ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags30d09
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AF411228.1|AF411228 Hordeum vulgare ascorbate peroxidase mRNA... 1140 0.0
2gb|BT009090.1| Triticum aestivum clone wkm2c.pk0002.f7:fis, full... 934 0.0
3ref|XM_479627.1| Oryza sativa (japonica cultivar-group), mRNA 585 e-164
4ref|XM_506596.1| PREDICTED Oryza sativa (japonica cultivar-group... 585 e-164
5dbj|AB053297.1| Oryza sativa (japonica cultivar-group) APXb mRNA... 585 e-164
6dbj|AK061715.1| Oryza sativa (japonica cultivar-group) cDNA clon... 585 e-164
7dbj|AB050724.1| Oryza sativa (japonica cultivar-group) APXb mRNA... 585 e-164
8dbj|AK102751.1| Oryza sativa (japonica cultivar-group) cDNA clon... 577 e-161
9dbj|AK068430.1| Oryza sativa (japonica cultivar-group) cDNA clon... 577 e-161
10emb|Z34934.1|ZMAPXG Z.mays apx gene encoding cytosolic ascorbate... 525 e-146
11gb|AY104492.1| Zea mays PCO104002 mRNA sequence 525 e-146
12gb|BT019024.1| Zea mays clone Contig527.F mRNA sequence 486 e-134
13dbj|AK122175.1| Oryza sativa (japonica cultivar-group) cDNA clon... 422 e-115
14gb|BT016458.1| Zea mays clone Contig291 mRNA sequence 373 e-100
15gb|BT017015.1| Zea mays clone EK07D2311G04.c mRNA sequence 311 2e-81
16ref|XM_470658.1| Oryza sativa (japonica cultivar-group), predic... 285 9e-74
17emb|AJ006358.1|HVU6 Hordeum vulgare mRNA for ascorbate peroxidase 285 9e-74
18gb|AY254495.1| Oryza sativa (indica cultivar-group) ascorbate pe... 285 9e-74
19dbj|AK061841.1| Oryza sativa (japonica cultivar-group) cDNA clon... 285 9e-74
20dbj|D45423.1| Rice mRNA for ascorbate peroxidase, complete cds 285 9e-74
21gb|AF411227.1|AF411227 Hordeum vulgare ascorbate peroxidase mRNA... 202 1e-48
22gb|AY462246.1| Rehmannia glutinosa ascorbate peroxidase (APX) mR... 188 2e-44
23dbj|AB078599.1| Brassica oleracea BO-APX 1 mRNA for ascorbate pe... 184 2e-43
24emb|AJ279686.1|BPE279686 Betula pendula partial mRNA for ascorba... 182 1e-42
25gb|AY823545.1| Pennisetum glaucum ascorbate peroxidase (Apx) mRN... 176 6e-41
26gb|AY078080.1| Capsicum annuum putative ascorbate peroxidase mRN... 172 9e-40
27gb|DQ442272.1| Camellia sinensis ascorbate peroxidase mRNA, comp... 172 9e-40
28emb|X78452.1|RSAPX R.sativus (Fakir) APX mRNA for L-ascorbate pe... 170 4e-39
29emb|X81376.1|CAYWCAP C.annuum mRNA for cytosolic ascorbate perox... 167 6e-38
30gb|AF540556.1| Brassica juncea clone APX 8A ascorbate peroxidase... 163 9e-37
31gb|AF457210.1| Hevea brasiliensis ascorbate peroxidase (APX) mRN... 163 9e-37
32gb|AF159633.1|AF159633 Fragaria x ananassa cytosolic ascorbate p... 161 4e-36
33gb|AF159632.1|AF159632 Fragaria x ananassa cytosolic ascorbate p... 161 4e-36
34gb|AY937208.1| Rosa hybrid cultivar APX1 mRNA, partial cds 157 6e-35
35emb|Y11461.1|BN11461 B.napus mRNA for ascorbate peroxidase 153 9e-34
36gb|AF159628.1|AF159628 Fragaria x ananassa cytosolic ascorbate p... 153 9e-34
37gb|AF159627.1|AF159627 Fragaria x ananassa cytosolic ascorbate p... 153 9e-34
38gb|L20864.1|SPIASCPER Spinacia oleracea ascorbate peroxidase mRN... 153 9e-34
39dbj|D85864.1|SPICAP Spinacia oleracea mRNA for cytosolic ascorba... 153 9e-34
40gb|DQ002888.1| Capsicum annuum cytosolic ascorbate peroxidase (A... 151 3e-33
41gb|AF540557.1| Brassica juncea clone APX 6A ascorbate peroxidase... 147 5e-32
42gb|AF159631.1|AF159631 Fragaria x ananassa cytosolic ascorbate p... 145 2e-31
43gb|AF159630.1|AF159630 Fragaria x ananassa cytosolic ascorbate p... 145 2e-31
44gb|AF159629.1|AF159629 Fragaria x ananassa cytosolic ascorbate p... 145 2e-31
45gb|AF022213.1|AF022213 Fragaria x ananassa cytosolic ascorbate p... 145 2e-31
46gb|DQ097722.1| Arachis hypogaea cytosolic ascorbate peroxidase m... 137 5e-29
47gb|AF039953.1|AF039953 Fragaria x ananassa cytosolic ascorbate p... 137 5e-29
48gb|AY974805.1| Lycopersicon esculentum ascorbate peroxidase (APX... 137 5e-29
49gb|AY206407.1| Ipomoea batatas ascorbate peroxidase mRNA, comple... 133 8e-28
50emb|AJ000223.1|HVJ000223 Hordeum vulgare mRNA for expressed sequ... 133 8e-28
51gb|AY973623.1| Manihot esculenta ascorbate peroxidase APX3 mRNA,... 131 3e-27
52gb|AY973622.1| Manihot esculenta ascorbate peroxidase APX2 mRNA,... 131 3e-27
53dbj|AB078600.1| Brassica oleracea BO-APX 2 mRNA for ascorbate pe... 131 3e-27
54gb|DQ096287.1| Lycopersicon esculentum cytosolic ascorbate perox... 129 1e-26
55gb|AY338957.1| Cucumis sativus ascorbate peroxidase (apox) mRNA,... 129 1e-26
56gb|AF378131.1|AF378131 Zantedeschia aethiopica ascorbate peroxid... 129 1e-26
57dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 129 1e-26
58dbj|AP005199.3| Oryza sativa (japonica cultivar-group) genomic D... 129 1e-26
59dbj|D88649.1| Cucumis sativus mRNA for cytosolic ascorbate perox... 129 1e-26
60gb|AF053474.1|AF053474 Zantedeschia aethiopica ascorbate peroxid... 127 5e-26
61emb|X62077.1|PSAPXI P.sativum ApxI mRNA for ascorbate peroxidase 127 5e-26
62gb|AY485994.1| Pinus pinaster ascorbate peroxidase (csApx) mRNA,... 119 1e-23
63gb|U15933.1|NTU15933 Nicotiana tabacum ascorbate peroxidase (APX... 119 1e-23
64dbj|D85912.1|TOBTCAP Nicotiana tabacum mRNA for cytosolic ascorb... 119 1e-23
65dbj|D25238.1|RICSS622CC Oryza sativa SS622 mRNA for ascorbate pe... 113 8e-22
66emb|AJ698922.1| Populus euramericana partial mRNA for putative a... 107 5e-20
67gb|DQ222519.1| Solanum tuberosum clone 121A05 ascorbate peroxida... 103 7e-19
68dbj|AB041343.1| Solanum tuberosum APx mRNA for ascorbate peroxid... 103 7e-19
69dbj|AB254809.1| Cryptomeria japonica mRNA for putative ascorbate... 98 4e-17
70dbj|AB024991.1| Cicer arietinum mRNA for ascorbate peroxidase, p... 96 2e-16
71gb|AY034893.1| Suaeda maritima subsp. salsa cytosolic ascorbate ... 94 7e-16
72ref|NM_179276.1| Arabidopsis thaliana APX1; L-ascorbate peroxida... 92 3e-15
73ref|NM_202057.1| Arabidopsis thaliana APX1; L-ascorbate peroxida... 92 3e-15
74ref|NM_100663.2| Arabidopsis thaliana APX1; L-ascorbate peroxida... 92 3e-15
75ref|NM_001035915.1| Arabidopsis thaliana APX1; L-ascorbate perox... 92 3e-15
76emb|X59600.1|ATASCOR A.thaliana mRNA for ascorbate peroxidase 92 3e-15
77gb|AY094002.1| Arabidopsis thaliana At1g07890/F24B9_2 mRNA, comp... 92 3e-15
78gb|AY056395.1| Arabidopsis thaliana At1g07890/F24B9_2 mRNA, comp... 92 3e-15
79gb|AY039879.1| Arabidopsis thaliana At1g07890/F24B9_2 mRNA, comp... 92 3e-15
80emb|BX816429.1|CNS0ABNP Arabidopsis thaliana Full-length cDNA Co... 92 3e-15
81emb|BX815448.1|CNS0AE8X Arabidopsis thaliana Full-length cDNA Co... 92 3e-15
82emb|BX813944.1|CNS0AEB8 Arabidopsis thaliana Full-length cDNA Co... 92 3e-15
83emb|BX815850.1|CNS0ABNN Arabidopsis thaliana Full-length cDNA Co... 92 3e-15
84emb|BX813948.1|CNS0ACBX Arabidopsis thaliana Full-length cDNA Co... 92 3e-15
85emb|BX816810.1|CNS0ABP3 Arabidopsis thaliana Full-length cDNA Co... 92 3e-15
86emb|BX815009.1|CNS0ABC3 Arabidopsis thaliana Full-length cDNA Co... 92 3e-15
87emb|BX841772.1|CNS09Y65 Arabidopsis thaliana Full-length cDNA Co... 92 3e-15
88gb|AY086425.1| Arabidopsis thaliana clone 25057 mRNA, complete s... 92 3e-15
89dbj|AB082931.1| Glycine max apx1 mRNA for cytosolic ascorbate pe... 92 3e-15
90dbj|AB082930.1| Glycine max apx1 mRNA for cytosolic ascorbate pe... 92 3e-15
91gb|L10292.1|SOYASCPER Soybean ascorbate peroxidase mRNA, complet... 92 3e-15
92gb|DQ096286.1| Lycopersicon esculentum cytosolic ascorbate perox... 90 1e-14
93gb|AF001529.1|AF001529 Musa acuminata ripening-associated protei... 90 1e-14
94gb|AY831398.2| Dimocarpus longan cytosolic ascorbate peroxidase ... 86 2e-13
95gb|DQ004738.1| Phaseolus lunatus ascorbate peroxidase (AP1) mRNA... 86 2e-13
96emb|BX815873.1|CNS0ABWS Arabidopsis thaliana Full-length cDNA Co... 86 2e-13
97gb|AY306210.1| Citrullus lanatus ascorbate peroxidase (APX) mRNA... 84 7e-13
98emb|BX814227.1|CNS0AC1P Arabidopsis thaliana Full-length cDNA Co... 84 7e-13
99emb|BX817157.1|CNS0ABKO Arabidopsis thaliana Full-length cDNA Co... 84 7e-13
100gb|AF281082.1|AF281082 Astragalus membranaceus ascorbate peroxid... 82 3e-12
101gb|AF158654.1|AF158654 Fragaria x ananassa cytosolic ascorbate p... 80 1e-11
102emb|Z17398.1|DCORFA Daucus carota mRNA for unknown protein 78 4e-11
103gb|AY148472.1| Retama raetam cytosolic ascorbate peroxidase mRNA... 74 6e-10
104ref|NM_001035914.1| Arabidopsis thaliana APX1; L-ascorbate perox... 72 3e-09
105gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 70 1e-08
106emb|AJ971947.1| Pinus pinea partial mRNA for cytosolic ascorbate... 70 1e-08
107dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 70 1e-08
108gb|AC134232.2| Oryza sativa (japonica cultivar-group) chromosome... 70 1e-08
109gb|AF038839.1| Brassica juncea ascorbate peroxidase mRNA, comple... 70 1e-08
110gb|AF159380.1|AF159380 Pimpinella brachycarpa ascorbate peroxida... 68 4e-08
111gb|AY054988.1| Medicago sativa ascorbate peroxidase mRNA, partia... 66 2e-07
112gb|AY832500.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
113gb|AY832499.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
114gb|AY832498.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
115gb|AY832497.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
116gb|AY832496.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
117gb|AY832495.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
118gb|AY832494.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
119gb|AY832493.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
120gb|AY832492.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
121gb|AY832491.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
122gb|AY832490.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
123gb|AY832489.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
124gb|AY832488.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
125gb|AY832487.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
126gb|AY832486.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
127gb|AY832485.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
128gb|AY832484.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
129gb|AY832483.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
130gb|AY832482.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
131gb|AY832481.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
132gb|AY832480.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
133gb|AY832479.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
134gb|AY832478.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
135gb|AY832477.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
136gb|AY832476.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
137gb|AY832475.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
138gb|AY832474.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
139gb|AY832473.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
140emb|AJ489279.1|CSA489279 Crocus sativus partial mRNA for ascorba... 64 6e-07
141gb|AF127804.1|AF127804 Glycine max ascorbate peroxidase (apx1) m... 64 6e-07
142gb|AF158652.2|AF158652 Fragaria x ananassa cytosolic ascorbate p... 64 6e-07
143dbj|AB082932.1| Glycine max apx2 mRNA for cytosolic ascorbate pe... 64 6e-07
144gb|AF158653.1|AF158653 Fragaria x ananassa cytosolic ascorbate p... 64 6e-07
145gb|DQ246218.1| Litchi chinensis putative ascorbate peroxidase mR... 62 2e-06
146gb|U56634.1|GMU56634 Glycine max ascorbate peroxidase 2 (APx2) m... 62 2e-06
147gb|M93051.1|PEAAPXIA Pisum sativum ascorbate peroxidase (ApxI) g... 62 2e-06
148dbj|AB243015.1| Codonopsis lanceolata mRNA for cytosolic ascorba... 56 2e-04
149dbj|D14442.1|ATHAPX1 Arabidopsis thaliana APX1 gene for ascorbat... 56 2e-04
150gb|AF443182.1|AF443182 Nicotiana tabacum ascorbate peroxidase mR... 56 2e-04
151gb|AC007583.2|F24B9 Arabidopsis thaliana chromosome 1 BAC F24B9 ... 56 2e-04
152gb|AF146521.1|AF146521 Musa acuminata ascorbate peroxidase mRNA,... 56 2e-04
153gb|U63815.1|ATU63815 Arabidopsis thaliana AT.I.24-1, AT.I.24-2, ... 56 2e-04
154gb|DQ442396.1| Striga asiatica clone St543 ascorbate peroxidase ... 52 0.002
155gb|AF326783.1|AF326783 Pinus strobus ascorbate peroxidase (APX) ... 52 0.002
156ref|NM_111798.2| Arabidopsis thaliana APX2 (ASCORBATE PEROXIDASE... 50 0.009
157ref|NM_001035587.1| Arabidopsis thaliana APX2 (ASCORBATE PEROXID... 50 0.009
158gb|DQ446651.1| Arabidopsis thaliana clone pENTR221-At3g09640 L-a... 50 0.009
159emb|X98275.1|ATAPCYT A.thaliana mRNA for ascorbate peroxidase, c... 50 0.009
160dbj|AK176821.1| Arabidopsis thaliana mRNA for putative ascorbate... 50 0.009
161dbj|AK176908.1| Arabidopsis thaliana mRNA for putative ascorbate... 50 0.009
162ref|NM_116947.2| Arabidopsis thaliana peroxidase AT4G08770 mRNA,... 48 0.037
163gb|BT000180.1| Arabidopsis thaliana peroxidase C2 precursor-like... 48 0.037
164emb|AJ493275.1|PPA493275 Physcomitrella patens mRNA for putative... 48 0.037
165gb|AY136364.1| Arabidopsis thaliana peroxidase C2 precursor-like... 48 0.037
166gb|AF452387.1| Arabidopsis thaliana class III peroxidase ATP38 m... 48 0.037
167gb|AY742959.1| Solanum tuberosum cytosolic ascorbate peroxidase ... 46 0.15
168gb|U61379.1|VUU61379 Vigna unguiculata cytosolic ascorbate perox... 46 0.15
169gb|AC145164.11| Medicago truncatula clone mth2-27j21, complete s... 46 0.15
170gb|AC137668.18| Medicago truncatula clone mth2-5f8, complete seq... 46 0.15
171emb|Y16773.1|LEAPX Lycopersicaon esculentum APX gene, complete CDS 46 0.15
172ref|XM_517658.1| PREDICTED: Pan troglodytes similar to very larg... 44 0.58
173gb|AC157986.4| Mus musculus chromosome 19, clone RP23-160F18, co... 44 0.58
174gb|AC093529.2| Homo sapiens chromosome 5 clone RP11-29K14, compl... 44 0.58
175gb|AC027323.5| Homo sapiens chromosome 5 clone CTD-2034A10, comp... 44 0.58
176dbj|AK020572.1| Mus musculus adult male urinary bladder cDNA, RI... 44 0.58
177gb|AC102722.7| Mus musculus chromosome 19, clone RP24-108O16, co... 44 0.58
178gb|AC139062.10| Mus musculus chromosome 17, clone RP23-69L11, co... 42 2.3
179gb|AC119181.11| Mus musculus chromosome 18, clone RP24-111I16, c... 42 2.3
180gb|AC131185.4| Mus musculus BAC clone RP23-402H1 from chromosome... 42 2.3
181gb|AC162901.4| Mus musculus BAC clone RP23-417K5 from chromosome... 42 2.3
182gb|CP000009.1| Gluconobacter oxydans 621H, complete genome 42 2.3
183gb|AC124491.5| Mus musculus BAC clone RP23-454B2 from chromosome... 42 2.3
184gb|AC165153.2| Mus musculus BAC clone RP23-359L1 from chromosome... 42 2.3
185ref|XM_527102.1| PREDICTED: Pan troglodytes similar to mKIAA1935... 40 9.1
186gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence 40 9.1
187ref|XM_960403.1| Neurospora crassa OR74A hypothetical protein (N... 40 9.1
188ref|XM_329054.1| Neurospora crassa OR74A hypothetical protein (N... 40 9.1
189ref|XM_608956.2| PREDICTED: Bos taurus similar to Nucleolar prer... 40 9.1
190gb|AC134560.5| Mus musculus BAC clone RP24-100B13 from chromosom... 40 9.1
191ref|XM_981494.1| PREDICTED: Mus musculus similar to Nucleolar pr... 40 9.1
192ref|XM_489612.4| PREDICTED: Mus musculus RIKEN cDNA 4921511H13 g... 40 9.1
193ref|XM_904396.2| PREDICTED: Mus musculus RIKEN cDNA 4921511H13 g... 40 9.1
194ref|XM_975719.1| PREDICTED: Mus musculus similar to AIDA-1b, tra... 40 9.1
195ref|XM_975691.1| PREDICTED: Mus musculus similar to AIDA-1b, tra... 40 9.1
196ref|XM_975823.1| PREDICTED: Mus musculus similar to AIDA-1b, tra... 40 9.1
197ref|XM_975853.1| PREDICTED: Mus musculus similar to AIDA-1b, tra... 40 9.1
198ref|XM_975757.1| PREDICTED: Mus musculus similar to AIDA-1b, tra... 40 9.1
199ref|XM_975884.1| PREDICTED: Mus musculus similar to AIDA-1b, tra... 40 9.1
200ref|XM_975790.1| PREDICTED: Mus musculus similar to AIDA-1b, tra... 40 9.1
201ref|XM_975534.1| PREDICTED: Mus musculus similar to AIDA-1b, tra... 40 9.1
202ref|XM_001002918.1| PREDICTED: Mus musculus ankyrin repeat and s... 40 9.1
203ref|XM_924927.2| PREDICTED: Mus musculus ankyrin repeat and ster... 40 9.1
204ref|XM_924933.2| PREDICTED: Mus musculus ankyrin repeat and ster... 40 9.1
205ref|XM_924929.2| PREDICTED: Mus musculus ankyrin repeat and ster... 40 9.1
206ref|XM_924921.2| PREDICTED: Mus musculus ankyrin repeat and ster... 40 9.1
207ref|XM_924931.2| PREDICTED: Mus musculus ankyrin repeat and ster... 40 9.1
208ref|XM_917405.2| PREDICTED: Mus musculus ankyrin repeat and ster... 40 9.1
209ref|XM_001003427.1| PREDICTED: Mus musculus ankyrin repeat and s... 40 9.1
210ref|XM_001003423.1| PREDICTED: Mus musculus ankyrin repeat and s... 40 9.1
211ref|XM_001003446.1| PREDICTED: Mus musculus ankyrin repeat and s... 40 9.1
212ref|XM_001003440.1| PREDICTED: Mus musculus ankyrin repeat and s... 40 9.1
213ref|XM_001003432.1| PREDICTED: Mus musculus ankyrin repeat and s... 40 9.1
214ref|XM_001003455.1| PREDICTED: Mus musculus ankyrin repeat and s... 40 9.1
215ref|XM_001003434.1| PREDICTED: Mus musculus ankyrin repeat and s... 40 9.1
216ref|XM_001003400.1| PREDICTED: Mus musculus ankyrin repeat and s... 40 9.1
217ref|XM_536448.2| PREDICTED: Canis familiaris similar to PWWP dom... 40 9.1
218ref|XM_862066.1| PREDICTED: Canis familiaris similar to PWWP dom... 40 9.1
219ref|XM_848192.1| PREDICTED: Canis familiaris similar to PWWP dom... 40 9.1
220emb|Z95116.1|HS57G9 Human DNA sequence from clone CTA-57G9 on ch... 40 9.1
221ref|XM_779767.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 9.1
222emb|BX842681.1| Neurospora crassa DNA linkage group I BAC clone ... 40 9.1
223emb|CR858482.1| Pongo pygmaeus mRNA; cDNA DKFZp469D094 (from clo... 40 9.1
224dbj|AB188037.1| Uncultured bacterium gene for 16S rRNA, partial ... 40 9.1
225dbj|AK055921.1| Homo sapiens cDNA FLJ31359 fis, clone MESAN20005... 40 9.1
226gb|BC105110.1| Homo sapiens MSTP101, mRNA (cDNA clone MGC:132770... 40 9.1
227gb|BC035076.2| Homo sapiens MSTP101, mRNA (cDNA clone IMAGE:5260... 40 9.1
228gb|AC008706.5| Homo sapiens chromosome 5 clone CTB-77M23, comple... 40 9.1
229gb|AC091062.5| Homo sapiens chromosome 17, clone RP11-506D12, co... 40 9.1
230ref|XM_940683.1| PREDICTED: Homo sapiens KIAA1935 protein (KIAA1... 40 9.1
231ref|XM_087672.5| PREDICTED: Homo sapiens KIAA1935 protein (KIAA1... 40 9.1
232dbj|AK050735.1| Mus musculus 9 days embryo whole body cDNA, RIKE... 40 9.1
233dbj|AK034224.1| Mus musculus adult male diencephalon cDNA, RIKEN... 40 9.1
234dbj|AK017495.1| Mus musculus 8 days embryo whole body cDNA, RIKE... 40 9.1
235gb|AC018633.2|AC018633 Homo sapiens clone UWGC:djs1 or RP11-16G1... 40 9.1
236gb|AC138719.4| Mus musculus BAC clone RP23-178O8 from 10, comple... 40 9.1
237gb|AC140410.3| Mus musculus BAC clone RP23-141J11 from 10, compl... 40 9.1
238emb|AL772259.7| Mouse DNA sequence from clone RP23-408D7 on chro... 40 9.1

>gb|AF411228.1|AF411228 Hordeum vulgare ascorbate peroxidase mRNA, complete cds
          Length = 1138

 Score = 1140 bits (575), Expect = 0.0
 Identities = 575/575 (100%)
 Strand = Plus / Plus

                                                                       
Query: 2   cgacatcgccgtcaggctgctcgagcccatcaaggagcagttccccatcctctcctacgc 61
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 302 cgacatcgccgtcaggctgctcgagcccatcaaggagcagttccccatcctctcctacgc 361

                                                                       
Query: 62  cgacttctaccagctcgctggagtcgtcgccgtcgaggtgaccggcgggcctgaggttcc 121
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 362 cgacttctaccagctcgctggagtcgtcgccgtcgaggtgaccggcgggcctgaggttcc 421

                                                                       
Query: 122 cttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctgatgc 181
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 422 cttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctgatgc 481

                                                                       
Query: 182 cacccaaggctctgaccacctcaggcaggtgttttccactcagatgggtttgagtgacca 241
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 482 cacccaaggctctgaccacctcaggcaggtgttttccactcagatgggtttgagtgacca 541

                                                                       
Query: 242 ggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctgg 301
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 542 ggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctgg 601

                                                                       
Query: 302 gtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagct 361
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 602 gtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagct 661

                                                                       
Query: 362 cctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctgactga 421
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 662 cctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctgactga 721

                                                                       
Query: 422 cccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctttgctga 481
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 722 cccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctttgctga 781

                                                                       
Query: 482 ctacgccgaggcacacctcaagctctctgaacttggattcggcgaggcgtctgagggctg 541
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 782 ctacgccgaggcacacctcaagctctctgaacttggattcggcgaggcgtctgagggctg 841

                                              
Query: 542 ctgctgattcaagatcggcgcctgagggtcggtaa 576
           |||||||||||||||||||||||||||||||||||
Sbjct: 842 ctgctgattcaagatcggcgcctgagggtcggtaa 876



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 640 gcaataagaatctgtcgtcggccca 664
           |||||||||||||||||||||||||
Sbjct: 922 gcaataagaatctgtcgtcggccca 946



to top

>gb|BT009090.1| Triticum aestivum clone wkm2c.pk0002.f7:fis, full insert mRNA
           sequence
          Length = 973

 Score =  934 bits (471), Expect = 0.0
 Identities = 546/571 (95%)
 Strand = Plus / Plus

                                                                       
Query: 2   cgacatcgccgtcaggctgctcgagcccatcaaggagcagttccccatcctctcctacgc 61
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 119 cgacatcgccgtcaggctgctcgagcccatcaaggagcagttccccatcctctcctacgc 178

                                                                       
Query: 62  cgacttctaccagctcgctggagtcgtcgccgtcgaggtgaccggcgggcctgaggttcc 121
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 179 cgacttctaccagctcgctggagtcgtcgccgtcgaggtgaccggcgggcctgaggtccc 238

                                                                       
Query: 122 cttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctgatgc 181
           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 239 cttccacccggggagacaggacaagcccgagcctcctccagaaggccgtcttcctgatgc 298

                                                                       
Query: 182 cacccaaggctctgaccacctcaggcaggtgttttccactcagatgggtttgagtgacca 241
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 299 tacccaaggctctgaccacctcaggcaggtgttttccactcagatgggtttgagtgacca 358

                                                                       
Query: 242 ggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctgg 301
           |||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||
Sbjct: 359 ggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagaggtccgg 418

                                                                       
Query: 302 gtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagct 361
            ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 419 ctttgagggagcctggactgccaaccctttgatcttcgacaactcttacttcactgagct 478

                                                                       
Query: 362 cctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctgactga 421
           |||  |||||||||||||||| ||||||||||||||||||||||||  ||| ||||||||
Sbjct: 479 cctttgtggggagaaggaaggccttcttcagttgccgaccgacaagaccctcctgactga 538

                                                                       
Query: 422 cccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctttgctga 481
           |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 539 cccggccttccgcccacttgtggacaaatatgctgcggatgaggatgctttctttgctga 598

                                                                       
Query: 482 ctacgccgaggcacacctcaagctctctgaacttggattcggcgaggcgtctgagggctg 541
           |||||| ||||||||||||||||| || ||| | ||||| ||||||||   |||||||||
Sbjct: 599 ctacgctgaggcacacctcaagctatccgaattgggatttggcgaggctgttgagggctg 658

                                          
Query: 542 ctgctgattcaagatcggcgcctgagggtcg 572
           ||||||||||||| ||||||||||| |||||
Sbjct: 659 ctgctgattcaagctcggcgcctgaaggtcg 689



to top

>ref|XM_479627.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1110

 Score =  585 bits (295), Expect = e-164
 Identities = 463/519 (89%)
 Strand = Plus / Plus

                                                                       
Query: 2   cgacatcgccgtcaggctgctcgagcccatcaaggagcagttccccatcctctcctacgc 61
           |||||||||||||||||| ||||| ||||||||||| ||  | |||||||||||||||||
Sbjct: 301 cgacatcgccgtcaggcttctcgaccccatcaaggaccaacttcccatcctctcctacgc 360

                                                                       
Query: 62  cgacttctaccagctcgctggagtcgtcgccgtcgaggtgaccggcgggcctgaggttcc 121
           ||||||||||||||| ||||| || || ||||||||||| |||||||| |||||||| ||
Sbjct: 361 cgacttctaccagcttgctggcgttgtggccgtcgaggtcaccggcggacctgaggtccc 420

                                                                       
Query: 122 cttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctgatgc 181
           |||||| || || || ||||||||||| ||||||||||| ||||||||||||||||||||
Sbjct: 421 cttccatccgggcaggcaggacaagcctgagcctcctcctgaaggccgtcttcctgatgc 480

                                                                       
Query: 182 cacccaaggctctgaccacctcaggcaggtgttttccactcagatgggtttgagtgacca 241
           ||| ||||| ||||||||||| |||||||| |||||  | |||||||||||||||||| |
Sbjct: 481 cacacaaggttctgaccacctaaggcaggtcttttctgcgcagatgggtttgagtgacaa 540

                                                                       
Query: 242 ggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctgg 301
           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 541 ggacatagttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctgg 600

                                                                       
Query: 302 gtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagct 361
            |||||||||||||||||  |||||||||||||||| ||||||||||||||||| |||||
Sbjct: 601 ctttgagggagcctggacgtccaaccctttgatctttgacaactcttacttcaccgagct 660

                                                                       
Query: 362 cctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctgactga 421
             ||||||| ||||||||||| ||||||||| |||| |  ||||| | |||  || ||||
Sbjct: 661 tgtgagtggcgagaaggaaggccttcttcagctgccaagtgacaaagccctcatggctga 720

                                                                       
Query: 422 cccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctttgctga 481
           ||| |||||||| ||||| ||||| |||||||||||||||||||| || |||||||| ||
Sbjct: 721 cccagccttccgtccactggtggagaaatatgctgcggatgaggacgccttctttgcgga 780

                                                  
Query: 482 ctacgccgaggcacacctcaagctctctgaacttggatt 520
            ||||||||||| |||||||||||||||||||| |||||
Sbjct: 781 ttacgccgaggcccacctcaagctctctgaactgggatt 819



to top

>ref|XM_506596.1| PREDICTED Oryza sativa (japonica cultivar-group), P0627E10.12 mRNA
          Length = 1392

 Score =  585 bits (295), Expect = e-164
 Identities = 463/519 (89%)
 Strand = Plus / Plus

                                                                       
Query: 2   cgacatcgccgtcaggctgctcgagcccatcaaggagcagttccccatcctctcctacgc 61
           |||||||||||||||||| ||||| ||||||||||| ||  | |||||||||||||||||
Sbjct: 297 cgacatcgccgtcaggcttctcgaccccatcaaggaccaacttcccatcctctcctacgc 356

                                                                       
Query: 62  cgacttctaccagctcgctggagtcgtcgccgtcgaggtgaccggcgggcctgaggttcc 121
           ||||||||||||||| ||||| || || ||||||||||| |||||||| |||||||| ||
Sbjct: 357 cgacttctaccagcttgctggcgttgtggccgtcgaggtcaccggcggacctgaggtccc 416

                                                                       
Query: 122 cttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctgatgc 181
           |||||| || || || ||||||||||| ||||||||||| ||||||||||||||||||||
Sbjct: 417 cttccatccgggcaggcaggacaagcctgagcctcctcctgaaggccgtcttcctgatgc 476

                                                                       
Query: 182 cacccaaggctctgaccacctcaggcaggtgttttccactcagatgggtttgagtgacca 241
           ||| ||||| ||||||||||| |||||||| |||||  | |||||||||||||||||| |
Sbjct: 477 cacacaaggttctgaccacctaaggcaggtcttttctgcgcagatgggtttgagtgacaa 536

                                                                       
Query: 242 ggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctgg 301
           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 537 ggacatagttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctgg 596

                                                                       
Query: 302 gtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagct 361
            |||||||||||||||||  |||||||||||||||| ||||||||||||||||| |||||
Sbjct: 597 ctttgagggagcctggacgtccaaccctttgatctttgacaactcttacttcaccgagct 656

                                                                       
Query: 362 cctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctgactga 421
             ||||||| ||||||||||| ||||||||| |||| |  ||||| | |||  || ||||
Sbjct: 657 tgtgagtggcgagaaggaaggccttcttcagctgccaagtgacaaagccctcatggctga 716

                                                                       
Query: 422 cccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctttgctga 481
           ||| |||||||| ||||| ||||| |||||||||||||||||||| || |||||||| ||
Sbjct: 717 cccagccttccgtccactggtggagaaatatgctgcggatgaggacgccttctttgcgga 776

                                                  
Query: 482 ctacgccgaggcacacctcaagctctctgaacttggatt 520
            ||||||||||| |||||||||||||||||||| |||||
Sbjct: 777 ttacgccgaggcccacctcaagctctctgaactgggatt 815



to top

>dbj|AB053297.1| Oryza sativa (japonica cultivar-group) APXb mRNA for L-ascorbate
           peroxidase, complete cds
          Length = 1160

 Score =  585 bits (295), Expect = e-164
 Identities = 463/519 (89%)
 Strand = Plus / Plus

                                                                       
Query: 2   cgacatcgccgtcaggctgctcgagcccatcaaggagcagttccccatcctctcctacgc 61
           |||||||||||||||||| ||||| ||||||||||| ||  | |||||||||||||||||
Sbjct: 288 cgacatcgccgtcaggcttctcgaccccatcaaggaccaacttcccatcctctcctacgc 347

                                                                       
Query: 62  cgacttctaccagctcgctggagtcgtcgccgtcgaggtgaccggcgggcctgaggttcc 121
           ||||||||||||||| ||||| || || ||||||||||| |||||||| |||||||| ||
Sbjct: 348 cgacttctaccagcttgctggcgttgtggccgtcgaggtcaccggcggacctgaggtccc 407

                                                                       
Query: 122 cttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctgatgc 181
           |||||| || || || ||||||||||| ||||||||||| ||||||||||||||||||||
Sbjct: 408 cttccatccgggcaggcaggacaagcctgagcctcctcctgaaggccgtcttcctgatgc 467

                                                                       
Query: 182 cacccaaggctctgaccacctcaggcaggtgttttccactcagatgggtttgagtgacca 241
           ||| ||||| ||||||||||| |||||||| |||||  | |||||||||||||||||| |
Sbjct: 468 cacacaaggttctgaccacctaaggcaggtcttttctgcgcagatgggtttgagtgacaa 527

                                                                       
Query: 242 ggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctgg 301
           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 528 ggacatagttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctgg 587

                                                                       
Query: 302 gtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagct 361
            |||||||||||||||||  |||||||||||||||| ||||||||||||||||| |||||
Sbjct: 588 ctttgagggagcctggacgtccaaccctttgatctttgacaactcttacttcaccgagct 647

                                                                       
Query: 362 cctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctgactga 421
             ||||||| ||||||||||| ||||||||| |||| |  ||||| | |||  || ||||
Sbjct: 648 tgtgagtggcgagaaggaaggccttcttcagctgccaagtgacaaagccctcatggctga 707

                                                                       
Query: 422 cccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctttgctga 481
           ||| |||||||| ||||| ||||| |||||||||||||||||||| || |||||||| ||
Sbjct: 708 cccagccttccgtccactggtggagaaatatgctgcggatgaggacgccttctttgcgga 767

                                                  
Query: 482 ctacgccgaggcacacctcaagctctctgaacttggatt 520
            ||||||||||| |||||||||||||||||||| |||||
Sbjct: 768 ttacgccgaggcccacctcaagctctctgaactgggatt 806



to top

>dbj|AK061715.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-H06, full
           insert sequence
          Length = 1110

 Score =  585 bits (295), Expect = e-164
 Identities = 463/519 (89%)
 Strand = Plus / Plus

                                                                       
Query: 2   cgacatcgccgtcaggctgctcgagcccatcaaggagcagttccccatcctctcctacgc 61
           |||||||||||||||||| ||||| ||||||||||| ||  | |||||||||||||||||
Sbjct: 301 cgacatcgccgtcaggcttctcgaccccatcaaggaccaacttcccatcctctcctacgc 360

                                                                       
Query: 62  cgacttctaccagctcgctggagtcgtcgccgtcgaggtgaccggcgggcctgaggttcc 121
           ||||||||||||||| ||||| || || ||||||||||| |||||||| |||||||| ||
Sbjct: 361 cgacttctaccagcttgctggcgttgtggccgtcgaggtcaccggcggacctgaggtccc 420

                                                                       
Query: 122 cttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctgatgc 181
           |||||| || || || ||||||||||| ||||||||||| ||||||||||||||||||||
Sbjct: 421 cttccatccgggcaggcaggacaagcctgagcctcctcctgaaggccgtcttcctgatgc 480

                                                                       
Query: 182 cacccaaggctctgaccacctcaggcaggtgttttccactcagatgggtttgagtgacca 241
           ||| ||||| ||||||||||| |||||||| |||||  | |||||||||||||||||| |
Sbjct: 481 cacacaaggttctgaccacctaaggcaggtcttttctgcgcagatgggtttgagtgacaa 540

                                                                       
Query: 242 ggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctgg 301
           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 541 ggacatagttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctgg 600

                                                                       
Query: 302 gtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagct 361
            |||||||||||||||||  |||||||||||||||| ||||||||||||||||| |||||
Sbjct: 601 ctttgagggagcctggacgtccaaccctttgatctttgacaactcttacttcaccgagct 660

                                                                       
Query: 362 cctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctgactga 421
             ||||||| ||||||||||| ||||||||| |||| |  ||||| | |||  || ||||
Sbjct: 661 tgtgagtggcgagaaggaaggccttcttcagctgccaagtgacaaagccctcatggctga 720

                                                                       
Query: 422 cccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctttgctga 481
           ||| |||||||| ||||| ||||| |||||||||||||||||||| || |||||||| ||
Sbjct: 721 cccagccttccgtccactggtggagaaatatgctgcggatgaggacgccttctttgcgga 780

                                                  
Query: 482 ctacgccgaggcacacctcaagctctctgaacttggatt 520
            ||||||||||| |||||||||||||||||||| |||||
Sbjct: 781 ttacgccgaggcccacctcaagctctctgaactgggatt 819



to top

>dbj|AB050724.1| Oryza sativa (japonica cultivar-group) APXb mRNA for ascorbate
           peroxidase, complete cds
          Length = 1058

 Score =  585 bits (295), Expect = e-164
 Identities = 463/519 (89%)
 Strand = Plus / Plus

                                                                       
Query: 2   cgacatcgccgtcaggctgctcgagcccatcaaggagcagttccccatcctctcctacgc 61
           |||||||||||||||||| ||||| ||||||||||| ||  | |||||||||||||||||
Sbjct: 283 cgacatcgccgtcaggcttctcgaccccatcaaggaccaacttcccatcctctcctacgc 342

                                                                       
Query: 62  cgacttctaccagctcgctggagtcgtcgccgtcgaggtgaccggcgggcctgaggttcc 121
           ||||||||||||||| ||||| || || ||||||||||| |||||||| |||||||| ||
Sbjct: 343 cgacttctaccagcttgctggcgttgtggccgtcgaggtcaccggcggacctgaggtccc 402

                                                                       
Query: 122 cttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctgatgc 181
           |||||| || || || ||||||||||| ||||||||||| ||||||||||||||||||||
Sbjct: 403 cttccatccgggcaggcaggacaagcctgagcctcctcctgaaggccgtcttcctgatgc 462

                                                                       
Query: 182 cacccaaggctctgaccacctcaggcaggtgttttccactcagatgggtttgagtgacca 241
           ||| ||||| ||||||||||| |||||||| |||||  | |||||||||||||||||| |
Sbjct: 463 cacacaaggttctgaccacctaaggcaggtcttttctgcgcagatgggtttgagtgacaa 522

                                                                       
Query: 242 ggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctgg 301
           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 523 ggacatagttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctgg 582

                                                                       
Query: 302 gtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagct 361
            |||||||||||||||||  |||||||||||||||| ||||||||||||||||| |||||
Sbjct: 583 ctttgagggagcctggacgtccaaccctttgatctttgacaactcttacttcaccgagct 642

                                                                       
Query: 362 cctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctgactga 421
             ||||||| ||||||||||| ||||||||| |||| |  ||||| | |||  || ||||
Sbjct: 643 tgtgagtggcgagaaggaaggccttcttcagctgccaagtgacaaagccctcatggctga 702

                                                                       
Query: 422 cccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctttgctga 481
           ||| |||||||| ||||| ||||| |||||||||||||||||||| || |||||||| ||
Sbjct: 703 cccagccttccgtccactggtggagaaatatgctgcggatgaggacgccttctttgcgga 762

                                                  
Query: 482 ctacgccgaggcacacctcaagctctctgaacttggatt 520
            ||||||||||| |||||||||||||||||||| |||||
Sbjct: 763 ttacgccgaggcccacctcaagctctctgaactgggatt 801



to top

>dbj|AK102751.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033106K23, full
           insert sequence
          Length = 2215

 Score =  577 bits (291), Expect = e-161
 Identities = 462/519 (89%)
 Strand = Plus / Plus

                                                                       
Query: 2   cgacatcgccgtcaggctgctcgagcccatcaaggagcagttccccatcctctcctacgc 61
           |||||||||||||||||| ||||| ||||||||||| ||  | |||| ||||||||||||
Sbjct: 301 cgacatcgccgtcaggcttctcgaccccatcaaggaccaacttcccaccctctcctacgc 360

                                                                       
Query: 62  cgacttctaccagctcgctggagtcgtcgccgtcgaggtgaccggcgggcctgaggttcc 121
           ||||||||||||||| ||||| || || ||||||||||| |||||||| |||||||| ||
Sbjct: 361 cgacttctaccagcttgctggcgttgtggccgtcgaggtcaccggcggacctgaggtccc 420

                                                                       
Query: 122 cttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctgatgc 181
           |||||| || || || ||||||||||| ||||||||||| ||||||||||||||||||||
Sbjct: 421 cttccatccgggcaggcaggacaagcctgagcctcctcctgaaggccgtcttcctgatgc 480

                                                                       
Query: 182 cacccaaggctctgaccacctcaggcaggtgttttccactcagatgggtttgagtgacca 241
           ||| ||||| ||||||||||| |||||||| |||||  | |||||||||||||||||| |
Sbjct: 481 cacacaaggttctgaccacctaaggcaggtcttttctgcgcagatgggtttgagtgacaa 540

                                                                       
Query: 242 ggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctgg 301
           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 541 ggacatagttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctgg 600

                                                                       
Query: 302 gtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagct 361
            |||||||||||||||||  |||||||||||||||| ||||||||||||||||| |||||
Sbjct: 601 ctttgagggagcctggacgtccaaccctttgatctttgacaactcttacttcaccgagct 660

                                                                       
Query: 362 cctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctgactga 421
             ||||||| ||||||||||| ||||||||| |||| |  ||||| | |||  || ||||
Sbjct: 661 tgtgagtggcgagaaggaaggccttcttcagctgccaagtgacaaagccctcatggctga 720

                                                                       
Query: 422 cccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctttgctga 481
           ||| |||||||| ||||| ||||| |||||||||||||||||||| || |||||||| ||
Sbjct: 721 cccagccttccgtccactggtggagaaatatgctgcggatgaggacgccttctttgcgga 780

                                                  
Query: 482 ctacgccgaggcacacctcaagctctctgaacttggatt 520
            ||||||||||| |||||||||||||||||||| |||||
Sbjct: 781 ttacgccgaggcccacctcaagctctctgaactgggatt 819



to top

>dbj|AK068430.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013156P11, full
           insert sequence
          Length = 1393

 Score =  577 bits (291), Expect = e-161
 Identities = 462/519 (89%)
 Strand = Plus / Plus

                                                                       
Query: 2   cgacatcgccgtcaggctgctcgagcccatcaaggagcagttccccatcctctcctacgc 61
           |||||||||||||||||| ||||| ||||||||||| ||  | |||||||||||||||||
Sbjct: 297 cgacatcgccgtcaggcttctcgaccccatcaaggaccaacttcccatcctctcctacgc 356

                                                                       
Query: 62  cgacttctaccagctcgctggagtcgtcgccgtcgaggtgaccggcgggcctgaggttcc 121
           ||||||||||||||| ||||| || || ||||||||||| |||||||| |||||||| ||
Sbjct: 357 cgacttctaccagcttgctggcgttgtggccgtcgaggtcaccggcggacctgaggtccc 416

                                                                       
Query: 122 cttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctgatgc 181
           |||||| || || || ||||||||||| ||||||||||| ||||||||||||||||||||
Sbjct: 417 cttccatccgggcaggcaggacaagcctgagcctcctcctgaaggccgtcttcctgatgc 476

                                                                       
Query: 182 cacccaaggctctgaccacctcaggcaggtgttttccactcagatgggtttgagtgacca 241
           ||| ||||| ||||||||||| |||||||| |||||  | |||||||||||||||||| |
Sbjct: 477 cacacaaggttctgaccacctaaggcaggtcttttctgcgcagatgggtttgagtgacaa 536

                                                                       
Query: 242 ggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctgg 301
           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 537 ggacatagttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctgg 596

                                                                       
Query: 302 gtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagct 361
            |||||||||||||||||  ||| |||||||||||| ||||||||||||||||| |||||
Sbjct: 597 ctttgagggagcctggacgtccatccctttgatctttgacaactcttacttcaccgagct 656

                                                                       
Query: 362 cctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctgactga 421
             ||||||| ||||||||||| ||||||||| |||| |  ||||| | |||  || ||||
Sbjct: 657 tgtgagtggcgagaaggaaggccttcttcagctgccaagtgacaaagccctcatggctga 716

                                                                       
Query: 422 cccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctttgctga 481
           ||| |||||||| ||||| ||||| |||||||||||||||||||| || |||||||| ||
Sbjct: 717 cccagccttccgtccactggtggagaaatatgctgcggatgaggacgccttctttgcgga 776

                                                  
Query: 482 ctacgccgaggcacacctcaagctctctgaacttggatt 520
            ||||||||||| |||||||||||||||||||| |||||
Sbjct: 777 ttacgccgaggcccacctcaagctctctgaactgggatt 815



to top

>emb|Z34934.1|ZMAPXG Z.mays apx gene encoding cytosolic ascorbate peroxidase
          Length = 1042

 Score =  525 bits (265), Expect = e-146
 Identities = 436/493 (88%)
 Strand = Plus / Plus

                                                                       
Query: 13  tcaggctgctcgagcccatcaaggagcagttccccatcctctcctacgccgacttctacc 72
           |||||||||| ||||||||||||||||||||||||||||| |||||||| ||||||||||
Sbjct: 304 tcaggctgctagagcccatcaaggagcagttccccatcctatcctacgctgacttctacc 363

                                                                       
Query: 73  agctcgctggagtcgtcgccgtcgaggtgaccggcgggcctgaggttcccttccaccccg 132
           |||| ||||||||||| || |||||||| |||||||| ||||| || ||||||||||| |
Sbjct: 364 agcttgctggagtcgtggcagtcgaggtaaccggcggacctgatgtccccttccaccctg 423

                                                                       
Query: 133 ggagacaggacaagcccgagcctcctccagaaggccgtcttcctgatgccacccaaggct 192
           |||| ||||||||||| |||||||| || |||||||| |||||||||||||||||||| |
Sbjct: 424 ggaggcaggacaagcctgagcctccaccggaaggccgccttcctgatgccacccaaggtt 483

                                                                       
Query: 193 ctgaccacctcaggcaggtgttttccactcagatgggtttgagtgaccaggacattgttg 252
           |||| |||||||||||||| || ||||| |||||||||||||| ||||||||||||||||
Sbjct: 484 ctgatcacctcaggcaggttttctccacacagatgggtttgagcgaccaggacattgttg 543

                                                                       
Query: 253 ctctttctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggag 312
           | |||||||||||||||||||||||||||||||||||||| || ||||| ||||||||||
Sbjct: 544 cgctttctggtggtcacaccctgggaagatgccacaaggacaggtctggatttgagggag 603

                                                                       
Query: 313 cctggaccgccaaccctttgatcttcgacaactcttacttcactgagctcctgagtgggg 372
           |||||||  |||||||||||||||| ||||||||||||||||  ||||| ||||| || |
Sbjct: 604 cctggacgtccaaccctttgatctttgacaactcttacttcaaggagcttctgagcggag 663

                                                                       
Query: 373 agaaggaaggtcttcttcagttgccgaccgacaaggtcctgctgactgacccggccttcc 432
           |||||||||| ||||| ||| | || |  ||||| | ||| ||  |||| ||  ||||||
Sbjct: 664 agaaggaaggccttctgcagctaccaagtgacaaagccctcctctctgatccatccttcc 723

                                                                       
Query: 433 gcccacttgtggacaaatatgctgcggatgaggatgcgttctttgctgactacgccgagg 492
           |||||||||| |||||||| || ||||| ||||| || ||||||||||||||||||||||
Sbjct: 724 gcccacttgttgacaaatacgcagcggacgaggacgctttctttgctgactacgccgagg 783

                        
Query: 493 cacacctcaagct 505
           | ||||| |||||
Sbjct: 784 cccacctgaagct 796



to top

>gb|AY104492.1| Zea mays PCO104002 mRNA sequence
          Length = 1052

 Score =  525 bits (265), Expect = e-146
 Identities = 436/493 (88%)
 Strand = Plus / Plus

                                                                       
Query: 13  tcaggctgctcgagcccatcaaggagcagttccccatcctctcctacgccgacttctacc 72
           |||||||||| ||||||||||||||||||||||||||||| |||||||| ||||||||||
Sbjct: 318 tcaggctgctagagcccatcaaggagcagttccccatcctatcctacgctgacttctacc 377

                                                                       
Query: 73  agctcgctggagtcgtcgccgtcgaggtgaccggcgggcctgaggttcccttccaccccg 132
           |||| ||||||||||| || |||||||| |||||||| ||||| || ||||||||||| |
Sbjct: 378 agcttgctggagtcgtggcagtcgaggtaaccggcggacctgatgtccccttccaccctg 437

                                                                       
Query: 133 ggagacaggacaagcccgagcctcctccagaaggccgtcttcctgatgccacccaaggct 192
           |||| ||||||||||| |||||||| || |||||||| |||||||||||||||||||| |
Sbjct: 438 ggaggcaggacaagcctgagcctccaccggaaggccgccttcctgatgccacccaaggtt 497

                                                                       
Query: 193 ctgaccacctcaggcaggtgttttccactcagatgggtttgagtgaccaggacattgttg 252
           |||| |||||||||||||| || ||||| |||||||||||||| ||||||||||||||||
Sbjct: 498 ctgatcacctcaggcaggttttctccacacagatgggtttgagcgaccaggacattgttg 557

                                                                       
Query: 253 ctctttctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggag 312
           | |||||||||||||||||||||||||||||||||||||| || ||||| ||||||||||
Sbjct: 558 cgctttctggtggtcacaccctgggaagatgccacaaggacaggtctggatttgagggag 617

                                                                       
Query: 313 cctggaccgccaaccctttgatcttcgacaactcttacttcactgagctcctgagtgggg 372
           |||||||  |||||||||||||||| ||||||||||||||||  ||||| ||||| || |
Sbjct: 618 cctggacgtccaaccctttgatctttgacaactcttacttcaaggagcttctgagcggag 677

                                                                       
Query: 373 agaaggaaggtcttcttcagttgccgaccgacaaggtcctgctgactgacccggccttcc 432
           |||||||||| ||||| ||| | || |  ||||| | ||| ||  |||| ||  ||||||
Sbjct: 678 agaaggaaggccttctgcagctaccaagtgacaaagccctcctctctgatccatccttcc 737

                                                                       
Query: 433 gcccacttgtggacaaatatgctgcggatgaggatgcgttctttgctgactacgccgagg 492
           |||||||||| |||||||| || ||||| ||||| || ||||||||||||||||||||||
Sbjct: 738 gcccacttgttgacaaatacgcagcggacgaggacgctttctttgctgactacgccgagg 797

                        
Query: 493 cacacctcaagct 505
           | ||||| |||||
Sbjct: 798 cccacctgaagct 810



to top

>gb|BT019024.1| Zea mays clone Contig527.F mRNA sequence
          Length = 854

 Score =  486 bits (245), Expect = e-134
 Identities = 431/493 (87%)
 Strand = Plus / Plus

                                                                       
Query: 13  tcaggctgctcgagcccatcaaggagcagttccccatcctctcctacgccgacttctacc 72
           |||||||||| ||||||||||||||||| ||   | |||| |||||||| ||||||||||
Sbjct: 116 tcaggctgctagagcccatcaaggagcattttttcttcctatcctacgctgacttctacc 175

                                                                       
Query: 73  agctcgctggagtcgtcgccgtcgaggtgaccggcgggcctgaggttcccttccaccccg 132
           |||| ||||||||||| || |||||||| |||||||| ||||| || |||||||||||||
Sbjct: 176 agcttgctggagtcgtggcagtcgaggtaaccggcggacctgatgtccccttccaccccg 235

                                                                       
Query: 133 ggagacaggacaagcccgagcctcctccagaaggccgtcttcctgatgccacccaaggct 192
           |||| ||||||||||| |||||||| || |||||||| |||||||||||||||||||| |
Sbjct: 236 ggaggcaggacaagcctgagcctccaccggaaggccgccttcctgatgccacccaaggtt 295

                                                                       
Query: 193 ctgaccacctcaggcaggtgttttccactcagatgggtttgagtgaccaggacattgttg 252
           |||| |||||||||||||| || || || |||||||||||||| ||||||||||||||||
Sbjct: 296 ctgatcacctcaggcaggttttctcgacacagatgggtttgagcgaccaggacattgttg 355

                                                                       
Query: 253 ctctttctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggag 312
           | |||||||||||||||||||||||||||||||||||||| || ||||||||||||||||
Sbjct: 356 cgctttctggtggtcacaccctgggaagatgccacaaggacaggtctgggtttgagggag 415

                                                                       
Query: 313 cctggaccgccaaccctttgatcttcgacaactcttacttcactgagctcctgagtgggg 372
           |||||||  |||||||||||||||| ||||||||||||||||  ||||| ||||| || |
Sbjct: 416 cctggacgtccaaccctttgatctttgacaactcttacttcaaggagcttctgagcggag 475

                                                                       
Query: 373 agaaggaaggtcttcttcagttgccgaccgacaaggtcctgctgactgacccggccttcc 432
           |||| ||||| ||||| ||| | || |  ||||| | ||| ||  |||| ||  ||||||
Sbjct: 476 agaaagaaggccttctgcagctaccaagtgacaaagccctcctctctgatccatccttcc 535

                                                                       
Query: 433 gcccacttgtggacaaatatgctgcggatgaggatgcgttctttgctgactacgccgagg 492
           |||||||||| |||||||| || ||||| ||||| || ||||||||||||||||||||||
Sbjct: 536 gcccacttgttgacaaatacgcagcggacgaggacgctttctttgctgactacgccgagg 595

                        
Query: 493 cacacctcaagct 505
           | ||||| |||||
Sbjct: 596 cccacctgaagct 608



to top

>dbj|AK122175.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033148L03, full
           insert sequence
          Length = 2982

 Score =  422 bits (213), Expect = e-115
 Identities = 309/341 (90%)
 Strand = Plus / Plus

                                                                       
Query: 2   cgacatcgccgtcaggctgctcgagcccatcaaggagcagttccccatcctctcctacgc 61
           |||||||||||||||||| ||||| ||||||||||| ||  | |||||||||||||||||
Sbjct: 298 cgacatcgccgtcaggcttctcgaccccatcaaggaccaacttcccatcctctcctacgc 357

                                                                       
Query: 62  cgacttctaccagctcgctggagtcgtcgccgtcgaggtgaccggcgggcctgaggttcc 121
           ||||||||||||||| ||||| || || ||||||||||| |||||||| |||||||| ||
Sbjct: 358 cgacttctaccagcttgctggcgttgtggccgtcgaggtcaccggcggacctgaggtccc 417

                                                                       
Query: 122 cttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctgatgc 181
           |||||| || || || ||||||||||| ||||||||||| ||||||||||||||||||||
Sbjct: 418 cttccatccgggcaggcaggacaagcctgagcctcctcctgaaggccgtcttcctgatgc 477

                                                                       
Query: 182 cacccaaggctctgaccacctcaggcaggtgttttccactcagatgggtttgagtgacca 241
           ||| ||||| ||||||||||| |||||||| |||||  | |||||||||||||||||| |
Sbjct: 478 cacacaaggttctgaccacctaaggcaggtcttttctgcgcagatgggtttgagtgacaa 537

                                                                       
Query: 242 ggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctgg 301
           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 538 ggacatagttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctgg 597

                                                    
Query: 302 gtttgagggagcctggaccgccaaccctttgatcttcgaca 342
            |||||||||||||||||  |||||||||||||||| ||||
Sbjct: 598 ctttgagggagcctggacgtccaaccctttgatctttgaca 638



to top

>gb|BT016458.1| Zea mays clone Contig291 mRNA sequence
          Length = 1269

 Score =  373 bits (188), Expect = e-100
 Identities = 431/512 (84%)
 Strand = Plus / Plus

                                                                       
Query: 3   gacatcgccgtcaggctgctcgagcccatcaaggagcagttccccatcctctcctacgcc 62
           |||||||| ||  ||||||||||||||||||||||| ||||||||| ||||||||| |||
Sbjct: 314 gacatcgcggtgcggctgctcgagcccatcaaggaggagttccccaccctctcctatgcc 373

                                                                       
Query: 63  gacttctaccagctcgctggagtcgtcgccgtcgaggtgaccggcgggcctgaggttccc 122
           || ||||||||||| || ||||| || ||||||||||| ||||| ||||||||| | |||
Sbjct: 374 gatttctaccagcttgccggagttgtggccgtcgaggtcaccggtgggcctgagatcccc 433

                                                                       
Query: 123 ttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctgatgcc 182
           ||||||||||| ||  ||||||||||  |||| || || || ||||||||||||||||||
Sbjct: 434 ttccaccccggcagggaggacaagcctcagccgccacctgagggccgtcttcctgatgcc 493

                                                                       
Query: 183 acccaaggctctgaccacctcaggcaggtgttttccactcagatgggtttgagtgaccag 242
           ||| | || ||||||||||| ||||| || |||  ||  ||||||||||||||||| |||
Sbjct: 494 accaagggttctgaccacctgaggcaagtctttggcaagcagatgggtttgagtgatcag 553

                                                                       
Query: 243 gacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctggg 302
           ||||||||||| || |||||||| |||||| ||||||| |||||||| ||| | ||||| 
Sbjct: 554 gacattgttgccctctctggtggccacaccttgggaaggtgccacaaagagcggtctggt 613

                                                                       
Query: 303 tttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagctc 362
           |||||||| ||||||||  | ||||||||| |||| ||||||||||||||||  || || 
Sbjct: 614 tttgagggggcctggactacgaaccctttggtctttgacaactcttacttcaaggaactt 673

                                                                       
Query: 363 ctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctgactgac 422
           |||||||| || ||||| || ||||||||| | || |  ||||| | ||||||||  |||
Sbjct: 674 ctgagtggcgacaaggagggccttcttcagctcccaagtgacaaagccctgctgagcgac 733

                                                                       
Query: 423 ccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctttgctgac 482
           || | ||||||||| |||||||| ||||||||||| |||||| | || ||||||| ||||
Sbjct: 734 cctgtcttccgccctcttgtggagaaatatgctgcagatgagaaggcattctttgatgac 793

                                           
Query: 483 tacgccgaggcacacctcaagctctctgaact 514
           |||   ||||| |||||||||||||| |||||
Sbjct: 794 tacaaagaggcccacctcaagctctccgaact 825



to top

>gb|BT017015.1| Zea mays clone EK07D2311G04.c mRNA sequence
          Length = 1097

 Score =  311 bits (157), Expect = 2e-81
 Identities = 423/512 (82%)
 Strand = Plus / Plus

                                                                       
Query: 3   gacatcgccgtcaggctgctcgagcccatcaaggagcagttccccatcctctcctacgcc 62
           |||||||| ||  ||||||||||||||||||||||| ||||||| |||||||| ||||||
Sbjct: 298 gacatcgcggtgcggctgctcgagcccatcaaggaggagttcccaatcctctcttacgcc 357

                                                                       
Query: 63  gacttctaccagctcgctggagtcgtcgccgtcgaggtgaccggcgggcctgaggttccc 122
           || |||||||||||||| ||||| || ||||| ||||| ||||| ||||||||| |||||
Sbjct: 358 gatttctaccagctcgcgggagttgtggccgtggaggtcaccggtgggcctgagattccc 417

                                                                       
Query: 123 ttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctgatgcc 182
           ||||||||||| ||  ||||||||||  | || || || || ||||| |||||||| |||
Sbjct: 418 ttccaccccggtagggaggacaagcctcaacccccacctgagggccgccttcctgacgcc 477

                                                                       
Query: 183 acccaaggctctgaccacctcaggcaggtgttttccactcagatgggtttgagtgaccag 242
           ||  | || ||||||||||| ||||| || |||  ||  |||||||| ||||| || |||
Sbjct: 478 actaagggttctgaccacctgaggcaagtttttggcaagcagatgggcttgagcgatcag 537

                                                                       
Query: 243 gacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctggg 302
           ||||||||||| || |||||||| |||||| ||||||| |||||||| ||| | ||||| 
Sbjct: 538 gacattgttgccctctctggtggccacaccttgggaaggtgccacaaagagcggtctggt 597

                                                                       
Query: 303 tttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagctc 362
           || ||||| ||||||||  | ||||||||| |||| ||||||||||||||||  || || 
Sbjct: 598 ttcgagggggcctggactacaaaccctttggtctttgacaactcttacttcaaggaactt 657

                                                                       
Query: 363 ctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctgactgac 422
           |||||||| || ||||| || ||||||||| | || |  ||||| | |||| |||  |||
Sbjct: 658 ctgagtggtgataaggagggccttcttcagctcccaagtgacaaagccctgntgagcgac 717

                                                                       
Query: 423 ccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctttgctgac 482
           || |  |||||||| ||||| || |||||||||||||||||| | || ||||||| ||||
Sbjct: 718 cctgttttccgccctcttgtcgagaaatatgctgcggatgagaaggctttctttgatgac 777

                                           
Query: 483 tacgccgaggcacacctcaagctctctgaact 514
           |||   ||||| |||||||||||||| |||||
Sbjct: 778 tacaaagaggcccacctcaagctctccgaact 809



to top

>ref|XM_470658.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 753

 Score =  285 bits (144), Expect = 9e-74
 Identities = 408/496 (82%)
 Strand = Plus / Plus

                                                                       
Query: 19  tgctcgagcccatcaaggagcagttccccatcctctcctacgccgacttctaccagctcg 78
           |||||||||||||||||||| || | |||| | ||||||||||||| ||||||||||| |
Sbjct: 239 tgctcgagcccatcaaggaggagatacccaccatctcctacgccgatttctaccagcttg 298

                                                                       
Query: 79  ctggagtcgtcgccgtcgaggtgaccggcgggcctgaggttcccttccaccccgggagac 138
           | ||||| || |||||||||||| |||| || ||||  || ||||||||||| || ||  
Sbjct: 299 ccggagttgtggccgtcgaggtgtccggtggacctgccgtccccttccacccaggaaggg 358

                                                                       
Query: 139 aggacaagcccgagcctcctccagaaggccgtcttcctgatgccacccaaggctctgacc 198
           ||||||| || |  || || || || ||||||||||||||||| ||| | || |||||||
Sbjct: 359 aggacaaacctgcacccccacctgagggccgtcttcctgatgctaccaagggttctgacc 418

                                                                       
Query: 199 acctcaggcaggtgttttccactcagatgggtttgagtgaccaggacattgttgctcttt 258
           |||| |||||||| ||     | |||||||| |||||||| |||||||||||||| || |
Sbjct: 419 acctaaggcaggtcttcggtgcgcagatgggcttgagtgatcaggacattgttgccctct 478

                                                                       
Query: 259 ctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgga 318
           |||| ||||||||||||||||| ||||||||||| |||||||| ||||||||| | ||||
Sbjct: 479 ctggcggtcacaccctgggaaggtgccacaaggaaagatctggttttgagggaccttgga 538

                                                                       
Query: 319 ccgccaaccctttgatcttcgacaactcttacttcactgagctcctgagtggggagaagg 378
           |    |||||| ||   || ||||||||||||||||| ||||| |||||||| || ||||
Sbjct: 539 caagaaaccctctgcagtttgacaactcttacttcacggagcttctgagtggtgacaagg 598

                                                                       
Query: 379 aaggtcttcttcagttgccgaccgacaaggtcctgctgactgacccggccttccgcccac 438
           | || ||||||||| | || |  ||||| | |||||||| |||||| |||||||||||||
Sbjct: 599 agggccttcttcagcttcctagtgacaaagccctgctgagtgaccctgccttccgcccac 658

                                                                       
Query: 439 ttgtggacaaatatgctgcggatgaggatgcgttctttgctgactacgccgaggcacacc 498
           | || || ||||||||||| |||||| | || |||||||  ||||||   ||||| ||||
Sbjct: 659 tcgtcgagaaatatgctgcagatgagaaggctttctttgaagactacaaggaggcccacc 718

                           
Query: 499 tcaagctctctgaact 514
           |||||||||| |||||
Sbjct: 719 tcaagctctccgaact 734



to top

>emb|AJ006358.1|HVU6 Hordeum vulgare mRNA for ascorbate peroxidase
          Length = 1050

 Score =  285 bits (144), Expect = 9e-74
 Identities = 420/512 (82%)
 Strand = Plus / Plus

                                                                       
Query: 3   gacatcgccgtcaggctgctcgagcccatcaaggagcagttccccatcctctcctacgcc 62
           |||||||||||  || |||||||||||||||||||| || |||||| | |||||||||||
Sbjct: 296 gacatcgccgtgcggatgctcgagcccatcaaggaggagatccccaccatctcctacgcc 355

                                                                       
Query: 63  gacttctaccagctcgctggagtcgtcgccgtcgaggtgaccggcgggcctgaggttccc 122
           ||  |||||||||| || ||||| |||||||| |||||| |||| || || | | | |||
Sbjct: 356 gatctctaccagcttgcgggagttgtcgccgtggaggtgtccggtggacccgtgatcccc 415

                                                                       
Query: 123 ttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctgatgcc 182
           |||||||| |||||  ||||||||||  |||| || ||||| || || || |||||||| 
Sbjct: 416 ttccacccagggagggaggacaagcctcagcccccaccagagggtcgcctccctgatgct 475

                                                                       
Query: 183 acccaaggctctgaccacctcaggcaggtgttttccactcagatgggtttgagtgaccag 242
           ||| | || ||||||||||| ||||| || |||   |  |||||||| |||||||| |||
Sbjct: 476 accaagggttctgaccacctaaggcaagtctttgggaagcagatgggcttgagtgatcag 535

                                                                       
Query: 243 gacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctggg 302
           || |||||||| || ||||||||||||||||||||||| || ||||||||||| ||||| 
Sbjct: 536 gatattgttgccctctctggtggtcacaccctgggaaggtgtcacaaggagaggtctggc 595

                                                                       
Query: 303 tttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagctc 362
           ||||||||| |||||||    ||||||||||  || ||||||||||||||||| ||||| 
Sbjct: 596 tttgagggaccctggacaaggaaccctttgaagtttgacaactcttacttcacggagctt 655

                                                                       
Query: 363 ctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctgactgac 422
            ||||||| || || || || ||||||||| | || |  |||||    ||||||||||||
Sbjct: 656 ttgagtggtgacaaagagggacttcttcagcttccaagtgacaaaactctgctgactgac 715

                                                                       
Query: 423 ccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctttgctgac 482
           || | ||||||||| |||||||| |||||||||||||||||| | || ||||| |  |||
Sbjct: 716 cctgtcttccgccctcttgtggagaaatatgctgcggatgagaaggctttcttcgaggac 775

                                           
Query: 483 tacgccgaggcacacctcaagctctctgaact 514
           |||   ||||||||||||| |||||| |||||
Sbjct: 776 tacaaggaggcacacctcaggctctccgaact 807



to top

>gb|AY254495.1| Oryza sativa (indica cultivar-group) ascorbate peroxidase mRNA,
           complete cds
          Length = 806

 Score =  285 bits (144), Expect = 9e-74
 Identities = 408/496 (82%)
 Strand = Plus / Plus

                                                                       
Query: 19  tgctcgagcccatcaaggagcagttccccatcctctcctacgccgacttctaccagctcg 78
           |||||||||||||||||||| || | |||| | ||||||||||||| ||||||||||| |
Sbjct: 252 tgctcgagcccatcaaggaggagatacccaccatctcctacgccgatttctaccagcttg 311

                                                                       
Query: 79  ctggagtcgtcgccgtcgaggtgaccggcgggcctgaggttcccttccaccccgggagac 138
           | ||||| || |||||||||||| |||| || ||||  || ||||||||||| || ||  
Sbjct: 312 ccggagttgtggccgtcgaggtgtccggtggacctgccgtccccttccacccaggaaggg 371

                                                                       
Query: 139 aggacaagcccgagcctcctccagaaggccgtcttcctgatgccacccaaggctctgacc 198
           ||||||| || |  || || || || ||||||||||||||||| ||| | || |||||||
Sbjct: 372 aggacaaacctgcacccccacctgagggccgtcttcctgatgctaccaagggttctgacc 431

                                                                       
Query: 199 acctcaggcaggtgttttccactcagatgggtttgagtgaccaggacattgttgctcttt 258
           |||| |||||||| ||     |||||||||| |||||||| |||||||||||||| || |
Sbjct: 432 acctaaggcaggtcttcggtgctcagatgggcttgagtgatcaggacattgttgccctct 491

                                                                       
Query: 259 ctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgga 318
           |||| ||||||||||||||||| ||||||||||| |||||||| ||||||||| | ||||
Sbjct: 492 ctggcggtcacaccctgggaaggtgccacaaggaaagatctggttttgagggaccttgga 551

                                                                       
Query: 319 ccgccaaccctttgatcttcgacaactcttacttcactgagctcctgagtggggagaagg 378
           |    |||||| ||   || ||||||||||||||||| ||||| |||||||| || ||||
Sbjct: 552 caagaaaccctctgcagtttgacaactcttacttcacggagcttctgagtggtgacaagg 611

                                                                       
Query: 379 aaggtcttcttcagttgccgaccgacaaggtcctgctgactgacccggccttccgcccac 438
           | || ||||||||| | || |  ||||| |  ||||||| |||||| |||||||||||||
Sbjct: 612 agggccttcttcagcttcctagtgacaaagcactgctgagtgaccctgccttccgcccac 671

                                                                       
Query: 439 ttgtggacaaatatgctgcggatgaggatgcgttctttgctgactacgccgaggcacacc 498
           | || || ||||||||||| |||||| | || |||||||  ||||||   ||||| ||||
Sbjct: 672 tcgtcgagaaatatgctgcagatgagaaggctttctttgaagactacaaggaggcccacc 731

                           
Query: 499 tcaagctctctgaact 514
           |||||||||| |||||
Sbjct: 732 tcaagctctccgaact 747



to top

>dbj|AK061841.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-E04, full
           insert sequence
          Length = 1070

 Score =  285 bits (144), Expect = 9e-74
 Identities = 408/496 (82%)
 Strand = Plus / Plus

                                                                       
Query: 19  tgctcgagcccatcaaggagcagttccccatcctctcctacgccgacttctaccagctcg 78
           |||||||||||||||||||| || | |||| | ||||||||||||| ||||||||||| |
Sbjct: 304 tgctcgagcccatcaaggaggagatacccaccatctcctacgccgatttctaccagcttg 363

                                                                       
Query: 79  ctggagtcgtcgccgtcgaggtgaccggcgggcctgaggttcccttccaccccgggagac 138
           | ||||| || |||||||||||| |||| || ||||  || ||||||||||| || ||  
Sbjct: 364 ccggagttgtggccgtcgaggtgtccggtggacctgccgtccccttccacccaggaaggg 423

                                                                       
Query: 139 aggacaagcccgagcctcctccagaaggccgtcttcctgatgccacccaaggctctgacc 198
           ||||||| || |  || || || || ||||||||||||||||| ||| | || |||||||
Sbjct: 424 aggacaaacctgcacccccacctgagggccgtcttcctgatgctaccaagggttctgacc 483

                                                                       
Query: 199 acctcaggcaggtgttttccactcagatgggtttgagtgaccaggacattgttgctcttt 258
           |||| |||||||| ||     | |||||||| |||||||| |||||||||||||| || |
Sbjct: 484 acctaaggcaggtcttcggtgcgcagatgggcttgagtgatcaggacattgttgccctct 543

                                                                       
Query: 259 ctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgga 318
           |||| ||||||||||||||||| ||||||||||| |||||||| ||||||||| | ||||
Sbjct: 544 ctggcggtcacaccctgggaaggtgccacaaggaaagatctggttttgagggaccttgga 603

                                                                       
Query: 319 ccgccaaccctttgatcttcgacaactcttacttcactgagctcctgagtggggagaagg 378
           |    |||||| ||   || ||||||||||||||||| ||||| |||||||| || ||||
Sbjct: 604 caagaaaccctctgcagtttgacaactcttacttcacggagcttctgagtggtgacaagg 663

                                                                       
Query: 379 aaggtcttcttcagttgccgaccgacaaggtcctgctgactgacccggccttccgcccac 438
           | || ||||||||| | || |  ||||| | |||||||| |||||| |||||||||||||
Sbjct: 664 agggccttcttcagcttcctagtgacaaagccctgctgagtgaccctgccttccgcccac 723

                                                                       
Query: 439 ttgtggacaaatatgctgcggatgaggatgcgttctttgctgactacgccgaggcacacc 498
           | || || ||||||||||| |||||| | || |||||||  ||||||   ||||| ||||
Sbjct: 724 tcgtcgagaaatatgctgcagatgagaaggctttctttgaagactacaaggaggcccacc 783

                           
Query: 499 tcaagctctctgaact 514
           |||||||||| |||||
Sbjct: 784 tcaagctctccgaact 799



to top

>dbj|D45423.1| Rice mRNA for ascorbate peroxidase, complete cds
          Length = 983

 Score =  285 bits (144), Expect = 9e-74
 Identities = 408/496 (82%)
 Strand = Plus / Plus

                                                                       
Query: 19  tgctcgagcccatcaaggagcagttccccatcctctcctacgccgacttctaccagctcg 78
           |||||||||||||||||||| || | |||| | ||||||||||||| ||||||||||| |
Sbjct: 278 tgctcgagcccatcaaggaggagatacccaccatctcctacgccgatttctaccagcttg 337

                                                                       
Query: 79  ctggagtcgtcgccgtcgaggtgaccggcgggcctgaggttcccttccaccccgggagac 138
           | ||||| || |||||||||||| |||| || ||||  || ||||||||||| || ||  
Sbjct: 338 ccggagttgtggccgtcgaggtgtccggtggacctgccgtccccttccacccaggaaggg 397

                                                                       
Query: 139 aggacaagcccgagcctcctccagaaggccgtcttcctgatgccacccaaggctctgacc 198
           ||||||| || |  || || || || ||||||||||||||||| ||| | || |||||||
Sbjct: 398 aggacaaacctgcacccccacctgagggccgtcttcctgatgctaccaagggttctgacc 457

                                                                       
Query: 199 acctcaggcaggtgttttccactcagatgggtttgagtgaccaggacattgttgctcttt 258
           |||| |||||||| ||     | |||||||| |||||||| |||||||||||||| || |
Sbjct: 458 acctaaggcaggtcttcggtgcgcagatgggcttgagtgatcaggacattgttgccctct 517

                                                                       
Query: 259 ctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgga 318
           |||| ||||||||||||||||| ||||||||||| |||||||| ||||||||| | ||||
Sbjct: 518 ctggcggtcacaccctgggaaggtgccacaaggaaagatctggttttgagggaccttgga 577

                                                                       
Query: 319 ccgccaaccctttgatcttcgacaactcttacttcactgagctcctgagtggggagaagg 378
           |    |||||| ||   || ||||||||||||||||| ||||| |||||||| || ||||
Sbjct: 578 caagaaaccctctgcagtttgacaactcttacttcacggagcttctgagtggtgacaagg 637

                                                                       
Query: 379 aaggtcttcttcagttgccgaccgacaaggtcctgctgactgacccggccttccgcccac 438
           | || ||||||||| | || |  ||||| | |||||||| |||||| |||||||||||||
Sbjct: 638 agggccttcttcagcttcctagtgacaaagccctgctgagtgaccctgccttccgcccac 697

                                                                       
Query: 439 ttgtggacaaatatgctgcggatgaggatgcgttctttgctgactacgccgaggcacacc 498
           | || || ||||||||||| |||||| | || |||||||  ||||||   ||||| ||||
Sbjct: 698 tcgtcgagaaatatgctgcagatgagaaggctttctttgaagactacaaggaggcccacc 757

                           
Query: 499 tcaagctctctgaact 514
           |||||||||| |||||
Sbjct: 758 tcaagctctccgaact 773



to top

>gb|AF411227.1|AF411227 Hordeum vulgare ascorbate peroxidase mRNA, partial cds
          Length = 676

 Score =  202 bits (102), Expect = 1e-48
 Identities = 351/434 (80%)
 Strand = Plus / Plus

                                                                       
Query: 81  ggagtcgtcgccgtcgaggtgaccggcgggcctgaggttcccttccaccccgggagacag 140
           ||||| |||||||| |||||| |||| || || | | | ||||||||||| |||||  ||
Sbjct: 11  ggagttgtcgccgtggaggtgtccggtggacccgtgatccccttccacccagggagggag 70

                                                                       
Query: 141 gacaagcccgagcctcctccagaaggccgtcttcctgatgccacccaaggctctgaccac 200
           ||||||||  |||| || ||||| || || || |||||||| ||| | || |||||||||
Sbjct: 71  gacaagcctcagcccccaccagagggtcgcctccctgatgctaccaagggttctgaccac 130

                                                                       
Query: 201 ctcaggcaggtgttttccactcagatgggtttgagtgaccaggacattgttgctctttct 260
           || ||||| || |||   |  |||||||| |||||||| ||||| |||||||| || |||
Sbjct: 131 ctaaggcaagtctttgggaagcagatgggcttgagtgatcaggatattgttgccctctct 190

                                                                       
Query: 261 ggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctggacc 320
           |||||||||||||||||||| || ||||||||||| ||||| ||||||||| ||||||| 
Sbjct: 191 ggtggtcacaccctgggaaggtgtcacaaggagaggtctggctttgagggaccctggaca 250

                                                                       
Query: 321 gccaaccctttgatcttcgacaactcttacttcactgagctcctgagtggggagaaggaa 380
              ||||||||||  || ||||||||||||||||| |||||  ||||||| || ||  | 
Sbjct: 251 aggaaccctttgaagtttgacaactcttacttcacggagcttttgagtggtgacaaaaag 310

                                                                       
Query: 381 ggtcttcttcagttgccgaccgacaaggtcctgctgactgacccggccttccgcccactt 440
           || ||||||||| | || |  |||||    |||||||||||||| | ||||||||| |||
Sbjct: 311 ggacttcttcagcttccaagtgacaaaactctgctgactgaccctgtcttccgccctctt 370

                                                                       
Query: 441 gtggacaaatatgctgcggatgaggatgcgttctttgctgactacgccgaggcacacctc 500
           ||||| |||||||||||||||||| | || || || |  ||||||   ||||||||||||
Sbjct: 371 gtggagaaatatgctgcggatgagaaggcttttttcgaggactacaaggaggcacacctc 430

                         
Query: 501 aagctctctgaact 514
           | |||||| |||||
Sbjct: 431 aggctctccgaact 444



to top

>gb|AY462246.1| Rehmannia glutinosa ascorbate peroxidase (APX) mRNA, complete cds
          Length = 1122

 Score =  188 bits (95), Expect = 2e-44
 Identities = 389/487 (79%)
 Strand = Plus / Plus

                                                                       
Query: 25  agcccatcaaggagcagttccccatcctctcctacgccgacttctaccagctcgctggag 84
           |||| |||| |||||| ||||| ||||| ||  | || |||||||| ||| | || ||||
Sbjct: 376 agccaatcagggagcaattccctatcctttctcatgctgacttctatcagttggccggag 435

                                                                       
Query: 85  tcgtcgccgtcgaggtgaccggcgggcctgaggttcccttccaccccgggagacaggaca 144
           | ||||| || || || ||||| || ||||| ||||| |||||||| || |||| |||||
Sbjct: 436 ttgtcgctgttgaagttaccggaggacctgaagttccattccacccaggaagaccggaca 495

                                                                       
Query: 145 agcccgagcctcctccagaaggccgtcttcctgatgccacccaaggctctgaccacctca 204
           ||   ||||| ||    ||||| ||  | |||||||| ||| | || ||||||||||| |
Sbjct: 496 aggaggagccaccagttgaaggtcgcttgcctgatgctaccaaggggtctgaccacctga 555

                                                                       
Query: 205 ggcaggtgttttccactcagatgggtttgagtgaccaggacattgttgctctttctggtg 264
           || | |||||| |||  || ||||||||||||||||||||||| ||||| || |||||||
Sbjct: 556 gggatgtgtttaccaaacaaatgggtttgagtgaccaggacatcgttgcactctctggtg 615

                                                                       
Query: 265 gtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctggaccgcca 324
             ||||| ||||||||||||||||||||  | || |||||||||||| | ||||| || |
Sbjct: 616 cccacactctgggaagatgccacaaggaacgttccgggtttgagggaccatggactgcaa 675

                                                                       
Query: 325 accctttgatcttcgacaactcttacttcactgagctcctgagtggggagaaggaaggtc 384
           ||||| | ||||||||||| |||||||| |  ||||| |||||||| || || ||||| |
Sbjct: 676 accctctcatcttcgacaattcttactttaaggagcttctgagtggagaaaaagaagggc 735

                                                                       
Query: 385 ttcttcagttgccgaccgacaaggtcctgctgactgacccggccttccgcccacttgtgg 444
           || | ||||||||  | ||||| |  || ||  | |||||  | |||||||||||||| |
Sbjct: 736 ttttgcagttgccatcagacaaagctcttcttgccgacccttcattccgcccacttgttg 795

                                                                       
Query: 445 acaaatatgctgcggatgaggatgcgttctttgctgactacgccgaggcacacctcaagc 504
           | |||||||||||||| |||||||| ||||||||||| || || ||||| ||| | ||||
Sbjct: 796 agaaatatgctgcggacgaggatgccttctttgctgattatgcagaggctcacttgaagc 855

                  
Query: 505 tctctga 511
           |||||||
Sbjct: 856 tctctga 862



to top

>dbj|AB078599.1| Brassica oleracea BO-APX 1 mRNA for ascorbate peroxidase, complete
           cds
          Length = 753

 Score =  184 bits (93), Expect = 2e-43
 Identities = 300/369 (81%)
 Strand = Plus / Plus

                                                                       
Query: 24  gagcccatcaaggagcagttccccatcctctcctacgccgacttctaccagctcgctgga 83
           |||||||||| |||||||||||| | | ||||| | || || ||| | ||||| ||||| 
Sbjct: 244 gagcccatcagggagcagttccctaccatctcccatgctgatttccatcagcttgctggt 303

                                                                       
Query: 84  gtcgtcgccgtcgaggtgaccggcgggcctgaggttcccttccaccccgggagacaggac 143
           || || || || || || || || || |||||| |||| |||||||| || ||| |||||
Sbjct: 304 gttgtggctgttgaagtcactggtggacctgagattcctttccaccctggaagagaggac 363

                                                                       
Query: 144 aagcccgagcctcctccagaaggccgtcttcctgatgccacccaaggctctgaccacctc 203
           |||||| |||| |||||||| || ||||| |||||||| ||  | ||||  |||||| | 
Sbjct: 364 aagccccagccacctccagagggtcgtctccctgatgctacaaagggctgcgaccacttg 423

                                                                       
Query: 204 aggcaggtgttttccactcagatgggtttgagtgaccaggacattgttgctctttctggt 263
           |||||||| || |  |  ||||||||||| | ||||||||||||||| ||||| ||||||
Sbjct: 424 aggcaggtcttcttaaagcagatgggtttaactgaccaggacattgtcgctctgtctggt 483

                                                                       
Query: 264 ggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctggaccgcc 323
           |  ||||| |||||||||||||||||||| || ||||| || || || ||||||||  | 
Sbjct: 484 gcccacactctgggaagatgccacaaggataggtctggcttcgaaggtgcctggacttca 543

                                                                       
Query: 324 aaccctttgatcttcgacaactcttacttcactgagctcctgagtggggagaaggaaggt 383
           |||||| | ||||||||||||||||||||||  || ||| |||| |||||||||||||||
Sbjct: 544 aaccctcttatcttcgacaactcttacttcaaggaactcttgagcggggagaaggaaggt 603

                    
Query: 384 cttcttcag 392
           ||| |||||
Sbjct: 604 ctttttcag 612



to top

>emb|AJ279686.1|BPE279686 Betula pendula partial mRNA for ascorbate peroxidase (apx gene)
          Length = 289

 Score =  182 bits (92), Expect = 1e-42
 Identities = 206/244 (84%)
 Strand = Plus / Plus

                                                                       
Query: 234 agtgaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggag 293
           |||||||||||||||||||||||||||||||  |||||||||||||| ||||||||||||
Sbjct: 44  agtgaccaggacattgttgctctttctggtgcacacaccctgggaaggtgccacaaggag 103

                                                                       
Query: 294 agatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttc 353
            | ||||| ||||||||| |||||||  |||||||| | ||||| | |||| | ||||||
Sbjct: 104 cgttctggctttgagggaccctggacttccaaccctctcatctttggcaacacgtacttc 163

                                                                       
Query: 354 actgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctg 413
           || || ||| ||||||| ||||||||||| ||||| ||| ||||  | |||||||  |  
Sbjct: 164 acggaactcttgagtggtgagaaggaaggacttctgcagctgccatctgacaaggcacct 223

                                                                       
Query: 414 ctgactgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttc 473
           ||| ||||| | || |||||||| ||||| ||||||||||| || ||||||||||| |||
Sbjct: 224 ctgtctgacgcagcattccgccctcttgttgacaaatatgccgctgatgaggatgccttc 283

               
Query: 474 tttg 477
           ||||
Sbjct: 284 tttg 287



to top

>gb|AY823545.1| Pennisetum glaucum ascorbate peroxidase (Apx) mRNA, complete cds
          Length = 680

 Score =  176 bits (89), Expect = 6e-41
 Identities = 276/337 (81%), Gaps = 1/337 (0%)
 Strand = Plus / Plus

                                                                       
Query: 19  tgctcgagcccatcaaggagcagttccccatcctctcctacgccgacttctaccagctcg 78
           ||||||||||| |||||||| |||||||||||||||| ||||||||  | |||||||| |
Sbjct: 326 tgctcgagcccgtcaaggaggagttccccatcctctcgtacgccgatctgtaccagcttg 385

                                                                       
Query: 79  ctggagtcgtcgccgtcgaggtgaccggcgggcctgaggttcccttccaccccgggagac 138
           | ||||| || ||||| ||||| || || || |||||| | |||||||||||||| ||  
Sbjct: 386 cgggagttgtggccgtggaggttactggtggacctgagatccccttccaccccggtaggg 445

                                                                       
Query: 139 aggacaagcccgagcctcctccagaaggccgtcttcctgatgccacccaaggctctgacc 198
           ||||||||||  |||| || || || || || ||||||||||| ||  | || |||||||
Sbjct: 446 aggacaagcctcagccaccacctgagggtcgccttcctgatgctactaagggttctgacc 505

                                                                       
Query: 199 acctcaggcaggtgttttccactcagatgggtttgagtgaccaggacattgttgctcttt 258
           | || ||||| || |||  ||  |||||||| |||||||| |||||||||||||| || |
Sbjct: 506 atctgaggcaagtctttggcaagcagatgggcttgagtgatcaggacattgttgccctct 565

                                                                       
Query: 259 ctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgga 318
           ||||||| |||||| ||||||| || ||||||||| | ||||| ||||||||  ||||||
Sbjct: 566 ctggtggccacaccttgggaaggtgtcacaaggagcggtctggttttgaggggccctgga 625

                                                
Query: 319 ccgccaaccctttgatc-ttcgacaactcttacttca 354
           |    ||||||||| || || ||||||||||||||||
Sbjct: 626 ctagaaaccctttggtcttttgacaactcttacttca 662



to top

>gb|AY078080.1| Capsicum annuum putative ascorbate peroxidase mRNA, complete cds
          Length = 972

 Score =  172 bits (87), Expect = 9e-40
 Identities = 396/499 (79%)
 Strand = Plus / Plus

                                                                       
Query: 24  gagcccatcaaggagcagttccccatcctctcctacgccgacttctaccagctcgctgga 83
           |||||||| | ||||||||| |||||||||||||| || || ||||| ||  | ||||| 
Sbjct: 266 gagcccattagggagcagtttcccatcctctcctatgctgatttctatcaattggctggt 325

                                                                       
Query: 84  gtcgtcgccgtcgaggtgaccggcgggcctgaggttcccttccaccccgggagacaggac 143
           || || || || |||||||| || || ||||| |||||||| |||||||| ||| |||||
Sbjct: 326 gttgttgctgttgaggtgactggaggacctgatgttccctttcaccccggcagagaggac 385

                                                                       
Query: 144 aagcccgagcctcctccagaaggccgtcttcctgatgccacccaaggctctgaccacctc 203
           ||||| ||||| |||   ||||| ||  | |||||||| ||| | |||||||||||| | 
Sbjct: 386 aagccagagccacctgttgaaggtcgcttgcctgatgcaaccaagggctctgaccacttg 445

                                                                       
Query: 204 aggcaggtgttttccactcagatgggtttgagtgaccaggacattgttgctctttctggt 263
           ||| | |||||    |  || |||||| |   ||| ||||| |||||||| || ||||||
Sbjct: 446 agggacgtgttcgtgaaacaaatgggtctttctgatcaggatattgttgcactctctggt 505

                                                                       
Query: 264 ggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctggaccgcc 323
           || || ||| |||||||||||||||||||| | ||||| ||||||||| | |||||||||
Sbjct: 506 ggccataccttgggaagatgccacaaggagcgttctggttttgagggaccttggaccgcc 565

                                                                       
Query: 324 aaccctttgatcttcgacaactcttacttcactgagctcctgagtggggagaaggaaggt 383
           || ||  | || || |||||||| |||||||  || ||  || ||||||| || ||||||
Sbjct: 566 aatcccctcatttttgacaactcatacttcaaggaactattgggtggggaaaaagaaggt 625

                                                                       
Query: 384 cttcttcagttgccgaccgacaaggtcctgctgactgacccggccttccgcccacttgtg 443
           ||| | ||||||||  | |||||||  || ||  |||| || || ||||| || ||||| 
Sbjct: 626 cttttacagttgccctcagacaaggctctcctctctgatcctgctttccgtccccttgtt 685

                                                                       
Query: 444 gacaaatatgctgcggatgaggatgcgttctttgctgactacgccgaggcacacctcaag 503
           || ||||||||||| ||||| ||||| |||||||||||||| || ||||| ||| | |||
Sbjct: 686 gagaaatatgctgcagatgaagatgccttctttgctgactatgctgaggctcacttgaag 745

                              
Query: 504 ctctctgaacttggattcg 522
           ||||||||| | |||||||
Sbjct: 746 ctctctgaattgggattcg 764



to top

>gb|DQ442272.1| Camellia sinensis ascorbate peroxidase mRNA, complete cds
          Length = 1042

 Score =  172 bits (87), Expect = 9e-40
 Identities = 231/279 (82%)
 Strand = Plus / Plus

                                                                       
Query: 236 tgaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagag 295
           |||| |||||||||||||||| |||||||| || ||||||||||| |||||||||||| |
Sbjct: 515 tgacaaggacattgttgctctatctggtggccataccctgggaaggtgccacaaggagcg 574

                                                                       
Query: 296 atctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcac 355
            ||||| ||||||||  ||||||| ||||| ||  | ||||| || ||||| ||||||||
Sbjct: 575 ttctggatttgaggggccctggactgccaatccactcatctttgataactcctacttcac 634

                                                                       
Query: 356 tgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgct 415
            || ||||||| ||||||||||||||| ||||| ||  ||||  | | |||||  || ||
Sbjct: 635 ggaactcctgactggggagaaggaagggcttctacaactgccatctggcaaggctctcct 694

                                                                       
Query: 416 gactgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctt 475
            | ||| || | ||||||||| ||||| || ||||||||||||||||||||||| |||||
Sbjct: 695 caatgatcctgtcttccgccctcttgttgagaaatatgctgcggatgaggatgcattctt 754

                                                  
Query: 476 tgctgactacgccgaggcacacctcaagctctctgaact 514
           ||| || || ||||| || ||| | ||||||||||||||
Sbjct: 755 tgcagattatgccgaagcccacatgaagctctctgaact 793



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 139/173 (80%)
 Strand = Plus / Plus

                                                                       
Query: 9   gccgtcaggctgctcgagcccatcaaggagcagttccccatcctctcctacgccgacttc 68
           ||||||||||| || ||||| ||||||||||||||||| ||| |||| || || ||||||
Sbjct: 288 gccgtcaggctactagagcctatcaaggagcagttcccgatcatctcttatgctgacttc 347

                                                                       
Query: 69  taccagctcgctggagtcgtcgccgtcgaggtgaccggcgggcctgaggttcccttccac 128
           || ||| | ||||| || || ||||| ||  | || || || ||||| ||||| ||||| 
Sbjct: 348 tatcagttggctggtgttgttgccgttgaaattactgggggacctgatgttccattccat 407

                                                                
Query: 129 cccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctgatgc 181
           || |||||  |||| ||||| ||||| |||   |||||||| |||||||||||
Sbjct: 408 ccagggagggaggataagcctgagccacctgttgaaggccgccttcctgatgc 460



to top

>emb|X78452.1|RSAPX R.sativus (Fakir) APX mRNA for L-ascorbate peroxidase
          Length = 753

 Score =  170 bits (86), Expect = 4e-39
 Identities = 305/378 (80%)
 Strand = Plus / Plus

                                                                       
Query: 15  aggctgctcgagcccatcaaggagcagttccccatcctctcctacgccgacttctaccag 74
           |||||| | ||||| |||| |||||||||||| | | ||||| | || || ||| | |||
Sbjct: 235 aggctgttggagcctatcagggagcagttccctaccatctcccatgctgatttccatcag 294

                                                                       
Query: 75  ctcgctggagtcgtcgccgtcgaggtgaccggcgggcctgaggttcccttccaccccggg 134
           || ||||| || || ||||| || || || || || |||||  |||| |||||||| || 
Sbjct: 295 cttgctggtgttgtggccgttgaagtcactggtggacctgaaattcctttccaccctgga 354

                                                                       
Query: 135 agacaggacaagcccgagcctcctccagaaggccgtcttcctgatgccacccaaggctct 194
           ||| ||||||||||| |||| |||||||| || |||||||||||||||||| | | || |
Sbjct: 355 agagaggacaagccccagccacctccagagggtcgtcttcctgatgccaccaaggcctgt 414

                                                                       
Query: 195 gaccacctcaggcaggtgttttccactcagatgggtttgagtgaccaggacattgttgct 254
           |||||  | |||||||| || |  |  ||||||||||| | |||||||||||| || |||
Sbjct: 415 gaccatttgaggcaggtcttcttaaagcagatgggtttaactgaccaggacatcgtcgct 474

                                                                       
Query: 255 ctttctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcc 314
            | |||||||  ||||| |||||||||||||||||||| || ||||| || || || || 
Sbjct: 475 ttgtctggtgcccacactctgggaagatgccacaaggataggtctggtttcgaaggtgct 534

                                                                       
Query: 315 tggaccgccaaccctttgatcttcgacaactcttacttcactgagctcctgagtggggag 374
           |||||  | |||||| | ||||||||||||||||||||||  || ||| |||| || |||
Sbjct: 535 tggacttcaaaccctctcatcttcgacaactcttacttcaaggaactcttgagcggtgag 594

                             
Query: 375 aaggaaggtcttcttcag 392
           ||||||||||||||||||
Sbjct: 595 aaggaaggtcttcttcag 612



to top

>emb|X81376.1|CAYWCAP C.annuum mRNA for cytosolic ascorbate peroxidase
          Length = 953

 Score =  167 bits (84), Expect = 6e-38
 Identities = 387/488 (79%)
 Strand = Plus / Plus

                                                                       
Query: 35  ggagcagttccccatcctctcctacgccgacttctaccagctcgctggagtcgtcgccgt 94
           ||||||||| |||||||||||||| || || ||||| ||  | ||||| || || || ||
Sbjct: 281 ggagcagtttcccatcctctcctatgctgatttctatcaattggctggtgttgttgctgt 340

                                                                       
Query: 95  cgaggtgaccggcgggcctgaggttcccttccaccccgggagacaggacaagcccgagcc 154
            |||||||| || || ||||| |||||||| |||||||| ||| |||||||||| |||||
Sbjct: 341 tgaggtgactggaggacctgatgttccctttcaccccggcagagaggacaagccagagcc 400

                                                                       
Query: 155 tcctccagaaggccgtcttcctgatgccacccaaggctctgaccacctcaggcaggtgtt 214
            |||   ||||| ||  | |||||||| ||| | |||||||||||| | ||| | |||||
Sbjct: 401 acctgttgaaggtcgcttgcctgatgcaaccaagggctctgaccacttgagggacgtgtt 460

                                                                       
Query: 215 ttccactcagatgggtttgagtgaccaggacattgttgctctttctggtggtcacaccct 274
               |  || |||||| |   ||| ||||| |||||||| || |||||||| || ||| |
Sbjct: 461 cgtgaaacaaatgggtctttctgatcaggatattgttgcactctctggtggccatacctt 520

                                                                       
Query: 275 gggaagatgccacaaggagagatctgggtttgagggagcctggaccgccaaccctttgat 334
           ||||||||||||||||||| | ||||| ||||||||| | ||||||||||| ||  | ||
Sbjct: 521 gggaagatgccacaaggagcgttctggttttgagggaccttggaccgccaatcccctcat 580

                                                                       
Query: 335 cttcgacaactcttacttcactgagctcctgagtggggagaaggaaggtcttcttcagtt 394
            || |||||||| |||||||  || ||  || ||||||| || ||||||||| | |||||
Sbjct: 581 ttttgacaactcatacttcaaggaactattgggtggggaaaaagaaggtcttttacagtt 640

                                                                       
Query: 395 gccgaccgacaaggtcctgctgactgacccggccttccgcccacttgtggacaaatatgc 454
           |||  | |||||||  || ||  |||| || || ||||| || ||||| || ||||||||
Sbjct: 641 gccctcagacaaggctctcctctctgatcctgctttccgtccccttgttgagaaatatgc 700

                                                                       
Query: 455 tgcggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaact 514
           ||| ||||| ||||| |||||||||||||| || ||||| ||| | |||||||||||| |
Sbjct: 701 tgcagatgaagatgccttctttgctgactatgctgaggctcacttgaagctctctgaatt 760

                   
Query: 515 tggattcg 522
            |||||||
Sbjct: 761 gggattcg 768



to top

>gb|AF540556.1| Brassica juncea clone APX 8A ascorbate peroxidase mRNA, complete
           cds
          Length = 987

 Score =  163 bits (82), Expect = 9e-37
 Identities = 295/366 (80%)
 Strand = Plus / Plus

                                                                       
Query: 27  cccatcaaggagcagttccccatcctctcctacgccgacttctaccagctcgctggagtc 86
           ||||||| ||||||||||||   | |||||| ||| |||||| | ||||||||||| || 
Sbjct: 316 cccatcagggagcagttccctgccatctccttcgctgacttccatcagctcgctggtgtt 375

                                                                       
Query: 87  gtcgccgtcgaggtgaccggcgggcctgaggttcccttccaccccgggagacaggacaag 146
           || || || || || || || || |||||| | || |||||||| || ||| ||||||||
Sbjct: 376 gtggctgtggaagtcactggtggacctgagatccctttccaccctggaagagaggacaag 435

                                                                       
Query: 147 cccgagcctcctccagaaggccgtcttcctgatgccacccaaggctctgaccacctcagg 206
           ||| |||| || ||||| || ||||| |||||||| ||  | || | |||||| || || 
Sbjct: 436 ccccagccaccaccagagggacgtctccctgatgctacgaagggatgtgaccatctgaga 495

                                                                       
Query: 207 caggtgttttccactcagatgggtttgagtgaccaggacattgttgctctttctggtggt 266
           ||||||||| | |  ||||||||||||  |||| |||||||||| ||| | |||||||  
Sbjct: 496 caggtgtttacgaagcagatgggtttgtctgacaaggacattgtcgctttatctggtgcc 555

                                                                       
Query: 267 cacaccctgggaagatgccacaaggagagatctgggtttgagggagcctggaccgccaac 326
           ||||| |||||||||||||||||||| || ||||| || || || ||||||||  | |||
Sbjct: 556 cacactctgggaagatgccacaaggataggtctggattcgaaggtgcctggacgtcaaac 615

                                                                       
Query: 327 cctttgatcttcgacaactcttacttcactgagctcctgagtggggagaaggaaggtctt 386
           ||| | || |||||||||||||||||||  |||||| |||  || |||||||||||||||
Sbjct: 616 cctcttattttcgacaactcttacttcaaggagctcttgaccggtgagaaggaaggtctt 675

                 
Query: 387 cttcag 392
           ||||||
Sbjct: 676 cttcag 681



to top

>gb|AF457210.1| Hevea brasiliensis ascorbate peroxidase (APX) mRNA, complete cds
          Length = 1058

 Score =  163 bits (82), Expect = 9e-37
 Identities = 364/458 (79%)
 Strand = Plus / Plus

                                                                       
Query: 24  gagcccatcaaggagcagttccccatcctctcctacgccgacttctaccagctcgctgga 83
           |||||||||||| |||||||||| ||||||||||| || |||||||| ||||| ||||| 
Sbjct: 315 gagcccatcaagcagcagttccctatcctctcctatgctgacttctatcagcttgctggt 374

                                                                       
Query: 84  gtcgtcgccgtcgaggtgaccggcgggcctgaggttcccttccaccccgggagacaggac 143
           || || ||||| ||| | || || ||||||||| | || |||||||| || ||| |||||
Sbjct: 375 gttgttgccgttgagatcactggtgggcctgagatcccattccaccctggcagagaggac 434

                                                                       
Query: 144 aagcccgagcctcctccagaaggccgtcttcctgatgccacccaaggctctgaccacctc 203
           ||||| || || ||||||||||| ||||| ||| |||| ||  ||||  |||| ||| | 
Sbjct: 435 aagcctgaaccacctccagaaggtcgtctgcctaatgctactaaaggtgctgatcacttg 494

                                                                       
Query: 204 aggcaggtgttttccactcagatgggtttgagtgaccaggacattgttgctctttctggt 263
           ||| |||| |||  ||     |||||| | |||||| |||| || |||| ||| ||||||
Sbjct: 495 agggaggtctttggcaaaaccatgggtctcagtgacaaggatatcgttgttctctctggt 554

                                                                       
Query: 264 ggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctggaccgcc 323
           || |||||||||||||| |||||||||||| | ||||| ||||| ||  ||||||| || 
Sbjct: 555 ggccacaccctgggaaggtgccacaaggagcgctctggttttgacgggccctggactgct 614

                                                                       
Query: 324 aaccctttgatcttcgacaactcttacttcactgagctcctgagtggggagaaggaaggt 383
           |||||  | ||||| ||||| |||| |||||| |||||| ||  |||  |||||||||| 
Sbjct: 615 aacccactcatctttgacaattctttcttcacggagctcttggctggacagaaggaaggc 674

                                                                       
Query: 384 cttcttcagttgccgaccgacaaggtcctgctgactgacccggccttccgcccacttgtg 443
           ||||| || ||||| || ||||  || ||  | || || || | ||||||||||  ||| 
Sbjct: 675 cttctacaattgccaactgacaccgttcttgttaccgatcctgtcttccgcccatatgtt 734

                                                 
Query: 444 gacaaatatgctgcggatgaggatgcgttctttgctga 481
           || ||||||||||| ||||| ||||| |||||||||||
Sbjct: 735 gaaaaatatgctgctgatgaagatgcattctttgctga 772



to top

>gb|AF159633.1|AF159633 Fragaria x ananassa cytosolic ascorbate peroxidase (APX) mRNA,
           APX26 allele, complete cds
          Length = 1035

 Score =  161 bits (81), Expect = 4e-36
 Identities = 204/245 (83%)
 Strand = Plus / Plus

                                                                       
Query: 237 gaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagaga 296
           |||||||||||||||||||| ||||||||||||||| |||||||    ||||||||  | 
Sbjct: 516 gaccaggacattgttgctctctctggtggtcacaccttgggaagggcacacaaggaacgg 575

                                                                       
Query: 297 tctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcact 356
           ||||||||||| ||| |||||||  |||||||| | ||||| |||||||| || ||||||
Sbjct: 576 tctgggtttgaaggaccctggactcccaaccctcttatctttgacaactcatatttcact 635

                                                                       
Query: 357 gagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctg 416
           | |||  ||||||| ||||||||||| ||||| ||| | || ||||||||||  || |||
Sbjct: 636 gtgctgttgagtggagagaaggaaggccttctacagcttccaaccgacaaggctcttctg 695

                                                                       
Query: 417 actgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttcttt 476
            | ||||| | ||||||||| ||||| || ||||| ||||||||||| ||||| ||||||
Sbjct: 696 tcagaccctgtcttccgccctcttgttgagaaatacgctgcggatgaagatgctttcttt 755

                
Query: 477 gctga 481
            ||||
Sbjct: 756 tctga 760



 Score =  149 bits (75), Expect = 1e-32
 Identities = 153/179 (85%)
 Strand = Plus / Plus

                                                                       
Query: 3   gacatcgccgtcaggctgctcgagcccatcaaggagcagttccccatcctctcctacgcc 62
           ||||| || |||||||| || ||||| |||||||||||||||||||| ||||| ||||| 
Sbjct: 282 gacattgctgtcaggctcctggagccgatcaaggagcagttccccattctctcttacgct 341

                                                                       
Query: 63  gacttctaccagctcgctggagtcgtcgccgtcgaggtgaccggcgggcctgaggttccc 122
           |||||||||||| | |||||||| || || || ||||| ||||| || ||||| ||||| 
Sbjct: 342 gacttctaccagttggctggagttgttgctgttgaggtcaccggtggacctgatgttcca 401

                                                                      
Query: 123 ttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctgatgc 181
           |||||||| || ||| |||||||||| || || || |||||||||||||||||||||||
Sbjct: 402 ttccacccaggaagagaggacaagccagaaccaccaccagaaggccgtcttcctgatgc 460



to top

>gb|AF159632.1|AF159632 Fragaria x ananassa cytosolic ascorbate peroxidase (APX) mRNA,
           APX22 allele, complete cds
          Length = 1065

 Score =  161 bits (81), Expect = 4e-36
 Identities = 204/245 (83%)
 Strand = Plus / Plus

                                                                       
Query: 237 gaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagaga 296
           |||||||||||||||||||| ||||||||||||||| |||||||    ||||||||  | 
Sbjct: 529 gaccaggacattgttgctctctctggtggtcacaccttgggaagggcacacaaggaacgg 588

                                                                       
Query: 297 tctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcact 356
           ||||||||||| ||| |||||||  |||||||| | ||||| |||||||| || ||||||
Sbjct: 589 tctgggtttgaaggaccctggactcccaaccctcttatctttgacaactcatatttcact 648

                                                                       
Query: 357 gagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctg 416
           | |||  ||||||| ||||||||||| ||||| ||| | || ||||||||||  || |||
Sbjct: 649 gtgctgttgagtggagagaaggaaggccttctacagcttccaaccgacaaggctcttctg 708

                                                                       
Query: 417 actgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttcttt 476
            | ||||| | ||||||||| ||||| || ||||| ||||||||||| ||||| ||||||
Sbjct: 709 tcagaccctgtcttccgccctcttgttgagaaatacgctgcggatgaagatgctttcttt 768

                
Query: 477 gctga 481
            ||||
Sbjct: 769 tctga 773



 Score =  157 bits (79), Expect = 6e-35
 Identities = 154/179 (86%)
 Strand = Plus / Plus

                                                                       
Query: 3   gacatcgccgtcaggctgctcgagcccatcaaggagcagttccccatcctctcctacgcc 62
           ||||| || |||||||| || ||||| |||||||||||||||||||| ||||| ||||| 
Sbjct: 295 gacattgctgtcaggctcctggagccgatcaaggagcagttccccattctctcttacgct 354

                                                                       
Query: 63  gacttctaccagctcgctggagtcgtcgccgtcgaggtgaccggcgggcctgaggttccc 122
           |||||||||||| | |||||||| || || || ||||| ||||| || ||||| ||||||
Sbjct: 355 gacttctaccagttggctggagttgttgctgttgaggtcaccggtggacctgatgttccc 414

                                                                      
Query: 123 ttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctgatgc 181
           |||||||| || ||| |||||||||| || || || |||||||||||||||||||||||
Sbjct: 415 ttccacccaggaagagaggacaagccagaaccaccaccagaaggccgtcttcctgatgc 473



to top

>gb|AY937208.1| Rosa hybrid cultivar APX1 mRNA, partial cds
          Length = 567

 Score =  157 bits (79), Expect = 6e-35
 Identities = 190/227 (83%)
 Strand = Plus / Plus

                                                                       
Query: 237 gaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagaga 296
           |||||||||||||||||||| ||||||||||||||| |||||||    ||||||||  | 
Sbjct: 340 gaccaggacattgttgctctctctggtggtcacaccttgggaagggcacacaaggaacgc 399

                                                                       
Query: 297 tctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcact 356
           ||||| ||||||||| |||||||  |||||||| | ||||| |||||||| || ||||| 
Sbjct: 400 tctggatttgagggaccctggactcccaaccctcttatctttgacaactcatatttcacg 459

                                                                       
Query: 357 gagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctg 416
           |||||  ||||||| ||||||||||||||||| ||| | || || |||||||  || |||
Sbjct: 460 gagctgttgagtggagagaaggaaggtcttctacagcttccaactgacaaggctcttctg 519

                                                          
Query: 417 actgacccggccttccgcccacttgtggacaaatatgctgcggatga 463
            | ||||| | ||||||||| ||||| || |||||||||||||||||
Sbjct: 520 tccgaccctgtcttccgccctcttgttgaaaaatatgctgcggatga 566



 Score =  125 bits (63), Expect = 2e-25
 Identities = 132/155 (85%)
 Strand = Plus / Plus

                                                                       
Query: 24  gagcccatcaaggagcagttccccatcctctcctacgccgacttctaccagctcgctgga 83
           ||||| ||||||||||||||||| || ||||| ||||| |||||||||||||| ||||||
Sbjct: 127 gagccaatcaaggagcagttccctattctctcttacgctgacttctaccagctggctgga 186

                                                                       
Query: 84  gtcgtcgccgtcgaggtgaccggcgggcctgaggttcccttccaccccgggagacaggac 143
           || || || || ||||| || || || ||||| ||||| |||||||| || ||| |||||
Sbjct: 187 gttgttgctgtagaggttactggtggacctgatgttccattccacccaggaagagaggac 246

                                              
Query: 144 aagcccgagcctcctccagaaggccgtcttcctga 178
           ||||| |  || |||||||||||||||||||||||
Sbjct: 247 aagcctgcaccacctccagaaggccgtcttcctga 281



to top

>emb|Y11461.1|BN11461 B.napus mRNA for ascorbate peroxidase
          Length = 1050

 Score =  153 bits (77), Expect = 9e-34
 Identities = 296/369 (80%)
 Strand = Plus / Plus

                                                                       
Query: 24  gagcccatcaaggagcagttccccatcctctcctacgccgacttctaccagctcgctgga 83
           ||||| |||| |||||||||||| | | ||||| | || || ||| | ||||| ||||| 
Sbjct: 296 gagcctatcagggagcagttccctaccatctcccatgctgatttccatcagcttgctggt 355

                                                                       
Query: 84  gtcgtcgccgtcgaggtgaccggcgggcctgaggttcccttccaccccgggagacaggac 143
           || || || || || || ||||| || |||||  |||| |||||||| || ||| |||||
Sbjct: 356 gttgtggctgttgaagtcaccggtggacctgaaattcctttccaccctggaagagaggac 415

                                                                       
Query: 144 aagcccgagcctcctccagaaggccgtcttcctgatgccacccaaggctctgaccacctc 203
           |||||| |||| |||||||| || ||||| |||||||||||  | | || ||||||| | 
Sbjct: 416 aagccccagccacctccagagggtcgtctccctgatgccacaaaggcctgtgaccacttg 475

                                                                       
Query: 204 aggcaggtgttttccactcagatgggtttgagtgaccaggacattgttgctctttctggt 263
           |||||||| || |  |  ||||||| ||| | ||||||||||||||| ||| | ||||||
Sbjct: 476 aggcaggtcttcttaaagcagatggttttaactgaccaggacattgtcgctttgtctggt 535

                                                                       
Query: 264 ggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctggaccgcc 323
           |  ||||| |||||||||||||||||||| || ||||| || || || ||||||||  | 
Sbjct: 536 gcccacactctgggaagatgccacaaggataggtctggcttcgaaggtgcctggacttca 595

                                                                       
Query: 324 aaccctttgatcttcgacaactcttacttcactgagctcctgagtggggagaaggaaggt 383
           |||||| | || |||||||||||||||||||  || ||  |||| || ||||||||||||
Sbjct: 596 aaccctcttattttcgacaactcttacttcaaggaacttttgagcggtgagaaggaaggt 655

                    
Query: 384 cttcttcag 392
           |||||||||
Sbjct: 656 cttcttcag 664



to top

>gb|AF159628.1|AF159628 Fragaria x ananassa cytosolic ascorbate peroxidase (APX) mRNA,
           APX44 allele, complete cds
          Length = 1040

 Score =  153 bits (77), Expect = 9e-34
 Identities = 203/245 (82%)
 Strand = Plus / Plus

                                                                       
Query: 237 gaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagaga 296
           |||||||||||||||||||| ||||||||||||||| |||||||    ||||||||  | 
Sbjct: 529 gaccaggacattgttgctctctctggtggtcacaccttgggaagggcgcacaaggaacgg 588

                                                                       
Query: 297 tctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcact 356
           ||||| ||||||||| | |||||  |||||||| | ||||| |||||||| || ||||||
Sbjct: 589 tctggatttgagggaccatggactcccaaccctcttatctttgacaactcatatttcact 648

                                                                       
Query: 357 gagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctg 416
           | |||  ||||||| ||||||||||| ||||| ||| | || || |||||||  || |||
Sbjct: 649 gtgctattgagtggagagaaggaaggccttctacagcttccaactgacaaggctcttctg 708

                                                                       
Query: 417 actgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttcttt 476
            | ||||| | ||||||||| ||||| || ||||| ||||||||||| ||||| ||||||
Sbjct: 709 tcagaccctgtcttccgccctcttgttgagaaatacgctgcggatgaagatgctttcttt 768

                
Query: 477 gctga 481
           |||||
Sbjct: 769 gctga 773



 Score =  141 bits (71), Expect = 3e-30
 Identities = 152/179 (84%)
 Strand = Plus / Plus

                                                                       
Query: 3   gacatcgccgtcaggctgctcgagcccatcaaggagcagttccccatcctctcctacgcc 62
           ||||| || |||||||| || ||||| ||||||||||||||||| || ||||| ||||| 
Sbjct: 295 gacattgctgtcaggctcctggagccgatcaaggagcagttccctattctctcttacgct 354

                                                                       
Query: 63  gacttctaccagctcgctggagtcgtcgccgtcgaggtgaccggcgggcctgaggttccc 122
           |||||||||||| | |||||||| || || || ||||| ||||| || ||||| ||||| 
Sbjct: 355 gacttctaccagttggctggagttgttgctgttgaggtcaccggtggacctgatgttcca 414

                                                                      
Query: 123 ttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctgatgc 181
           |||||||| || ||| |||||||||| || || || |||||||||||||||||||||||
Sbjct: 415 ttccacccaggaagagaggacaagccagaaccaccaccagaaggccgtcttcctgatgc 473



to top

>gb|AF159627.1|AF159627 Fragaria x ananassa cytosolic ascorbate peroxidase (APX) mRNA,
           APX18 allele, complete cds
          Length = 1012

 Score =  153 bits (77), Expect = 9e-34
 Identities = 203/245 (82%)
 Strand = Plus / Plus

                                                                       
Query: 237 gaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagaga 296
           |||||||||||||||||||| ||||||||||||||| |||||||    ||||||||  | 
Sbjct: 501 gaccaggacattgttgctctctctggtggtcacaccttgggaagggcgcacaaggaacgg 560

                                                                       
Query: 297 tctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcact 356
           ||||| ||||||||| | |||||  |||||||| | ||||| |||||||| || ||||||
Sbjct: 561 tctggatttgagggaccatggactcccaaccctcttatctttgacaactcatatttcact 620

                                                                       
Query: 357 gagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctg 416
           | |||  ||||||| ||||||||||| ||||| ||| | || || |||||||  || |||
Sbjct: 621 gtgctattgagtggagagaaggaaggccttctacagcttccaactgacaaggctcttctg 680

                                                                       
Query: 417 actgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttcttt 476
            | ||||| | ||||||||| ||||| || ||||| ||||||||||| ||||| ||||||
Sbjct: 681 tcagaccctgtcttccgccctcttgttgagaaatacgctgcggatgaagatgctttcttt 740

                
Query: 477 gctga 481
           |||||
Sbjct: 741 gctga 745



 Score =  141 bits (71), Expect = 3e-30
 Identities = 152/179 (84%)
 Strand = Plus / Plus

                                                                       
Query: 3   gacatcgccgtcaggctgctcgagcccatcaaggagcagttccccatcctctcctacgcc 62
           ||||| || |||||||| || ||||| ||||||||||||||||| || ||||| ||||| 
Sbjct: 267 gacattgctgtcaggctcctggagccgatcaaggagcagttccctattctctcttacgct 326

                                                                       
Query: 63  gacttctaccagctcgctggagtcgtcgccgtcgaggtgaccggcgggcctgaggttccc 122
           |||||||||||| | |||||||| || || || ||||| ||||| || ||||| ||||| 
Sbjct: 327 gacttctaccagttggctggagttgttgctgttgaggtcaccggtggacctgatgttcca 386

                                                                      
Query: 123 ttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctgatgc 181
           |||||||| || ||| |||||||||| || || || |||||||||||||||||||||||
Sbjct: 387 ttccacccaggaagagaggacaagccagaaccaccaccagaaggccgtcttcctgatgc 445



to top

>gb|L20864.1|SPIASCPER Spinacia oleracea ascorbate peroxidase mRNA, complete cds
          Length = 1069

 Score =  153 bits (77), Expect = 9e-34
 Identities = 233/285 (81%)
 Strand = Plus / Plus

                                                                       
Query: 236 tgaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagag 295
           ||||||||||||||||||||| ||||| || |||||  |||| ||||||||||||||  |
Sbjct: 501 tgaccaggacattgttgctctatctggaggccacactttggggagatgccacaaggaccg 560

                                                                       
Query: 296 atctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcac 355
            ||||| ||||| || || |||||  ||||||||||| ||||||||||| | ||||||| 
Sbjct: 561 ctctggttttgaaggtgcttggactaccaaccctttggtcttcgacaacacctacttcaa 620

                                                                       
Query: 356 tgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgct 415
            |||||||||||||| ||||| ||||||||  | ||| ||||  | |||||||  || ||
Sbjct: 621 ggagctcctgagtggtgagaaagaaggtctcttgcagctgccatctgacaaggctcttct 680

                                                                       
Query: 416 gactgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctt 475
             ||||||| | |||||||||||| || || |||||||| || ||||| ||||| |||||
Sbjct: 681 ctctgaccctgtcttccgcccactggttgagaaatatgcagctgatgaagatgcattctt 740

                                                        
Query: 476 tgctgactacgccgaggcacacctcaagctctctgaacttggatt 520
           ||| ||||| || ||||| ||| | || || |||||||| |||||
Sbjct: 741 tgccgactatgctgaggcgcacttgaaactttctgaactcggatt 785



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 64/75 (85%)
 Strand = Plus / Plus

                                                                       
Query: 111 cctgaggttcccttccaccccgggagacaggacaagcccgagcctcctccagaaggccgt 170
           ||||| |||||||||||||| || ||| |||||||||| ||||| || |  ||||| |||
Sbjct: 376 cctgaagttcccttccacccaggcagagaggacaagccagagccaccccaggaaggacgt 435

                          
Query: 171 cttcctgatgccacc 185
           || ||||||||||||
Sbjct: 436 ctccctgatgccacc 450



to top

>dbj|D85864.1|SPICAP Spinacia oleracea mRNA for cytosolic ascorbate peroxidase, complete
           cds
          Length = 1083

 Score =  153 bits (77), Expect = 9e-34
 Identities = 233/285 (81%)
 Strand = Plus / Plus

                                                                       
Query: 236 tgaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagag 295
           ||||||||||||||||||||| ||||| || |||||  |||| ||||||||||||||  |
Sbjct: 524 tgaccaggacattgttgctctatctggaggccacactttggggagatgccacaaggaccg 583

                                                                       
Query: 296 atctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcac 355
            ||||| ||||| || || |||||  ||||||||||| ||||||||||| | ||||||| 
Sbjct: 584 ctctggttttgaaggtgcttggactaccaaccctttggtcttcgacaacacctacttcaa 643

                                                                       
Query: 356 tgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgct 415
            |||||||||||||| ||||| ||||||||  | ||| ||||  | |||||||  || ||
Sbjct: 644 ggagctcctgagtggtgagaaagaaggtctcttgcagctgccatctgacaaggctcttct 703

                                                                       
Query: 416 gactgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctt 475
             ||||||| | |||||||||||| || || |||||||| || ||||| ||||| |||||
Sbjct: 704 ctctgaccctgtcttccgcccactggttgagaaatatgcagctgatgaagatgcattctt 763

                                                        
Query: 476 tgctgactacgccgaggcacacctcaagctctctgaacttggatt 520
           ||| ||||| || ||||| ||| | || || |||||||| |||||
Sbjct: 764 tgccgactatgctgaggcgcacttgaaactttctgaactcggatt 808



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 64/75 (85%)
 Strand = Plus / Plus

                                                                       
Query: 111 cctgaggttcccttccaccccgggagacaggacaagcccgagcctcctccagaaggccgt 170
           ||||| |||||||||||||| || ||| |||||||||| ||||| || |  ||||| |||
Sbjct: 399 cctgaagttcccttccacccaggcagagaggacaagccagagccaccccaggaaggacgt 458

                          
Query: 171 cttcctgatgccacc 185
           || ||||||||||||
Sbjct: 459 ctccctgatgccacc 473



to top

>gb|DQ002888.1| Capsicum annuum cytosolic ascorbate peroxidase (APX1) mRNA,
           complete cds
          Length = 1011

 Score =  151 bits (76), Expect = 3e-33
 Identities = 328/412 (79%)
 Strand = Plus / Plus

                                                                       
Query: 111 cctgaggttcccttccaccccgggagacaggacaagcccgagcctcctccagaaggccgt 170
           ||||| |||||||| ||||| || ||| |||||||||| || || |||   ||||| || 
Sbjct: 405 cctgatgttccctttcaccctggcagagaggacaagccagaaccacctgttgaaggtcgc 464

                                                                       
Query: 171 cttcctgatgccacccaaggctctgaccacctcaggcaggtgttttccactcagatgggt 230
           || |||||||||||| | |||||||||||| | ||| | ||||||   |  || ||||||
Sbjct: 465 ctgcctgatgccaccaagggctctgaccacttgagggacgtgtttgtgaaacaaatgggt 524

                                                                       
Query: 231 ttgagtgaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaag 290
            |   |||| |||| |||||||| || |||||||| || ||| ||||||| |||||||||
Sbjct: 525 ctttctgacaaggatattgttgcactctctggtggccataccttgggaaggtgccacaag 584

                                                                       
Query: 291 gagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttac 350
           ||| | ||||| ||||||||| | |||||| |||| ||  | || || |||||||| |||
Sbjct: 585 gagcgttctggttttgagggaccttggaccaccaatcccctcatatttgacaactcatac 644

                                                                       
Query: 351 ttcactgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtc 410
           || |  || || ||||||||||| || ||||| ||| | ||||||||  | |||||||  
Sbjct: 645 tttaaggaacttctgagtggggaaaaagaagggcttttacagttgccatcagacaaggct 704

                                                                       
Query: 411 ctgctgactgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcg 470
           || ||  | ||||| || |||||||| ||||| || ||||||||||||||||| ||||| 
Sbjct: 705 ctcctctcggaccctgctttccgcccccttgttgagaaatatgctgcggatgaagatgcc 764

                                                               
Query: 471 ttctttgctgactacgccgaggcacacctcaagctctctgaacttggattcg 522
           |||||||||||||| || ||||| ||| | |||||||||||| | |||||||
Sbjct: 765 ttctttgctgactatgctgaggctcacttgaagctctctgaattgggattcg 816



to top

>gb|AF540557.1| Brassica juncea clone APX 6A ascorbate peroxidase mRNA, complete
           cds
          Length = 990

 Score =  147 bits (74), Expect = 5e-32
 Identities = 293/366 (80%)
 Strand = Plus / Plus

                                                                       
Query: 27  cccatcaaggagcagttccccatcctctcctacgccgacttctaccagctcgctggagtc 86
           ||||||| |||||||||||| | | | |||| ||| || ||| | ||||||||||| || 
Sbjct: 266 cccatcagggagcagttccctaccatttccttcgctgatttccatcagctcgctggtgtt 325

                                                                       
Query: 87  gtcgccgtcgaggtgaccggcgggcctgaggttcccttccaccccgggagacaggacaag 146
           || || || || || || || || |||||| |||| |||||||| || ||| ||||||||
Sbjct: 326 gtggctgtggaagtcactggtggacctgagattcctttccaccctggaagagaggacaag 385

                                                                       
Query: 147 cccgagcctcctccagaaggccgtcttcctgatgccacccaaggctctgaccacctcagg 206
           ||  |||| || ||||| || ||||| |||||||| ||  | || | |||||| || || 
Sbjct: 386 ccgcagccaccaccagaggggcgtctccctgatgctacgaaggggtgtgaccatctgaga 445

                                                                       
Query: 207 caggtgttttccactcagatgggtttgagtgaccaggacattgttgctctttctggtggt 266
           ||||||||| | |  ||||||||||||  |||| |||||||||| ||| | |||||||  
Sbjct: 446 caggtgtttactaagcagatgggtttgtctgacaaggacattgtcgctttatctggtgcc 505

                                                                       
Query: 267 cacaccctgggaagatgccacaaggagagatctgggtttgagggagcctggaccgccaac 326
           ||||| |||||||||||||||||||| || ||||| || || || || |||||  | |||
Sbjct: 506 cacactctgggaagatgccacaaggataggtctggattcgaaggtgcatggacgtcaaac 565

                                                                       
Query: 327 cctttgatcttcgacaactcttacttcactgagctcctgagtggggagaaggaaggtctt 386
           ||| | || |||||||||||||||||||  |||||| |||  || |||||||||||||||
Sbjct: 566 cctcttattttcgacaactcttacttcaaggagctcttgaccggtgagaaggaaggtctt 625

                 
Query: 387 cttcag 392
           ||||||
Sbjct: 626 cttcag 631



to top

>gb|AF159631.1|AF159631 Fragaria x ananassa cytosolic ascorbate peroxidase (APX) mRNA,
           APX19 allele, complete cds
          Length = 1051

 Score =  145 bits (73), Expect = 2e-31
 Identities = 202/245 (82%)
 Strand = Plus / Plus

                                                                       
Query: 237 gaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagaga 296
           |||||||||||||||||||| ||||||||||||||| |||||||    ||||||||  | 
Sbjct: 516 gaccaggacattgttgctctctctggtggtcacaccttgggaagggcacacaaggaacgg 575

                                                                       
Query: 297 tctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcact 356
           ||||| || |||||| |||||||  |||||||| | ||||| |||||||| || ||||||
Sbjct: 576 tctggattcgagggaccctggactcccaaccctcttatctttgacaactcatatttcact 635

                                                                       
Query: 357 gagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctg 416
           | | |  ||||||| ||||||||||| ||||| ||| | || || |||||||  || |||
Sbjct: 636 gtgttgttgagtggagagaaggaaggccttctacagcttccaactgacaaggctcttctg 695

                                                                       
Query: 417 actgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttcttt 476
            | ||||| | ||||||||| ||||| || ||||| ||||||||||| ||||| ||||||
Sbjct: 696 tcagaccctgtcttccgccctcttgttgagaaatacgctgcggatgaagatgctttcttt 755

                
Query: 477 gctga 481
           |||||
Sbjct: 756 gctga 760



 Score =  133 bits (67), Expect = 8e-28
 Identities = 151/179 (84%)
 Strand = Plus / Plus

                                                                       
Query: 3   gacatcgccgtcaggctgctcgagcccatcaaggagcagttccccatcctctcctacgcc 62
           ||||| || ||||||||  | ||||| ||||||||||||||||| || ||||| || |||
Sbjct: 282 gacattgctgtcaggctcttggagccgatcaaggagcagttccctattctctcttatgcc 341

                                                                       
Query: 63  gacttctaccagctcgctggagtcgtcgccgtcgaggtgaccggcgggcctgaggttccc 122
           |||||||||||| | |||||||| || || || ||||| ||||| || ||||| ||||| 
Sbjct: 342 gacttctaccagttggctggagttgttgctgttgaggtcaccggtggacctgatgttcct 401

                                                                      
Query: 123 ttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctgatgc 181
           |||||||| || ||| |||||||||| || || || |||||||||||||||||||||||
Sbjct: 402 ttccacccaggaagagaggacaagccagaaccaccaccagaaggccgtcttcctgatgc 460



to top

>gb|AF159630.1|AF159630 Fragaria x ananassa cytosolic ascorbate peroxidase (APX) mRNA,
           APX42 allele, complete cds
          Length = 1035

 Score =  145 bits (73), Expect = 2e-31
 Identities = 202/245 (82%)
 Strand = Plus / Plus

                                                                       
Query: 237 gaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagaga 296
           |||||||||||||||||||| ||||||||||||||| |||||||    ||||||||  | 
Sbjct: 529 gaccaggacattgttgctctctctggtggtcacaccttgggaagggcacacaaggaacgg 588

                                                                       
Query: 297 tctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcact 356
           ||||| || |||||| |||||||  |||||||  | ||||| |||||||| || ||||||
Sbjct: 589 tctggattcgagggaccctggactcccaacccccttatctttgacaactcatatttcact 648

                                                                       
Query: 357 gagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctg 416
           | |||  ||||||| ||||||||||| ||||| ||| | || || |||||||  || |||
Sbjct: 649 gtgctgttgagtggagagaaggaaggccttctacagcttccaactgacaaggctcttctg 708

                                                                       
Query: 417 actgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttcttt 476
            | ||||| | ||||||||| ||||| || ||||| ||||||||||| ||||| ||||||
Sbjct: 709 tcagaccctgtcttccgccctcttgttgagaaatacgctgcggatgaagatgctttcttt 768

                
Query: 477 gctga 481
           |||||
Sbjct: 769 gctga 773



 Score =  133 bits (67), Expect = 8e-28
 Identities = 151/179 (84%)
 Strand = Plus / Plus

                                                                       
Query: 3   gacatcgccgtcaggctgctcgagcccatcaaggagcagttccccatcctctcctacgcc 62
           ||||| || ||||||||  | ||||| ||||||||||||||||| || ||||| || || 
Sbjct: 295 gacattgctgtcaggctcttggagccgatcaaggagcagttccctattctctcttatgct 354

                                                                       
Query: 63  gacttctaccagctcgctggagtcgtcgccgtcgaggtgaccggcgggcctgaggttccc 122
           |||||||||||| | |||||||| || || || ||||| ||||| || ||||| ||||| 
Sbjct: 355 gacttctaccagttggctggagttgttgctgttgaggtcaccggtggacctgatgttcca 414

                                                                      
Query: 123 ttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctgatgc 181
           |||||||| || ||| ||||||||||||| || || |||||||||||||||||||||||
Sbjct: 415 ttccacccaggaagagaggacaagcccgaaccaccaccagaaggccgtcttcctgatgc 473



to top

>gb|AF159629.1|AF159629 Fragaria x ananassa cytosolic ascorbate peroxidase (APX) mRNA,
           APX27 allele, complete cds
          Length = 1030

 Score =  145 bits (73), Expect = 2e-31
 Identities = 202/245 (82%)
 Strand = Plus / Plus

                                                                       
Query: 237 gaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagaga 296
           |||||||||||||||||||| ||||||||||||||| |||||||    ||||||||  | 
Sbjct: 524 gaccaggacattgttgctctctctggtggtcacaccttgggaagggcacacaaggaacgg 583

                                                                       
Query: 297 tctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcact 356
           ||||| || |||||| |||||||  |||||||  | ||||| |||||||| || ||||||
Sbjct: 584 tctggattcgagggaccctggactcccaacccccttatctttgacaactcatatttcact 643

                                                                       
Query: 357 gagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctg 416
           | |||  ||||||| ||||||||||| ||||| ||| | || || |||||||  || |||
Sbjct: 644 gtgctgttgagtggagagaaggaaggccttctacagcttccaactgacaaggctcttctg 703

                                                                       
Query: 417 actgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttcttt 476
            | ||||| | ||||||||| ||||| || ||||| ||||||||||| ||||| ||||||
Sbjct: 704 tcagaccctgtcttccgccctcttgttgagaaatacgctgcggatgaagatgctttcttt 763

                
Query: 477 gctga 481
           |||||
Sbjct: 764 gctga 768



 Score =  133 bits (67), Expect = 8e-28
 Identities = 151/179 (84%)
 Strand = Plus / Plus

                                                                       
Query: 3   gacatcgccgtcaggctgctcgagcccatcaaggagcagttccccatcctctcctacgcc 62
           ||||| || ||||||||  | ||||| ||||||||||||||||| || ||||| || || 
Sbjct: 290 gacattgctgtcaggctcttggagccgatcaaggagcagttccctattctctcttatgct 349

                                                                       
Query: 63  gacttctaccagctcgctggagtcgtcgccgtcgaggtgaccggcgggcctgaggttccc 122
           |||||||||||| | |||||||| || || || ||||| ||||| || ||||| ||||| 
Sbjct: 350 gacttctaccagttggctggagttgttgctgttgaggtcaccggtggacctgatgttcca 409

                                                                      
Query: 123 ttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctgatgc 181
           |||||||| || ||| ||||||||||||| || || |||||||||||||||||||||||
Sbjct: 410 ttccacccaggaagagaggacaagcccgaaccaccaccagaaggccgtcttcctgatgc 468



to top

>gb|AF022213.1|AF022213 Fragaria x ananassa cytosolic ascorbate peroxidase (APX-c) mRNA,
           complete cds
          Length = 1044

 Score =  145 bits (73), Expect = 2e-31
 Identities = 202/245 (82%)
 Strand = Plus / Plus

                                                                       
Query: 237 gaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagaga 296
           |||||||||||||||||||| ||||||||||||||| |||||||    ||||||||  | 
Sbjct: 520 gaccaggacattgttgctctctctggtggtcacaccttgggaagggcacacaaggaacgg 579

                                                                       
Query: 297 tctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcact 356
           ||||| || |||||| |||||||  |||||||  | ||||| |||||||| || ||||||
Sbjct: 580 tctggattcgagggaccctggactcccaacccccttatctttgacaactcatatttcact 639

                                                                       
Query: 357 gagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctg 416
           | |||  ||||||| ||||||||||| ||||| ||| | || || |||||||  || |||
Sbjct: 640 gtgctgttgagtggagagaaggaaggccttctacagcttccaactgacaaggctcttctg 699

                                                                       
Query: 417 actgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttcttt 476
            | ||||| | ||||||||| ||||| || ||||| ||||||||||| ||||| ||||||
Sbjct: 700 tcagaccctgtcttccgccctcttgttgagaaatacgctgcggatgaagatgctttcttt 759

                
Query: 477 gctga 481
           |||||
Sbjct: 760 gctga 764



 Score =  133 bits (67), Expect = 8e-28
 Identities = 151/179 (84%)
 Strand = Plus / Plus

                                                                       
Query: 3   gacatcgccgtcaggctgctcgagcccatcaaggagcagttccccatcctctcctacgcc 62
           ||||| || ||||||||  | ||||| ||||||||||||||||| || ||||| || || 
Sbjct: 286 gacattgctgtcaggctcttggagccgatcaaggagcagttccctattctctcttatgct 345

                                                                       
Query: 63  gacttctaccagctcgctggagtcgtcgccgtcgaggtgaccggcgggcctgaggttccc 122
           |||||||||||| | |||||||| || || || ||||| ||||| || ||||| ||||| 
Sbjct: 346 gacttctaccagttggctggagttgttgctgttgaggtcaccggtggacctgatgttcca 405

                                                                      
Query: 123 ttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctgatgc 181
           |||||||| || ||| ||||||||||||| || || |||||||||||||||||||||||
Sbjct: 406 ttccacccaggaagagaggacaagcccgaaccaccaccagaaggccgtcttcctgatgc 464



to top

>gb|DQ097722.1| Arachis hypogaea cytosolic ascorbate peroxidase mRNA, complete cds
          Length = 1046

 Score =  137 bits (69), Expect = 5e-29
 Identities = 233/285 (81%), Gaps = 2/285 (0%)
 Strand = Plus / Plus

                                                                       
Query: 234 agtgaccaggacattgttgctctttctggtggtcacaccctgggaagatgc-cacaagga 292
           ||||| ||||| |||||||| || |||||||||||||| || || || ||| ||||||||
Sbjct: 533 agtgatcaggatattgttgccctgtctggtggtcacactcttgg-agctgcacacaagga 591

                                                                       
Query: 293 gagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttactt 352
           | | ||||| ||||| ||  | |||||   ||| ||  | ||||| ||||||||||||||
Sbjct: 592 gcgttctggctttgaaggcccttggacaagcaatcccctcatctttgacaactcttactt 651

                                                                       
Query: 353 cactgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcct 412
           ||  |||||  ||||||| ||||||||||| || ||||||||||| |  || ||||  ||
Sbjct: 652 caaggagcttttgagtggtgagaaggaaggactccttcagttgccaagtgataaggcact 711

                                                                       
Query: 413 gctgactgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgtt 472
             ||| |||||| |  |||||||| ||||| || ||||||||||||||||| ||||| ||
Sbjct: 712 cttgagtgaccctgtattccgccctcttgttgagaaatatgctgcggatgaagatgcatt 771

                                                        
Query: 473 ctttgctgactacgccgaggcacacctcaagctctctgaacttgg 517
           ||||||||| ||||| ||||||||||| ||||||||||| |||||
Sbjct: 772 ctttgctgattacgctgaggcacaccttaagctctctgagcttgg 816



to top

>gb|AF039953.1|AF039953 Fragaria x ananassa cytosolic ascorbate peroxidase (ApxSC) mRNA,
           complete cds
          Length = 1040

 Score =  137 bits (69), Expect = 5e-29
 Identities = 201/245 (82%)
 Strand = Plus / Plus

                                                                       
Query: 237 gaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagaga 296
           |||||||||||||||||||| ||||||||||||||| |||||||    ||||||||  | 
Sbjct: 528 gaccaggacattgttgctctctctggtggtcacaccttgggaagggcacacaaggaacgg 587

                                                                       
Query: 297 tctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcact 356
           ||||| || |||||| |||||||  | |||||| | ||||| |||||||| || ||||||
Sbjct: 588 tctggattcgagggaccctggactcctaaccctcttatctttgacaactcatatttcact 647

                                                                       
Query: 357 gagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctg 416
           | |||  ||||||| ||||||||||| ||||| ||| | || || |||||||  || |||
Sbjct: 648 gtgctgttgagtggagagaaggaaggccttctacagcttccaactgacaaggctcttctg 707

                                                                       
Query: 417 actgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttcttt 476
            | ||||| | ||||||||| ||||| || ||||| ||||||||||| ||||| ||||||
Sbjct: 708 tcagaccctgtcttccgccctcttgttgagaaatacgctgcggatgaagatgctttcttt 767

                
Query: 477 gctga 481
            ||||
Sbjct: 768 tctga 772



 Score =  125 bits (63), Expect = 2e-25
 Identities = 150/179 (83%)
 Strand = Plus / Plus

                                                                       
Query: 3   gacatcgccgtcaggctgctcgagcccatcaaggagcagttccccatcctctcctacgcc 62
           ||||| || ||||||||  | ||||| ||||||||||||||||| || ||||| || || 
Sbjct: 294 gacattgctgtcaggctcttggagccgatcaaggagcagttccctattctctcttatgct 353

                                                                       
Query: 63  gacttctaccagctcgctggagtcgtcgccgtcgaggtgaccggcgggcctgaggttccc 122
           |||||||||||| | |||||||| || || || ||||| ||||| || ||||| ||||| 
Sbjct: 354 gacttctaccagttggctggagttgttgctgttgaggtcaccggtggacctgatgttcct 413

                                                                      
Query: 123 ttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctgatgc 181
           |||||||| || ||| |||||||||| || || || |||||||||||||||||||||||
Sbjct: 414 ttccacccaggaagagaggacaagccagaaccaccaccagaaggccgtcttcctgatgc 472



to top

>gb|AY974805.1| Lycopersicon esculentum ascorbate peroxidase (APX) mRNA, complete
           cds
          Length = 1169

 Score =  137 bits (69), Expect = 5e-29
 Identities = 204/249 (81%)
 Strand = Plus / Plus

                                                                       
Query: 236 tgaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagag 295
           |||| |||| |||||||| || |||||||  || ||| |||||||||||||||||||| |
Sbjct: 497 tgacaaggatattgttgcactctctggtgcccataccttgggaagatgccacaaggagcg 556

                                                                       
Query: 296 atctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcac 355
            ||||| ||||||||| | ||||||||||| ||  | ||||| |||||||| ||||| ||
Sbjct: 557 ttctggttttgagggaccttggaccgccaatccccttatctttgacaactcatactttac 616

                                                                       
Query: 356 tgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgct 415
            |||||  |||||||||| |||||||| ||  | ||||||||  | ||||| |  || ||
Sbjct: 617 ggagcttttgagtggggaaaaggaagggctcttacagttgccatcagacaaagctctcct 676

                                                                       
Query: 416 gactgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctt 475
            | ||| || || |||||||| ||||| || ||||||||||||||||| ||||| |||||
Sbjct: 677 cagtgatcctgctttccgcccccttgttgagaaatatgctgcggatgaagatgccttctt 736

                    
Query: 476 tgctgacta 484
           |||||||||
Sbjct: 737 tgctgacta 745



to top

>gb|AY206407.1| Ipomoea batatas ascorbate peroxidase mRNA, complete cds
          Length = 1046

 Score =  133 bits (67), Expect = 8e-28
 Identities = 226/279 (81%)
 Strand = Plus / Plus

                                                                       
Query: 241 aggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctg 300
           |||| ||||||||||| |||||||| || ||||||||||| |||||||||||| | ||||
Sbjct: 556 aggatattgttgctctctctggtggccataccctgggaaggtgccacaaggagcgctctg 615

                                                                       
Query: 301 ggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagc 360
           | ||||| ||  | |||||  |||||||  | ||||| || ||||||||||| || ||||
Sbjct: 616 gatttgaaggcccttggactaccaacccactcatctttgataactcttactttacagagc 675

                                                                       
Query: 361 tcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctgactg 420
           |  ||||||| ||||| ||||| ||||| || ||||| || |||||||  || || | ||
Sbjct: 676 ttttgagtggtgagaaagaagggcttctacaattgcccactgacaaggcacttcttaatg 735

                                                                       
Query: 421 acccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctttgctg 480
           |  | |  ||||||||||| || || ||||||||||| ||||| ||||| ||||||||||
Sbjct: 736 attccgttttccgcccactggttgaaaaatatgctgcagatgaagatgccttctttgctg 795

                                                  
Query: 481 actacgccgaggcacacctcaagctctctgaacttggat 519
           ||||  | ||||| ||  | |||||||||||||||||||
Sbjct: 796 actatccagaggctcatttgaagctctctgaacttggat 834



 Score = 48.1 bits (24), Expect = 0.037
 Identities = 66/80 (82%)
 Strand = Plus / Plus

                                                                       
Query: 111 cctgaggttcccttccaccccgggagacaggacaagcccgagcctcctccagaaggccgt 170
           ||||| ||||| ||||| || |||||| |||||||| | ||||| ||    ||||| |||
Sbjct: 426 cctgatgttcctttccatcctgggagagaggacaagacagagcccccagttgaaggtcgt 485

                               
Query: 171 cttcctgatgccacccaagg 190
           |||||||||||||| |||||
Sbjct: 486 cttcctgatgccacacaagg 505



to top

>emb|AJ000223.1|HVJ000223 Hordeum vulgare mRNA for expressed sequence tag
          Length = 550

 Score =  133 bits (67), Expect = 8e-28
 Identities = 205/251 (81%)
 Strand = Plus / Plus

                                                                       
Query: 3   gacatcgccgtcaggctgctcgagcccatcaaggagcagttccccatcctctcctacgcc 62
           |||||||||||  || |||||||||||||||||||| || |||||| | |||||||||||
Sbjct: 296 gacatcgccgtgcggatgctcgagcccatcaaggaggagatccccaccatctcctacgcc 355

                                                                       
Query: 63  gacttctaccagctcgctggagtcgtcgccgtcgaggtgaccggcgggcctgaggttccc 122
           ||  |||||||||| || ||||| |||||||| |||||| |||| || || | | | |||
Sbjct: 356 gatctctaccagcttgcgggagttgtcgccgtggaggtgtccggtggacccgtgatcccc 415

                                                                       
Query: 123 ttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctgatgcc 182
           |||||||| |||||  ||||||||||  |||| || ||||| || || || |||||||| 
Sbjct: 416 ttccacccagggagggaggacaagcctcagcccccaccagagggtcgcctccctgatgct 475

                                                                       
Query: 183 acccaaggctctgaccacctcaggcaggtgttttccactcagatgggtttgagtgaccag 242
           ||| | || ||||||||||| ||||| || |||   |  |||||||| |||||||| |||
Sbjct: 476 accaagggttctgaccacctaaggcaagtctttgggaagcagatgggcttgagtgatcag 535

                      
Query: 243 gacattgttgc 253
           || ||||||||
Sbjct: 536 gatattgttgc 546



to top

>gb|AY973623.1| Manihot esculenta ascorbate peroxidase APX3 mRNA, complete cds
          Length = 1060

 Score =  131 bits (66), Expect = 3e-27
 Identities = 135/158 (85%)
 Strand = Plus / Plus

                                                                       
Query: 24  gagcccatcaaggagcagttccccatcctctcctacgccgacttctaccagctcgctgga 83
           ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| 
Sbjct: 305 gagcccatcaaggagcagttccctatcctctcctacgccgacttctatcagctcgctggt 364

                                                                       
Query: 84  gtcgtcgccgtcgaggtgaccggcgggcctgaggttcccttccaccccgggagacaggac 143
           || || ||||| ||| | || || ||||||||  | || |||||||| || ||| |||||
Sbjct: 365 gttgttgccgttgagatcactggtgggcctgatatcccattccacccaggaagagaggac 424

                                                 
Query: 144 aagcccgagcctcctccagaaggccgtcttcctgatgc 181
           ||||| || || ||||||||||| ||||| ||| ||||
Sbjct: 425 aagcctgaaccgcctccagaaggtcgtctccctaatgc 462



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 241 aggacattgttgctctttctggtggtcacaccctgggaagatgccacaagga 292
           |||| |||||||  ||||||||||| |||||| ||||||| |||||||||||
Sbjct: 522 aggatattgttgtcctttctggtggccacaccttgggaaggtgccacaagga 573



 Score = 44.1 bits (22), Expect = 0.58
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                 
Query: 428 cttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctttgctga 481
           ||||||||||  ||| || ||||||||||| ||||| || || |||||||||||
Sbjct: 709 cttccgcccatatgttgaaaaatatgctgctgatgaagaggcattctttgctga 762



to top

>gb|AY973622.1| Manihot esculenta ascorbate peroxidase APX2 mRNA, complete cds
          Length = 1045

 Score =  131 bits (66), Expect = 3e-27
 Identities = 135/158 (85%)
 Strand = Plus / Plus

                                                                       
Query: 24  gagcccatcaaggagcagttccccatcctctcctacgccgacttctaccagctcgctgga 83
           ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| 
Sbjct: 309 gagcccatcaaggagcagttccctatcctctcctacgccgacttctatcagctcgctggt 368

                                                                       
Query: 84  gtcgtcgccgtcgaggtgaccggcgggcctgaggttcccttccaccccgggagacaggac 143
           || || ||||| ||| | || || ||||||||  | || |||||||| || ||| |||||
Sbjct: 369 gttgttgccgttgagatcactggtgggcctgatatcccattccacccaggaagagaggac 428

                                                 
Query: 144 aagcccgagcctcctccagaaggccgtcttcctgatgc 181
           ||||| || || ||||||||||| ||||| ||| ||||
Sbjct: 429 aagcctgaaccgcctccagaaggtcgtctccctaatgc 466



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 241 aggacattgttgctctttctggtggtcacaccctgggaagatgccacaagga 292
           |||| |||||||  ||||||||||| |||||| ||||||| |||||||||||
Sbjct: 526 aggatattgttgtcctttctggtggccacaccttgggaaggtgccacaagga 577



 Score = 44.1 bits (22), Expect = 0.58
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                 
Query: 428 cttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctttgctga 481
           ||||||||||  ||| || ||||||||||| ||||| || || |||||||||||
Sbjct: 713 cttccgcccatatgttgaaaaatatgctgctgatgaagaggcattctttgctga 766



to top

>dbj|AB078600.1| Brassica oleracea BO-APX 2 mRNA for ascorbate peroxidase, complete
           cds
          Length = 753

 Score =  131 bits (66), Expect = 3e-27
 Identities = 228/282 (80%)
 Strand = Plus / Plus

                                                                       
Query: 111 cctgaggttcccttccaccccgggagacaggacaagcccgagcctcctccagaaggccgt 170
           |||||| |||| |||||||| || ||| ||||||||||  |||| || ||||| || |||
Sbjct: 331 cctgagattcctttccaccctggaagagaggacaagcctcagccaccaccagagggacgt 390

                                                                       
Query: 171 cttcctgatgccacccaaggctctgaccacctcaggcaggtgttttccactcagatgggt 230
           || |||||||| ||  | || | ||||||| | || ||||||||| | |  |||||||||
Sbjct: 391 ctccctgatgctacaaagggatgtgaccacttgagacaggtgtttacaaagcagatgggt 450

                                                                       
Query: 231 ttgagtgaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaag 290
           ||   |||| |||||||||| ||| | ||||| |  ||||| ||||||||||||||||||
Sbjct: 451 ttatctgacaaggacattgtcgctttatctggcgcccacactctgggaagatgccacaag 510

                                                                       
Query: 291 gagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttac 350
           || || ||||| || || || || |||||  | |||||| | || |||||||||||||||
Sbjct: 511 gataggtctggattcgaaggtgcatggacttcaaaccctcttattttcgacaactcttac 570

                                                     
Query: 351 ttcactgagctcctgagtggggagaaggaaggtcttcttcag 392
           ||||  |||||| |||| || |||||||||||||||||||||
Sbjct: 571 ttcaaggagctcttgagcggtgagaaggaaggtcttcttcag 612



to top

>gb|DQ096287.1| Lycopersicon esculentum cytosolic ascorbate peroxidase 2 (APX2)
           mRNA, complete cds
          Length = 972

 Score =  129 bits (65), Expect = 1e-26
 Identities = 203/249 (81%)
 Strand = Plus / Plus

                                                                       
Query: 236 tgaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagag 295
           |||| |||| |||||||| || |||||||  || ||| |||||||||||||||||||| |
Sbjct: 465 tgacaaggatattgttgcactctctggtgcccataccttgggaagatgccacaaggagcg 524

                                                                       
Query: 296 atctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcac 355
            ||||| ||||||||| | ||||||||||| ||  | ||||| |||||||| ||||| ||
Sbjct: 525 ttctggttttgagggaccttggaccgccaatccccttatctttgacaactcatactttac 584

                                                                       
Query: 356 tgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgct 415
            |||||  |||||||||| |||||||| ||  | ||||||||  | | ||| |  || ||
Sbjct: 585 ggagcttttgagtggggaaaaggaagggctcttacagttgccatcaggcaaagctctcct 644

                                                                       
Query: 416 gactgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctt 475
            | ||| || || |||||||| ||||| || ||||||||||||||||| ||||| |||||
Sbjct: 645 cagtgatcctgctttccgcccccttgttgagaaatatgctgcggatgaagatgccttctt 704

                    
Query: 476 tgctgacta 484
           |||||||||
Sbjct: 705 tgctgacta 713



to top

>gb|AY338957.1| Cucumis sativus ascorbate peroxidase (apox) mRNA, partial cds
          Length = 906

 Score =  129 bits (65), Expect = 1e-26
 Identities = 200/245 (81%)
 Strand = Plus / Plus

                                                                       
Query: 237 gaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagaga 296
           ||||||||||||||||| || ||||||||||||||  |||| ||    ||||||||  ||
Sbjct: 456 gaccaggacattgttgccctctctggtggtcacacattgggtagggcacacaaggaacga 515

                                                                       
Query: 297 tctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcact 356
           || || || |||||  | |||||  |||||||| | ||||| ||||| || |||||||| 
Sbjct: 516 tccggtttcgaggggccatggactaccaaccctctcatctttgacaaatcgtacttcaca 575

                                                                       
Query: 357 gagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctg 416
           || ||| ||| ||| ||||||||||| ||||| |||||| |  | |||||||  || |||
Sbjct: 576 gaactcttgactggagagaaggaaggacttctgcagttggcatcagacaaggcacttctg 635

                                                                       
Query: 417 actgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttcttt 476
            ||||||| | ||||||||||||||| || ||||||||||| ||||||||||| ||||||
Sbjct: 636 tctgacccagtcttccgcccacttgtcgaaaaatatgctgccgatgaggatgctttcttt 695

                
Query: 477 gctga 481
           |||||
Sbjct: 696 gctga 700



 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 157/194 (80%)
 Strand = Plus / Plus

                                                                       
Query: 3   gacatcgccgtcaggctgctcgagcccatcaaggagcagttccccatcctctcctacgcc 62
           |||||||| || |||||  | ||||| |||||||| ||||||||||||||||| || || 
Sbjct: 225 gacatcgctgttaggctattggagccgatcaaggaacagttccccatcctctcatatgca 284

                                                                       
Query: 63  gacttctaccagctcgctggagtcgtcgccgtcgaggtgaccggcgggcctgaggttccc 122
           ||||| |||||| | ||||| || || || || ||||| || || || || || ||||| 
Sbjct: 285 gacttttaccagttggctggtgttgttgctgttgaggttactggaggacccgacgttcct 344

                                                                       
Query: 123 ttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctgatgcc 182
           |||||||| || ||| ||||||| |||||||| || |||||||||||  | |||||||| 
Sbjct: 345 ttccaccctggtagagaggacaaacccgagccaccaccagaaggccgcttgcctgatgct 404

                         
Query: 183 acccaaggctctga 196
           ||| | ||||||||
Sbjct: 405 accaagggctctga 418



to top

>gb|AF378131.1|AF378131 Zantedeschia aethiopica ascorbate peroxidase (csApx2) mRNA,
           complete cds
          Length = 1108

 Score =  129 bits (65), Expect = 1e-26
 Identities = 401/513 (78%)
 Strand = Plus / Plus

                                                                       
Query: 2   cgacatcgccgtcaggctgctcgagcccatcaaggagcagttccccatcctctcctacgc 61
           |||||||||| || | ||||| ||||| ||||||||||||||||||||||||  ||||||
Sbjct: 262 cgacatcgccatccgcctgctggagccgatcaaggagcagttccccatcctcagctacgc 321

                                                                       
Query: 62  cgacttctaccagctcgctggagtcgtcgccgtcgaggtgaccggcgggcctgaggttcc 121
           ||| ||||||||| | ||||| ||||| || || ||| | ||||| ||||| ||| | ||
Sbjct: 322 cgatttctaccagttggctggggtcgttgctgttgagatcaccggagggcccgagatccc 381

                                                                       
Query: 122 cttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctgatgc 181
            ||  |||| |||||  |||||||||| |  |||||||| ||||| || || || |||||
Sbjct: 382 gttaaacccggggagggaggacaagccagtacctcctcctgaaggtcgactgccagatgc 441

                                                                       
Query: 182 cacccaaggctctgaccacctcaggcaggtgttttccactcagatgggtttgagtgacca 241
           |||  |||| ||||| ||  | || || || |||  |   ||||||||| |  |||||||
Sbjct: 442 cacaaaaggttctgatcatttaagacaagtctttggccaacagatgggtctctgtgacca 501

                                                                       
Query: 242 ggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctgg 301
            || || |||||||||||||| || || |||||||| ||    |||| |||| | |||||
Sbjct: 502 agatatcgttgctctttctgggggccataccctgggtagggcgcacagggagcgttctgg 561

                                                                       
Query: 302 gtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagct 361
            |||||||| || |||||  | || ||| | || || || |||||||||||||| || ||
Sbjct: 562 ctttgagggtgcttggacttcaaatcctcttatatttgataactcttacttcacggaact 621

                                                                       
Query: 362 cctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctgactga 421
             |||  |||||||||||||| ||||| ||| ||||  | ||||| | ||| || | |||
Sbjct: 622 tttgaccggggagaaggaagggcttctccagctgccatctgacaaagccctccttagtga 681

                                                                       
Query: 422 cccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctttgctga 481
           ||| |  |||||||| |||||||| |||||||| || ||||||||||| |||||||| ||
Sbjct: 682 ccctgtgttccgcccccttgtggagaaatatgcagctgatgaggatgctttctttgccga 741

                                            
Query: 482 ctacgccgaggcacacctcaagctctctgaact 514
            ||  | || || ||| | ||||||||||||||
Sbjct: 742 ttattctgaagctcacttaaagctctctgaact 774



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  129 bits (65), Expect = 1e-26
 Identities = 77/81 (95%)
 Strand = Plus / Minus

                                                                            
Query: 275      gggaagatgccacaaggagagatctgggtttgagggagcctggaccgccaaccctttgat 334
                ||||||||||||||||||||||||||| |||||||||||||||||  |||||||||||||
Sbjct: 29531335 gggaagatgccacaaggagagatctggctttgagggagcctggacgtccaaccctttgat 29531276

                                     
Query: 335      cttcgacaactcttacttcac 355
                ||| |||||||||||||||||
Sbjct: 29531275 ctttgacaactcttacttcac 29531255



 Score =  113 bits (57), Expect = 8e-22
 Identities = 78/85 (91%)
 Strand = Plus / Minus

                                                                            
Query: 192      tctgaccacctcaggcaggtgttttccactcagatgggtttgagtgaccaggacattgtt 251
                ||||||||||| |||||||| |||||  | |||||||||||||||||| ||||||| |||
Sbjct: 29531507 tctgaccacctaaggcaggtcttttctgcgcagatgggtttgagtgacaaggacatagtt 29531448

                                         
Query: 252      gctctttctggtggtcacaccctgg 276
                |||||||||||||||||||||||||
Sbjct: 29531447 gctctttctggtggtcacaccctgg 29531423



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 67/73 (91%)
 Strand = Plus / Minus

                                                                            
Query: 2        cgacatcgccgtcaggctgctcgagcccatcaaggagcagttccccatcctctcctacgc 61
                |||||||||||||||||| ||||| ||||||||||| ||  | |||||||||||||||||
Sbjct: 29532332 cgacatcgccgtcaggcttctcgaccccatcaaggaccaacttcccatcctctcctacgc 29532273

                             
Query: 62       cgacttctaccag 74
                |||||||||||||
Sbjct: 29532272 cgacttctaccag 29532260



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 49/52 (94%)
 Strand = Plus / Minus

                                                                    
Query: 139      aggacaagcccgagcctcctccagaaggccgtcttcctgatgccacccaagg 190
                |||||||||| ||||||||||| ||||||||||||||||||||||| |||||
Sbjct: 29531918 aggacaagcctgagcctcctcctgaaggccgtcttcctgatgccacacaagg 29531867



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 52/57 (91%)
 Strand = Plus / Minus

                                                                         
Query: 458      ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaact 514
                ||||||||| || |||||||| || ||||||||||| ||||||||||||||||||||
Sbjct: 29530902 ggatgaggacgccttctttgcggattacgccgaggcccacctcaagctctctgaact 29530846



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 81/96 (84%)
 Strand = Plus / Minus

                                                                            
Query: 364      tgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctgactgacc 423
                ||||||| ||||||||||| ||||||||| |||| |  ||||| | |||  || ||||||
Sbjct: 29531130 tgagtggcgagaaggaaggccttcttcagctgccaagtgacaaagccctcatggctgacc 29531071

                                                    
Query: 424      cggccttccgcccacttgtggacaaatatgctgcgg 459
                | |||||||| ||||| ||||| |||||||||||||
Sbjct: 29531070 cagccttccgtccactggtggagaaatatgctgcgg 29531035



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                        
Query: 72       cagctcgctggagtcgtcgccgtcgaggtgaccggcgggcctgaggttcccttcca 127
                ||||| ||||| || || ||||||||||| |||||||| |||||||| ||||||||
Sbjct: 29532177 cagcttgctggcgttgtggccgtcgaggtcaccggcggacctgaggtccccttcca 29532122



to top

>dbj|AP005199.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0627E10
          Length = 163388

 Score =  129 bits (65), Expect = 1e-26
 Identities = 77/81 (95%)
 Strand = Plus / Minus

                                                                         
Query: 275   gggaagatgccacaaggagagatctgggtttgagggagcctggaccgccaaccctttgat 334
             ||||||||||||||||||||||||||| |||||||||||||||||  |||||||||||||
Sbjct: 58007 gggaagatgccacaaggagagatctggctttgagggagcctggacgtccaaccctttgat 57948

                                  
Query: 335   cttcgacaactcttacttcac 355
             ||| |||||||||||||||||
Sbjct: 57947 ctttgacaactcttacttcac 57927



 Score =  113 bits (57), Expect = 8e-22
 Identities = 78/85 (91%)
 Strand = Plus / Minus

                                                                         
Query: 192   tctgaccacctcaggcaggtgttttccactcagatgggtttgagtgaccaggacattgtt 251
             ||||||||||| |||||||| |||||  | |||||||||||||||||| ||||||| |||
Sbjct: 58179 tctgaccacctaaggcaggtcttttctgcgcagatgggtttgagtgacaaggacatagtt 58120

                                      
Query: 252   gctctttctggtggtcacaccctgg 276
             |||||||||||||||||||||||||
Sbjct: 58119 gctctttctggtggtcacaccctgg 58095



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 67/73 (91%)
 Strand = Plus / Minus

                                                                         
Query: 2     cgacatcgccgtcaggctgctcgagcccatcaaggagcagttccccatcctctcctacgc 61
             |||||||||||||||||| ||||| ||||||||||| ||  | |||||||||||||||||
Sbjct: 59004 cgacatcgccgtcaggcttctcgaccccatcaaggaccaacttcccatcctctcctacgc 58945

                          
Query: 62    cgacttctaccag 74
             |||||||||||||
Sbjct: 58944 cgacttctaccag 58932



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 49/52 (94%)
 Strand = Plus / Minus

                                                                 
Query: 139   aggacaagcccgagcctcctccagaaggccgtcttcctgatgccacccaagg 190
             |||||||||| ||||||||||| ||||||||||||||||||||||| |||||
Sbjct: 58590 aggacaagcctgagcctcctcctgaaggccgtcttcctgatgccacacaagg 58539



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 52/57 (91%)
 Strand = Plus / Minus

                                                                      
Query: 458   ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaact 514
             ||||||||| || |||||||| || ||||||||||| ||||||||||||||||||||
Sbjct: 57574 ggatgaggacgccttctttgcggattacgccgaggcccacctcaagctctctgaact 57518



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 81/96 (84%)
 Strand = Plus / Minus

                                                                         
Query: 364   tgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctgactgacc 423
             ||||||| ||||||||||| ||||||||| |||| |  ||||| | |||  || ||||||
Sbjct: 57802 tgagtggcgagaaggaaggccttcttcagctgccaagtgacaaagccctcatggctgacc 57743

                                                 
Query: 424   cggccttccgcccacttgtggacaaatatgctgcgg 459
             | |||||||| ||||| ||||| |||||||||||||
Sbjct: 57742 cagccttccgtccactggtggagaaatatgctgcgg 57707



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                     
Query: 72    cagctcgctggagtcgtcgccgtcgaggtgaccggcgggcctgaggttcccttcca 127
             ||||| ||||| || || ||||||||||| |||||||| |||||||| ||||||||
Sbjct: 58849 cagcttgctggcgttgtggccgtcgaggtcaccggcggacctgaggtccccttcca 58794



to top

>dbj|D88649.1| Cucumis sativus mRNA for cytosolic ascorbate peroxidase, complete
           cds
          Length = 1069

 Score =  129 bits (65), Expect = 1e-26
 Identities = 200/245 (81%)
 Strand = Plus / Plus

                                                                       
Query: 237 gaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagaga 296
           ||||||||||||||||| || ||||||||||||||  |||| ||    ||||||||  ||
Sbjct: 488 gaccaggacattgttgccctctctggtggtcacacattgggtagggcacacaaggaacga 547

                                                                       
Query: 297 tctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcact 356
           || || || |||||  | |||||  |||||||| | ||||| ||||| || |||||||| 
Sbjct: 548 tccggtttcgaggggccatggactaccaaccctctcatctttgacaaatcgtacttcaca 607

                                                                       
Query: 357 gagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctg 416
           || ||| ||| ||| ||||||||||| ||||| |||||| |  | |||||||  || |||
Sbjct: 608 gaactcttgactggagagaaggaaggacttctgcagttggcatcagacaaggcacttctg 667

                                                                       
Query: 417 actgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttcttt 476
            ||||||| | ||||||||||||||| || ||||||||||| ||||||||||| ||||||
Sbjct: 668 tctgacccagtcttccgcccacttgtcgaaaaatatgctgccgatgaggatgctttcttt 727

                
Query: 477 gctga 481
           |||||
Sbjct: 728 gctga 732



 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 157/194 (80%)
 Strand = Plus / Plus

                                                                       
Query: 3   gacatcgccgtcaggctgctcgagcccatcaaggagcagttccccatcctctcctacgcc 62
           |||||||| || |||||  | ||||| |||||||| ||||||||||||||||| || || 
Sbjct: 257 gacatcgctgttaggctattggagccgatcaaggaacagttccccatcctctcatatgca 316

                                                                       
Query: 63  gacttctaccagctcgctggagtcgtcgccgtcgaggtgaccggcgggcctgaggttccc 122
           ||||| |||||| | ||||| || || || || ||||| || || || || || ||||| 
Sbjct: 317 gacttttaccagttggctggtgttgttgctgttgaggttactggaggacccgacgttcct 376

                                                                       
Query: 123 ttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctgatgcc 182
           |||||||| || ||| ||||||| |||||||| || |||||||||||  | |||||||| 
Sbjct: 377 ttccaccctggtagagaggacaaacccgagccaccaccagaaggccgcttgcctgatgct 436

                         
Query: 183 acccaaggctctga 196
           ||| | ||||||||
Sbjct: 437 accaagggctctga 450



to top

>gb|AF053474.1|AF053474 Zantedeschia aethiopica ascorbate peroxidase (csApx1) mRNA,
           complete cds
          Length = 1097

 Score =  127 bits (64), Expect = 5e-26
 Identities = 238/296 (80%)
 Strand = Plus / Plus

                                                                       
Query: 24  gagcccatcaaggagcagttccccatcctctcctacgccgacttctaccagctcgctgga 83
           ||||| ||||||||||||||||| |||||||| |||||||| ||||||||| | ||||||
Sbjct: 298 gagccgatcaaggagcagttcccgatcctctcttacgccgatttctaccagttggctgga 357

                                                                       
Query: 84  gtcgtcgccgtcgaggtgaccggcgggcctgaggttcccttccaccccgggagacaggac 143
           || || ||||||||||| || || || |||||| | || ||||||||||||||  |||||
Sbjct: 358 gttgttgccgtcgaggtcacgggaggacctgagatcccgttccaccccgggagggaggac 417

                                                                       
Query: 144 aagcccgagcctcctccagaaggccgtcttcctgatgccacccaaggctctgaccacctc 203
           ||||| |  |||||    ||||| || || || ||||||||  |||| ||||||||  | 
Sbjct: 418 aagcctgcacctccagtggaaggtcgcctgccagatgccacaaaaggttctgaccatttg 477

                                                                       
Query: 204 aggcaggtgttttccactcagatgggtttgagtgaccaggacattgttgctctttctggt 263
           ||||||||||||  |   || |||||  ||| |||||| || || |||||  | ||||| 
Sbjct: 478 aggcaggtgtttagccaacaaatggggctgaatgaccaagatatcgttgccttgtctggg 537

                                                                   
Query: 264 ggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctggac 319
           |  || ||||||||||| |||||||||||| | ||||| ||||||||||| |||||
Sbjct: 538 gcccataccctgggaaggtgccacaaggagcgttctggctttgagggagcttggac 593



to top

>emb|X62077.1|PSAPXI P.sativum ApxI mRNA for ascorbate peroxidase
          Length = 1054

 Score =  127 bits (64), Expect = 5e-26
 Identities = 234/288 (81%), Gaps = 2/288 (0%)
 Strand = Plus / Plus

                                                                       
Query: 234 agtgaccaggacattgttgctctttctggtggtcacaccctgggaagatgc-cacaagga 292
           ||||| ||||||||||||||||| ||||||||||||||| | || || ||| ||||||||
Sbjct: 534 agtgatcaggacattgttgctctatctggtggtcacaccattgg-agctgcacacaagga 592

                                                                       
Query: 293 gagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttactt 352
           | | ||||| ||||||||| | |||||  | || ||| | || || |||||||| || ||
Sbjct: 593 gcgttctggatttgagggaccatggacttctaatcctctcatttttgacaactcatattt 652

                                                                       
Query: 353 cactgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcct 412
           ||||||| |  ||| ||| |||||||| || |||||||||||||| |  || ||||  ||
Sbjct: 653 cactgagttgttgactggtgagaaggatggccttcttcagttgccaagtgataaggcact 712

                                                                       
Query: 413 gctgactgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgtt 472
             |||||||| | |  |||||||| ||||| || ||||||||||||||||| ||||  ||
Sbjct: 713 tttgactgactctgtattccgccctcttgttgagaaatatgctgcggatgaagatgtttt 772

                                                           
Query: 473 ctttgctgactacgccgaggcacacctcaagctctctgaacttggatt 520
           ||||||||| || || || ||||| || ||||||||||| ||||||||
Sbjct: 773 ctttgctgattatgctgaagcacatcttaagctctctgagcttggatt 820



to top

>gb|AY485994.1| Pinus pinaster ascorbate peroxidase (csApx) mRNA, complete cds
          Length = 1084

 Score =  119 bits (60), Expect = 1e-23
 Identities = 120/140 (85%)
 Strand = Plus / Plus

                                                                       
Query: 258 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 317
           |||||||  |||||| |||| ||||||||||||||||||||||| ||||| ||| | |||
Sbjct: 546 tctggtgcccacaccttggggagatgccacaaggagagatctggttttgaaggaccatgg 605

                                                                       
Query: 318 accgccaaccctttgatcttcgacaactcttacttcactgagctcctgagtggggagaag 377
           ||| | |||||| | ||||| ||||||||||||||||| |||||  ||| ||| ||||||
Sbjct: 606 acctctaaccctcttatctttgacaactcttacttcacagagcttgtgactggagagaag 665

                               
Query: 378 gaaggtcttcttcagttgcc 397
           |||||||| |||||| ||||
Sbjct: 666 gaaggtctgcttcagctgcc 685



 Score =  101 bits (51), Expect = 3e-18
 Identities = 147/179 (82%)
 Strand = Plus / Plus

                                                                       
Query: 3   gacatcgccgtcaggctgctcgagcccatcaaggagcagttccccatcctctcctacgcc 62
           |||||||| || ||||| || ||||| |||||||| |||||||||||  ||||||| || 
Sbjct: 294 gacatcgcagttaggctcctggagccaatcaaggaacagttccccataatctcctatgct 353

                                                                       
Query: 63  gacttctaccagctcgctggagtcgtcgccgtcgaggtgaccggcgggcctgaggttccc 122
           ||||| || ||| | ||||| || || || || || |||||||| || |||||  |||| 
Sbjct: 354 gacttttatcagttggctggtgtggtggctgttgaagtgaccgggggacctgacattccg 413

                                                                      
Query: 123 ttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctgatgc 181
           ||||| ||||| ||| | |||||||| ||||||||||||||||| || |||||||||||
Sbjct: 414 ttccatcccggaagagaagacaagcctgagcctcctccagaaggtcggcttcctgatgc 472



 Score = 44.1 bits (22), Expect = 0.58
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 465 gatgcgttctttgctgactacgccgaggcacacctcaagctctctgaact 514
           ||||| |||||||||||||| || || || ||||| ||||| ||||||||
Sbjct: 753 gatgctttctttgctgactatgcggaagctcacctgaagctttctgaact 802



to top

>gb|U15933.1|NTU15933 Nicotiana tabacum ascorbate peroxidase (APX) mRNA, complete cds
          Length = 1040

 Score =  119 bits (60), Expect = 1e-23
 Identities = 219/272 (80%)
 Strand = Plus / Plus

                                                                       
Query: 241 aggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctg 300
           |||| |||||||| || |||||||| || ||| ||||||| |||||||||||  | ||||
Sbjct: 544 aggatattgttgcactctctggtggccataccttgggaaggtgccacaaggaacgttctg 603

                                                                       
Query: 301 ggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagc 360
           | ||||||||| | |||||  |||| ||  | ||||| |||||||| ||||| || || |
Sbjct: 604 gttttgagggaccttggactaccaatcccctcatctttgacaactcatactttacggaac 663

                                                                       
Query: 361 tcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctgactg 420
           |  ||||||||||||| ||||| ||| | ||||||||  | |||||||  || ||  |||
Sbjct: 664 ttttgagtggggagaaagaagggcttttgcagttgccttcagacaaggctctcctctctg 723

                                                                       
Query: 421 acccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctttgctg 480
           | || || |||||||| ||||| || ||||||||||||||||| || || |||||||| |
Sbjct: 724 atcctgctttccgcccccttgttgagaaatatgctgcggatgaagacgccttctttgcgg 783

                                           
Query: 481 actacgccgaggcacacctcaagctctctgaa 512
           |||| || ||||| ||| | ||||||||||||
Sbjct: 784 actatgctgaggctcacttgaagctctctgaa 815



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 24  gagcccatcaaggagcagttccccatcctctc 55
           |||||||| ||||||||||| || ||||||||
Sbjct: 327 gagcccattaaggagcagtttcctatcctctc 358



to top

>dbj|D85912.1|TOBTCAP Nicotiana tabacum mRNA for cytosolic ascorbate peroxidase, complete
           cds
          Length = 1055

 Score =  119 bits (60), Expect = 1e-23
 Identities = 222/276 (80%)
 Strand = Plus / Plus

                                                                       
Query: 236 tgaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagag 295
           |||| |||| |||||||| || |||||||| || ||| ||||||| |||||||||||  |
Sbjct: 567 tgacaaggatattgttgcactctctggtggccataccttgggaaggtgccacaaggaacg 626

                                                                       
Query: 296 atctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcac 355
            ||||| || |||||| | |||||  |||| ||  | ||||| |||||||| ||||| ||
Sbjct: 627 ttctggtttcgagggaccttggactaccaatcccctcatctttgacaactcatactttac 686

                                                                       
Query: 356 tgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgct 415
            || ||  ||||||||||||| ||||| ||| | ||||||||  | |||||||  || ||
Sbjct: 687 ggaacttttgagtggggagaaagaagggcttttgcagttgccttcagacaaggctctcct 746

                                                                       
Query: 416 gactgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctt 475
             |||| || || |||||||| ||||| || ||||||||||||||||| || || |||||
Sbjct: 747 ttctgatcctgctttccgcccccttgttgagaaatatgctgcggatgaagacgccttctt 806

                                               
Query: 476 tgctgactacgccgaggcacacctcaagctctctga 511
           ||||||||| || ||||| ||| | |||||||||||
Sbjct: 807 tgctgactatgctgaggctcacttgaagctctctga 842



 Score = 48.1 bits (24), Expect = 0.037
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 24  gagcccatcaaggagcagttccccatcctctc 55
           |||||||||||||||||||| || ||||||||
Sbjct: 355 gagcccatcaaggagcagtttcctatcctctc 386



to top

>dbj|D25238.1|RICSS622CC Oryza sativa SS622 mRNA for ascorbate peroxidase, partial cds
          Length = 273

 Score =  113 bits (57), Expect = 8e-22
 Identities = 85/95 (89%)
 Strand = Plus / Plus

                                                                       
Query: 426 gccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctttgctgactac 485
           |||||||| ||||| ||||| |||||||||||||||||||| || |||||||| || |||
Sbjct: 46  gccttccgtccactggtgganaaatatgctgcggatgaggacgccttctttgcggattac 105

                                              
Query: 486 gccgaggcacacctcaagctctctgaacttggatt 520
           |||||||| |||||||||||||||||| | |||||
Sbjct: 106 gccgaggcccacctcaagctctctgaantgggatt 140



to top

>emb|AJ698922.1| Populus euramericana partial mRNA for putative ascorbate peroxidase
           (apx gene)
          Length = 933

 Score =  107 bits (54), Expect = 5e-20
 Identities = 135/162 (83%)
 Strand = Plus / Plus

                                                                       
Query: 225 atgggtttgagtgaccaggacattgttgctctttctggtggtcacaccctgggaagatgc 284
           |||||| | |||||| | || |||||||| || || ||||||||||| |||||||| |||
Sbjct: 307 atgggtctcagtgacaaagatattgttgccctatccggtggtcacactctgggaaggtgc 366

                                                                       
Query: 285 cacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaac 344
           ||||||||| | ||||| ||||||||| |||||||| |||||||| |  | |||||||||
Sbjct: 367 cacaaggagcgttctggatttgagggaccctggacccccaaccctcttgttttcgacaac 426

                                                     
Query: 345 tcttacttcactgagctcctgagtggggagaaggaaggtctt 386
           || || ||||  || ||||| ||||| ||||| |||||||||
Sbjct: 427 tcctatttcaaggaactcctcagtggagagaaagaaggtctt 468



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 428 cttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctttgc 478
           ||||||||| ||||| || ||||||||||| ||||||||||| ||||||||
Sbjct: 510 cttccgcccccttgttgaaaaatatgctgcagatgaggatgccttctttgc 560



to top

>gb|DQ222519.1| Solanum tuberosum clone 121A05 ascorbate peroxidase-like mRNA,
           complete cds
          Length = 969

 Score =  103 bits (52), Expect = 7e-19
 Identities = 196/244 (80%)
 Strand = Plus / Plus

                                                                       
Query: 241 aggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctg 300
           |||| |||||||| || |||||||  || ||| ||||||| |||||||||||| | ||||
Sbjct: 533 aggatattgttgcactctctggtgcccataccttgggaaggtgccacaaggagcgttctg 592

                                                                       
Query: 301 ggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagc 360
           | ||||||||| | ||||||||||| ||  | ||||| |||||||| ||||| || ||||
Sbjct: 593 gttttgagggaccttggaccgccaatccccttatctttgacaactcatactttacggagc 652

                                                                       
Query: 361 tcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctgactg 420
           |  |||||||||| || ||||| ||  | ||||||||  | |||||||  || ||   ||
Sbjct: 653 ttttgagtggggaaaaagaagggctcttacagttgccatcagacaaggctctcctctgtg 712

                                                                       
Query: 421 acccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctttgctg 480
           | || || |||||||  ||||| || ||||||||||||||||| ||||| ||||| ||||
Sbjct: 713 atcctgctttccgcctccttgttgagaaatatgctgcggatgaagatgccttcttcgctg 772

               
Query: 481 acta 484
           ||||
Sbjct: 773 acta 776



to top

>dbj|AB041343.1| Solanum tuberosum APx mRNA for ascorbate peroxidase, complete cds
          Length = 1039

 Score =  103 bits (52), Expect = 7e-19
 Identities = 196/244 (80%)
 Strand = Plus / Plus

                                                                       
Query: 241 aggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctg 300
           |||| |||||||| || |||||||  || ||| ||||||| |||||||||||| | ||||
Sbjct: 545 aggatattgttgcactctctggtgcccataccttgggaaggtgccacaaggagcgttctg 604

                                                                       
Query: 301 ggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagc 360
           | ||||||||| | ||||||||||| ||  | ||||| |||||||| ||||| || ||||
Sbjct: 605 gttttgagggaccttggaccgccaatccccttatctttgacaactcatactttacggagc 664

                                                                       
Query: 361 tcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctgactg 420
           |  |||||||||| || ||||| ||  | ||||||||  | |||||||  || ||   ||
Sbjct: 665 ttttgagtggggaaaaagaagggctcttacagttgccatcagacaaggctctcctctgtg 724

                                                                       
Query: 421 acccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctttgctg 480
           | || || |||||||  ||||| || ||||||||||||||||| ||||| ||||| ||||
Sbjct: 725 atcctgctttccgcctccttgttgagaaatatgctgcggatgaagatgccttcttcgctg 784

               
Query: 481 acta 484
           ||||
Sbjct: 785 acta 788



to top

>dbj|AB254809.1| Cryptomeria japonica mRNA for putative ascorbate peroxidase,
           complete cds
          Length = 1012

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 142/173 (82%)
 Strand = Plus / Plus

                                                                       
Query: 225 atgggtttgagtgaccaggacattgttgctctttctggtggtcacaccctgggaagatgc 284
           ||||| |||||||||||||||||||| ||| | ||||||| ||||||  ||||||| |||
Sbjct: 482 atgggattgagtgaccaggacattgtggctttgtctggtgctcacactttgggaagttgc 541

                                                                       
Query: 285 cacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaac 344
           ||||||||||||||||| ||||| ||  | |||||  | |||||  | ||||| ||||||
Sbjct: 542 cacaaggagagatctggatttgaaggtccatggacttctaacccgctcatctttgacaac 601

                                                                
Query: 345 tcttacttcactgagctcctgagtggggagaaggaaggtcttcttcagttgcc 397
           || || ||||| || ||  | | ||| |||||||||||||| ||||| |||||
Sbjct: 602 tcctatttcacagaacttgtcactggagagaaggaaggtctgcttcaattgcc 654



to top

>dbj|AB024991.1| Cicer arietinum mRNA for ascorbate peroxidase, partial cds
          Length = 738

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 212/264 (80%), Gaps = 2/264 (0%)
 Strand = Plus / Plus

                                                                       
Query: 246 attgttgctctttctggtggtcacaccctgggaagatgc-cacaaggagagatctgggtt 304
           ||||||||| | || |||||||||||| | || || ||| ||||||||| | ||||| ||
Sbjct: 247 attgttgctttgtccggtggtcacaccattgg-agctgcacacaaggagcgttctggatt 305

                                                                       
Query: 305 tgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagctcct 364
           ||||||  | |||||  |||| ||| | || || ||||||||||||||||| ||| |  |
Sbjct: 306 tgagggcccatggacttccaatcctctcatttttgacaactcttacttcacggagttgtt 365

                                                                       
Query: 365 gagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctgactgaccc 424
           || ||| ||||||||||| |||||| ||||||| |  || ||||  ||  ||| ||||||
Sbjct: 366 gaatggtgagaaggaaggccttcttaagttgccaagtgataaggcacttttgagtgaccc 425

                                                                       
Query: 425 ggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctttgctgacta 484
            |  ||||| || ||||| || ||||||||||||||||| ||||| ||||||||||| ||
Sbjct: 426 tgtattccgtcctcttgtagagaaatatgctgcggatgaagatgccttctttgctgatta 485

                                   
Query: 485 cgccgaggcacacctcaagctctc 508
           ||| ||||| || || ||||||||
Sbjct: 486 cgctgaggctcatcttaagctctc 509



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 75/89 (84%)
 Strand = Plus / Plus

                                                                       
Query: 111 cctgaggttcccttccaccccgggagacaggacaagcccgagcctcctccagaaggccgt 170
           ||||| ||||| ||||||||||| ||| |||||||||| ||||| || ||||| || || 
Sbjct: 112 cctgaagttcctttccaccccggtagagaggacaagcctgagccaccaccagagggtcgc 171

                                        
Query: 171 cttcctgatgccacccaaggctctgacca 199
            | |||||||||||| |||| ||||||||
Sbjct: 172 ttgcctgatgccaccaaaggttctgacca 200



to top

>gb|AY034893.1| Suaeda maritima subsp. salsa cytosolic ascorbate peroxidase (APX)
           mRNA, complete cds
          Length = 1152

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 143/175 (81%)
 Strand = Plus / Plus

                                                                       
Query: 118 ttcccttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctg 177
           |||||||||||||||| ||| |||||||||| ||||| || |  ||||||||||| ||||
Sbjct: 443 ttcccttccaccccggcagagaggacaagcctgagccaccccaggaaggccgtctccctg 502

                                                                       
Query: 178 atgccacccaaggctctgaccacctcaggcaggtgttttccactcagatgggtttgagtg 237
           |||||||| | || | ||||||||| ||  | || ||   ||  || |||||| | | ||
Sbjct: 503 atgccaccaagggttgtgaccacctaagagatgtcttcatcaagcaaatgggtcttactg 562

                                                                  
Query: 238 accaggacattgttgctctttctggtggtcacaccctgggaagatgccacaagga 292
           |||| ||||||||||||||||| || || |||||| ||||||| |||||||||||
Sbjct: 563 accaagacattgttgctctttccggaggccacaccttgggaaggtgccacaagga 617



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 82/100 (82%)
 Strand = Plus / Plus

                                                                       
Query: 418 ctgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctttg 477
           ||||||| | ||| ||||||||||| || |||||||| || || |||||||| |||||||
Sbjct: 743 ctgaccctgtctttcgcccacttgttgagaaatatgcagctgacgaggatgcattctttg 802

                                                   
Query: 478 ctgactacgccgaggcacacctcaagctctctgaacttgg 517
           | |||||  | || || ||||| || || |||||||||||
Sbjct: 803 ccgactattctgatgcccacctgaaactttctgaacttgg 842



to top

>ref|NM_179276.1| Arabidopsis thaliana APX1; L-ascorbate peroxidase AT1G07890 (APX1)
           transcript variant AT1G07890.2 mRNA, complete cds
          Length = 999

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 124/150 (82%)
 Strand = Plus / Plus

                                                                       
Query: 243 gacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctggg 302
           |||||||| ||| | |||||||  ||||| |||||| ||||||||||||| || ||||| 
Sbjct: 489 gacattgtcgctttatctggtgcccacactctgggacgatgccacaaggataggtctggc 548

                                                                       
Query: 303 tttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagctc 362
           || || || || |||||  | |||||| | ||||||||||||||||||||||  || |||
Sbjct: 549 ttcgaaggtgcatggacatcaaaccctctaatcttcgacaactcttacttcaaggaactc 608

                                         
Query: 363 ctgagtggggagaaggaaggtcttcttcag 392
            |||| || ||||||||||| |||||||||
Sbjct: 609 ttgagcggagagaaggaaggccttcttcag 638



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 118 ttcccttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctg 177
           |||| |||||||| || ||| ||||||||||| | || |||||||| || ||||||||||
Sbjct: 364 ttcctttccaccctggaagagaggacaagccccaaccacctccagagggtcgtcttcctg 423

               
Query: 178 atgc 181
           ||||
Sbjct: 424 atgc 427



to top

>ref|NM_202057.1| Arabidopsis thaliana APX1; L-ascorbate peroxidase AT1G07890 (APX1)
           transcript variant AT1G07890.3 mRNA, complete cds
          Length = 1012

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 124/150 (82%)
 Strand = Plus / Plus

                                                                       
Query: 243 gacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctggg 302
           |||||||| ||| | |||||||  ||||| |||||| ||||||||||||| || ||||| 
Sbjct: 502 gacattgtcgctttatctggtgcccacactctgggacgatgccacaaggataggtctggc 561

                                                                       
Query: 303 tttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagctc 362
           || || || || |||||  | |||||| | ||||||||||||||||||||||  || |||
Sbjct: 562 ttcgaaggtgcatggacatcaaaccctctaatcttcgacaactcttacttcaaggaactc 621

                                         
Query: 363 ctgagtggggagaaggaaggtcttcttcag 392
            |||| || ||||||||||| |||||||||
Sbjct: 622 ttgagcggagagaaggaaggccttcttcag 651



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 118 ttcccttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctg 177
           |||| |||||||| || ||| ||||||||||| | || |||||||| || ||||||||||
Sbjct: 377 ttcctttccaccctggaagagaggacaagccccaaccacctccagagggtcgtcttcctg 436

               
Query: 178 atgc 181
           ||||
Sbjct: 437 atgc 440



to top

>ref|NM_100663.2| Arabidopsis thaliana APX1; L-ascorbate peroxidase AT1G07890 (APX1)
           transcript variant AT1G07890.1 mRNA, complete cds
          Length = 1116

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 124/150 (82%)
 Strand = Plus / Plus

                                                                       
Query: 243 gacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctggg 302
           |||||||| ||| | |||||||  ||||| |||||| ||||||||||||| || ||||| 
Sbjct: 606 gacattgtcgctttatctggtgcccacactctgggacgatgccacaaggataggtctggc 665

                                                                       
Query: 303 tttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagctc 362
           || || || || |||||  | |||||| | ||||||||||||||||||||||  || |||
Sbjct: 666 ttcgaaggtgcatggacatcaaaccctctaatcttcgacaactcttacttcaaggaactc 725

                                         
Query: 363 ctgagtggggagaaggaaggtcttcttcag 392
            |||| || ||||||||||| |||||||||
Sbjct: 726 ttgagcggagagaaggaaggccttcttcag 755



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 118 ttcccttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctg 177
           |||| |||||||| || ||| ||||||||||| | || |||||||| || ||||||||||
Sbjct: 481 ttcctttccaccctggaagagaggacaagccccaaccacctccagagggtcgtcttcctg 540

               
Query: 178 atgc 181
           ||||
Sbjct: 541 atgc 544



to top

>ref|NM_001035915.1| Arabidopsis thaliana APX1; L-ascorbate peroxidase AT1G07890 (APX1)
           transcript variant AT1G07890.5 mRNA, complete cds
          Length = 1291

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 124/150 (82%)
 Strand = Plus / Plus

                                                                       
Query: 243 gacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctggg 302
           |||||||| ||| | |||||||  ||||| |||||| ||||||||||||| || ||||| 
Sbjct: 701 gacattgtcgctttatctggtgcccacactctgggacgatgccacaaggataggtctggc 760

                                                                       
Query: 303 tttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagctc 362
           || || || || |||||  | |||||| | ||||||||||||||||||||||  || |||
Sbjct: 761 ttcgaaggtgcatggacatcaaaccctctaatcttcgacaactcttacttcaaggaactc 820

                                         
Query: 363 ctgagtggggagaaggaaggtcttcttcag 392
            |||| || ||||||||||| |||||||||
Sbjct: 821 ttgagcggagagaaggaaggccttcttcag 850



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 118 ttcccttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctg 177
           |||| |||||||| || ||| ||||||||||| | || |||||||| || ||||||||||
Sbjct: 576 ttcctttccaccctggaagagaggacaagccccaaccacctccagagggtcgtcttcctg 635

               
Query: 178 atgc 181
           ||||
Sbjct: 636 atgc 639



to top

>emb|X59600.1|ATASCOR A.thaliana mRNA for ascorbate peroxidase
          Length = 1023

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 124/150 (82%)
 Strand = Plus / Plus

                                                                       
Query: 243 gacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctggg 302
           |||||||| ||| | |||||||  ||||| |||||| ||||||||||||| || ||||| 
Sbjct: 502 gacattgtcgctttatctggtgcccacactctgggacgatgccacaaggataggtctggc 561

                                                                       
Query: 303 tttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagctc 362
           || || || || |||||  | |||||| | ||||||||||||||||||||||  || |||
Sbjct: 562 ttcgaaggtgcatggacatcaaaccctctaatcttcgacaactcttacttcaaggaactc 621

                                         
Query: 363 ctgagtggggagaaggaaggtcttcttcag 392
            |||| || ||||||||||| |||||||||
Sbjct: 622 ttgagcggagagaaggaaggccttcttcag 651



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 118 ttcccttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctg 177
           |||| |||||||| || ||| ||||||||||| | || |||||||| || ||||||||||
Sbjct: 377 ttcctttccaccctggaagagaggacaagccccaaccacctccagagggtcgtcttcctg 436

               
Query: 178 atgc 181
           ||||
Sbjct: 437 atgc 440



to top

>gb|AY094002.1| Arabidopsis thaliana At1g07890/F24B9_2 mRNA, complete cds
          Length = 753

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 124/150 (82%)
 Strand = Plus / Plus

                                                                       
Query: 243 gacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctggg 302
           |||||||| ||| | |||||||  ||||| |||||| ||||||||||||| || ||||| 
Sbjct: 463 gacattgtcgctttatctggtgcccacactctgggacgatgccacaaggataggtctggc 522

                                                                       
Query: 303 tttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagctc 362
           || || || || |||||  | |||||| | ||||||||||||||||||||||  || |||
Sbjct: 523 ttcgaaggtgcatggacatcaaaccctctaatcttcgacaactcttacttcaaggaactc 582

                                         
Query: 363 ctgagtggggagaaggaaggtcttcttcag 392
            |||| || ||||||||||| |||||||||
Sbjct: 583 ttgagcggagagaaggaaggccttcttcag 612



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 118 ttcccttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctg 177
           |||| |||||||| || ||| ||||||||||| | || |||||||| || ||||||||||
Sbjct: 338 ttcctttccaccctggaagagaggacaagccccaaccacctccagagggtcgtcttcctg 397

               
Query: 178 atgc 181
           ||||
Sbjct: 398 atgc 401



to top

>gb|AY056395.1| Arabidopsis thaliana At1g07890/F24B9_2 mRNA, complete cds
          Length = 1060

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 124/150 (82%)
 Strand = Plus / Plus

                                                                       
Query: 243 gacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctggg 302
           |||||||| ||| | |||||||  ||||| |||||| ||||||||||||| || ||||| 
Sbjct: 553 gacattgtcgctttatctggtgcccacactctgggacgatgccacaaggataggtctggc 612

                                                                       
Query: 303 tttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagctc 362
           || || || || |||||  | |||||| | ||||||||||||||||||||||  || |||
Sbjct: 613 ttcgaaggtgcatggacatcaaaccctctaatcttcgacaactcttacttcaaggaactc 672

                                         
Query: 363 ctgagtggggagaaggaaggtcttcttcag 392
            |||| || ||||||||||| |||||||||
Sbjct: 673 ttgagcggagagaaggaaggccttcttcag 702



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 118 ttcccttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctg 177
           |||| |||||||| || ||| ||||||||||| | || |||||||| || ||||||||||
Sbjct: 428 ttcctttccaccctggaagagaggacaagccccaaccacctccagagggtcgtcttcctg 487

               
Query: 178 atgc 181
           ||||
Sbjct: 488 atgc 491



to top

>gb|AY039879.1| Arabidopsis thaliana At1g07890/F24B9_2 mRNA, complete cds
          Length = 1059

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 124/150 (82%)
 Strand = Plus / Plus

                                                                       
Query: 243 gacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctggg 302
           |||||||| ||| | |||||||  ||||| |||||| ||||||||||||| || ||||| 
Sbjct: 553 gacattgtcgctttatctggtgcccacactctgggacgatgccacaaggataggtctggc 612

                                                                       
Query: 303 tttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagctc 362
           || || || || |||||  | |||||| | ||||||||||||||||||||||  || |||
Sbjct: 613 ttcgaaggtgcatggacatcaaaccctctaatcttcgacaactcttacttcaaggaactc 672

                                         
Query: 363 ctgagtggggagaaggaaggtcttcttcag 392
            |||| || ||||||||||| |||||||||
Sbjct: 673 ttgagcggagagaaggaaggccttcttcag 702



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 118 ttcccttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctg 177
           |||| |||||||| || ||| ||||||||||| | || |||||||| || ||||||||||
Sbjct: 428 ttcctttccaccctggaagagaggacaagccccaaccacctccagagggtcgtcttcctg 487

               
Query: 178 atgc 181
           ||||
Sbjct: 488 atgc 491



to top

>emb|BX816429.1|CNS0ABNP Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH48ZA02 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1032

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 124/150 (82%)
 Strand = Plus / Plus

                                                                       
Query: 243 gacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctggg 302
           |||||||| ||| | |||||||  ||||| |||||| ||||||||||||| || ||||| 
Sbjct: 530 gacattgtcgctttatctggtgcccacactctgggacgatgccacaaggataggtctggc 589

                                                                       
Query: 303 tttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagctc 362
           || || || || |||||  | |||||| | ||||||||||||||||||||||  || |||
Sbjct: 590 ttcgaaggtgcatggacatcaaaccctctaatcttcgacaactcttacttcaaggaactc 649

                                         
Query: 363 ctgagtggggagaaggaaggtcttcttcag 392
            |||| || ||||||||||| |||||||||
Sbjct: 650 ttgagcggagagaaggaaggccttcttcag 679



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 118 ttcccttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctg 177
           |||| |||||||| || ||| ||||||||||| | || |||||||| || ||||||||||
Sbjct: 405 ttcctttccaccctggaagagaggacaagccccaaccacctccagagggtcgtcttcctg 464

               
Query: 178 atgc 181
           ||||
Sbjct: 465 atgc 468



to top

>emb|BX815448.1|CNS0AE8X Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS60ZF11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 929

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 124/150 (82%)
 Strand = Plus / Plus

                                                                       
Query: 243 gacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctggg 302
           |||||||| ||| | |||||||  ||||| |||||| ||||||||||||| || ||||| 
Sbjct: 421 gacattgtcgctttatctggtgcccacactctgggacgatgccacaaggataggtctggc 480

                                                                       
Query: 303 tttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagctc 362
           || || || || |||||  | |||||| | ||||||||||||||||||||||  || |||
Sbjct: 481 ttcgaaggtgcatggacatcaaaccctctaatcttcgacaactcttacttcaaggaactc 540

                                         
Query: 363 ctgagtggggagaaggaaggtcttcttcag 392
            |||| || ||||||||||| |||||||||
Sbjct: 541 ttgagcggagagaaggaaggccttcttcag 570



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 118 ttcccttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctg 177
           |||| |||||||| || ||| ||||||||||| | || |||||||| || ||||||||||
Sbjct: 296 ttcctttccaccctggaagagaggacaagccccaaccacctccagagggtcgtcttcctg 355

               
Query: 178 atgc 181
           ||||
Sbjct: 356 atgc 359



to top

>emb|BX813944.1|CNS0AEB8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB49ZC10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1009

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 124/150 (82%)
 Strand = Plus / Plus

                                                                       
Query: 243 gacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctggg 302
           |||||||| ||| | |||||||  ||||| |||||| ||||||||||||| || ||||| 
Sbjct: 501 gacattgtcgctttatctggtgcccacactctgggacgatgccacaaggataggtctggc 560

                                                                       
Query: 303 tttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagctc 362
           || || || || |||||  | |||||| | ||||||||||||||||||||||  || |||
Sbjct: 561 ttcgaaggtgcatggacatcaaaccctctaatcttcgacaactcttacttcaaggaactc 620

                                         
Query: 363 ctgagtggggagaaggaaggtcttcttcag 392
            |||| || ||||||||||| |||||||||
Sbjct: 621 ttgagcggagagaaggaaggccttcttcag 650



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 118 ttcccttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctg 177
           |||| |||||||| || ||| ||||||||||| | || |||||||| || ||||||||||
Sbjct: 376 ttcctttccaccctggaagagaggacaagccccaaccacctccagagggtcgtcttcctg 435

               
Query: 178 atgc 181
           ||||
Sbjct: 436 atgc 439



to top

>emb|BX815850.1|CNS0ABNN Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH12ZD09 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 907

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 124/150 (82%)
 Strand = Plus / Plus

                                                                       
Query: 243 gacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctggg 302
           |||||||| ||| | |||||||  ||||| |||||| ||||||||||||| || ||||| 
Sbjct: 397 gacattgtcgctttatctggtgcccacactctgggacgatgccacaaggataggtctggc 456

                                                                       
Query: 303 tttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagctc 362
           || || || || |||||  | |||||| | ||||||||||||||||||||||  || |||
Sbjct: 457 ttcgaaggtgcatggacatcaaaccctctaatcttcgacaactcttacttcaaggaactc 516

                                         
Query: 363 ctgagtggggagaaggaaggtcttcttcag 392
            |||| || ||||||||||| |||||||||
Sbjct: 517 ttgagcggagagaaggaaggccttcttcag 546



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 118 ttcccttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctg 177
           |||| |||||||| || ||| ||||||||||| | || |||||||| || ||||||||||
Sbjct: 272 ttcctttccaccctggaagagaggacaagccccaaccacctccagagggtcgtcttcctg 331

               
Query: 178 atgc 181
           ||||
Sbjct: 332 atgc 335



to top

>emb|BX813948.1|CNS0ACBX Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB49ZF02 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1045

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 124/150 (82%)
 Strand = Plus / Plus

                                                                       
Query: 243 gacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctggg 302
           |||||||| ||| | |||||||  ||||| |||||| ||||||||||||| || ||||| 
Sbjct: 537 gacattgtcgctttatctggtgcccacactctgggacgatgccacaaggataggtctggc 596

                                                                       
Query: 303 tttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagctc 362
           || || || || |||||  | |||||| | ||||||||||||||||||||||  || |||
Sbjct: 597 ttcgaaggtgcatggacatcaaaccctctaatcttcgacaactcttacttcaaggaactc 656

                                         
Query: 363 ctgagtggggagaaggaaggtcttcttcag 392
            |||| || ||||||||||| |||||||||
Sbjct: 657 ttgagcggagagaaggaaggccttcttcag 686



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 118 ttcccttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctg 177
           |||| |||||||| || ||| ||||||||||| | || |||||||| || ||||||||||
Sbjct: 412 ttcctttccaccctggaagagaggacaagccccaaccacctccagagggtcgtcttcctg 471

               
Query: 178 atgc 181
           ||||
Sbjct: 472 atgc 475



to top

>emb|BX816810.1|CNS0ABP3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH69ZH04 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 972

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 124/150 (82%)
 Strand = Plus / Plus

                                                                       
Query: 243 gacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctggg 302
           |||||||| ||| | |||||||  ||||| |||||| ||||||||||||| || ||||| 
Sbjct: 529 gacattgtcgctttatctggtgcccacactctgggacgatgccacaaggataggtctggc 588

                                                                       
Query: 303 tttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagctc 362
           || || || || |||||  | |||||| | ||||||||||||||||||||||  || |||
Sbjct: 589 ttcgaaggtgcatggacatcaaaccctctaatcttcgacaactcttacttcaaggaactc 648

                                         
Query: 363 ctgagtggggagaaggaaggtcttcttcag 392
            |||| || ||||||||||| |||||||||
Sbjct: 649 ttgagcggagagaaggaaggccttcttcag 678



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 118 ttcccttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctg 177
           |||| |||||||| || ||| ||||||||||| | || |||||||| || ||||||||||
Sbjct: 404 ttcctttccaccctggaagagaggacaagccccaaccacctccagagggtcgtcttcctg 463

               
Query: 178 atgc 181
           ||||
Sbjct: 464 atgc 467



to top

>emb|BX815009.1|CNS0ABC3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS23ZF04 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1023

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 124/150 (82%)
 Strand = Plus / Plus

                                                                       
Query: 243 gacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctggg 302
           |||||||| ||| | |||||||  ||||| |||||| ||||||||||||| || ||||| 
Sbjct: 529 gacattgtcgctttatctggtgcccacactctgggacgatgccacaaggataggtctggc 588

                                                                       
Query: 303 tttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagctc 362
           || || || || |||||  | |||||| | ||||||||||||||||||||||  || |||
Sbjct: 589 ttcgaaggtgcatggacatcaaaccctctaatcttcgacaactcttacttcaaggaactc 648

                                         
Query: 363 ctgagtggggagaaggaaggtcttcttcag 392
            |||| || ||||||||||| |||||||||
Sbjct: 649 ttgagcggagagaaggaaggccttcttcag 678



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 118 ttcccttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctg 177
           |||| |||||||| || ||| ||||||||||| | || |||||||| || ||||||||||
Sbjct: 404 ttcctttccaccctggaagagaggacaagccccaaccacctccagagggtcgtcttcctg 463

               
Query: 178 atgc 181
           ||||
Sbjct: 464 atgc 467



to top

>emb|BX841772.1|CNS09Y65 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB28ZA07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 975

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 124/150 (82%)
 Strand = Plus / Plus

                                                                       
Query: 243 gacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctggg 302
           |||||||| ||| | |||||||  ||||| |||||| ||||||||||||| || ||||| 
Sbjct: 477 gacattgtcgctttatctggtgcccacactctgggacgatgccacaaggataggtctggc 536

                                                                       
Query: 303 tttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagctc 362
           || || || || |||||  | |||||| | ||||||||||||||||||||||  || |||
Sbjct: 537 ttcgaaggtgcatggacatcaaaccctctaatcttcgacaactcttacttcaaggaactc 596

                                         
Query: 363 ctgagtggggagaaggaaggtcttcttcag 392
            |||| || ||||||||||| |||||||||
Sbjct: 597 ttgagcggagagaaggaaggccttcttcag 626



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 118 ttcccttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctg 177
           |||| |||||||| || ||| ||||||||||| | || |||||||| || ||||||||||
Sbjct: 352 ttcctttccaccctggaagagaggacaagccccaaccacctccagagggtcgtcttcctg 411

               
Query: 178 atgc 181
           ||||
Sbjct: 412 atgc 415



to top

>gb|AY086425.1| Arabidopsis thaliana clone 25057 mRNA, complete sequence
          Length = 1112

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 124/150 (82%)
 Strand = Plus / Plus

                                                                       
Query: 243 gacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctggg 302
           |||||||| ||| | |||||||  ||||| |||||| ||||||||||||| || ||||| 
Sbjct: 606 gacattgtcgctttatctggtgcccacactctgggacgatgccacaaggataggtctggc 665

                                                                       
Query: 303 tttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagctc 362
           || || || || |||||  | |||||| | ||||||||||||||||||||||  || |||
Sbjct: 666 ttcgaaggtgcatggacatcaaaccctctaatcttcgacaactcttacttcaaggaactc 725

                                         
Query: 363 ctgagtggggagaaggaaggtcttcttcag 392
            |||| || ||||||||||| |||||||||
Sbjct: 726 ttgagcggagagaaggaaggccttcttcag 755



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 118 ttcccttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctg 177
           |||| |||||||| || ||| ||||||||||| | || |||||||| || ||||||||||
Sbjct: 481 ttcctttccaccctggaagagaggacaagccccaaccacctccagagggtcgtcttcctg 540

               
Query: 178 atgc 181
           ||||
Sbjct: 541 atgc 544



to top

>dbj|AB082931.1| Glycine max apx1 mRNA for cytosolic ascorbate peroxidase 1,
           complete cds, cultivar:Hokkaihadaka
          Length = 840

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 172/214 (80%)
 Strand = Plus / Plus

                                                                       
Query: 285 cacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaac 344
           ||||||||| | ||||| ||||||||  |||||||| | || ||| | || |||||||||
Sbjct: 548 cacaaggagcgttctggatttgagggtccctggacctctaatcctcttattttcgacaac 607

                                                                       
Query: 345 tcttacttcactgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgac 404
           || |||||||| ||| |  ||||||| |||||||||||||| |||||| | ||  | |||
Sbjct: 608 tcatacttcacggagttgttgagtggtgagaaggaaggtctccttcagctaccttctgac 667

                                                                       
Query: 405 aaggtcctgctgactgacccggccttccgcccacttgtggacaaatatgctgcggatgag 464
           ||||  ||  || ||||||| |  |||||||| || || || |||||||| ||||| || 
Sbjct: 668 aaggctcttttgtctgaccctgtattccgccctctcgttgataaatatgcagcggacgaa 727

                                             
Query: 465 gatgcgttctttgctgactacgccgaggcacacc 498
           ||||| ||||||||||| ||||| ||||| ||||
Sbjct: 728 gatgccttctttgctgattacgctgaggctcacc 761



to top

>dbj|AB082930.1| Glycine max apx1 mRNA for cytosolic ascorbate peroxidase 1,
           complete cds, cultivar:Kitamusume
          Length = 839

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 172/214 (80%)
 Strand = Plus / Plus

                                                                       
Query: 285 cacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaac 344
           ||||||||| | ||||| ||||||||  |||||||| | || ||| | || |||||||||
Sbjct: 548 cacaaggagcgttctggatttgagggtccctggacctctaatcctcttattttcgacaac 607

                                                                       
Query: 345 tcttacttcactgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgac 404
           || |||||||| ||| |  ||||||| |||||||||||||| |||||| | ||  | |||
Sbjct: 608 tcatacttcacggagttgttgagtggtgagaaggaaggtctccttcagctaccttctgac 667

                                                                       
Query: 405 aaggtcctgctgactgacccggccttccgcccacttgtggacaaatatgctgcggatgag 464
           ||||  ||  || ||||||| |  |||||||| || || || |||||||| ||||| || 
Sbjct: 668 aaggctcttttgtctgaccctgtattccgccctctcgttgataaatatgcagcggacgaa 727

                                             
Query: 465 gatgcgttctttgctgactacgccgaggcacacc 498
           ||||| ||||||||||| ||||| ||||| ||||
Sbjct: 728 gatgccttctttgctgattacgctgaggctcacc 761



to top

>gb|L10292.1|SOYASCPER Soybean ascorbate peroxidase mRNA, complete cds
          Length = 1030

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 172/214 (80%)
 Strand = Plus / Plus

                                                                       
Query: 285 cacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaac 344
           ||||||||| | ||||| ||||||||  |||||||| | || ||| | || |||||||||
Sbjct: 552 cacaaggagcgttctggatttgagggtccctggacctctaatcctcttattttcgacaac 611

                                                                       
Query: 345 tcttacttcactgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgac 404
           || |||||||| ||| |  ||||||| |||||||||||||| |||||| | ||  | |||
Sbjct: 612 tcatacttcacggagttgttgagtggtgagaaggaaggtctccttcagctaccttctgac 671

                                                                       
Query: 405 aaggtcctgctgactgacccggccttccgcccacttgtggacaaatatgctgcggatgag 464
           ||||  ||  || ||||||| |  |||||||| || || || |||||||| ||||| || 
Sbjct: 672 aaggctcttttgtctgaccctgtattccgccctctcgttgataaatatgcagcggacgaa 731

                                             
Query: 465 gatgcgttctttgctgactacgccgaggcacacc 498
           ||||| ||||||||||| ||||| ||||| ||||
Sbjct: 732 gatgccttctttgctgattacgctgaggctcacc 765



to top

>gb|DQ096286.1| Lycopersicon esculentum cytosolic ascorbate peroxidase 1 (APX1)
           mRNA, complete cds
          Length = 1117

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 219/277 (79%)
 Strand = Plus / Plus

                                                                       
Query: 236 tgaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagag 295
           ||||||||| |||||||| || |||||||  || ||| |||||||    ||||||||| |
Sbjct: 621 tgaccaggatattgttgcactctctggtgcccataccttgggaagggcacacaaggagcg 680

                                                                       
Query: 296 atctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcac 355
            ||||| ||||| ||| | ||||| ||||| ||  | ||||| ||||| || ||||||||
Sbjct: 681 ttctggttttgaaggaccttggactgccaatccccttatctttgacaattcatacttcac 740

                                                                       
Query: 356 tgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgct 415
            |||||  |||||||||| || || || ||  | ||||||||| | |||||||  || ||
Sbjct: 741 ggagcttttgagtggggaaaaagaggggctcttacagttgccgtcagacaaggctctcct 800

                                                                       
Query: 416 gactgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctt 475
              ||| || || ||||| || ||||| || ||||||||||||||||| ||||| |||||
Sbjct: 801 ttgtgatcctgctttccgtccccttgttgagaaatatgctgcggatgaagatgccttctt 860

                                                
Query: 476 tgctgactacgccgaggcacacctcaagctctctgaa 512
           ||||||||| || ||||| ||| | ||||| ||||||
Sbjct: 861 tgctgactatgctgaggctcacttgaagctttctgaa 897



to top

>gb|AF001529.1|AF001529 Musa acuminata ripening-associated protein mRNA, partial cds
          Length = 582

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 170/212 (80%)
 Strand = Plus / Plus

                                                                       
Query: 4   acatcgccgtcaggctgctcgagcccatcaaggagcagttccccatcctctcctacgccg 63
           ||||||| ||||||||  | ||||||||||||||||||||||||||| |  | ||||| |
Sbjct: 266 acatcgctgtcaggctcttggagcccatcaaggagcagttccccatcttgacatacgctg 325

                                                                       
Query: 64  acttctaccagctcgctggagtcgtcgccgtcgaggtgaccggcgggcctgaggttccct 123
           ||||||| |||||||| ||||| || || ||||| || ||||| || || ||| | || |
Sbjct: 326 acttctatcagctcgccggagttgtggctgtcgaagttaccggaggaccggagatccctt 385

                                                                       
Query: 124 tccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctgatgcca 183
           |||| || |||||  |||||||||| || |||||   | |||| || ||||||||||| |
Sbjct: 386 tccatcctgggagggaggacaagcctgaacctcccgtanaaggtcgccttcctgatgcta 445

                                           
Query: 184 cccaaggctctgaccacctcaggcaggtgttt 215
           || | || ||||| ||||| ||| | ||||||
Sbjct: 446 ccaagggttctgatcaccttagggatgtgttt 477



to top

>gb|AY831398.2| Dimocarpus longan cytosolic ascorbate peroxidase mRNA, partial cds
          Length = 868

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 240/305 (78%), Gaps = 3/305 (0%)
 Strand = Plus / Plus

                                                                       
Query: 15  aggctgctcgagcccatcaaggagcagttccccatcctctcctacgccgacttctaccag 74
           |||||| | |||||||||||||||||||| || ||  | |||||||| || |||||||||
Sbjct: 120 aggctgttggagcccatcaaggagcagtttccaatattgtcctacgcagatttctaccag 179

                                                                       
Query: 75  ctcgctggagtcgtcgccgtcgaggtgaccggcgggcctgaggttcccttccaccccggg 134
            | |||||||| || || || ||  | || || ||||||||| |||| |||||||| || 
Sbjct: 180 ttggctggagttgttgctgttgaaattactggagggcctgagattcctttccacccggga 239

                                                                       
Query: 135 agacaggacaagcccgagcctcctccagaaggccgtcttcctgatgccacccaaggctct 194
           |||| ||||||  | || ||||| |||||||| ||  | |||| ||||||| |||| || 
Sbjct: 240 agaccggacaaatctgatcctcccccagaaggtcgcttgcctgctgccaccgaaggttca 299

                                                                       
Query: 195 gaccacctcaggcaggtgttttccactcagatgggtttgagtgaccaggacattgttgct 254
           |||||| | ||| | || |||     ||| |||||| | |||||  |||| |||||||| 
Sbjct: 300 gaccacttgagggatgtcttt---ggtcatatgggtctaagtgataaggatattgttgcc 356

                                                                       
Query: 255 ctttctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcc 314
            | ||||| |||||||||||||| || |||||| ||||| | ||||| ||||||||| ||
Sbjct: 357 ttatctggcggtcacaccctgggtaggtgccacgaggagcgttctggatttgagggaccc 416

                
Query: 315 tggac 319
           |||||
Sbjct: 417 tggac 421



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 62/72 (86%)
 Strand = Plus / Plus

                                                                       
Query: 449 atatgctgcggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctc 508
           ||||||||| ||||||||||| ||||||||||| ||||| ||  | ||  | ||||||||
Sbjct: 551 atatgctgcagatgaggatgctttctttgctgattacgctgaatctcatttaaagctctc 610

                       
Query: 509 tgaacttggatt 520
           ||||||||||||
Sbjct: 611 tgaacttggatt 622



to top

>gb|DQ004738.1| Phaseolus lunatus ascorbate peroxidase (AP1) mRNA, partial cds
          Length = 374

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 204/255 (80%), Gaps = 2/255 (0%)
 Strand = Plus / Plus

                                                                       
Query: 234 agtgaccaggacattgttgctctttctggtggtcacaccctgggaagatgc-cacaagga 292
           ||||||| ||| ||||||||||| ||||||||||||||| | ||| |  || ||||||||
Sbjct: 87  agtgacctggatattgttgctctatctggtggtcacaccatcgga-gcggcacacaagga 145

                                                                       
Query: 293 gagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttactt 352
           | | ||||| ||||||||  | |||||| | |||||| | || || |||||||| |||||
Sbjct: 146 gcgttctggatttgaggggccgtggacctcaaaccctcttatttttgacaactcgtactt 205

                                                                       
Query: 353 cactgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcct 412
           ||  ||| |  |||| || || |||||||| || |||||| ||||  | |||||||  ||
Sbjct: 206 caaggagttgttgagcggtgaaaaggaaggcctccttcagctgccttctgacaaggcact 265

                                                                       
Query: 413 gctgactgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgtt 472
             |||||||||| |  |||||||| ||||| || |||||||| ||||| || ||||||||
Sbjct: 266 tttgactgaccctgtattccgccctcttgttgaaaaatatgcagcggacgaagatgcgtt 325

                          
Query: 473 ctttgctgactacgc 487
           ||| ||||| |||||
Sbjct: 326 cttcgctgattacgc 340



to top

>emb|BX815873.1|CNS0ABWS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH14ZC09 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1009

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 112/135 (82%)
 Strand = Plus / Plus

                                                                       
Query: 258 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 317
           |||||||  ||||| |||||| ||||||||||||| || ||||| || || || || |||
Sbjct: 555 tctggtgcccacactctgggacgatgccacaaggataggtctggcttcgaaggtgcatgg 614

                                                                       
Query: 318 accgccaaccctttgatcttcgacaactcttacttcactgagctcctgagtggggagaag 377
           ||  | |||||| | ||||||||||||||||||||||  || ||| |||| || ||||||
Sbjct: 615 acatcaaaccctctaatcttcgacaactcttacttcaaggaactcttgagcggagagaag 674

                          
Query: 378 gaaggtcttcttcag 392
           ||||| |||||||||
Sbjct: 675 gaaggccttcttcag 689



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 118 ttcccttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctg 177
           |||| |||||||| || ||| ||||||||||| | || |||||||| || ||||||||||
Sbjct: 415 ttcctttccaccctggaagagaggacaagccccaaccacctccagagggtcgtcttcctg 474

               
Query: 178 atgc 181
           ||||
Sbjct: 475 atgc 478



to top

>gb|AY306210.1| Citrullus lanatus ascorbate peroxidase (APX) mRNA, partial cds
          Length = 370

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 174/218 (79%)
 Strand = Plus / Plus

                                                                       
Query: 237 gaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagaga 296
           ||||||||||||||||| || ||||| ||||||||  |||| ||    ||||| ||  ||
Sbjct: 146 gaccaggacattgttgccctctctggcggtcacacattgggtagggcacacaaagaacga 205

                                                                       
Query: 297 tctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcact 356
           ||||| ||||||||  | |||||  |||||||| | ||||| || || || |||||||||
Sbjct: 206 tctggttttgaggggccgtggacttccaaccctctcatctttgataattcatacttcact 265

                                                                       
Query: 357 gagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctg 416
           || ||| |||| |||||||||||||| ||||| |||||| |  | |||||||  || |||
Sbjct: 266 gaactcttgagcggggagaaggaaggccttctgcagttggcatcagacaaggcacttctg 325

                                                 
Query: 417 actgacccggccttccgcccacttgtggacaaatatgc 454
            |||| || | ||||||||| ||||| || ||||||||
Sbjct: 326 tctgatcccgtcttccgcccccttgttgaaaaatatgc 363



to top

>emb|BX814227.1|CNS0AC1P Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB62ZB01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 998

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 123/150 (82%)
 Strand = Plus / Plus

                                                                       
Query: 243 gacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctggg 302
           |||||||| ||| | |||||||  ||||| |||||| ||||||||||||| || ||||| 
Sbjct: 529 gacattgtcgctttatctggtgcccacactctgggacgatgccacaaggataggtctggc 588

                                                                       
Query: 303 tttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagctc 362
           || || || || |||||  | |||||| | ||||||||||||||| ||||||  || |||
Sbjct: 589 ttcgaaggtgcatggacatcaaaccctctaatcttcgacaactctgacttcaaggaactc 648

                                         
Query: 363 ctgagtggggagaaggaaggtcttcttcag 392
            |||| || ||||||||||| |||||||||
Sbjct: 649 ttgagcggagagaaggaaggccttcttcag 678



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 118 ttcccttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctg 177
           |||| |||||||| || ||| ||||||||||| | || |||||||| || ||||||||||
Sbjct: 404 ttcctttccaccctggaagagaggacaagccccaaccacctccagagggtcgtcttcctg 463

               
Query: 178 atgc 181
           ||||
Sbjct: 464 atgc 467



to top

>emb|BX817157.1|CNS0ABKO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH8ZD10 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1033

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 105/126 (83%)
 Strand = Plus / Plus

                                                                       
Query: 267 cacaccctgggaagatgccacaaggagagatctgggtttgagggagcctggaccgccaac 326
           ||||| |||||| ||||||||||||| || ||||| || || || || |||||  | |||
Sbjct: 562 cacactctgggacgatgccacaaggataggtctggcttcgaaggtgcatggacatcaaac 621

                                                                       
Query: 327 cctttgatcttcgacaactcttacttcactgagctcctgagtggggagaaggaaggtctt 386
           ||| | ||||||||||||||||||||||  || ||| |||| || ||||||||||| |||
Sbjct: 622 cctctaatcttcgacaactcttacttcaaggaactcttgagcggagagaaggaaggcctt 681

                 
Query: 387 cttcag 392
           ||||||
Sbjct: 682 cttcag 687



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 118 ttcccttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctg 177
           |||| |||||||| || ||| ||||||||||| | || |||||||| || ||||||||||
Sbjct: 411 ttcctttccaccctggaagagaggacaagccccaaccacctccagagggtcgtcttcctg 470

               
Query: 178 atgc 181
           ||||
Sbjct: 471 atgc 474



to top

>gb|AF281082.1|AF281082 Astragalus membranaceus ascorbate peroxidase mRNA, partial cds
          Length = 545

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 158/197 (80%)
 Strand = Plus / Plus

                                                                       
Query: 285 cacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaac 344
           ||||||||| | ||||| |||| |||  |||||||  | || ||||| || || ||||||
Sbjct: 125 cacaaggagcgttctggatttgggggtccctggacttctaatcctttaatttttgacaac 184

                                                                       
Query: 345 tcttacttcactgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgac 404
           || |||||||  ||| |  ||||||| ||||||||||| || |||||| |||| |  || 
Sbjct: 185 tcatacttcaaggagttgttgagtggagagaaggaaggcctccttcagctgccaagtgat 244

                                                                       
Query: 405 aaggtcctgctgactgacccggccttccgcccacttgtggacaaatatgctgcggatgag 464
           ||||  ||  |||||||||| |  |||||||| ||||| || ||||||||||||||||| 
Sbjct: 245 aaggcacttttgactgaccctgtattccgccctcttgttgagaaatatgctgcggatgaa 304

                            
Query: 465 gatgcgttctttgctga 481
           ||||| |||||||||||
Sbjct: 305 gatgccttctttgctga 321



to top

>gb|AF158654.1|AF158654 Fragaria x ananassa cytosolic ascorbate peroxidase APX26 gene,
            complete cds
          Length = 3430

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 64/72 (88%)
 Strand = Plus / Plus

                                                                        
Query: 3    gacatcgccgtcaggctgctcgagcccatcaaggagcagttccccatcctctcctacgcc 62
            ||||| || |||||||| || ||||| |||||||||||||||||||| ||||| ||||| 
Sbjct: 1171 gacattgctgtcaggctcctggagccgatcaaggagcagttccccattctctcttacgct 1230

                        
Query: 63   gacttctaccag 74
            ||||||||||||
Sbjct: 1231 gacttctaccag 1242



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 35/36 (97%)
 Strand = Plus / Plus

                                                
Query: 237  gaccaggacattgttgctctttctggtggtcacacc 272
            |||||||||||||||||||| |||||||||||||||
Sbjct: 2171 gaccaggacattgttgctctctctggtggtcacacc 2206



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 79/96 (82%)
 Strand = Plus / Plus

                                                                        
Query: 364  tgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctgactgacc 423
            ||||||| ||||||||||| ||||| ||| | || ||||||||||  || ||| | ||||
Sbjct: 2537 tgagtggagagaaggaaggccttctacagcttccaaccgacaaggctcttctgtcagacc 2596

                                                
Query: 424  cggccttccgcccacttgtggacaaatatgctgcgg 459
            | | ||||||||| ||||| || ||||| |||||||
Sbjct: 2597 ctgtcttccgccctcttgttgagaaatacgctgcgg 2632



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                        
Query: 138  caggacaagcccgagcctcctccagaaggccgtcttcctgatgc 181
            ||||||||||| || || || |||||||||||||||||||||||
Sbjct: 1986 caggacaagccagaaccaccaccagaaggccgtcttcctgatgc 2029



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                       
Query: 297  tctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcac 355
            ||||||||||| ||| |||||||  |||||||| | ||||| |||||||| || |||||
Sbjct: 2360 tctgggtttgaaggaccctggactcccaaccctcttatctttgacaactcatatttcac 2418



to top

>emb|Z17398.1|DCORFA Daucus carota mRNA for unknown protein
          Length = 1049

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 66/75 (88%)
 Strand = Plus / Plus

                                                                       
Query: 24  gagcccatcaaggagcagttccccatcctctcctacgccgacttctaccagctcgctgga 83
           ||||| |||||||||||||||||||||||||| || | ||||||||| ||| | ||||||
Sbjct: 282 gagcctatcaaggagcagttccccatcctctcttatggcgacttctatcagttggctgga 341

                          
Query: 84  gtcgtcgccgtcgag 98
           || || |||||||||
Sbjct: 342 gttgttgccgtcgag 356



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 131/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 236 tgaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagag 295
           |||| |||| |||||| |||||||||| || || || |||||||| || ||||||||| |
Sbjct: 494 tgacaaggatattgttactctttctggcgggcatactctgggaaggtgtcacaaggagcg 553

                                                                       
Query: 296 atctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcac 355
           |||||||||||| ||| |||||||   ||| ||| | ||||||||||||   ||||||| 
Sbjct: 554 atctgggtttgaaggaccctggactagcaatcctctcatcttcgacaacagctacttcaa 613

                                                     
Query: 356 tgagctcctgagtggggagaaggaaggtcttcttcagttgcc 397
            || ||| ||| |||||| || ||||| ||||| || |||||
Sbjct: 614 ggaactcttgactggggaaaaagaagggcttctgcaattgcc 655



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 428 cttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctttgc 478
           |||||| || |||||||| ||||||||||||||||||||||| ||||||||
Sbjct: 686 cttccgtcctcttgtggaaaaatatgctgcggatgaggatgctttctttgc 736



to top

>gb|AY148472.1| Retama raetam cytosolic ascorbate peroxidase mRNA, complete cds
          Length = 673

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 121/149 (81%)
 Strand = Plus / Plus

                                                                       
Query: 234 agtgaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggag 293
           ||||| ||||| |||||||||||||||||||| |||||| | |||  |   |||||||||
Sbjct: 464 agtgatcaggatattgttgctctttctggtggccacaccattggagcagcacacaaggag 523

                                                                       
Query: 294 agatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttc 353
            | ||||| ||||||||| ||||||||  ||| ||  | || || |||||||| ||||||
Sbjct: 524 cgttctggatttgagggaccctggaccagcaatcccctcatttttgacaactcatacttc 583

                                        
Query: 354 actgagctcctgagtggggagaaggaagg 382
           || || ||  ||||||| |||||||||||
Sbjct: 584 acggaactattgagtggtgagaaggaagg 612



to top

>ref|NM_001035914.1| Arabidopsis thaliana APX1; L-ascorbate peroxidase AT1G07890 (APX1)
           transcript variant AT1G07890.4 mRNA, complete cds
          Length = 1294

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 93/112 (83%)
 Strand = Plus / Plus

                                                                       
Query: 243 gacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctggg 302
           |||||||| ||| | |||||||  ||||| |||||| ||||||||||||| || ||||| 
Sbjct: 701 gacattgtcgctttatctggtgcccacactctgggacgatgccacaaggataggtctggc 760

                                                               
Query: 303 tttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttca 354
           || || || || |||||  | |||||| | ||||||||||||||||||||||
Sbjct: 761 ttcgaaggtgcatggacatcaaaccctctaatcttcgacaactcttacttca 812



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 118 ttcccttccaccccgggagacaggacaagcccgagcctcctccagaaggccgtcttcctg 177
           |||| |||||||| || ||| ||||||||||| | || |||||||| || ||||||||||
Sbjct: 576 ttcctttccaccctggaagagaggacaagccccaaccacctccagagggtcgtcttcctg 635

               
Query: 178 atgc 181
           ||||
Sbjct: 636 atgc 639



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                      
Query: 222     cagatgggtttgagtgaccaggacattgttgctctttctggtggtcacaccctgg 276
               |||||||| |||||||| |||||||||||||| || ||||| |||||||||||||
Sbjct: 9817708 cagatgggcttgagtgatcaggacattgttgccctctctggcggtcacaccctgg 9817762



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 84/101 (83%)
 Strand = Plus / Plus

                                                                           
Query: 357     gagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctg 416
               ||||| |||||||| || ||||| || ||||||||| | || |  ||||| | |||||||
Sbjct: 9818024 gagcttctgagtggtgacaaggagggccttcttcagcttcctagtgacaaagccctgctg 9818083

                                                        
Query: 417     actgacccggccttccgcccacttgtggacaaatatgctgc 457
               | |||||| |||||||||||||| || || |||||||||||
Sbjct: 9818084 agtgaccctgccttccgcccactcgtcgagaaatatgctgc 9818124



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                       
Query: 19      tgctcgagcccatcaaggagcagttccccatcctctcctacgccgacttctaccag 74
               |||||||||||||||||||| || | |||| | ||||||||||||| |||||||||
Sbjct: 9815722 tgctcgagcccatcaaggaggagatacccaccatctcctacgccgatttctaccag 9815777



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                    
Query: 275     gggaagatgccacaaggagagatctgggtttgaggga 311
               |||||| ||||||||||| |||||||| |||||||||
Sbjct: 9817847 gggaaggtgccacaaggaaagatctggttttgaggga 9817883



to top

>emb|AJ971947.1| Pinus pinea partial mRNA for cytosolic ascorbate peroxidase (apxcyt
           gene)
          Length = 167

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 89/107 (83%)
 Strand = Plus / Plus

                                                                       
Query: 291 gagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttac 350
           ||||||||||| ||||| ||| | |||||| | |||||| | ||||| ||||||||||||
Sbjct: 1   gagagatctggttttgaaggaccatggacctctaaccctcttatctttgacaactcttac 60

                                                          
Query: 351 ttcactgagctcctgagtggggagaaggaaggtcttcttcagttgcc 397
           ||||  |||||  ||| ||| ||||||||||| || |||||| ||||
Sbjct: 61  ttcatagagcttgtgactggagagaaggaaggcctgcttcagctgcc 107



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                      
Query: 222     cagatgggtttgagtgaccaggacattgttgctctttctggtggtcacaccctgg 276
               |||||||| |||||||| |||||||||||||| || ||||| |||||||||||||
Sbjct: 9815829 cagatgggcttgagtgatcaggacattgttgccctctctggcggtcacaccctgg 9815883



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 84/101 (83%)
 Strand = Plus / Plus

                                                                           
Query: 357     gagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctg 416
               ||||| |||||||| || ||||| || ||||||||| | || |  ||||| | |||||||
Sbjct: 9816145 gagcttctgagtggtgacaaggagggccttcttcagcttcctagtgacaaagccctgctg 9816204

                                                        
Query: 417     actgacccggccttccgcccacttgtggacaaatatgctgc 457
               | |||||| |||||||||||||| || || |||||||||||
Sbjct: 9816205 agtgaccctgccttccgcccactcgtcgagaaatatgctgc 9816245



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                       
Query: 19      tgctcgagcccatcaaggagcagttccccatcctctcctacgccgacttctaccag 74
               |||||||||||||||||||| || | |||| | ||||||||||||| |||||||||
Sbjct: 9813843 tgctcgagcccatcaaggaggagatacccaccatctcctacgccgatttctaccag 9813898



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                    
Query: 275     gggaagatgccacaaggagagatctgggtttgaggga 311
               |||||| ||||||||||| |||||||| |||||||||
Sbjct: 9815968 gggaaggtgccacaaggaaagatctggttttgaggga 9816004



to top

>gb|AC134232.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone
             OSJNBa0013D02, complete sequence
          Length = 131883

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                    
Query: 222   cagatgggtttgagtgaccaggacattgttgctctttctggtggtcacaccctgg 276
             |||||||| |||||||| |||||||||||||| || ||||| |||||||||||||
Sbjct: 56789 cagatgggcttgagtgatcaggacattgttgccctctctggcggtcacaccctgg 56735



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 84/101 (83%)
 Strand = Plus / Minus

                                                                         
Query: 357   gagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctg 416
             ||||| |||||||| || ||||| || ||||||||| | || |  ||||| | |||||||
Sbjct: 56473 gagcttctgagtggtgacaaggagggccttcttcagcttcctagtgacaaagccctgctg 56414

                                                      
Query: 417   actgacccggccttccgcccacttgtggacaaatatgctgc 457
             | |||||| |||||||||||||| || || |||||||||||
Sbjct: 56413 agtgaccctgccttccgcccactcgtcgagaaatatgctgc 56373



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                     
Query: 19    tgctcgagcccatcaaggagcagttccccatcctctcctacgccgacttctaccag 74
             |||||||||||||||||||| || | |||| | ||||||||||||| |||||||||
Sbjct: 58775 tgctcgagcccatcaaggaggagatacccaccatctcctacgccgatttctaccag 58720



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                  
Query: 275   gggaagatgccacaaggagagatctgggtttgaggga 311
             |||||| ||||||||||| |||||||| |||||||||
Sbjct: 56650 gggaaggtgccacaaggaaagatctggttttgaggga 56614



to top

>gb|AF038839.1| Brassica juncea ascorbate peroxidase mRNA, complete cds
          Length = 753

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 203/259 (78%)
 Strand = Plus / Plus

                                                                       
Query: 24  gagcccatcaaggagcagttccccatcctctcctacgccgacttctaccagctcgctgga 83
           |||||||||| |||||||||||| | | | |||| ||| || ||| | ||||||||||| 
Sbjct: 244 gagcccatcagggagcagttccctaccatttccttcgctgatttccatcagctcgctggt 303

                                                                       
Query: 84  gtcgtcgccgtcgaggtgaccggcgggcctgaggttcccttccaccccgggagacaggac 143
           || || || || || || || || || |||||  |||| |||||||| || ||| |||||
Sbjct: 304 gttgtggctgtggaagtcactggtggacctgacattcctttccaccctggaagagaggac 363

                                                                       
Query: 144 aagcccgagcctcctccagaaggccgtcttcctgatgccacccaaggctctgaccacctc 203
           |||||  |||| || ||||| || ||||| |||||||| ||  | |||| ||||||| | 
Sbjct: 364 aagccgcagccaccaccagaggggcgtctccctgatgctacgaagggctgtgaccacttg 423

                                                                       
Query: 204 aggcaggtgttttccactcagatgggtttgagtgaccaggacattgttgctctttctggt 263
           || ||||||||    |  ||||||| ||| | ||||||||||||||| ||| | ||||||
Sbjct: 424 agacaggtgttactaaagcagatggttttaactgaccaggacattgtcgctttgtctggt 483

                              
Query: 264 ggtcacaccctgggaagat 282
           |  ||||| ||||||||||
Sbjct: 484 gcccacactctgggaagat 502



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 51/57 (89%)
 Strand = Plus / Plus

                                                                    
Query: 336 ttcgacaactcttacttcactgagctcctgagtggggagaaggaaggtcttcttcag 392
           |||||||||||||||||||  |||||| |||  || |||||||||||||||||||||
Sbjct: 556 ttcgacaactcttacttcaaggagctcttgaccggtgagaaggaaggtcttcttcag 612



to top

>gb|AF159380.1|AF159380 Pimpinella brachycarpa ascorbate peroxidase (APX) mRNA, complete
           cds
          Length = 994

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 220/282 (78%)
 Strand = Plus / Plus

                                                                       
Query: 236 tgaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagag 295
           |||| |||| |||||| | || |||||||| |||||||||||| |    || |||||| |
Sbjct: 505 tgacaaggatattgttaccctctctggtggccacaccctgggacgcgctcataaggagcg 564

                                                                       
Query: 296 atctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcac 355
            ||||||||||| ||| |||||||   ||| ||| | ||||| || ||||| ||||| | 
Sbjct: 565 ttctgggtttgaaggaccctggacaagcaatcctctcatctttgataactcctactttaa 624

                                                                       
Query: 356 tgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgct 415
            || ||| ||| ||| ||||||||||| ||||||||  |||| || ||||||   || ||
Sbjct: 625 ggaactcttgactggagagaaggaagggcttcttcaactgccaactgacaagtctcttct 684

                                                                       
Query: 416 gactgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctt 475
               ||||| | |||||| || ||||| ||||||||||||   ||||||||||| |||||
Sbjct: 685 tgaagaccctgtcttccgtccccttgttgacaaatatgcttgtgatgaggatgccttctt 744

                                                     
Query: 476 tgctgactacgccgaggcacacctcaagctctctgaacttgg 517
           ||||||||| || ||  | ||| | ||||| |||||||||||
Sbjct: 745 tgctgactatgctgaatctcacatgaagctttctgaacttgg 786



to top

>gb|AY054988.1| Medicago sativa ascorbate peroxidase mRNA, partial cds
          Length = 564

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 134/165 (81%), Gaps = 2/165 (1%)
 Strand = Plus / Plus

                                                                       
Query: 234 agtgaccaggacattgttgctctttctggtggtcacaccctgggaagatgc-cacaagga 292
           |||||||||||||| |||||||| |||||||| |||||| | || || ||| ||||||||
Sbjct: 337 agtgaccaggacatcgttgctctgtctggtggccacaccattgg-agctgcacacaagga 395

                                                                       
Query: 293 gagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttactt 352
           | | ||||| ||||||||  | |||||  | || ||| | || || |||||||| |||||
Sbjct: 396 gcgttctggatttgagggcccatggacttctaatcctctcatttttgacaactcatactt 455

                                                        
Query: 353 cactgagctcctgagtggggagaaggaaggtcttcttcagttgcc 397
           ||  ||| |  || |||| ||||||||||| ||||||||||||||
Sbjct: 456 caaggagttgttgggtggtgagaaggaaggccttcttcagttgcc 500



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 73/89 (82%)
 Strand = Plus / Plus

                                                                       
Query: 111 cctgaggttcccttccaccccgggagacaggacaagcccgagcctcctccagaaggccgt 170
           ||||| ||||| ||||||||||| ||  |||||||||| ||||| || ||||| || || 
Sbjct: 214 cctgaagttcctttccaccccggtagggaggacaagcctgagccaccaccagagggtcgc 273

                                        
Query: 171 cttcctgatgccacccaaggctctgacca 199
            | |||||||||||| | || ||||||||
Sbjct: 274 ttgcctgatgccaccaagggttctgacca 302



to top

>gb|AY832500.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_412m2
           ascorbate peroxidase (APX) gene, partial cds
          Length = 856

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 458 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 517
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 420 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 479



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 258 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 317
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 318 ac 319
           ||
Sbjct: 62  ac 63



to top

>gb|AY832499.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_412m1
           ascorbate peroxidase (APX) gene, partial cds
          Length = 858

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 458 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 517
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 422 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 481



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 258 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 317
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 318 ac 319
           ||
Sbjct: 62  ac 63



to top

>gb|AY832498.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_013d2
           ascorbate peroxidase (APX) gene, partial cds
          Length = 863

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 458 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 517
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 420 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 479



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 258 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 317
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 318 ac 319
           ||
Sbjct: 62  ac 63



to top

>gb|AY832497.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_013d1
           ascorbate peroxidase (APX) gene, partial cds
          Length = 856

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 458 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 517
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 420 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 479



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 258 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 317
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 318 ac 319
           ||
Sbjct: 62  ac 63



to top

>gb|AY832496.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_24 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 858

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 458 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 517
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 422 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 481



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 258 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 317
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 318 ac 319
           ||
Sbjct: 62  ac 63



to top

>gb|AY832495.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_23 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 856

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 458 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 517
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 420 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 479



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 258 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 317
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 318 ac 319
           ||
Sbjct: 62  ac 63



to top

>gb|AY832494.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_22 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 850

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 458 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 517
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 420 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 479



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 258 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 317
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 318 ac 319
           ||
Sbjct: 62  ac 63



to top

>gb|AY832493.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_21 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 856

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 458 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 517
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 420 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 479



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 258 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 317
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 318 ac 319
           ||
Sbjct: 62  ac 63



to top

>gb|AY832492.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_20 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 858

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 458 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 517
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 422 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 481



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 258 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 317
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 318 ac 319
           ||
Sbjct: 62  ac 63



to top

>gb|AY832491.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_19 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 854

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 458 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 517
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 420 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 479



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 258 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 317
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 318 ac 319
           ||
Sbjct: 62  ac 63



to top

>gb|AY832490.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_18 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 856

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 458 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 517
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 420 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 479



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 258 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 317
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 318 ac 319
           ||
Sbjct: 62  ac 63



to top

>gb|AY832489.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_17 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 858

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 458 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 517
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 422 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 481



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 258 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 317
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 318 ac 319
           ||
Sbjct: 62  ac 63



to top

>gb|AY832488.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_16 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 858

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 458 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 517
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 422 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 481



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 258 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 317
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 318 ac 319
           ||
Sbjct: 62  ac 63



to top

>gb|AY832487.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_15 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 856

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 458 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 517
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 420 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 479



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 258 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 317
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 318 ac 319
           ||
Sbjct: 62  ac 63



to top

>gb|AY832486.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_14 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 856

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 458 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 517
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 420 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 479



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 258 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 317
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 318 ac 319
           ||
Sbjct: 62  ac 63



to top

>gb|AY832485.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_13 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 856

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 458 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 517
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 420 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 479



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 258 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 317
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 318 ac 319
           ||
Sbjct: 62  ac 63



to top

>gb|AY832484.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_12 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 858

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 458 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 517
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 422 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 481



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 258 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 317
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 318 ac 319
           ||
Sbjct: 62  ac 63



to top

>gb|AY832483.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_11 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 863

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 458 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 517
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 420 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 479



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 258 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 317
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 318 ac 319
           ||
Sbjct: 62  ac 63



to top

>gb|AY832482.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_10 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 856

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 458 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 517
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 420 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 479



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 258 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 317
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 318 ac 319
           ||
Sbjct: 62  ac 63



to top

>gb|AY832481.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_9 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 858

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 458 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 517
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 422 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 481



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 258 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 317
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 318 ac 319
           ||
Sbjct: 62  ac 63



to top

>gb|AY832480.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_8 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 856

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 458 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 517
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 420 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 479



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 258 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 317
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 318 ac 319
           ||
Sbjct: 62  ac 63



to top

>gb|AY832479.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_7 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 858

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 458 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 517
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 422 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 481



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 258 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 317
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 318 ac 319
           ||
Sbjct: 62  ac 63



to top

>gb|AY832478.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_6 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 856

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 458 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 517
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 420 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 479



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 258 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 317
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 318 ac 319
           ||
Sbjct: 62  ac 63



to top

>gb|AY832477.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_5 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 858

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 458 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 517
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 422 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 481



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 258 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 317
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 318 ac 319
           ||
Sbjct: 62  ac 63



to top

>gb|AY832476.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_4 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 857

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 458 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 517
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 420 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 479



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 258 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 317
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 318 ac 319
           ||
Sbjct: 62  ac 63



to top

>gb|AY832475.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_3 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 856

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 458 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 517
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 420 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 479



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 258 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 317
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 318 ac 319
           ||
Sbjct: 62  ac 63



to top

>gb|AY832474.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_2 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 856

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 458 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 517
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 420 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 479



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 258 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 317
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 318 ac 319
           ||
Sbjct: 62  ac 63



to top

>gb|AY832473.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_1 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 858

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 458 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 517
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 422 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 481



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 258 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 317
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 318 ac 319
           ||
Sbjct: 62  ac 63



to top

>emb|AJ489279.1|CSA489279 Crocus sativus partial mRNA for ascorbate peroxidase
          Length = 525

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 59/68 (86%)
 Strand = Plus / Plus

                                                                       
Query: 225 atgggtttgagtgaccaggacattgttgctctttctggtggtcacaccctgggaagatgc 284
           ||||| ||||| ||| ||||||||||||| |||||||| || ||||| |||||||| || 
Sbjct: 445 atgggattgagcgacaaggacattgttgcgctttctggaggacacacactgggaaggtgt 504

                   
Query: 285 cacaagga 292
           ||||||||
Sbjct: 505 cacaagga 512



 Score = 44.1 bits (22), Expect = 0.58
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 9   gccgtcaggctgctcgagcccatcaaggagcagttccccatcctctccta 58
           |||||||||||  | || || ||||||||||||||||| ||| |||||||
Sbjct: 229 gccgtcaggctcttggaaccgatcaaggagcagttcccgatcatctccta 278



to top

>gb|AF127804.1|AF127804 Glycine max ascorbate peroxidase (apx1) mRNA, complete cds
          Length = 758

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 89/108 (82%)
 Strand = Plus / Plus

                                                                       
Query: 56  ctacgccgacttctaccagctcgctggagtcgtcgccgtcgaggtgaccggcgggcctga 115
           ||||||||| ||||||||| | ||||| || || ||||| ||||| ||||| || |||||
Sbjct: 276 ctacgccgatttctaccagttggctggcgttgttgccgttgaggtcaccggtggacctga 335

                                                           
Query: 116 ggttcccttccaccccgggagacaggacaagcccgagcctcctccaga 163
            ||||||||||| || || ||| ||||||| || ||||| || |||||
Sbjct: 336 agttcccttccatcctggaagagaggacaaacctgagccaccaccaga 383



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 182/233 (78%)
 Strand = Plus / Plus

                                                                       
Query: 285 cacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaac 344
           ||||||||| | ||||| || |||||  |||||||| | || ||| | || |||||||||
Sbjct: 505 cacaaggagcgttctggattcgagggtccctggacctctaatcctcttattttcgacaac 564

                                                                       
Query: 345 tcttacttcactgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgac 404
           || |||||||  ||| |  ||||||| ||||| ||||| || |||||| | ||  | |||
Sbjct: 565 tcatacttcaaggagttgttgagtggtgagaaagaaggcctccttcagctaccttctgac 624

                                                                       
Query: 405 aaggtcctgctgactgacccggccttccgcccacttgtggacaaatatgctgcggatgag 464
           ||||  ||  || ||||||| |  |||||||| ||||| || ||||||||  |||| || 
Sbjct: 625 aaggcacttttgtctgaccctgtgttccgccctcttgttgagaaatatgcatcggacgaa 684

                                                                
Query: 465 gatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 517
           ||||| ||||| ||||| ||||| ||||| ||||  ||||| ||||| |||||
Sbjct: 685 gatgccttcttcgctgattacgctgaggctcaccaaaagctttctgagcttgg 737



to top

>gb|AF158652.2|AF158652 Fragaria x ananassa cytosolic ascorbate peroxidase (ApxSC) gene,
            ApxSC-c allele, complete cds
          Length = 6436

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 35/36 (97%)
 Strand = Plus / Plus

                                                
Query: 237  gaccaggacattgttgctctttctggtggtcacacc 272
            |||||||||||||||||||| |||||||||||||||
Sbjct: 5071 gaccaggacattgttgctctctctggtggtcacacc 5106



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                        
Query: 138  caggacaagcccgagcctcctccagaaggccgtcttcctgatgc 181
            ||||||||||| || || || |||||||||||||||||||||||
Sbjct: 4888 caggacaagccagaaccaccaccagaaggccgtcttcctgatgc 4931



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                        
Query: 3    gacatcgccgtcaggctgctcgagcccatcaaggagcagttccccatcctctcctacgcc 62
            ||||| || ||||||||  | ||||| ||||||||||||||||| || ||||| || || 
Sbjct: 4085 gacattgctgtcaggctcttggagccgatcaaggagcagttccctattctctcttatgct 4144

                        
Query: 63   gacttctaccag 74
            ||||||||||||
Sbjct: 4145 gacttctaccag 4156



 Score = 48.1 bits (24), Expect = 0.037
 Identities = 78/96 (81%)
 Strand = Plus / Plus

                                                                        
Query: 364  tgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctgactgacc 423
            ||||||| ||||||||||| ||||| ||| | || || |||||||  || ||| | ||||
Sbjct: 5440 tgagtggagagaaggaaggccttctacagcttccaactgacaaggctcttctgtcagacc 5499

                                                
Query: 424  cggccttccgcccacttgtggacaaatatgctgcgg 459
            | | ||||||||| ||||| || ||||| |||||||
Sbjct: 5500 ctgtcttccgccctcttgttgagaaatacgctgcgg 5535



to top

>dbj|AB082932.1| Glycine max apx2 mRNA for cytosolic ascorbate peroxidase 2,
           complete cds
          Length = 840

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 89/108 (82%)
 Strand = Plus / Plus

                                                                       
Query: 56  ctacgccgacttctaccagctcgctggagtcgtcgccgtcgaggtgaccggcgggcctga 115
           ||||||||| ||||||||| | ||||| || || ||||| ||||| ||||| || |||||
Sbjct: 319 ctacgccgatttctaccagttggctggcgttgttgccgttgaggtcaccggtggacctga 378

                                                           
Query: 116 ggttcccttccaccccgggagacaggacaagcccgagcctcctccaga 163
            ||||||||||| || || ||| ||||||| || ||||| || |||||
Sbjct: 379 agttcccttccatcctggaagagaggacaaacctgagccaccaccaga 426



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 182/233 (78%)
 Strand = Plus / Plus

                                                                       
Query: 285 cacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaac 344
           ||||||||| | ||||| || |||||  |||||||| | || ||| | || |||||||||
Sbjct: 548 cacaaggagcgttctggattcgagggtccctggacctctaatcctcttattttcgacaac 607

                                                                       
Query: 345 tcttacttcactgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgac 404
           || |||||||  ||| |  ||||||| ||||| ||||| || |||||| | ||  | |||
Sbjct: 608 tcatacttcaaggagttgttgagtggtgagaaagaaggcctccttcagctaccttctgac 667

                                                                       
Query: 405 aaggtcctgctgactgacccggccttccgcccacttgtggacaaatatgctgcggatgag 464
           ||||  ||  || ||||||| |  |||||||| ||||| || ||||||||  |||| || 
Sbjct: 668 aaggcacttttgtctgaccctgtgttccgccctcttgttgagaaatatgcatcggacgaa 727

                                                                
Query: 465 gatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 517
           ||||| ||||| ||||| ||||| ||||| ||||  ||||| ||||| |||||
Sbjct: 728 gatgccttcttcgctgattacgctgaggctcaccaaaagctttctgagcttgg 780



to top

>gb|AF158653.1|AF158653 Fragaria x ananassa cytosolic ascorbate peroxidase APX19 gene,
            complete cds
          Length = 5393

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 35/36 (97%)
 Strand = Plus / Plus

                                                
Query: 237  gaccaggacattgttgctctttctggtggtcacacc 272
            |||||||||||||||||||| |||||||||||||||
Sbjct: 3903 gaccaggacattgttgctctctctggtggtcacacc 3938



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 62/72 (86%)
 Strand = Plus / Plus

                                                                        
Query: 3    gacatcgccgtcaggctgctcgagcccatcaaggagcagttccccatcctctcctacgcc 62
            ||||| || ||||||||  | ||||| ||||||||||||||||| || ||||| || |||
Sbjct: 2910 gacattgctgtcaggctcttggagccgatcaaggagcagttccctattctctcttatgcc 2969

                        
Query: 63   gacttctaccag 74
            ||||||||||||
Sbjct: 2970 gacttctaccag 2981



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                        
Query: 138  caggacaagcccgagcctcctccagaaggccgtcttcctgatgc 181
            ||||||||||| || || || |||||||||||||||||||||||
Sbjct: 3720 caggacaagccagaaccaccaccagaaggccgtcttcctgatgc 3763



 Score = 48.1 bits (24), Expect = 0.037
 Identities = 78/96 (81%)
 Strand = Plus / Plus

                                                                        
Query: 364  tgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctgactgacc 423
            ||||||| ||||||||||| ||||| ||| | || || |||||||  || ||| | ||||
Sbjct: 4348 tgagtggagagaaggaaggccttctacagcttccaactgacaaggctcttctgtcagacc 4407

                                                
Query: 424  cggccttccgcccacttgtggacaaatatgctgcgg 459
            | | ||||||||| ||||| || ||||| |||||||
Sbjct: 4408 ctgtcttccgccctcttgttgagaaatacgctgcgg 4443



to top

>gb|DQ246218.1| Litchi chinensis putative ascorbate peroxidase mRNA, partial cds
          Length = 420

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 237/305 (77%), Gaps = 3/305 (0%)
 Strand = Plus / Plus

                                                                       
Query: 15  aggctgctcgagcccatcaaggagcagttccccatcctctcctacgccgacttctaccag 74
           |||||| | ||||||||||||||||||||  | ||  | ||||| || || |||||||||
Sbjct: 118 aggctgttggagcccatcaaggagcagtttgcaatattgtcctatgcagatttctaccag 177

                                                                       
Query: 75  ctcgctggagtcgtcgccgtcgaggtgaccggcgggcctgaggttcccttccaccccggg 134
            | |||||||| ||  | || ||  | || || ||||||||| |||| |||||||| || 
Sbjct: 178 ttggctggagttgttactgtagaaattactggagggcctgagattcctttccacccggga 237

                                                                       
Query: 135 agacaggacaagcccgagcctcctccagaaggccgtcttcctgatgccacccaaggctct 194
           |||| ||||||  | || ||||| |||||||| ||  | |||| ||||||| |||| || 
Sbjct: 238 agaccggacaaatctgatcctcccccagaaggtcgcttgcctgctgccaccgaaggttca 297

                                                                       
Query: 195 gaccacctcaggcaggtgttttccactcagatgggtttgagtgaccaggacattgttgct 254
           |||||| | ||| | || |||     ||| |||||| | |||||  |||| |||||||| 
Sbjct: 298 gaccacttgagggatgtcttt---ggtcatatgggtctaagtgataaggatattgttgcc 354

                                                                       
Query: 255 ctttctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcc 314
            | ||||| |||||||||||||| || |||||||||||| | ||||| ||||| ||| ||
Sbjct: 355 ttatctggcggtcacaccctgggtaggtgccacaaggagcgttctggttttgaaggaccc 414

                
Query: 315 tggac 319
           |||||
Sbjct: 415 tggac 419



to top

>gb|U56634.1|GMU56634 Glycine max ascorbate peroxidase 2 (APx2) mRNA, complete cds
          Length = 1064

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 88/107 (82%)
 Strand = Plus / Plus

                                                                       
Query: 57  tacgccgacttctaccagctcgctggagtcgtcgccgtcgaggtgaccggcgggcctgag 116
           |||||||| ||||||||| | ||||| || || ||||| ||||| ||||| || ||||| 
Sbjct: 352 tacgccgatttctaccagttggctggcgttgttgccgttgaggtcaccggtggacctgaa 411

                                                          
Query: 117 gttcccttccaccccgggagacaggacaagcccgagcctcctccaga 163
           ||||||||||| || || ||| ||||||| || ||||| || |||||
Sbjct: 412 gttcccttccatcctggaagagaggacaaacctgagccaccaccaga 458



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 182/233 (78%)
 Strand = Plus / Plus

                                                                       
Query: 285 cacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaac 344
           ||||||||| | ||||| || |||||  |||||||| | || ||| | || |||||||||
Sbjct: 580 cacaaggagcgttctggattcgagggtccctggacctctaatcctcttattttcgacaac 639

                                                                       
Query: 345 tcttacttcactgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgac 404
           || |||||||  ||| |  ||||||| ||||| ||||| || |||||| | ||  | |||
Sbjct: 640 tcatacttcaaggagttgttgagtggtgagaaagaaggcctccttcagctaccttctgac 699

                                                                       
Query: 405 aaggtcctgctgactgacccggccttccgcccacttgtggacaaatatgctgcggatgag 464
           ||||  ||  || ||||||| |  |||||||| ||||| || ||||||||  |||| || 
Sbjct: 700 aaggcacttttgtctgaccctgtgttccgccctcttgttgagaaatatgcatcggacgaa 759

                                                                
Query: 465 gatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 517
           ||||| ||||| ||||| ||||| ||||| ||||  ||||| ||||| |||||
Sbjct: 760 gatgccttcttcgctgattacgctgaggctcaccaaaagctttctgagcttgg 812



to top

>gb|M93051.1|PEAAPXIA Pisum sativum ascorbate peroxidase (ApxI) gene, complete cds
          Length = 3625

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 37/39 (94%)
 Strand = Plus / Plus

                                                   
Query: 234  agtgaccaggacattgttgctctttctggtggtcacacc 272
            ||||| ||||||||||||||||| |||||||||||||||
Sbjct: 2417 agtgatcaggacattgttgctctatctggtggtcacacc 2455



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                        
Query: 458  ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 517
            |||||| ||||  ||||||||||| || || || ||||| || ||||||||||| |||||
Sbjct: 3089 ggatgaagatgttttctttgctgattatgctgaagcacatcttaagctctctgagcttgg 3148



to top

>dbj|AB243015.1| Codonopsis lanceolata mRNA for cytosolic ascorbate peroxidase,
           complete cds
          Length = 983

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 246 attgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctgg 301
           |||||| |||| || ||||||||||| |||||||| ||||||||||| || |||||
Sbjct: 497 attgttactctatccggtggtcacactctgggaaggtgccacaaggaaaggtctgg 552



to top

>dbj|D14442.1|ATHAPX1 Arabidopsis thaliana APX1 gene for ascorbate peroxidase, complete cds
          Length = 3050

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 67/80 (83%)
 Strand = Plus / Plus

                                                                        
Query: 275  gggaagatgccacaaggagagatctgggtttgagggagcctggaccgccaaccctttgat 334
            |||| ||||||||||||| || ||||| || || || || |||||  | |||||| | ||
Sbjct: 1723 gggacgatgccacaaggataggtctggcttcgaaggtgcatggacatcaaaccctctaat 1782

                                
Query: 335  cttcgacaactcttacttca 354
            ||||||||||||||||||||
Sbjct: 1783 cttcgacaactcttacttca 1802



 Score = 48.1 bits (24), Expect = 0.037
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 138  caggacaagcccgagcctcctccagaaggccgtcttcctgatgc 181
            |||||||||||| | || |||||||| || ||||||||||||||
Sbjct: 1495 caggacaagccccaaccacctccagagggtcgtcttcctgatgc 1538



to top

>gb|AF443182.1|AF443182 Nicotiana tabacum ascorbate peroxidase mRNA, partial cds
          Length = 457

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 91/112 (81%)
 Strand = Plus / Plus

                                                                       
Query: 241 aggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctg 300
           |||| |||||||| || |||||||| || ||| ||||||| |||||||||||  | ||||
Sbjct: 345 aggatattgttgcactctctggtggccataccttgggaaggtgccacaaggaacgttctg 404

                                                               
Query: 301 ggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttactt 352
           | ||||||||| | |||||  |||| ||  | ||||| |||||||| |||||
Sbjct: 405 gttttgagggaccttggactaccaatcccctcatctttgacaactcatactt 456



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 24  gagcccatcaaggagcagttccccatcctctc 55
           |||||||| ||||||||||| || ||||||||
Sbjct: 128 gagcccattaaggagcagtttcctatcctctc 159



to top

>gb|AC007583.2|F24B9 Arabidopsis thaliana chromosome 1 BAC F24B9 sequence, complete
            sequence
          Length = 107234

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                        
Query: 275  gggaagatgccacaaggagagatctgggtttgagggagcctggaccgccaaccctttgat 334
            |||| ||||||||||||| || ||||| || || || || |||||  | |||||| | ||
Sbjct: 6298 gggacgatgccacaaggataggtctggcttcgaaggtgcatggacatcaaaccctctaat 6239

                                
Query: 335  cttcgacaactcttacttca 354
            ||||||||||||||||||||
Sbjct: 6238 cttcgacaactcttacttca 6219



 Score = 48.1 bits (24), Expect = 0.037
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 138  caggacaagcccgagcctcctccagaaggccgtcttcctgatgc 181
            |||||||||||| | || |||||||| || ||||||||||||||
Sbjct: 6526 caggacaagccccaaccacctccagagggtcgtcttcctgatgc 6483



to top

>gb|AF146521.1|AF146521 Musa acuminata ascorbate peroxidase mRNA, partial cds
          Length = 346

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 162/206 (78%), Gaps = 3/206 (1%)
 Strand = Plus / Plus

                                                                       
Query: 162 gaaggccgtcttcctgatgccacccaaggctctgaccacctcaggcaggtgttttccact 221
           |||||||| || |||||||||||  |||| || |||||||||||| | ||||||  |   
Sbjct: 35  gaaggccgcctgcctgatgccacaaaaggttcggaccacctcagggatgtgtttggc--- 91

                                                                       
Query: 222 cagatgggtttgagtgaccaggacattgttgctctttctggtggtcacaccctgggaaga 281
           || |||||| | || || ||||| || ||||| || || ||||| |||||  |||| |||
Sbjct: 92  cacatgggtctcagcgatcaggatatcgttgcgctctccggtgggcacacggtggggaga 151

                                                                       
Query: 282 tgccacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgac 341
           |||||||||||| | || || || |||||||| |||||  |||| ||| | || ||||| 
Sbjct: 152 tgccacaaggagcgctccggtttcgagggagcttggacttccaatcctcttattttcgat 211

                                     
Query: 342 aactcttacttcactgagctcctgag 367
           ||||| || ||||  |||||||||||
Sbjct: 212 aactcctatttcaaggagctcctgag 237



to top

>gb|U63815.1|ATU63815 Arabidopsis thaliana AT.I.24-1, AT.I.24-2, AT.I.24-3, AT.I.24-4,
             AT.I.24-5, AT.I.24-6, AT.I.24-9 and AT.I.24-14 genes,
             partial cds, AT.I.24-7, ascorbate peroxidase (ATHAPX1),
             EF-1alpha-A1, -A2 and -A3 (EF-1alpha) and AT.I.24-13
             genes, complete cds
          Length = 63093

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 67/80 (83%)
 Strand = Plus / Plus

                                                                         
Query: 275   gggaagatgccacaaggagagatctgggtttgagggagcctggaccgccaaccctttgat 334
             |||| ||||||||||||| || ||||| || || || || |||||  | |||||| | ||
Sbjct: 23414 gggacgatgccacaaggataggtctggcttcgaaggtgcatggacatcaaaccctctaat 23473

                                 
Query: 335   cttcgacaactcttacttca 354
             ||||||||||||||||||||
Sbjct: 23474 cttcgacaactcttacttca 23493



 Score = 48.1 bits (24), Expect = 0.037
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                         
Query: 138   caggacaagcccgagcctcctccagaaggccgtcttcctgatgc 181
             |||||||||||| | || |||||||| || ||||||||||||||
Sbjct: 23186 caggacaagccccaaccacctccagagggtcgtcttcctgatgc 23229



to top

>gb|DQ442396.1| Striga asiatica clone St543 ascorbate peroxidase mRNA, partial cds
          Length = 459

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 86/106 (81%)
 Strand = Plus / Plus

                                                                       
Query: 241 aggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctg 300
           |||||||||||||  | |||||||| ||||| ||||||||   ||| |||||  | ||||
Sbjct: 352 aggacattgttgcattgtctggtggccacactctgggaagggcccataaggaacggtctg 411

                                                         
Query: 301 ggtttgagggagcctggaccgccaaccctttgatcttcgacaactc 346
           | ||||||||| ||||||| |  |||||| | ||||| ||||||||
Sbjct: 412 gatttgagggaccctggactgaaaaccctctcatctttgacaactc 457



 Score = 44.1 bits (22), Expect = 0.58
 Identities = 85/106 (80%)
 Strand = Plus / Plus

                                                                       
Query: 25  agcccatcaaggagcagttccccatcctctcctacgccgacttctaccagctcgctggag 84
           |||| |||||||| || ||||||||||| || || || |||||||| ||| | |||||||
Sbjct: 136 agccaatcaaggatcaattccccatcctttcttatgctgacttctatcagttggctggag 195

                                                         
Query: 85  tcgtcgccgtcgaggtgaccggcgggcctgaggttcccttccaccc 130
           | || || || || ||||| || || |||||  |||| ||||||||
Sbjct: 196 ttgtagcagttgaagtgactggaggacctgaaattccattccaccc 241



to top

>gb|AF326783.1|AF326783 Pinus strobus ascorbate peroxidase (APX) mRNA, partial cds
          Length = 568

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Plus

                                                                       
Query: 13  tcaggctgctcgagcccatcaaggagcagttccccatcctctcctacgccgacttctacc 72
           |||||||||| || ||||||||||||||||| || |   | || |||||||| ||||| |
Sbjct: 116 tcaggctgctggaacccatcaaggagcagtttcctacaatttcatacgccgatttctatc 175

                     
Query: 73  agctcgctgg 82
           ||||||||||
Sbjct: 176 agctcgctgg 185



to top

>ref|NM_111798.2| Arabidopsis thaliana APX2 (ASCORBATE PEROXIDASE 2); L-ascorbate
           peroxidase AT3G09640 (APX2) transcript variant
           AT3G09640.1 mRNA, complete cds
          Length = 756

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 64/77 (83%)
 Strand = Plus / Plus

                                                                       
Query: 9   gccgtcaggctgctcgagcccatcaaggagcagttccccatcctctcctacgccgacttc 68
           ||||| ||||| || || || |||||||||| |||||| || || || || || ||||||
Sbjct: 232 gccgttaggcttcttgaccctatcaaggagctgttccctattctgtcatatgctgacttc 291

                            
Query: 69  taccagctcgctggagt 85
           |||||||| ||||||||
Sbjct: 292 taccagctagctggagt 308



 Score = 44.1 bits (22), Expect = 0.58
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 434 cccacttgtggacaaatatgctgcggatgaggatgcgttctt 475
           |||| |||| || ||||||||||| ||||||||||| |||||
Sbjct: 654 cccatttgttgaaaaatatgctgcagatgaggatgccttctt 695



to top

>ref|NM_001035587.1| Arabidopsis thaliana APX2 (ASCORBATE PEROXIDASE 2); L-ascorbate
           peroxidase AT3G09640 (APX2) transcript variant
           AT3G09640.2 mRNA, complete cds
          Length = 1065

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 64/77 (83%)
 Strand = Plus / Plus

                                                                       
Query: 9   gccgtcaggctgctcgagcccatcaaggagcagttccccatcctctcctacgccgacttc 68
           ||||| ||||| || || || |||||||||| |||||| || || || || || ||||||
Sbjct: 377 gccgttaggcttcttgaccctatcaaggagctgttccctattctgtcatatgctgacttc 436

                            
Query: 69  taccagctcgctggagt 85
           |||||||| ||||||||
Sbjct: 437 taccagctagctggagt 453



 Score = 44.1 bits (22), Expect = 0.58
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 434 cccacttgtggacaaatatgctgcggatgaggatgcgttctt 475
           |||| |||| || ||||||||||| ||||||||||| |||||
Sbjct: 799 cccatttgttgaaaaatatgctgcagatgaggatgccttctt 840



to top

>gb|DQ446651.1| Arabidopsis thaliana clone pENTR221-At3g09640 L-ascorbate
           peroxidase 1b (At3g09640) mRNA, complete cds
          Length = 756

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 64/77 (83%)
 Strand = Plus / Plus

                                                                       
Query: 9   gccgtcaggctgctcgagcccatcaaggagcagttccccatcctctcctacgccgacttc 68
           ||||| ||||| || || || |||||||||| |||||| || || || || || ||||||
Sbjct: 232 gccgttaggcttcttgaccctatcaaggagctgttccctattctgtcatatgctgacttc 291

                            
Query: 69  taccagctcgctggagt 85
           |||||||| ||||||||
Sbjct: 292 taccagctagctggagt 308



 Score = 44.1 bits (22), Expect = 0.58
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 434 cccacttgtggacaaatatgctgcggatgaggatgcgttctt 475
           |||| |||| || ||||||||||| ||||||||||| |||||
Sbjct: 654 cccatttgttgaaaaatatgctgcagatgaggatgccttctt 695



to top

>emb|X98275.1|ATAPCYT A.thaliana mRNA for ascorbate peroxidase, cytosolic (APX2)
          Length = 756

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 64/77 (83%)
 Strand = Plus / Plus

                                                                       
Query: 9   gccgtcaggctgctcgagcccatcaaggagcagttccccatcctctcctacgccgacttc 68
           ||||| ||||| || || || |||||||||| |||||| || || || || || ||||||
Sbjct: 232 gccgttaggcttcttgaccctatcaaggagctgttccctattctgtcatatgctgacttc 291

                            
Query: 69  taccagctcgctggagt 85
           |||||||| ||||||||
Sbjct: 292 taccagctagctggagt 308



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 434 cccacttgtggacaaatatgctgcggatgaggatgc 469
           |||| |||| || ||||||||||| |||||||||||
Sbjct: 654 cccatttgttgaaaaatatgctgcagatgaggatgc 689



to top

>dbj|AK176821.1| Arabidopsis thaliana mRNA for putative ascorbate peroxidase,
           complete cds, clone: RAFL25-37-O10
          Length = 992

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 64/77 (83%)
 Strand = Plus / Plus

                                                                       
Query: 9   gccgtcaggctgctcgagcccatcaaggagcagttccccatcctctcctacgccgacttc 68
           ||||| ||||| || || || |||||||||| |||||| || || || || || ||||||
Sbjct: 294 gccgttaggcttcttgaccctatcaaggagctgttccctattctgtcatatgctgacttc 353

                            
Query: 69  taccagctcgctggagt 85
           |||||||| ||||||||
Sbjct: 354 taccagctagctggagt 370



 Score = 44.1 bits (22), Expect = 0.58
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 434 cccacttgtggacaaatatgctgcggatgaggatgcgttctt 475
           |||| |||| || ||||||||||| ||||||||||| |||||
Sbjct: 716 cccatttgttgaaaaatatgctgcagatgaggatgccttctt 757



to top

>dbj|AK176908.1| Arabidopsis thaliana mRNA for putative ascorbate peroxidase,
           complete cds, clone: RAFL25-48-E13
          Length = 1075

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 64/77 (83%)
 Strand = Plus / Plus

                                                                       
Query: 9   gccgtcaggctgctcgagcccatcaaggagcagttccccatcctctcctacgccgacttc 68
           ||||| ||||| || || || |||||||||| |||||| || || || || || ||||||
Sbjct: 377 gccgttaggcttcttgaccctatcaaggagctgttccctattctgtcatatgctgacttc 436

                            
Query: 69  taccagctcgctggagt 85
           |||||||| ||||||||
Sbjct: 437 taccagctagctggagt 453



 Score = 44.1 bits (22), Expect = 0.58
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 434 cccacttgtggacaaatatgctgcggatgaggatgcgttctt 475
           |||| |||| || ||||||||||| ||||||||||| |||||
Sbjct: 799 cccatttgttgaaaaatatgctgcagatgaggatgccttctt 840



to top

>ref|NM_116947.2| Arabidopsis thaliana peroxidase AT4G08770 mRNA, complete cds
          Length = 1235

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 249 gttgctctttctggtggtcacacc 272
           ||||||||||||||||||||||||
Sbjct: 606 gttgctctttctggtggtcacacc 629



to top

>gb|BT000180.1| Arabidopsis thaliana peroxidase C2 precursor-like protein
           (At4g08770) mRNA, complete cds
          Length = 1126

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 249 gttgctctttctggtggtcacacc 272
           ||||||||||||||||||||||||
Sbjct: 556 gttgctctttctggtggtcacacc 579



to top

>emb|AJ493275.1|PPA493275 Physcomitrella patens mRNA for putative ascorbate peroxidase
          Length = 1145

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 57  tacgccgacttctaccagctcgctggagtcgtcgccgtcgaggtgaccggcgggcc 112
           ||||| ||||| |||  ||| ||||||||||| ||||| |||||||| ||||||||
Sbjct: 364 tacgctgacttttacacgctggctggagtcgttgccgtggaggtgacaggcgggcc 419



to top

>gb|AY136364.1| Arabidopsis thaliana peroxidase C2 precursor-like protein
           (At4g08770) mRNA, complete cds
          Length = 1210

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 249 gttgctctttctggtggtcacacc 272
           ||||||||||||||||||||||||
Sbjct: 606 gttgctctttctggtggtcacacc 629



to top

>gb|AF452387.1| Arabidopsis thaliana class III peroxidase ATP38 mRNA, complete cds
          Length = 1174

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 249 gttgctctttctggtggtcacacc 272
           ||||||||||||||||||||||||
Sbjct: 567 gttgctctttctggtggtcacacc 590



to top

>gb|AY742959.1| Solanum tuberosum cytosolic ascorbate peroxidase (APX) mRNA,
           partial cds
          Length = 277

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 47/55 (85%)
 Strand = Plus / Plus

                                                                  
Query: 458 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaa 512
           |||||| ||||| |||||||||||||| || ||||| ||| | ||||| ||||||
Sbjct: 11  ggatgaagatgccttctttgctgactatgctgaggctcacttgaagctttctgaa 65



to top

>gb|U61379.1|VUU61379 Vigna unguiculata cytosolic ascorbate peroxidase mRNA, complete cds
          Length = 1117

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 234 agtgaccaggacattgttgctctttctggtggtcacacc 272
           ||||| ||||| ||||||||||| |||||||| ||||||
Sbjct: 543 agtgatcaggatattgttgctctatctggtggccacacc 581



to top

>gb|AC145164.11| Medicago truncatula clone mth2-27j21, complete sequence
          Length = 110295

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                    
Query: 234   agtgaccaggacattgttgctctttctggtggtcacacc 272
             |||||||||||||| |||||| | |||||||| ||||||
Sbjct: 20123 agtgaccaggacatcgttgctttgtctggtggccacacc 20085



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 74/91 (81%)
 Strand = Plus / Minus

                                                                         
Query: 367   gtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctgactgacccgg 426
             |||| ||||||||||| |||||||||||||| |  || ||||  ||  |||  ||||| |
Sbjct: 19615 gtggtgagaaggaaggccttcttcagttgccaagtgataaggcacttttgagcgaccctg 19556

                                            
Query: 427   ccttccgcccacttgtggacaaatatgctgc 457
               |||||||||||||| || |||||||||||
Sbjct: 19555 tattccgcccacttgttgagaaatatgctgc 19525



to top

>gb|AC137668.18| Medicago truncatula clone mth2-5f8, complete sequence
          Length = 133085

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                     
Query: 234    agtgaccaggacattgttgctctttctggtggtcacacc 272
              |||||||||||||| |||||| | |||||||| ||||||
Sbjct: 116602 agtgaccaggacatcgttgctttgtctggtggccacacc 116564



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 74/91 (81%)
 Strand = Plus / Minus

                                                                          
Query: 367    gtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctgactgacccgg 426
              |||| ||||||||||| |||||||||||||| |  || ||||  ||  |||  ||||| |
Sbjct: 116094 gtggtgagaaggaaggccttcttcagttgccaagtgataaggcacttttgagcgaccctg 116035

                                             
Query: 427    ccttccgcccacttgtggacaaatatgctgc 457
                |||||||||||||| || |||||||||||
Sbjct: 116034 tattccgcccacttgttgagaaatatgctgc 116004



to top

>emb|Y16773.1|LEAPX Lycopersicaon esculentum APX gene, complete CDS
          Length = 4460

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 47/55 (85%)
 Strand = Plus / Plus

                                                                   
Query: 458  ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaa 512
            |||||| ||||| |||||||||||||| || ||||| ||| | ||||| ||||||
Sbjct: 3855 ggatgaagatgccttctttgctgactatgctgaggctcacttgaagctttctgaa 3909



to top

>ref|XM_517658.1| PREDICTED: Pan troglodytes similar to very large G-protein coupled
           receptor 1; very large G protein-coupled receptor 1; G
           protein-coupled receptor 98 (LOC461757), mRNA
          Length = 19057

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 259 ctggtggtcacaccctgggaagatgc 284
           |||||||||||||| |||||||||||
Sbjct: 400 ctggtggtcacaccatgggaagatgc 425



to top

>gb|AC157986.4| Mus musculus chromosome 19, clone RP23-160F18, complete sequence
          Length = 207504

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 288   aaggagagatctgggtttgagg 309
             ||||||||||||||||||||||
Sbjct: 45044 aaggagagatctgggtttgagg 45023



to top

>gb|AC093529.2| Homo sapiens chromosome 5 clone RP11-29K14, complete sequence
          Length = 109306

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 259    ctggtggtcacaccctgggaagatgc 284
              |||||||||||||| |||||||||||
Sbjct: 103531 ctggtggtcacaccatgggaagatgc 103506



to top

>gb|AC027323.5| Homo sapiens chromosome 5 clone CTD-2034A10, complete sequence
          Length = 140016

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 259  ctggtggtcacaccctgggaagatgc 284
            |||||||||||||| |||||||||||
Sbjct: 9379 ctggtggtcacaccatgggaagatgc 9354



to top

>dbj|AK020572.1| Mus musculus adult male urinary bladder cDNA, RIKEN full-length
           enriched library, clone:9530025L08
           product:unclassifiable, full insert sequence
          Length = 1019

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 288 aaggagagatctgggtttgagg 309
           ||||||||||||||||||||||
Sbjct: 73  aaggagagatctgggtttgagg 94



to top

>gb|AC102722.7| Mus musculus chromosome 19, clone RP24-108O16, complete sequence
          Length = 141681

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 288   aaggagagatctgggtttgagg 309
             ||||||||||||||||||||||
Sbjct: 95177 aaggagagatctgggtttgagg 95198



to top

>gb|AC139062.10| Mus musculus chromosome 17, clone RP23-69L11, complete sequence
          Length = 136224

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 171   cttcctgatgccacccaaggc 191
             |||||||||||||||||||||
Sbjct: 35356 cttcctgatgccacccaaggc 35376



to top

>gb|AC119181.11| Mus musculus chromosome 18, clone RP24-111I16, complete sequence
          Length = 195506

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 494    acacctcaagctctctgaact 514
              |||||||||||||||||||||
Sbjct: 177365 acacctcaagctctctgaact 177385



to top

>gb|AC131185.4| Mus musculus BAC clone RP23-402H1 from chromosome 19, complete sequence
          Length = 208584

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 108    gggcctgaggttcccttccac 128
              |||||||||||||||||||||
Sbjct: 113457 gggcctgaggttcccttccac 113477



to top

>gb|AC162901.4| Mus musculus BAC clone RP23-417K5 from chromosome 8, complete sequence
          Length = 205244

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 528    gcgtctgagggctgctgctga 548
              |||||||||||||||||||||
Sbjct: 101515 gcgtctgagggctgctgctga 101495



to top

>gb|CP000009.1| Gluconobacter oxydans 621H, complete genome
          Length = 2702173

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 453     gctgcggatgaggatgcgttc 473
               |||||||||||||||||||||
Sbjct: 1358119 gctgcggatgaggatgcgttc 1358099



to top

>gb|AC124491.5| Mus musculus BAC clone RP23-454B2 from chromosome 8, complete sequence
          Length = 187779

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 528   gcgtctgagggctgctgctga 548
             |||||||||||||||||||||
Sbjct: 32993 gcgtctgagggctgctgctga 33013



to top

>gb|AC165153.2| Mus musculus BAC clone RP23-359L1 from chromosome 17, complete sequence
          Length = 219548

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 171    cttcctgatgccacccaaggc 191
              |||||||||||||||||||||
Sbjct: 134384 cttcctgatgccacccaaggc 134364



to top

>ref|XM_527102.1| PREDICTED: Pan troglodytes similar to mKIAA1935 protein
           (LOC471724), mRNA
          Length = 1617

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 115 aggttcccttccaccccggg 134
           ||||||||||||||||||||
Sbjct: 750 aggttcccttccaccccggg 769



to top

>gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence
          Length = 3694126

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 89      cgccgtcgaggtgaccggcg 108
               ||||||||||||||||||||
Sbjct: 1417443 cgccgtcgaggtgaccggcg 1417462



to top

>ref|XM_960403.1| Neurospora crassa OR74A hypothetical protein (NCU01865.1) partial
           mRNA
          Length = 2049

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 65  cttctaccagctcgctggag 84
           ||||||||||||||||||||
Sbjct: 309 cttctaccagctcgctggag 328



to top

>ref|XM_329054.1| Neurospora crassa OR74A hypothetical protein (NCU01865.1) partial
           mRNA
          Length = 2049

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 65  cttctaccagctcgctggag 84
           ||||||||||||||||||||
Sbjct: 309 cttctaccagctcgctggag 328



to top

>ref|XM_608956.2| PREDICTED: Bos taurus similar to Nucleolar preribosomal-associated
            protein 1 (LOC530483), mRNA
          Length = 8377

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 358  agctcctgagtggggagaag 377
            ||||||||||||||||||||
Sbjct: 1199 agctcctgagtggggagaag 1218



to top

>gb|AC134560.5| Mus musculus BAC clone RP24-100B13 from chromosome 16, complete sequence
          Length = 175179

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 358    agctcctgagtggggagaag 377
              ||||||||||||||||||||
Sbjct: 151918 agctcctgagtggggagaag 151937



to top

>ref|XM_981494.1| PREDICTED: Mus musculus similar to Nucleolar
           preribosomal-associated protein 1 (LOC670473), mRNA
          Length = 1619

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 358 agctcctgagtggggagaag 377
           ||||||||||||||||||||
Sbjct: 671 agctcctgagtggggagaag 690



to top

>ref|XM_489612.4| PREDICTED: Mus musculus RIKEN cDNA 4921511H13 gene (4921511H13Rik),
           mRNA
          Length = 7482

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 358 agctcctgagtggggagaag 377
           ||||||||||||||||||||
Sbjct: 300 agctcctgagtggggagaag 319



to top

>ref|XM_904396.2| PREDICTED: Mus musculus RIKEN cDNA 4921511H13 gene (4921511H13Rik),
           mRNA
          Length = 7482

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 358 agctcctgagtggggagaag 377
           ||||||||||||||||||||
Sbjct: 300 agctcctgagtggggagaag 319



to top

>ref|XM_975719.1| PREDICTED: Mus musculus similar to AIDA-1b, transcript variant 7
            (LOC544718), mRNA
          Length = 3873

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 199  acctcaggcaggtgttttccactc 222
            |||||||||||| |||||||||||
Sbjct: 2927 acctcaggcaggggttttccactc 2950



to top

>ref|XM_975691.1| PREDICTED: Mus musculus similar to AIDA-1b, transcript variant 6
            (LOC544718), mRNA
          Length = 4510

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 199  acctcaggcaggtgttttccactc 222
            |||||||||||| |||||||||||
Sbjct: 3564 acctcaggcaggggttttccactc 3587



to top

>ref|XM_975823.1| PREDICTED: Mus musculus similar to AIDA-1b, transcript variant 10
            (LOC544718), mRNA
          Length = 5052

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 199  acctcaggcaggtgttttccactc 222
            |||||||||||| |||||||||||
Sbjct: 4106 acctcaggcaggggttttccactc 4129



to top

>ref|XM_975853.1| PREDICTED: Mus musculus similar to AIDA-1b, transcript variant 11
            (LOC544718), mRNA
          Length = 7565

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 199  acctcaggcaggtgttttccactc 222
            |||||||||||| |||||||||||
Sbjct: 6619 acctcaggcaggggttttccactc 6642



to top

>ref|XM_975757.1| PREDICTED: Mus musculus similar to AIDA-1b, transcript variant 8
            (LOC544718), mRNA
          Length = 5127

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 199  acctcaggcaggtgttttccactc 222
            |||||||||||| |||||||||||
Sbjct: 4181 acctcaggcaggggttttccactc 4204



to top

>ref|XM_975884.1| PREDICTED: Mus musculus similar to AIDA-1b, transcript variant 12
            (LOC544718), mRNA
          Length = 5232

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 199  acctcaggcaggtgttttccactc 222
            |||||||||||| |||||||||||
Sbjct: 4286 acctcaggcaggggttttccactc 4309



to top

>ref|XM_975790.1| PREDICTED: Mus musculus similar to AIDA-1b, transcript variant 9
            (LOC544718), mRNA
          Length = 5304

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 199  acctcaggcaggtgttttccactc 222
            |||||||||||| |||||||||||
Sbjct: 4358 acctcaggcaggggttttccactc 4381



to top

>ref|XM_975534.1| PREDICTED: Mus musculus similar to AIDA-1b, transcript variant 2
            (LOC544718), mRNA
          Length = 7333

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 199  acctcaggcaggtgttttccactc 222
            |||||||||||| |||||||||||
Sbjct: 6387 acctcaggcaggggttttccactc 6410



to top

>ref|XM_001002918.1| PREDICTED: Mus musculus ankyrin repeat and sterile alpha motif domain
            containing 1B, transcript variant 19 (Anks1b), mRNA
          Length = 3873

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 199  acctcaggcaggtgttttccactc 222
            |||||||||||| |||||||||||
Sbjct: 2927 acctcaggcaggggttttccactc 2950



to top

>ref|XM_924927.2| PREDICTED: Mus musculus ankyrin repeat and sterile alpha motif domain
            containing 1B, transcript variant 13 (Anks1b), mRNA
          Length = 7565

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 199  acctcaggcaggtgttttccactc 222
            |||||||||||| |||||||||||
Sbjct: 6619 acctcaggcaggggttttccactc 6642



to top

>ref|XM_924933.2| PREDICTED: Mus musculus ankyrin repeat and sterile alpha motif domain
            containing 1B, transcript variant 17 (Anks1b), mRNA
          Length = 5052

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 199  acctcaggcaggtgttttccactc 222
            |||||||||||| |||||||||||
Sbjct: 4106 acctcaggcaggggttttccactc 4129



to top

>ref|XM_924929.2| PREDICTED: Mus musculus ankyrin repeat and sterile alpha motif domain
            containing 1B, transcript variant 15 (Anks1b), mRNA
          Length = 5127

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 199  acctcaggcaggtgttttccactc 222
            |||||||||||| |||||||||||
Sbjct: 4181 acctcaggcaggggttttccactc 4204



to top

>ref|XM_924921.2| PREDICTED: Mus musculus ankyrin repeat and sterile alpha motif domain
            containing 1B, transcript variant 10 (Anks1b), mRNA
          Length = 5232

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 199  acctcaggcaggtgttttccactc 222
            |||||||||||| |||||||||||
Sbjct: 4286 acctcaggcaggggttttccactc 4309



to top

>ref|XM_924931.2| PREDICTED: Mus musculus ankyrin repeat and sterile alpha motif domain
            containing 1B, transcript variant 16 (Anks1b), mRNA
          Length = 5304

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 199  acctcaggcaggtgttttccactc 222
            |||||||||||| |||||||||||
Sbjct: 4358 acctcaggcaggggttttccactc 4381



to top

>ref|XM_917405.2| PREDICTED: Mus musculus ankyrin repeat and sterile alpha motif domain
            containing 1B, transcript variant 9 (Anks1b), mRNA
          Length = 7333

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 199  acctcaggcaggtgttttccactc 222
            |||||||||||| |||||||||||
Sbjct: 6387 acctcaggcaggggttttccactc 6410



to top

>ref|XM_001003427.1| PREDICTED: Mus musculus ankyrin repeat and sterile alpha motif domain
            containing 1B, transcript variant 7 (Anks1b), mRNA
          Length = 3873

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 199  acctcaggcaggtgttttccactc 222
            |||||||||||| |||||||||||
Sbjct: 2927 acctcaggcaggggttttccactc 2950



to top

>ref|XM_001003423.1| PREDICTED: Mus musculus ankyrin repeat and sterile alpha motif domain
            containing 1B, transcript variant 6 (Anks1b), mRNA
          Length = 4510

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 199  acctcaggcaggtgttttccactc 222
            |||||||||||| |||||||||||
Sbjct: 3564 acctcaggcaggggttttccactc 3587



to top

>ref|XM_001003446.1| PREDICTED: Mus musculus ankyrin repeat and sterile alpha motif domain
            containing 1B, transcript variant 11 (Anks1b), mRNA
          Length = 7565

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 199  acctcaggcaggtgttttccactc 222
            |||||||||||| |||||||||||
Sbjct: 6619 acctcaggcaggggttttccactc 6642



to top

>ref|XM_001003440.1| PREDICTED: Mus musculus ankyrin repeat and sterile alpha motif domain
            containing 1B, transcript variant 10 (Anks1b), mRNA
          Length = 5052

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 199  acctcaggcaggtgttttccactc 222
            |||||||||||| |||||||||||
Sbjct: 4106 acctcaggcaggggttttccactc 4129



to top

>ref|XM_001003432.1| PREDICTED: Mus musculus ankyrin repeat and sterile alpha motif domain
            containing 1B, transcript variant 8 (Anks1b), mRNA
          Length = 5127

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 199  acctcaggcaggtgttttccactc 222
            |||||||||||| |||||||||||
Sbjct: 4181 acctcaggcaggggttttccactc 4204



to top

>ref|XM_001003455.1| PREDICTED: Mus musculus ankyrin repeat and sterile alpha motif domain
            containing 1B, transcript variant 12 (Anks1b), mRNA
          Length = 5232

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 199  acctcaggcaggtgttttccactc 222
            |||||||||||| |||||||||||
Sbjct: 4286 acctcaggcaggggttttccactc 4309



to top

>ref|XM_001003434.1| PREDICTED: Mus musculus ankyrin repeat and sterile alpha motif domain
            containing 1B, transcript variant 9 (Anks1b), mRNA
          Length = 5304

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 199  acctcaggcaggtgttttccactc 222
            |||||||||||| |||||||||||
Sbjct: 4358 acctcaggcaggggttttccactc 4381



to top

>ref|XM_001003400.1| PREDICTED: Mus musculus ankyrin repeat and sterile alpha motif domain
            containing 1B, transcript variant 2 (Anks1b), mRNA
          Length = 7813

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 199  acctcaggcaggtgttttccactc 222
            |||||||||||| |||||||||||
Sbjct: 6867 acctcaggcaggggttttccactc 6890



to top

>ref|XM_536448.2| PREDICTED: Canis familiaris similar to PWWP domain containing 2,
           transcript variant 1 (LOC479310), mRNA
          Length = 1510

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 115 aggttcccttccaccccggg 134
           ||||||||||||||||||||
Sbjct: 980 aggttcccttccaccccggg 999



to top

>ref|XM_862066.1| PREDICTED: Canis familiaris similar to PWWP domain containing 2,
           transcript variant 3 (LOC479310), mRNA
          Length = 1170

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 115 aggttcccttccaccccggg 134
           ||||||||||||||||||||
Sbjct: 980 aggttcccttccaccccggg 999



to top

>ref|XM_848192.1| PREDICTED: Canis familiaris similar to PWWP domain containing 2,
           transcript variant 2 (LOC479310), mRNA
          Length = 2031

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 115 aggttcccttccaccccggg 134
           ||||||||||||||||||||
Sbjct: 980 aggttcccttccaccccggg 999



to top

>emb|Z95116.1|HS57G9 Human DNA sequence from clone CTA-57G9 on chromosome 22q12.1, complete
             sequence
          Length = 113872

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 216   tccactcagatgggtttgag 235
             ||||||||||||||||||||
Sbjct: 33207 tccactcagatgggtttgag 33188



to top

>ref|XM_779767.1| PREDICTED: Strongylocentrotus purpuratus similar to Ankyrin repeat
            and SAM domain containing protein 1 (LOC579663), mRNA
          Length = 4386

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 459  gatgaggatgcgttctttgc 478
            ||||||||||||||||||||
Sbjct: 2401 gatgaggatgcgttctttgc 2382



to top

>emb|BX842681.1| Neurospora crassa DNA linkage group I BAC clone B13N4
          Length = 78124

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 65    cttctaccagctcgctggag 84
             ||||||||||||||||||||
Sbjct: 15716 cttctaccagctcgctggag 15697



to top

>emb|CR858482.1| Pongo pygmaeus mRNA; cDNA DKFZp469D094 (from clone DKFZp469D094)
          Length = 4768

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 251  tgctctttctggtggtcaca 270
            ||||||||||||||||||||
Sbjct: 1230 tgctctttctggtggtcaca 1211



to top

>dbj|AB188037.1| Uncultured bacterium gene for 16S rRNA, partial sequence, clone:
           Niitsu39-12
          Length = 499

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 159 ccagaaggccgtcttcctga 178
           ||||||||||||||||||||
Sbjct: 416 ccagaaggccgtcttcctga 397



to top

>dbj|AK055921.1| Homo sapiens cDNA FLJ31359 fis, clone MESAN2000501, weakly similar
           to Homo sapiens DNA cytosine methyltransferase 3 alpha
           (DNMT3A) mRNA
          Length = 2608

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 115 aggttcccttccaccccggg 134
           ||||||||||||||||||||
Sbjct: 683 aggttcccttccaccccggg 702



to top

>gb|BC105110.1| Homo sapiens MSTP101, mRNA (cDNA clone MGC:132770 IMAGE:8144113),
            complete cds
          Length = 1741

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 115  aggttcccttccaccccggg 134
            ||||||||||||||||||||
Sbjct: 1435 aggttcccttccaccccggg 1454



to top

>gb|BC035076.2| Homo sapiens MSTP101, mRNA (cDNA clone IMAGE:5260356), partial cds
          Length = 2371

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 115  aggttcccttccaccccggg 134
            ||||||||||||||||||||
Sbjct: 1436 aggttcccttccaccccggg 1455



to top

>gb|AC008706.5| Homo sapiens chromosome 5 clone CTB-77M23, complete sequence
          Length = 164394

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 115   aggttcccttccaccccggg 134
             ||||||||||||||||||||
Sbjct: 88199 aggttcccttccaccccggg 88218



to top

>gb|AC091062.5| Homo sapiens chromosome 17, clone RP11-506D12, complete sequence
          Length = 81278

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    aggagcagttccccatcctc 53
             ||||||||||||||||||||
Sbjct: 46914 aggagcagttccccatcctc 46895



to top

>ref|XM_940683.1| PREDICTED: Homo sapiens KIAA1935 protein (KIAA1935), mRNA
          Length = 4145

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 115  aggttcccttccaccccggg 134
            ||||||||||||||||||||
Sbjct: 1593 aggttcccttccaccccggg 1612



to top

>ref|XM_087672.5| PREDICTED: Homo sapiens KIAA1935 protein (KIAA1935), mRNA
          Length = 4144

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 115  aggttcccttccaccccggg 134
            ||||||||||||||||||||
Sbjct: 1593 aggttcccttccaccccggg 1612



to top

>dbj|AK050735.1| Mus musculus 9 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:D030012J21 product:hypothetical
           protein, full insert sequence
          Length = 2184

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 358 agctcctgagtggggagaag 377
           ||||||||||||||||||||
Sbjct: 301 agctcctgagtggggagaag 320



to top

>dbj|AK034224.1| Mus musculus adult male diencephalon cDNA, RIKEN full-length enriched
            library, clone:9330165B21 product:RIKEN cDNA C030032C09
            gene, full insert sequence
          Length = 2590

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 199  acctcaggcaggtgttttccactc 222
            |||||||||||| |||||||||||
Sbjct: 1648 acctcaggcaggggttttccactc 1671



to top

>dbj|AK017495.1| Mus musculus 8 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:5730405K23 product:hypothetical
           protein, full insert sequence
          Length = 1224

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 358 agctcctgagtggggagaag 377
           ||||||||||||||||||||
Sbjct: 294 agctcctgagtggggagaag 313



to top

>gb|AC018633.2|AC018633 Homo sapiens clone UWGC:djs1 or RP11-16G1 from 7p14-15, complete
             sequence
          Length = 169234

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 305   tgagggagcctggaccgcca 324
             ||||||||||||||||||||
Sbjct: 73256 tgagggagcctggaccgcca 73237



to top

>gb|AC138719.4| Mus musculus BAC clone RP23-178O8 from 10, complete sequence
          Length = 183689

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 199    acctcaggcaggtgttttccactc 222
              |||||||||||| |||||||||||
Sbjct: 151957 acctcaggcaggggttttccactc 151980



to top

>gb|AC140410.3| Mus musculus BAC clone RP23-141J11 from 10, complete sequence
          Length = 205197

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 199  acctcaggcaggtgttttccactc 222
            |||||||||||| |||||||||||
Sbjct: 9787 acctcaggcaggggttttccactc 9810



to top

>emb|AL772259.7| Mouse DNA sequence from clone RP23-408D7 on chromosome 4, complete
            sequence
          Length = 48500

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 193  ctgaccacctcaggcaggtg 212
            ||||||||||||||||||||
Sbjct: 4460 ctgaccacctcaggcaggtg 4479


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,679,986
Number of Sequences: 3902068
Number of extensions: 4679986
Number of successful extensions: 113907
Number of sequences better than 10.0: 238
Number of HSP's better than 10.0 without gapping: 238
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 113222
Number of HSP's gapped (non-prelim): 627
length of query: 664
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 641
effective length of database: 17,143,297,704
effective search space: 10988853828264
effective search space used: 10988853828264
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top