTED: Danio rerio similar to Ck2a1 protein (LOC571171), mRNA
          Length = 1347

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 98/120 (81%)
 Strand = Plus / Plus

                                                                       
Query: 164 tctggacatgtggagccttgggtgcatgtttgctgggatgatcttccgcaaggagccatt 223
           ||||||||||||||| || || || ||||| ||  | ||||||||| | |||||||||||
Sbjct: 636 tctggacatgtggagtctcggctgtatgttggccagtatgatcttcaggaaggagccatt 695

                                                                       
Query: 224 cttctatggccatgataaccatgaccaacttgtgaaaattgcgaaggtacttggaacaga 283
           |||| |||| | ||||||| |||||||  | |||| ||| || || || |||||||||||
Sbjct: 696 cttccatgggcgtgataactatgaccagttggtgagaatagccaaagttcttggaacaga 755



to top

>ref|NM_001012691.1| Gallus gallus casein kinase 2, alpha prime polypeptide (CSNK2A2),
           mRNA
          Length = 1985

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 68/80 (85%)
 Strand = Plus / Plus

                                                                       
Query: 48  atagactggggcctggcggagttttaccatccaggcaaggaatacaatgtccgtgttgct 107
           ||||||||||| ||||| || || ||||||||||   ||||||||||||||||||| || 
Sbjct: 594 atagactggggtctggcagaattctaccatccagctcaggaatacaatgtccgtgtggcc 653

                               
Query: 108 tcaaggtatttcaagggacc 127
           || ||||| ||||| |||||
Sbjct: 654 tctaggtacttcaaaggacc 673



to top

>gb|M59457.1|CHKCKIIASA Chicken casein kinase II alpha' subunit mRNA, complete cds
          Length = 1985

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 68/80 (85%)
 Strand = Plus / Plus

                                                                       
Query: 48  atagactggggcctggcggagttttaccatccaggcaaggaatacaatgtccgtgttgct 107
           ||||||||||| ||||| || || ||||||||||   ||||||||||||||||||| || 
Sbjct: 594 atagactggggtctggcagaattctaccatccagctcaggaatacaatgtccgtgtggcc 653

                               
Query: 108 tcaaggtatttcaagggacc 127
           || ||||| ||||| |||||
Sbjct: 654 tctaggtacttcaaaggacc 673



to top

>gb|L05535.1|DDICK2AS Dictyostelium discoideum casein kinase II alpha subunit mRNA,
           complete cds
          Length = 1305

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 86/104 (82%)
 Strand = Plus / Plus

                                                                       
Query: 138 gttgatttgcaagattacgattattctctggacatgtggagccttgggtgcatgtttgct 197
           |||||| || ||||||| ||||||  ||| || |||||||| ||||| || |||||||||
Sbjct: 734 gttgatatggaagattatgattatagtcttgatatgtggagtcttggttgtatgtttgct 793

                                                       
Query: 198 gggatgatcttccgcaaggagccattcttctatggccatgataa 241
           || ||| ||||||  || || ||||||||| |||| ||||||||
Sbjct: 794 ggtatgctcttccaaaaagatccattcttccatggtcatgataa 837



to top

>emb|CR937926.1| Single read from an extremity of a cDNA clone made from Aedes
           aegypti total adult females. 5-prime end of clone
           KW0AAB1YA02AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 773

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 112/139 (80%)
 Strand = Plus / Plus

                                                                       
Query: 6   cataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctggcg 65
           |||||||||||||||||||| ||   ||| ||| | ||  | || || |||||| |||| 
Sbjct: 465 cataatgttatgattgatcacgagaatcggaaattgcggcttattgattggggcttggcc 524

                                                                       
Query: 66  gagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttcaaggga 125
           || || |||||||||||  ||||||||||||| |||||||||    | ||||||||||| 
Sbjct: 525 gaattctaccatccaggacaggaatacaatgttcgtgttgctagccgctatttcaagggc 584

                              
Query: 126 cctgaacttctagttgatt 144
           |||||||| ||||| ||||
Sbjct: 585 cctgaactgctagtcgatt 603



to top

>emb|CR937925.1| Single read from an extremity of a cDNA clone made from Aedes
           aegypti total adult females. 3-prime end of clone
           KW0AAB1YA02BBM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 654

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 112/139 (80%)
 Strand = Plus / Minus

                                                                       
Query: 6   cataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctggcg 65
           |||||||||||||||||||| ||   ||| ||| | ||  | || || |||||| |||| 
Sbjct: 648 cataatgttatgattgatcacgagaatcggaaattgcggcttattgattggggcttggcc 589

                                                                       
Query: 66  gagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggtatttcaaggga 125
           || || |||||||||||  ||||||||||||| |||||||||    | ||||||||||| 
Sbjct: 588 gaattctaccatccaggacaggaatacaatgttcgtgttgctagccgctatttcaagggc 529

                              
Query: 126 cctgaacttctagttgatt 144
           |||||||| ||||| ||||
Sbjct: 528 cctgaactgctagtcgatt 510



to top

>dbj|AK108187.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-140-B10, full
            insert sequence
          Length = 1614

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Plus

                                                                        
Query: 117  ttcaagggacctgaacttctagttgatttgcaagattacgattattctctggacatgtgg 176
            ||||||||||| || || ||||| || || || || ||||| || || || |||||||||
Sbjct: 1006 ttcaagggacccgagctgctagtcgacttccaggagtacgactactcgctcgacatgtgg 1065

                                                               
Query: 177  agccttgggtgcatgtttgctgggatgatcttccgcaaggagccattcttc 227
            ||||| || |||||||||||  | ||||||||| | |||||||| ||||||
Sbjct: 1066 agcctgggatgcatgtttgccagtatgatcttcaggaaggagccgttcttc 1116



to top

>ref|XM_653997.1| Aspergillus nidulans FGSC A4 casein kinase II subunit alpha
           (AN1485.2), mRNA
          Length = 1002

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 189 atgtttgctgggatgatcttccgcaaggagccattcttctatggc 233
           |||||||||  ||||||||||||||||||||| |||||| |||||
Sbjct: 640 atgtttgcttcgatgatcttccgcaaggagcctttcttccatggc 684



to top

>gb|AY558299.1| Saccharomyces cerevisiae clone FLH111276.01X YIL035C gene, complete
           cds
          Length = 1119

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 50/57 (87%)
 Strand = Plus / Plus

                                                                    
Query: 86  ggaatacaatgtccgtgttgcttcaaggtatttcaagggacctgaacttctagttga 142
           |||||||||||| |||||||| || |||| ||| ||||| |||||||| ||||||||
Sbjct: 675 ggaatacaatgttcgtgttgcgtcgaggttttttaagggtcctgaactactagttga 731



to top

>emb|Z46861.1|SC9905 S.cerevisiae chromosome IX cosmid 9905 and lambda 6569
          Length = 33954

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                      
Query: 86    ggaatacaatgtccgtgttgcttcaaggtatttcaagggacctgaacttctagttga 142
             |||||||||||| |||||||| || |||| ||| ||||| |||||||| ||||||||
Sbjct: 23325 ggaatacaatgttcgtgttgcgtcgaggttttttaagggtcctgaactactagttga 23269



to top

>emb|CR859932.1| Pongo pygmaeus mRNA; cDNA DKFZp469K1920 (from clone DKFZp469K1920)
          Length = 2684

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 89/109 (81%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           ||||||||||||| |||||||||||||| |   |||| || ||  | |||||||||||  
Sbjct: 701 agccccataatgtcatgattgatcatgagcacagaaagctacgactaatagactggggtt 760

                                                            
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           |||| |||||||| ||||| |||   ||||| |||||||| ||||||||
Sbjct: 761 tggctgagttttatcatcctggccgagaatataatgtccgagttgcttc 809



to top

>gb|M22473.1|YSCCSKAS Yeast (S.cerevisiae) casein kinase II alpha subunit (CKA1) gene,
            complete cds
          Length = 2318

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 50/57 (87%)
 Strand = Plus / Plus

                                                                     
Query: 86   ggaatacaatgtccgtgttgcttcaaggtatttcaagggacctgaacttctagttga 142
            |||||||||||| |||||||| || |||| ||| ||||| |||||||| ||||||||
Sbjct: 1278 ggaatacaatgttcgtgttgcgtcgaggttttttaagggtcctgaactactagttga 1334



to top

>ref|XM_535282.2| PREDICTED: Canis familiaris similar to Casein kinase II, alpha
           chain (CK II) (LOC478108), mRNA
          Length = 1210

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Plus

                                                                       
Query: 48  atagactggggcctggcggagttttaccatccaggcaaggaatacaatgtccgtgttgct 107
           ||||||||||| ||||| ||||| ||||| || |   |||| |||||||||||||| || 
Sbjct: 481 atagactggggtctggcagagttctaccaccctgctcaggagtacaatgtccgtgtagca 540

                               
Query: 108 tcaaggtatttcaagggacc 127
           || ||||| |||||||||||
Sbjct: 541 tcgaggtacttcaagggacc 560



to top

>gb|S56527.1| CK-II=casein kinase-II alpha subunit [rabbits, vascular smooth
           muscle cells, mRNA, 1234 nt]
          Length = 1234

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 64/76 (84%)
 Strand = Plus / Plus

                                                                       
Query: 166 tggacatgtggagccttgggtgcatgtttgctgggatgatcttccgcaaggagccattct 225
           |||||||||||||||| || || ||| | ||  | ||||||||||| ||||||||||| |
Sbjct: 666 tggacatgtggagcctgggttgtatgctggcaagtatgatcttccggaaggagccatttt 725

                           
Query: 226 tctatggccatgataa 241
           || |||| ||||||||
Sbjct: 726 tccatggacatgataa 741



to top

>gb|M98451.1|RABCKA2AB Oryctolagus cuniculus casein kinase-II alpha (ckA1) mRNA, complete
           cds
          Length = 1234

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 64/76 (84%)
 Strand = Plus / Plus

                                                                       
Query: 166 tggacatgtggagccttgggtgcatgtttgctgggatgatcttccgcaaggagccattct 225
           |||||||||||||||| || || ||| | ||  | ||||||||||| ||||||||||| |
Sbjct: 666 tggacatgtggagcctgggttgtatgctggcaagtatgatcttccggaaggagccatttt 725

                           
Query: 226 tctatggccatgataa 241
           || |||| ||||||||
Sbjct: 726 tccatggacatgataa 741



to top

>gb|BC047143.1| Mus musculus cDNA clone IMAGE:6396398
          Length = 1893

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 75/91 (82%)
 Strand = Plus / Plus

                                                                        
Query: 166  tggacatgtggagccttgggtgcatgtttgctgggatgatcttccgcaaggagccattct 225
            |||||||||||||| | || |||||||| ||  | ||||| ||||| |||||||||||||
Sbjct: 1004 tggacatgtggagcttgggctgcatgttagcgagcatgatattccgaaaggagccattct 1063

                                           
Query: 226  tctatggccatgataaccatgaccaacttgt 256
            || | || || || ||| ||||||| |||||
Sbjct: 1064 tccacgggcaggacaactatgaccagcttgt 1094



to top

>ref|NM_009974.2| Mus musculus casein kinase II, alpha 2, polypeptide (Csnk2a2), mRNA
          Length = 1877

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 75/91 (82%)
 Strand = Plus / Plus

                                                                        
Query: 166  tggacatgtggagccttgggtgcatgtttgctgggatgatcttccgcaaggagccattct 225
            |||||||||||||| | || |||||||| ||  | ||||| ||||| |||||||||||||
Sbjct: 984  tggacatgtggagcttgggctgcatgttagcgagcatgatattccgaaaggagccattct 1043

                                           
Query: 226  tctatggccatgataaccatgaccaacttgt 256
            || | || || || ||| ||||||| |||||
Sbjct: 1044 tccacgggcaggacaactatgaccagcttgt 1074



to top

>ref|XM_992182.1| PREDICTED: Mus musculus casein kinase II, alpha 2, polypeptide
           (Csnk2a2), mRNA
          Length = 4970

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 75/91 (82%)
 Strand = Plus / Plus

                                                                       
Query: 166 tggacatgtggagccttgggtgcatgtttgctgggatgatcttccgcaaggagccattct 225
           |||||||||||||| | || |||||||| ||  | ||||| ||||| |||||||||||||
Sbjct: 584 tggacatgtggagcttgggctgcatgttagcgagcatgatattccgaaaggagccattct 643

                                          
Query: 226 tctatggccatgataaccatgaccaacttgt 256
           || | || || || ||| ||||||| |||||
Sbjct: 644 tccacgggcaggacaactatgaccagcttgt 674



to top

>ref|XM_991797.1| PREDICTED: Mus musculus casein kinase II, alpha 2, polypeptide
           (Csnk2a2), mRNA
          Length = 5542

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 75/91 (82%)
 Strand = Plus / Plus

                                                                       
Query: 166 tggacatgtggagccttgggtgcatgtttgctgggatgatcttccgcaaggagccattct 225
           |||||||||||||| | || |||||||| ||  | ||||| ||||| |||||||||||||
Sbjct: 584 tggacatgtggagcttgggctgcatgttagcgagcatgatattccgaaaggagccattct 643

                                          
Query: 226 tctatggccatgataaccatgaccaacttgt 256
           || | || || || ||| ||||||| |||||
Sbjct: 644 tccacgggcaggacaactatgaccagcttgt 674



to top

>emb|AJ001420.1|MMCK2ALPH Mus musculus mRNA for CK2 alpha subunit
          Length = 1877

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 75/91 (82%)
 Strand = Plus / Plus

                                                                        
Query: 166  tggacatgtggagccttgggtgcatgtttgctgggatgatcttccgcaaggagccattct 225
            |||||||||||||| | || |||||||| ||  | ||||| ||||| |||||||||||||
Sbjct: 984  tggacatgtggagcttgggctgcatgttagcgagcatgatattccgaaaggagccattct 1043

                                           
Query: 226  tctatggccatgataaccatgaccaacttgt 256
            || | || || || ||| ||||||| |||||
Sbjct: 1044 tccacgggcaggacaactatgaccagcttgt 1074



to top

>dbj|AK002927.1| Mus musculus adult male kidney cDNA, RIKEN full-length enriched
            library, clone:0610043C19 product:casein kinase II, alpha
            2, polypeptide, full insert sequence
          Length = 1891

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 75/91 (82%)
 Strand = Plus / Plus

                                                                        
Query: 166  tggacatgtggagccttgggtgcatgtttgctgggatgatcttccgcaaggagccattct 225
            |||||||||||||| | || |||||||| ||  | ||||| ||||| |||||||||||||
Sbjct: 1022 tggacatgtggagcttgggctgcatgttagcgagcatgatattccgaaaggagccattct 1081

                                           
Query: 226  tctatggccatgataaccatgaccaacttgt 256
            || | || || || ||| ||||||| |||||
Sbjct: 1082 tccacgggcaggacaactatgaccagcttgt 1112



to top

>dbj|AK076042.1| Mus musculus 10 days embryo whole body cDNA, RIKEN full-length
            enriched library, clone:2610528F04 product:casein kinase
            II, alpha 2, polypeptide, full insert sequence
          Length = 1461

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 75/91 (82%)
 Strand = Plus / Plus

                                                                        
Query: 166  tggacatgtggagccttgggtgcatgtttgctgggatgatcttccgcaaggagccattct 225
            |||||||||||||| | || |||||||| ||  | ||||| ||||| |||||||||||||
Sbjct: 975  tggacatgtggagcttgggctgcatgttagcgagcatgatattccgaaaggagccattct 1034

                                           
Query: 226  tctatggccatgataaccatgaccaacttgt 256
            || | || || || ||| ||||||| |||||
Sbjct: 1035 tccacgggcaggacaactatgaccagcttgt 1065



to top

>ref|NG_001359.1| Mus musculus casein kinase II, alpha 1 polypeptide, pseudogene 1
           (Csnk2a1-ps1) on chromosome 14
          Length = 2209

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 87/107 (81%)
 Strand = Plus / Plus

                                                                       
Query: 3   ccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctg 62
           ||||||||||  | |||||||||||| |   |||| |||||  | |||||||||||  | 
Sbjct: 731 ccccataatggcacgattgatcatgagcacagaaagcttcggctcatagactggggttta 790

                                                          
Query: 63  gcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           || |||||||||||||||||| | || || |||||||| ||||||||
Sbjct: 791 gctgagttttaccatccaggccaagagtataatgtccgagttgcttc 837



to top

>dbj|AK030035.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:4932416H01 product:casein kinase II,
           alpha 2, polypeptide, full insert sequence
          Length = 2806

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 75/91 (82%)
 Strand = Plus / Plus

                                                                       
Query: 166 tggacatgtggagccttgggtgcatgtttgctgggatgatcttccgcaaggagccattct 225
           |||||||||||||| | || |||||||| ||  | ||||| ||||| |||||||||||||
Sbjct: 54  tggacatgtggagcttgggctgcatgttagcgagcatgatattccgaaaggagccattct 113

                                          
Query: 226 tctatggccatgataaccatgaccaacttgt 256
           || | || || || ||| ||||||| |||||
Sbjct: 114 tccacgggcaggacaactatgaccagcttgt 144



to top

>gb|AC154515.2| Mus musculus BAC clone RP24-81I13 from chromosome 14, complete sequence
          Length = 172475

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 87/107 (81%)
 Strand = Plus / Minus

                                                                         
Query: 3     ccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctg 62
             ||||||||||  | |||||||||||| |   |||| |||||  | |||||||||||  | 
Sbjct: 58477 ccccataatggcacgattgatcatgagcacagaaagcttcggctcatagactggggttta 58418

                                                            
Query: 63    gcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
             || |||||||||||||||||| | || || |||||||| ||||||||
Sbjct: 58417 gctgagttttaccatccaggccaagagtataatgtccgagttgcttc 58371



to top

>gb|BC057862.1| Mus musculus casein kinase II, alpha 2, polypeptide, mRNA (cDNA
           clone MGC:68186 IMAGE:5316132), complete cds
          Length = 1619

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 75/91 (82%)
 Strand = Plus / Plus

                                                                       
Query: 166 tggacatgtggagccttgggtgcatgtttgctgggatgatcttccgcaaggagccattct 225
           |||||||||||||| | || |||||||| ||  | ||||| ||||| |||||||||||||
Sbjct: 674 tggacatgtggagcttgggctgcatgttagcgagcatgatattccgaaaggagccattct 733

                                          
Query: 226 tctatggccatgataaccatgaccaacttgt 256
           || | || || || ||| ||||||| |||||
Sbjct: 734 tccacgggcaggacaactatgaccagcttgt 764



to top

>gb|AF012251.1|AF012251 Mus musculus casein kinase II, alpha prime subunit (Cskn2a2) mRNA,
           complete cds
          Length = 1630

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 75/91 (82%)
 Strand = Plus / Plus

                                                                       
Query: 166 tggacatgtggagccttgggtgcatgtttgctgggatgatcttccgcaaggagccattct 225
           |||||||||||||| | || |||||||| ||  | ||||| ||||| |||||||||||||
Sbjct: 739 tggacatgtggagcttgggctgcatgttagcgagcatgatattccgaaaggagccattct 798

                                          
Query: 226 tctatggccatgataaccatgaccaacttgt 256
           || | || || || ||| ||||||| |||||
Sbjct: 799 tccacgggcaggacaactatgaccagcttgt 829



to top

>dbj|AP006432.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT14C18, TM0330,
             complete sequence
          Length = 109258

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                            
Query: 207   ttccgcaaggagccattcttctatggccatgataaccatgaccaact 253
             ||||| |||||||||||||| ||||| ||||||||| |||| |||||
Sbjct: 72514 ttccgtaaggagccattcttttatgggcatgataactatgatcaact 72560



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 73/90 (81%)
 Strand = Plus / Plus

                                                                         
Query: 114   tatttcaagggacctgaacttctagttgatttgcaagattacgattattctctggacatg 173
             |||||||| || || || ||||| |||||| | ||||| || ||||| ||||| ||  | 
Sbjct: 72276 tatttcaaaggtcccgagcttcttgttgatcttcaagactatgattactctctagattta 72335

                                           
Query: 174   tggagccttgggtgcatgtttgctgggatg 203
             ||||| ||||| || |||||||||||||||
Sbjct: 72336 tggagtcttggttgtatgtttgctgggatg 72365



to top

>gb|M96173.1|MUSGHCK Mouse casein kinase II-alpha pseudogene
          Length = 2209

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 87/107 (81%)
 Strand = Plus / Plus

                                                                       
Query: 3   ccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctg 62
           ||||||||||  | |||||||||||| |   |||| |||||  | |||||||||||  | 
Sbjct: 731 ccccataatggcacgattgatcatgagcacagaaagcttcggctcatagactggggttta 790

                                                          
Query: 63  gcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           || |||||||||||||||||| | || || |||||||| ||||||||
Sbjct: 791 gctgagttttaccatccaggccaagagtataatgtccgagttgcttc 837



to top

>emb|CR962127.1| Medicago truncatula chromosome 5 clone mth2-181n9, COMPLETE SEQUENCE
          Length = 119528

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 92/114 (80%)
 Strand = Plus / Plus

                                                                         
Query: 1     agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
             |||| |||||| |||||||||| ||||  |  || || ||| || ||||||||||||| |
Sbjct: 52068 agccacataatattatgattgaccatgcgcagcgtaagctttgcctgatagactggggac 52127

                                                                   
Query: 61    tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttcaaggt 114
             | || |||||||| ||||| ||  | || || |||||||||||||| |||||||
Sbjct: 52128 ttgcagagttttatcatcccgggcaagagtataatgtccgtgttgcctcaaggt 52181



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                         
Query: 207   ttccgcaaggagccattcttctatggccatgataaccatgaccaacttgtgaaaattgcg 266
             ||||| |||||||||||||| ||||| || |||||| |||| ||||| || ||||| || 
Sbjct: 53844 ttccggaaggagccattcttttatggacaagataactatgatcaactagtaaaaatagcc 53903

                  
Query: 267   aaggt 271
             |||||
Sbjct: 53904 aaggt 53908



to top

>emb|AL049761.11|HSDJ863C7 Human DNA sequence from clone RP5-863C7 on chromosome 20p12.3-13
             Contains the CSNK2A1 gene for casein kinase 2 alpha 1
             polypeptide (EC 2.7.1.37), the 5' end of the C20orf140
             gene for a novel protein similar to Drosophila CG17883 and
             a CpG island, complete sequence
          Length = 108653

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                         
Query: 48    atagactggggcctggcggagttttaccatccaggcaaggaatacaatgtccgtgttgct 107
             |||||||||||  |||| |||||||| ||||| ||| | ||||| |||||||| ||||||
Sbjct: 35436 atagactggggtttggctgagttttatcatcctggccaagaatataatgtccgagttgct 35377

               
Query: 108   tc 109
             ||
Sbjct: 35376 tc 35375



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 1     agccccataatgttatgattgatcatga 28
             ||||||||||||| ||||||||||||||
Sbjct: 38837 agccccataatgtcatgattgatcatga 38810



to top

>gb|S72393.1| CSNK2A1=casein kinase II (CKII) subunit alpha [human, Genomic, 18862
             nt]
          Length = 18862

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                         
Query: 48    atagactggggcctggcggagttttaccatccaggcaaggaatacaatgtccgtgttgct 107
             |||||||||||  |||| |||||||| ||||| ||| | ||||| |||||||| ||||||
Sbjct: 15114 atagactggggtttggctgagttttatcatcctggccaagaatataatgtccgagttgct 15173

               
Query: 108   tc 109
             ||
Sbjct: 15174 tc 15175



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 1     agccccataatgttatgattgatcatga 28
             ||||||||||||| ||||||||||||||
Sbjct: 11713 agccccataatgtcatgattgatcatga 11740



to top

>dbj|AK013008.1| Mus musculus 10, 11 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2810406C12 product:casein kinase
           II, alpha 2, polypeptide, full insert sequence
          Length = 953

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                       
Query: 166 tggacatgtggagccttgggtgcatgtttgctgggatgatcttccgcaaggagccattct 225
           |||||||||||||| | || |||||||| ||  | ||||| ||||| |||||||||||||
Sbjct: 54  tggacatgtggagcttgggctgcatgttagcgagcatgatattccgaaaggagccattct 113

             
Query: 226 tc 227
           ||
Sbjct: 114 tc 115



to top

>gb|AC102555.11| Mus musculus chromosome 8, clone RP23-163N19, complete sequence
          Length = 196060

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                         
Query: 166   tggacatgtggagccttgggtgcatgtttgctgggatgatcttccgcaaggagccattct 225
             |||||||||||||| | || |||||||| ||  | ||||| ||||| |||||||||||||
Sbjct: 80642 tggacatgtggagcttgggctgcatgttagcgagcatgatattccgaaaggagccattct 80583

               
Query: 226   tc 227
             ||
Sbjct: 80582 tc 80581



to top

>ref|NM_174636.2| Bos taurus casein kinase 2, alpha prime polypeptide (CSNK2A2), mRNA
          Length = 1529

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 68/82 (82%)
 Strand = Plus / Plus

                                                                       
Query: 46  tgatagactggggcctggcggagttttaccatccaggcaaggaatacaatgtccgtgttg 105
           ||||||||||||| ||||| || || || ||||| | | |||| ||||||||||| || |
Sbjct: 526 tgatagactggggtctggcagaattctatcatcccgcccaggagtacaatgtccgagtgg 585

                                 
Query: 106 cttcaaggtatttcaagggacc 127
           | || ||||| |||||||||||
Sbjct: 586 cctccaggtacttcaagggacc 607



to top

>gb|AC165414.9| Mus musculus chromosome 8, clone RP23-424A21, complete sequence
          Length = 192707

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                          
Query: 166    tggacatgtggagccttgggtgcatgtttgctgggatgatcttccgcaaggagccattct 225
              |||||||||||||| | || |||||||| ||  | ||||| ||||| |||||||||||||
Sbjct: 154691 tggacatgtggagcttgggctgcatgttagcgagcatgatattccgaaaggagccattct 154632

                
Query: 226    tc 227
              ||
Sbjct: 154631 tc 154630



to top

>emb|AL831735.10| Mouse DNA sequence from clone RP23-452D3 on chromosome 2, complete
              sequence
          Length = 193718

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                          
Query: 48     atagactggggcctggcggagttttaccatccaggcaaggaatacaatgtccgtgttgct 107
              |||||||||||  | || |||||||||||||||||| | || || |||||||| ||||||
Sbjct: 128990 atagactggggtttagctgagttttaccatccaggccaagagtataatgtccgagttgct 129049

                
Query: 108    tc 109
              ||
Sbjct: 129050 tc 129051



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                    
Query: 201    atgatcttccgcaaggagccattcttctatggccatga 238
              ||||||||||| ||||||||||| ||| |||| |||||
Sbjct: 138477 atgatcttccggaaggagccatttttccatggacatga 138514



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 3      ccccataatgttatgattgatcatga 28
              ||||||||||| ||||||||||||||
Sbjct: 126605 ccccataatgtcatgattgatcatga 126630



to top

>emb|X69951.1|HSCKIIA H.sapiens gene for casein kinase II alpha subunit
          Length = 18862

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                         
Query: 48    atagactggggcctggcggagttttaccatccaggcaaggaatacaatgtccgtgttgct 107
             |||||||||||  |||| |||||||| ||||| ||| | ||||| |||||||| ||||||
Sbjct: 15114 atagactggggtttggctgagttttatcatcctggccaagaatataatgtccgagttgct 15173

               
Query: 108   tc 109
             ||
Sbjct: 15174 tc 15175



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 1     agccccataatgttatgattgatcatga 28
             ||||||||||||| ||||||||||||||
Sbjct: 11713 agccccataatgtcatgattgatcatga 11740



to top

>dbj|D17712.1|BOVPCK2A Bovine pCK2 mRNA for casein kinase II alpha subunit, complete cds
          Length = 1529

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 68/82 (82%)
 Strand = Plus / Plus

                                                                       
Query: 46  tgatagactggggcctggcggagttttaccatccaggcaaggaatacaatgtccgtgttg 105
           ||||||||||||| ||||| || || || ||||| | | |||| ||||||||||| || |
Sbjct: 526 tgatagactggggtctggcagaattctatcatcccgcccaggagtacaatgtccgagtgg 585

                                 
Query: 106 cttcaaggtatttcaagggacc 127
           | || ||||| |||||||||||
Sbjct: 586 cctccaggtacttcaagggacc 607



to top

>gb|AY723867.1| Saccharomyces cerevisiae clone FLH006291.01X YOR061W gene, complete
           cds
          Length = 1020

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 54  tggggcctggcggagttttaccatccagg 82
           ||||||||||||||||| |||||||||||
Sbjct: 559 tggggcctggcggagttctaccatccagg 587



to top

>ref|XM_742194.1| Aspergillus fumigatus Af293 casein kinase (Afu8g04810) partial mRNA
          Length = 1011

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 87/105 (82%), Gaps = 2/105 (1%)
 Strand = Plus / Plus

                                                                       
Query: 117 ttcaagggacctgaacttctagttgatttgcaagattacgattattctctggacatgtgg 176
           |||||||| ||||| || || |||||||| || || |||||||| || ||||||||||||
Sbjct: 568 ttcaagggccctgagctgcttgttgatttccaggaatacgattactccctggacatgtgg 627

                                                        
Query: 177 agccttgggtgc-atgtttgctgggatgatcttccgcaaggagcc 220
             |  ||||||| ||||||||    ||||||||||||||||||||
Sbjct: 628 -tcactgggtgcgatgtttgcctccatgatcttccgcaaggagcc 671



to top

>emb|Z74969.1|SCYOR061W S.cerevisiae chromosome XV reading frame ORF YOR061w
          Length = 1561

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 54  tggggcctggcggagttttaccatccagg 82
           ||||||||||||||||| |||||||||||
Sbjct: 929 tggggcctggcggagttctaccatccagg 957



to top

>emb|Z70678.1|SCXV55KB S.cerevisiae chromosome XV DNA, 54.7 kb region
          Length = 54719

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                          
Query: 54    tggggcctggcggagttttaccatccagg 82
             ||||||||||||||||| |||||||||||
Sbjct: 18925 tggggcctggcggagttctaccatccagg 18953



to top

>ref|NM_168986.1| Drosophila melanogaster Casein kinase II  subunit CG17520-RC,
            transcript variant C (CkIIalpha), mRNA
          Length = 1485

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 88/109 (80%)
 Strand = Plus / Plus

                                                                        
Query: 388  ctgataaccagcatctagtatctcccgaggccatagattttctcgataagcttcttcgct 447
            |||| ||||| |||||||| ||||| || ||  |||| ||||| ||||| ||| | ||||
Sbjct: 1128 ctgacaaccaacatctagtttctcctgaagcactagactttcttgataaacttttacgct 1187

                                                             
Query: 448  atgatcaccaagataggctcactgctcgtgaagctatggcgcatccata 496
            ||||||||   ||| | ||||| ||||| ||||| ||||| ||||||||
Sbjct: 1188 atgatcacgttgatcgactcacagctcgcgaagcaatggcccatccata 1236



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 87/109 (79%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           ||||||| ||||||||||| ||||| ||   ||||||| | ||| | ||||| ||||| |
Sbjct: 741 agccccacaatgttatgatagatcacgaaaatcgaaaattgcgccttatagattggggac 800

                                                            
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           | || || ||||||||||| ||  | ||||| ||||| ||||| |||||
Sbjct: 801 ttgccgaattttaccatcctggtcaagaatataatgttcgtgtggcttc 849



to top

>ref|NM_168985.1| Drosophila melanogaster Casein kinase II  subunit CG17520-RA,
            transcript variant A (CkIIalpha), mRNA
          Length = 1598

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 88/109 (80%)
 Strand = Plus / Plus

                                                                        
Query: 388  ctgataaccagcatctagtatctcccgaggccatagattttctcgataagcttcttcgct 447
            |||| ||||| |||||||| ||||| || ||  |||| ||||| ||||| ||| | ||||
Sbjct: 1241 ctgacaaccaacatctagtttctcctgaagcactagactttcttgataaacttttacgct 1300

                                                             
Query: 448  atgatcaccaagataggctcactgctcgtgaagctatggcgcatccata 496
            ||||||||   ||| | ||||| ||||| ||||| ||||| ||||||||
Sbjct: 1301 atgatcacgttgatcgactcacagctcgcgaagcaatggcccatccata 1349



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 87/109 (79%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           ||||||| ||||||||||| ||||| ||   ||||||| | ||| | ||||| ||||| |
Sbjct: 854 agccccacaatgttatgatagatcacgaaaatcgaaaattgcgccttatagattggggac 913

                                                            
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           | || || ||||||||||| ||  | ||||| ||||| ||||| |||||
Sbjct: 914 ttgccgaattttaccatcctggtcaagaatataatgttcgtgtggcttc 962



to top

>ref|NM_080179.4| Drosophila melanogaster Casein kinase II  subunit CG17520-RB,
            transcript variant B (CkIIalpha), mRNA
          Length = 1621

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 88/109 (80%)
 Strand = Plus / Plus

                                                                        
Query: 388  ctgataaccagcatctagtatctcccgaggccatagattttctcgataagcttcttcgct 447
            |||| ||||| |||||||| ||||| || ||  |||| ||||| ||||| ||| | ||||
Sbjct: 1266 ctgacaaccaacatctagtttctcctgaagcactagactttcttgataaacttttacgct 1325

                                                             
Query: 448  atgatcaccaagataggctcactgctcgtgaagctatggcgcatccata 496
            ||||||||   ||| | ||||| ||||| ||||| ||||| ||||||||
Sbjct: 1326 atgatcacgttgatcgactcacagctcgcgaagcaatggcccatccata 1374



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 87/109 (79%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           ||||||| ||||||||||| ||||| ||   ||||||| | ||| | ||||| ||||| |
Sbjct: 879 agccccacaatgttatgatagatcacgaaaatcgaaaattgcgccttatagattggggac 938

                                                            
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           | || || ||||||||||| ||  | ||||| ||||| ||||| |||||
Sbjct: 939 ttgccgaattttaccatcctggtcaagaatataatgttcgtgtggcttc 987



to top

>gb|AY069553.1| Drosophila melanogaster LD27706 full length cDNA
          Length = 1527

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 88/109 (80%)
 Strand = Plus / Plus

                                                                        
Query: 388  ctgataaccagcatctagtatctcccgaggccatagattttctcgataagcttcttcgct 447
            |||| ||||| |||||||| ||||| || ||  |||| ||||| ||||| ||| | ||||
Sbjct: 1122 ctgacaaccaacatctagtttctcctgaagcactagactttcttgataaacttttacgct 1181

                                                             
Query: 448  atgatcaccaagataggctcactgctcgtgaagctatggcgcatccata 496
            ||||||||   ||| | ||||| ||||| ||||| ||||| ||||||||
Sbjct: 1182 atgatcacgttgatcgactcacagctcgcgaagcaatggcccatccata 1230



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 87/109 (79%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           ||||||| ||||||||||| ||||| ||   ||||||| | ||| | ||||| ||||| |
Sbjct: 735 agccccacaatgttatgatagatcacgaaaatcgaaaattgcgccttatagattggggac 794

                                                            
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           | || || ||||||||||| ||  | ||||| ||||| ||||| |||||
Sbjct: 795 ttgccgaattttaccatcctggtcaagaatataatgttcgtgtggcttc 843



to top

>gb|AC010663.6| Drosophila melanogaster 3L BAC RP98-17M18 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 193914

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 88/109 (80%)
 Strand = Plus / Plus

                                                                          
Query: 388    ctgataaccagcatctagtatctcccgaggccatagattttctcgataagcttcttcgct 447
              |||| ||||| |||||||| ||||| || ||  |||| ||||| ||||| ||| | ||||
Sbjct: 140630 ctgacaaccaacatctagtttctcctgaagcactagactttcttgataaacttttacgct 140689

                                                               
Query: 448    atgatcaccaagataggctcactgctcgtgaagctatggcgcatccata 496
              ||||||||   ||| | ||||| ||||| ||||| ||||| ||||||||
Sbjct: 140690 atgatcacgttgatcgactcacagctcgcgaagcaatggcccatccata 140738



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 87/109 (79%)
 Strand = Plus / Plus

                                                                          
Query: 1      agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
              ||||||| ||||||||||| ||||| ||   ||||||| | ||| | ||||| ||||| |
Sbjct: 140243 agccccacaatgttatgatagatcacgaaaatcgaaaattgcgccttatagattggggac 140302

                                                               
Query: 61     tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
              | || || ||||||||||| ||  | ||||| ||||| ||||| |||||
Sbjct: 140303 ttgccgaattttaccatcctggtcaagaatataatgttcgtgtggcttc 140351



to top

>gb|AC117276.7| Drosophila melanogaster 3 BAC RP98-29A7 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 146426

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 88/109 (80%)
 Strand = Plus / Minus

                                                                         
Query: 388   ctgataaccagcatctagtatctcccgaggccatagattttctcgataagcttcttcgct 447
             |||| ||||| |||||||| ||||| || ||  |||| ||||| ||||| ||| | ||||
Sbjct: 99878 ctgacaaccaacatctagtttctcctgaagcactagactttcttgataaacttttacgct 99819

                                                              
Query: 448   atgatcaccaagataggctcactgctcgtgaagctatggcgcatccata 496
             ||||||||   ||| | ||||| ||||| ||||| ||||| ||||||||
Sbjct: 99818 atgatcacgttgatcgactcacagctcgcgaagcaatggcccatccata 99770



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 87/109 (79%)
 Strand = Plus / Minus

                                                                          
Query: 1      agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
              ||||||| ||||||||||| ||||| ||   ||||||| | ||| | ||||| ||||| |
Sbjct: 100265 agccccacaatgttatgatagatcacgaaaatcgaaaattgcgccttatagattggggac 100206

                                                               
Query: 61     tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
              | || || ||||||||||| ||  | ||||| ||||| ||||| |||||
Sbjct: 100205 ttgccgaattttaccatcctggtcaagaatataatgttcgtgtggcttc 100157



to top

>dbj|AK059258.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-025-A02, full
            insert sequence
          Length = 1434

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                     
Query: 489  catccatacttccttcaagtgagagcagcggagaacagcagggcacgaccgcaatga 545
            ||||| |||||||| ||||||||||| || || || ||||| |||||||| ||||||
Sbjct: 1131 catccgtacttcctccaagtgagagctgcagaaaatagcagagcacgaccacaatga 1187



to top

>gb|AE002786.2| Drosophila melanogaster chromosome 3L, section 81 of 83 of the complete
             sequence
          Length = 100825

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 88/109 (80%)
 Strand = Plus / Plus

                                                                         
Query: 388   ctgataaccagcatctagtatctcccgaggccatagattttctcgataagcttcttcgct 447
             |||| ||||| |||||||| ||||| || ||  |||| ||||| ||||| ||| | ||||
Sbjct: 60610 ctgacaaccaacatctagtttctcctgaagcactagactttcttgataaacttttacgct 60669

                                                              
Query: 448   atgatcaccaagataggctcactgctcgtgaagctatggcgcatccata 496
             ||||||||   ||| | ||||| ||||| ||||| ||||| ||||||||
Sbjct: 60670 atgatcacgttgatcgactcacagctcgcgaagcaatggcccatccata 60718



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 87/109 (79%)
 Strand = Plus / Plus

                                                                         
Query: 1     agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
             ||||||| ||||||||||| ||||| ||   ||||||| | ||| | ||||| ||||| |
Sbjct: 60223 agccccacaatgttatgatagatcacgaaaatcgaaaattgcgccttatagattggggac 60282

                                                              
Query: 61    tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
             | || || ||||||||||| ||  | ||||| ||||| ||||| |||||
Sbjct: 60283 ttgccgaattttaccatcctggtcaagaatataatgttcgtgtggcttc 60331



to top

>gb|M33759.1|YSCCKA2 S.cerevisiae casein kinase-II alpha' subunit gene, complete cds
          Length = 2393

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                         
Query: 54   tggggcctggcggagttttaccatccagg 82
            ||||||||||||||||| |||||||||||
Sbjct: 1078 tggggcctggcggagttctaccatccagg 1106



to top

>gb|M16534.1|DROCSKA D.melanogaster casein kinase II alpha subunit mRNA, complete cds
          Length = 1467

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 88/109 (80%)
 Strand = Plus / Plus

                                                                        
Query: 388  ctgataaccagcatctagtatctcccgaggccatagattttctcgataagcttcttcgct 447
            |||| ||||| |||||||| ||||| || ||  |||| ||||| ||||| ||| | ||||
Sbjct: 1112 ctgacaaccaacatctagtttctcctgaagcactagactttcttgataaacttttacgct 1171

                                                             
Query: 448  atgatcaccaagataggctcactgctcgtgaagctatggcgcatccata 496
            ||||||||   ||| | ||||| ||||| ||||| ||||| ||||||||
Sbjct: 1172 atgatcacgttgatcgactcacagctcgcgaagcaatggcccatccata 1220



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 87/109 (79%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           ||||||| ||||||||||| ||||| ||   ||||||| | ||| | ||||| ||||| |
Sbjct: 725 agccccacaatgttatgatagatcacgaaaatcgaaaattgcgccttatagattggggac 784

                                                            
Query: 61  tggcggagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           | || || ||||||||||| ||  | ||||| ||||| ||||| |||||
Sbjct: 785 ttgccgaattttaccatcctggtcaagaatataatgttcgtgtggcttc 833



to top

>gb|AY816076.1| Schistosoma japonicum SJCHGC01351 protein mRNA, complete cds
          Length = 1734

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 81/100 (81%)
 Strand = Plus / Plus

                                                                       
Query: 45  ttgatagactggggcctggcggagttttaccatccaggcaaggaatacaatgtccgtgtt 104
           ||||| || |||||||| || || ||||| ||||| ||  | |||||||| |||||||||
Sbjct: 561 ttgattgattggggcctagcagaattttatcatcctgggcaagaatacaacgtccgtgtt 620

                                                   
Query: 105 gcttcaaggtatttcaagggacctgaacttctagttgatt 144
           || ||| | || || || |||||||||||  |||||||||
Sbjct: 621 gcgtcacgctactttaaaggacctgaactattagttgatt 660



to top

>ref|NM_053824.1| Rattus norvegicus casein kinase II, alpha 1 polypeptide (Csnk2a1),
            mRNA
          Length = 2180

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 84/104 (80%)
 Strand = Plus / Plus

                                                                        
Query: 6    cataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctggcg 65
            |||||||| |||||||||||||| |   |||| |||||  | ||||| |||||  | || 
Sbjct: 1280 cataatgtcatgattgatcatgagcacagaaagcttcggctaatagattggggtttagca 1339

                                                        
Query: 66   gagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
            |||||||||||||| ||| | || || |||||||| ||||||||
Sbjct: 1340 gagttttaccatcctggccaagagtataatgtccgagttgcttc 1383



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                  
Query: 201  atgatcttccgcaaggagccattcttctatggccatga 238
            ||||||||||| ||||||||||| ||| |||| |||||
Sbjct: 1475 atgatcttccggaaggagccatttttccatggacatga 1512



to top

>emb|AL116068.1|CNS01CWC Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 188 catgtttgctgggatgatcttccgcaaggagccattcttc 227
           ||||||||||  |||||||||||| ||||| |||||||||
Sbjct: 438 catgtttgcttcgatgatcttccgaaaggaaccattcttc 477



to top

>emb|AL112276.1|CNS019Z0 Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 188 catgtttgctgggatgatcttccgcaaggagccattcttc 227
           ||||||||||  |||||||||||| ||||| |||||||||
Sbjct: 209 catgtttgcttcgatgatcttccgaaaggaaccattcttc 248



to top

>ref|XM_226237.3| PREDICTED: Rattus norvegicus casein kinase II, alpha 2, polypeptide
           (predicted) (Csnk2a2_predicted), mRNA
          Length = 1758

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 201 atgatcttccgcaaggagccattcttctatggccatgataaccatgaccaacttgt 256
           ||||| ||||| ||||||||||||||| |||| || || ||| ||||||| |||||
Sbjct: 696 atgatattccgaaaggagccattcttccatgggcaggacaactatgaccagcttgt 751



to top

>ref|XM_315576.2| Anopheles gambiae str. PEST ENSANGP00000017774
           (ENSANGG00000015285), partial mRNA
          Length = 1008

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                       
Query: 200 gatgatcttccgcaaggagccattcttc 227
           ||||||||||||||||||||| ||||||
Sbjct: 666 gatgatcttccgcaaggagccgttcttc 693



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 46  tgatagactggggcctggcggagttttaccatcc 79
           |||| |||||||||||||| ||||| ||||||||
Sbjct: 512 tgatcgactggggcctggccgagttctaccatcc 545



to top

>gb|BC091130.1| Rattus norvegicus casein kinase II, alpha 1 polypeptide, mRNA (cDNA
           clone MGC:108626 IMAGE:7367296), complete cds
          Length = 1546

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 84/104 (80%)
 Strand = Plus / Plus

                                                                       
Query: 6   cataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctggcg 65
           |||||||| |||||||||||||| |   |||| |||||  | ||||| |||||  | || 
Sbjct: 663 cataatgtcatgattgatcatgagcacagaaagcttcggctaatagattggggtttagca 722

                                                       
Query: 66  gagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           |||||||||||||| ||| | || || |||||||| ||||||||
Sbjct: 723 gagttttaccatcctggccaagagtataatgtccgagttgcttc 766



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 201 atgatcttccgcaaggagccattcttctatggccatga 238
           ||||||||||| ||||||||||| ||| |||| |||||
Sbjct: 858 atgatcttccggaaggagccatttttccatggacatga 895



to top

>gb|L15618.1|RATCK2ALPH Rat casein kinase II alpha subunit (CK2) mRNA, complete cds
          Length = 2180

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 84/104 (80%)
 Strand = Plus / Plus

                                                                        
Query: 6    cataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctggcg 65
            |||||||| |||||||||||||| |   |||| |||||  | ||||| |||||  | || 
Sbjct: 1280 cataatgtcatgattgatcatgagcacagaaagcttcggctaatagattggggtttagca 1339

                                                        
Query: 66   gagttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
            |||||||||||||| ||| | || || |||||||| ||||||||
Sbjct: 1340 gagttttaccatcctggccaagagtataatgtccgagttgcttc 1383



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                  
Query: 201  atgatcttccgcaaggagccattcttctatggccatga 238
            ||||||||||| ||||||||||| ||| |||| |||||
Sbjct: 1475 atgatcttccggaaggagccatttttccatggacatga 1512



to top

>ref|XM_511002.1| PREDICTED: Pan troglodytes LOC454131 (LOC454131), mRNA
          Length = 1418

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 85  aggaatacaatgtccgtgttgcttcaaggtatttcaagggacc 127
           |||| |||||||| ||||| || |||||||| |||||||||||
Sbjct: 671 aggagtacaatgttcgtgtagcctcaaggtacttcaagggacc 713



to top

>gb|BT019793.1| Synthetic construct Homo sapiens casein kinase 2, alpha prime
           polypeptide mRNA, partial cds
          Length = 1053

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 85  aggaatacaatgtccgtgttgcttcaaggtatttcaagggacc 127
           |||| |||||||| ||||| || |||||||| |||||||||||
Sbjct: 560 aggagtacaatgttcgtgtagcctcaaggtacttcaagggacc 602



to top

>gb|BC008812.2| Homo sapiens casein kinase 2, alpha prime polypeptide, mRNA (cDNA
           clone MGC:10397 IMAGE:3951914), complete cds
          Length = 1548

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 85  aggaatacaatgtccgtgttgcttcaaggtatttcaagggacc 127
           |||| |||||||| ||||| || |||||||| |||||||||||
Sbjct: 576 aggagtacaatgttcgtgtagcctcaaggtacttcaagggacc 618



to top

>ref|NM_001896.2| Homo sapiens casein kinase 2, alpha prime polypeptide (CSNK2A2),
           mRNA
          Length = 1674

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 85  aggaatacaatgtccgtgttgcttcaaggtatttcaagggacc 127
           |||| |||||||| ||||| || |||||||| |||||||||||
Sbjct: 702 aggagtacaatgttcgtgtagcctcaaggtacttcaagggacc 744



to top

>gb|AY335742.1| Synthetic construct Homo sapiens casein kinase 2, alpha prime
           polypeptide (CSNK2A2) mRNA, partial cds
          Length = 1053

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 85  aggaatacaatgtccgtgttgcttcaaggtatttcaagggacc 127
           |||| |||||||| ||||| || |||||||| |||||||||||
Sbjct: 560 aggagtacaatgttcgtgtagcctcaaggtacttcaagggacc 602



to top

>gb|AC009107.11| Homo sapiens chromosome 16 clone RP11-459F6, complete sequence
          Length = 208220

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                        
Query: 85    aggaatacaatgtccgtgttgcttcaaggtatttcaagggacc 127
             |||| |||||||| ||||| || |||||||| |||||||||||
Sbjct: 39326 aggagtacaatgttcgtgtagcctcaaggtacttcaagggacc 39284



to top

>gb|AC026771.6| Homo sapiens chromosome 16 clone CTB-134F13, complete sequence
          Length = 69808

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                       
Query: 85   aggaatacaatgtccgtgttgcttcaaggtatttcaagggacc 127
            |||| |||||||| ||||| || |||||||| |||||||||||
Sbjct: 8240 aggagtacaatgttcgtgtagcctcaaggtacttcaagggacc 8282



to top

>gb|AY890815.1| Synthetic construct Homo sapiens clone FLH009443.01L casein kinase
           2 alpha prime polypeptide (CSNK2A2) mRNA, partial cds
          Length = 1053

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 85  aggaatacaatgtccgtgttgcttcaaggtatttcaagggacc 127
           |||| |||||||| ||||| || |||||||| |||||||||||
Sbjct: 560 aggagtacaatgttcgtgtagcctcaaggtacttcaagggacc 602



to top

>gb|M55268.1|HUMA1CKII Human casein kinase II alpha' subunit mRNA, complete cds
          Length = 1677

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 85  aggaatacaatgtccgtgttgcttcaaggtatttcaagggacc 127
           |||| |||||||| ||||| || |||||||| |||||||||||
Sbjct: 723 aggagtacaatgttcgtgtagcctcaaggtacttcaagggacc 765



to top

>gb|AC111110.21| Mus musculus chromosome 1, clone RP23-201B13, complete sequence
          Length = 246043

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 323    tgaccctcagcttgaacatctt 344
              ||||||||||||||||||||||
Sbjct: 151370 tgaccctcagcttgaacatctt 151391



to top

>gb|AC117076.3| Dictyostelium discoideum chromosome 2 map 3323568-3470138 strain AX4,
              complete sequence
          Length = 146570

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                          
Query: 138    gttgatttgcaagattacgattattctctggacatgtggagccttgggtgcatgtttgct 197
              |||||| || ||||||| ||||||  ||| || |||||||| ||||| || |||||||||
Sbjct: 106152 gttgatatggaagattatgattatagtcttgatatgtggagtcttggttgtatgtttgct 106093

                
Query: 198    gg 199
              ||
Sbjct: 106092 gg 106091



to top

>emb|Z98559.1|SPAC23C11 S.pombe chromosome I cosmid c23C11
          Length = 38391

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                               
Query: 54    tggggcctggcggagttttaccatccaggcaaggaatacaatgtccgtgt 103
             ||||| ||||| |||||||| ||| | |||| |||||||||||| |||||
Sbjct: 19687 tggggtctggccgagttttatcatgctggcatggaatacaatgttcgtgt 19736



to top

>emb|X74275.1|SPCKIIA S.pombe mRNA for casein kinase II alpha subunit
          Length = 1583

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 54  tggggcctggcggagttttaccatccaggcaaggaatacaatgtccgtgt 103
           ||||| ||||| |||||||| ||| | |||| |||||||||||| |||||
Sbjct: 650 tggggtctggccgagttttatcatgctggcatggaatacaatgttcgtgt 699



to top

>ref|NM_001019073.1| Schizosaccharomyces pombe 972h- hypothetical protein
           (SPAC23C11.11), partial mRNA
          Length = 999

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 54  tggggcctggcggagttttaccatccaggcaaggaatacaatgtccgtgt 103
           ||||| ||||| |||||||| ||| | |||| |||||||||||| |||||
Sbjct: 538 tggggtctggccgagttttatcatgctggcatggaatacaatgttcgtgt 587



to top

>gb|L29508.1|YSPCKICAAA Schizosaccharomyces pombe casein kinase II catalytic subunit mRNA,
           complete cds
          Length = 1827

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 54  tggggcctggcggagttttaccatccaggcaaggaatacaatgtccgtgt 103
           ||||| ||||| |||||||| ||| | |||| |||||||||||| |||||
Sbjct: 655 tggggtctggccgagttttatcatgctggcatggaatacaatgttcgtgt 704



to top

>gb|BC044403.1| Danio rerio casein kinase 2 alpha 1, mRNA (cDNA clone MGC:55460
           IMAGE:2639934), complete cds
          Length = 2576

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 81/101 (80%)
 Strand = Plus / Plus

                                                                       
Query: 9   aatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctggcggag 68
           ||||| |||||||| ||||| |   |||| |||||  |||| || |||||| |||| |||
Sbjct: 757 aatgtcatgattgaccatgagcacagaaagcttcgtctgattgattggggcttggcagag 816

                                                    
Query: 69  ttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           |||||||| |||  | |||| |||||||| ||||| |||||
Sbjct: 817 ttttaccacccaaaccaggagtacaatgtacgtgtggcttc 857



to top

>gb|BC067595.1| Danio rerio cDNA clone IMAGE:6519793, containing frame-shift errors
          Length = 1834

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 81/101 (80%)
 Strand = Plus / Plus

                                                                       
Query: 9   aatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctggcggag 68
           ||||| |||||||| ||||| |   |||| |||||  |||| || |||||| |||| |||
Sbjct: 674 aatgtcatgattgaccatgagcacagaaagcttcgtctgattgattggggcttggcagag 733

                                                    
Query: 69  ttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           |||||||| |||  | |||| |||||||| ||||| |||||
Sbjct: 734 ttttaccacccaaaccaggagtacaatgtacgtgtggcttc 774



to top

>ref|XM_380853.1| Gibberella zeae PH-1 chromosome 1 KC2A_NEUCR Casein kinase II,
           alpha chain (CK II alpha subunit) (FG00677.1) partial
           mRNA
          Length = 1023

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 201 atgatcttccgcaaggagccattcttctatggc 233
           |||||||||||||| ||||| |||||| |||||
Sbjct: 652 atgatcttccgcaaagagcctttcttccatggc 684



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 60/73 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccccataatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcc 60
           |||| ||||| |||||||||||||||||    ||||| |||||  |||| || ||||| |
Sbjct: 452 agccacataacgttatgattgatcatgagaaccgaaagcttcgtctgattgattggggtc 511

                        
Query: 61  tggcggagtttta 73
           |||| ||||||||
Sbjct: 512 tggccgagtttta 524



to top

>gb|CP000089.1| Dechloromonas aromatica RCB, complete genome
          Length = 4501104

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 527    cagggcacgaccgcaatgaca 547
              |||||||||||||||||||||
Sbjct: 446140 cagggcacgaccgcaatgaca 446120



to top

>dbj|AB206394.1| Bombyx mori BmCK2a mRNA for casein kinase 2 alpha subunit, complete
           cds
          Length = 1785

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 201 atgatcttccgcaaggagccattcttctatggccatgataa 241
           ||||| ||||| || |||||||||||| ||||||| |||||
Sbjct: 919 atgattttccgtaaagagccattcttccatggccacgataa 959



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 467  cactgctcgtgaagctatgg 486
            ||||||||||||||||||||
Sbjct: 1185 cactgctcgtgaagctatgg 1204



to top

>gb|AY052172.1| Drosophila simulans isolate sim8 CKII-alpha gene, partial cds
          Length = 738

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 87/109 (79%)
 Strand = Plus / Plus

                                                                       
Query: 388 ctgataaccagcatctagtatctcccgaggccatagattttctcgataagcttcttcgct 447
           |||| ||||| |||||||| ||||| || ||  |||| ||||| ||||| ||| | ||||
Sbjct: 590 ctgacaaccaacatctagtttctcctgaagcactagactttcttgataaacttttacgct 649

                                                            
Query: 448 atgatcaccaagataggctcactgctcgtgaagctatggcgcatccata 496
           ||||||||   ||  | ||||| ||||| ||||| ||||| ||||||||
Sbjct: 650 atgatcacgttgaccgactcacagctcgcgaagcaatggcccatccata 698



to top

>gb|AY052171.1| Drosophila simulans isolate sim7 CKII-alpha gene, partial cds
          Length = 738

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 87/109 (79%)
 Strand = Plus / Plus

                                                                       
Query: 388 ctgataaccagcatctagtatctcccgaggccatagattttctcgataagcttcttcgct 447
           |||| ||||| |||||||| ||||| || ||  |||| ||||| ||||| ||| | ||||
Sbjct: 590 ctgacaaccaacatctagtttctcctgaagcactagactttcttgataaacttttacgct 649

                                                            
Query: 448 atgatcaccaagataggctcactgctcgtgaagctatggcgcatccata 496
           ||||||||   ||  | ||||| ||||| ||||| ||||| ||||||||
Sbjct: 650 atgatcacgttgaccgactcacagctcgcgaagcaatggcccatccata 698



to top

>gb|AY052170.1| Drosophila simulans isolate sim6 CKII-alpha gene, partial cds
          Length = 738

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 87/109 (79%)
 Strand = Plus / Plus

                                                                       
Query: 388 ctgataaccagcatctagtatctcccgaggccatagattttctcgataagcttcttcgct 447
           |||| ||||| |||||||| ||||| || ||  |||| ||||| ||||| ||| | ||||
Sbjct: 590 ctgacaaccaacatctagtttctcctgaagcactagactttcttgataaacttttacgct 649

                                                            
Query: 448 atgatcaccaagataggctcactgctcgtgaagctatggcgcatccata 496
           ||||||||   ||  | ||||| ||||| ||||| ||||| ||||||||
Sbjct: 650 atgatcacgttgaccgactcacagctcgcgaagcaatggcccatccata 698



to top

>gb|AY052169.1| Drosophila simulans isolate sim5 CKII-alpha gene, partial cds
          Length = 738

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 87/109 (79%)
 Strand = Plus / Plus

                                                                       
Query: 388 ctgataaccagcatctagtatctcccgaggccatagattttctcgataagcttcttcgct 447
           |||| ||||| |||||||| ||||| || ||  |||| ||||| ||||| ||| | ||||
Sbjct: 590 ctgacaaccaacatctagtttctcctgaagcactagactttcttgataaacttttacgct 649

                                                            
Query: 448 atgatcaccaagataggctcactgctcgtgaagctatggcgcatccata 496
           ||||||||   ||  | ||||| ||||| ||||| ||||| ||||||||
Sbjct: 650 atgatcacgttgaccgactcacagctcgcgaagcaatggcccatccata 698



to top

>gb|AY052168.1| Drosophila simulans isolate sim4 CKII-alpha gene, partial cds
          Length = 738

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 87/109 (79%)
 Strand = Plus / Plus

                                                                       
Query: 388 ctgataaccagcatctagtatctcccgaggccatagattttctcgataagcttcttcgct 447
           |||| ||||| |||||||| ||||| || ||  |||| ||||| ||||| ||| | ||||
Sbjct: 590 ctgacaaccaacatctagtttctcctgaagcactagactttcttgataaacttttacgct 649

                                                            
Query: 448 atgatcaccaagataggctcactgctcgtgaagctatggcgcatccata 496
           ||||||||   ||  | ||||| ||||| ||||| ||||| ||||||||
Sbjct: 650 atgatcacgttgaccgactcacagctcgcgaagcaatggcccatccata 698



to top

>gb|AY052167.1| Drosophila simulans isolate sim3 CKII-alpha gene, partial cds
          Length = 738

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 87/109 (79%)
 Strand = Plus / Plus

                                                                       
Query: 388 ctgataaccagcatctagtatctcccgaggccatagattttctcgataagcttcttcgct 447
           |||| ||||| |||||||| ||||| || ||  |||| ||||| ||||| ||| | ||||
Sbjct: 590 ctgacaaccaacatctagtttctcctgaagcactagactttcttgataaacttttacgct 649

                                                            
Query: 448 atgatcaccaagataggctcactgctcgtgaagctatggcgcatccata 496
           ||||||||   ||  | ||||| ||||| ||||| ||||| ||||||||
Sbjct: 650 atgatcacgttgaccgactcacagctcgcgaagcaatggcccatccata 698



to top

>gb|AY052166.1| Drosophila simulans isolate sim2 CKII-alpha gene, partial cds
          Length = 738

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 87/109 (79%)
 Strand = Plus / Plus

                                                                       
Query: 388 ctgataaccagcatctagtatctcccgaggccatagattttctcgataagcttcttcgct 447
           |||| ||||| |||||||| ||||| || ||  |||| ||||| ||||| ||| | ||||
Sbjct: 590 ctgacaaccaacatctagtttctcctgaagcactagactttcttgataaacttttacgct 649

                                                            
Query: 448 atgatcaccaagataggctcactgctcgtgaagctatggcgcatccata 496
           ||||||||   ||  | ||||| ||||| ||||| ||||| ||||||||
Sbjct: 650 atgatcacgttgaccgactcacagctcgcgaagcaatggcccatccata 698



to top

>gb|AY052165.1| Drosophila simulans isolate sim1 CKII-alpha gene, partial cds
          Length = 738

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 87/109 (79%)
 Strand = Plus / Plus

                                                                       
Query: 388 ctgataaccagcatctagtatctcccgaggccatagattttctcgataagcttcttcgct 447
           |||| ||||| |||||||| ||||| || ||  |||| ||||| ||||| ||| | ||||
Sbjct: 590 ctgacaaccaacatctagtttctcctgaagcactagactttcttgataaacttttacgct 649

                                                            
Query: 448 atgatcaccaagataggctcactgctcgtgaagctatggcgcatccata 496
           ||||||||   ||  | ||||| ||||| ||||| ||||| ||||||||
Sbjct: 650 atgatcacgttgaccgactcacagctcgcgaagcaatggcccatccata 698



to top

>ref|XM_696871.1| PREDICTED: Danio rerio hypothetical protein LOC554803 (LOC554803),
           mRNA
          Length = 2560

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 81/101 (80%)
 Strand = Plus / Plus

                                                                       
Query: 9   aatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctggcggag 68
           ||||| |||||||| ||||| |   |||| |||||  |||| || |||||| |||| |||
Sbjct: 757 aatgtcatgattgaccatgagcacagaaagcttcgtctgattgattggggcttggcagag 816

                                                    
Query: 69  ttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           |||||||| |||  | |||| |||||||| ||||| |||||
Sbjct: 817 ttttaccacccaaaccaggagtacaatgtacgtgtggcttc 857



to top

>gb|S76875.1| casein kinase 2 alpha subunit=protein kinase [Danio
           rerio=zebrafish|embryos, mRNA Partial, 1404 nt]
          Length = 1404

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 81/101 (80%)
 Strand = Plus / Plus

                                                                       
Query: 9   aatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctggcggag 68
           ||||| |||||||| ||||| |   |||| |||||  |||| || |||||| |||| |||
Sbjct: 297 aatgtcatgattgaccatgagcacagaaagcttcgtctgattgattggggcttggcagag 356

                                                    
Query: 69  ttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           |||||||| |||  | |||| |||||||| ||||| |||||
Sbjct: 357 ttttaccacccaaaccaggagtacaatgtacgtgtggcttc 397



to top

>ref|NM_131252.1| Danio rerio casein kinase 2 alpha 1 (ck2a1), mRNA
          Length = 2576

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 81/101 (80%)
 Strand = Plus / Plus

                                                                       
Query: 9   aatgttatgattgatcatgatcttcgaaaacttcgcttgatagactggggcctggcggag 68
           ||||| |||||||| ||||| |   |||| |||||  |||| || |||||| |||| |||
Sbjct: 757 aatgtcatgattgaccatgagcacagaaagcttcgtctgattgattggggcttggcagag 816

                                                    
Query: 69  ttttaccatccaggcaaggaatacaatgtccgtgttgcttc 109
           |||||||| |||  | |||| |||||||| ||||| |||||
Sbjct: 817 ttttaccacccaaaccaggagtacaatgtacgtgtggcttc 857



to top

>dbj|AB024599.1| Hemicentrotus pulcherrimus mRNA for CK2 alpha subunit, complete cds
          Length = 2667

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 39  cttcgcttgatagactggggcctggcggagttttaccatcc 79
           ||||| |||||||||||||| || || ||||| ||||||||
Sbjct: 648 cttcgtttgatagactggggtctagcagagttctaccatcc 688



to top

>gb|AY596298.1| Haloarcula marismortui ATCC 43049 chromosome II, complete sequence
          Length = 288050

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 604   atggaactgtcacgatggca 623
             ||||||||||||||||||||
Sbjct: 35916 atggaactgtcacgatggca 35897



to top

>gb|BC065457.1| Danio rerio taube nuss-like, mRNA (cDNA clone MGC:77837
            IMAGE:7001815), complete cds
          Length = 1493

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 106  cttcaaggtatttcaaggga 125
            ||||||||||||||||||||
Sbjct: 1323 cttcaaggtatttcaaggga 1304



to top

>gb|BC049422.1| Danio rerio taube nuss-like, mRNA (cDNA clone MGC:56401
            IMAGE:5605140), complete cds
          Length = 1334

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 106  cttcaaggtatttcaaggga 125
            ||||||||||||||||||||
Sbjct: 1172 cttcaaggtatttcaaggga 1153



to top

>gb|AC158990.2| Mus musculus BAC clone RP23-416E18 from chromosome 13, complete
             sequence
          Length = 191036

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 185   gtgcatgtttgctgggatgatctt 208
             |||||||||||||||||| |||||
Sbjct: 30198 gtgcatgtttgctgggataatctt 30175



to top

>ref|XM_959890.1| Neurospora crassa OR74A hypothetical protein ( (AF220947) kinase
           [Candida albicans] ) (NCU03124.1) partial mRNA
          Length = 876

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 201 atgatcttccgcaaggagcc 220
           ||||||||||||||||||||
Sbjct: 517 atgatcttccgcaaggagcc 536



to top

>ref|XM_330559.1| Neurospora crassa OR74A hypothetical protein ( (AF220947) kinase
           [Candida albicans] ) (NCU03124.1) partial mRNA
          Length = 876

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 201 atgatcttccgcaaggagcc 220
           ||||||||||||||||||||
Sbjct: 517 atgatcttccgcaaggagcc 536



to top

>emb|BX842637.1| Neurospora crassa DNA linkage group I cosmid contig 5C2
          Length = 98769

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 201   atgatcttccgcaaggagcc 220
             ||||||||||||||||||||
Sbjct: 91661 atgatcttccgcaaggagcc 91680



to top

>gb|AE016828.2| Coxiella burnetii RSA 493, complete genome
          Length = 1995281

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 100    gtgttgcttcaaggtatttc 119
              ||||||||||||||||||||
Sbjct: 413734 gtgttgcttcaaggtatttc 413753



to top

>gb|AC112243.5| Homo sapiens BAC clone RP11-517M22 from 4, complete sequence
          Length = 40933

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 189   atgtttgctgggatgatctt 208
             ||||||||||||||||||||
Sbjct: 34652 atgtttgctgggatgatctt 34633



to top

>gb|AF494376.1| Neurospora crassa casein kinase II alpha subunit CKA mRNA, complete
           cds
          Length = 1011

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 201 atgatcttccgcaaggagcc 220
           ||||||||||||||||||||
Sbjct: 652 atgatcttccgcaaggagcc 671



to top

>gb|AC090152.4| Homo sapiens chromosome 8, clone RP11-554M1, complete sequence
          Length = 118755

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 373   caaagttcattaatgctgat 392
             ||||||||||||||||||||
Sbjct: 50893 caaagttcattaatgctgat 50912



to top

>ref|NM_200286.1| Danio rerio taube nuss-like (tbnl), mRNA
          Length = 1334

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 106  cttcaaggtatttcaaggga 125
            ||||||||||||||||||||
Sbjct: 1172 cttcaaggtatttcaaggga 1153



to top

>gb|AC097488.2| Homo sapiens BAC clone RP11-218C23 from 4, complete sequence
          Length = 175970

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 322    ttgaccctcagcttgaacat 341
              ||||||||||||||||||||
Sbjct: 160331 ttgaccctcagcttgaacat 160312



to top

>gb|AC068234.8| Homo sapiens chromosome 17, clone RP11-290H9, complete sequence
          Length = 174566

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 167    ggacatgtggagccttgggt 186
              ||||||||||||||||||||
Sbjct: 134551 ggacatgtggagccttgggt 134532



to top

>ref|XM_685099.1| PREDICTED: Danio rerio similar to Tbnl protein (LOC573115), mRNA
          Length = 1778

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 106  cttcaaggtatttcaaggga 125
            ||||||||||||||||||||
Sbjct: 1264 cttcaaggtatttcaaggga 1245



to top

>ref|XM_702616.1| PREDICTED: Danio rerio similar to RIKEN cDNA 1700027A23, transcript
            variant 2 (LOC560315), mRNA
          Length = 1864

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 106  cttcaaggtatttcaaggga 125
            ||||||||||||||||||||
Sbjct: 1059 cttcaaggtatttcaaggga 1078


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,672,392
Number of Sequences: 3902068
Number of extensions: 4672392
Number of successful extensions: 79600
Number of sequences better than 10.0: 262
Number of HSP's better than 10.0 without gapping: 264
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 78777
Number of HSP's gapped (non-prelim): 770
length of query: 631
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 608
effective length of database: 17,143,297,704
effective search space: 10423125004032
effective search space used: 10423125004032
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top