Clone Name	bags30a01
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	emb|BX247952.2| Mouse DNA sequence from clone RP24-405K16 on chr...	44	0.43
2	gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome	42	1.7
3	gb|AC006790.2| Caenorhabditis elegans cosmid Y49F6B, complete se...	42	1.7
4	ref|XM_529058.1| PREDICTED: Pan troglodytes similar to zinc fing...	40	6.8
5	ref|NM_194938.1| Oryza sativa (japonica cultivar-group) putative...	40	6.8
6	gb|AC091724.3| Oryza sativa (japonica cultivar-group) chromosome...	40	6.8
7	ref|XM_424045.1| PREDICTED: Gallus gallus similar to synaptotagm...	40	6.8
8	ref|XM_423329.1| PREDICTED: Gallus gallus similar to synaptotagm...	40	6.8
9	ref|NM_021998.4| Homo sapiens zinc finger protein 6 (ZNF6), mRNA	40	6.8
10	ref|XM_706047.1| Candida albicans SC5314 hypothetical protein (C...	40	6.8
11	ref|XM_706029.1| Candida albicans SC5314 hypothetical protein (C...	40	6.8
12	ref|XM_705116.1| Candida albicans SC5314 hypothetical protein (C...	40	6.8
13	gb|U40409.2| Caenorhabditis elegans cosmid F32A6, complete sequence	40	6.8
14	gb|AC144540.7| Medicago truncatula clone mth2-19p16, complete se...	40	6.8
15	gb|BC006349.2| Homo sapiens zinc finger protein 6 (CMPX1), mRNA ...	40	6.8
16	gb|AC144657.6| Medicago truncatula clone mth2-16a6, complete seq...	40	6.8
17	gb|AC124954.14| Medicago truncatula clone mth2-10g9, complete se...	40	6.8
18	emb|Z82216.1|HS75N13 Human DNA sequence from clone RP1-75N13 on ...	40	6.8
19	emb|AL671136.3| Human DNA sequence from clone RP11-434D13 on chr...	40	6.8
20	emb|AL603841.4| Human DNA sequence from clone RP11-408E1 on chro...	40	6.8
21	emb|AL390965.15| Human DNA sequence from clone RP11-640E11 on ch...	40	6.8
22	emb|AL137847.12| Human DNA sequence from clone RP11-439K3 on chr...	40	6.8
23	emb|AL033378.12|HS323M4 Human DNA sequence from clone RP3-323M4 ...	40	6.8
24	emb|AL035603.11|HS179E13 Human DNA sequence from clone RP1-179E1...	40	6.8
25	emb|AL031257.1|HS796I11 Human DNA sequence from clone RP4-796I11...	40	6.8
26	emb|X56465.1|HSZNF Human znf6 mRNA for zinc finger transcription...	40	6.8
27	gb|AC003001.1| Homo sapiens chromosome X, clone HRPC928E24, comp...	40	6.8
28	gb|BC067294.1| Homo sapiens zinc finger protein 6 (CMPX1), mRNA ...	40	6.8
29	gb|CP000282.1| Saccharophagus degradans 2-40, complete genome	40	6.8
30	ref|NM_205887.1| Drosophila melanogaster Excitatory amino acid t...	40	6.8
31	gb|AY069083.1| Drosophila melanogaster GH09856 full length cDNA	40	6.8
32	gb|AE015928.1| Bacteroides thetaiotaomicron VPI-5482, complete g...	40	6.8
33	gb|AC092235.1|AC092235 Drosophila melanogaster, chromosome 2L, r...	40	6.8
34	dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D...	40	6.8
35	emb|BX648117.1|HSM808264 Homo sapiens mRNA; cDNA DKFZp686J2232 (...	40	6.8
36	gb|AE003588.3| Drosophila melanogaster chromosome 2L, section 3 ...	40	6.8
37	emb|BX004787.8| Zebrafish DNA sequence from clone DKEY-28B17 in ...	40	6.8
38	gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome...	40	6.8
39	gb|AC004420.1|AC004420 Drosophila melanogaster DNA sequence (P1 ...	40	6.8

---

>emb|BX247952.2| Mouse DNA sequence from clone RP24-405K16 on chromosome 4, complete
             sequence
          Length = 117872

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 159   atgaaaaaattggaaaatatat 180
             ||||||||||||||||||||||
Sbjct: 45413 atgaaaaaattggaaaatatat 45392

---

>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome
          Length = 5513844

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 49      ctcgatgagtttgttatggctttgg 73
               ||||||||||||| |||||||||||
Sbjct: 5156695 ctcgatgagtttggtatggctttgg 5156671

---

>gb|AC006790.2| Caenorhabditis elegans cosmid Y49F6B, complete sequence
          Length = 52139

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 156   ttcatgaaaaaattggaaaat 176
             |||||||||||||||||||||
Sbjct: 18522 ttcatgaaaaaattggaaaat 18542

---

>ref|XM_529058.1| PREDICTED: Pan troglodytes similar to zinc finger protein 6; zinc
           finger protein-6 (LOC473685), mRNA
          Length = 2424

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 411 gattcaagctgctggaggtgttcc 434
           ||||||||| ||||||||||||||
Sbjct: 516 gattcaagcagctggaggtgttcc 539

---

>ref|NM_194938.1| Oryza sativa (japonica cultivar-group) putative polyprotein
           (OSJNBa0004E08.19), mRNA
          Length = 3969

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 52  gatgagtttgttatggcttt 71
           ||||||||||||||||||||
Sbjct: 634 gatgagtttgttatggcttt 653

---

>gb|AC091724.3| Oryza sativa (japonica cultivar-group) chromosome 10 clone OSJNBa0004E08,
              complete sequence
          Length = 158294

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 52     gatgagtttgttatggcttt 71
              ||||||||||||||||||||
Sbjct: 133787 gatgagtttgttatggcttt 133806

---

>ref|XM_424045.1| PREDICTED: Gallus gallus similar to synaptotagmin-like 2 isoform b;
           chromosome 11 synaptotagmin; breast cancer-associated
           antigen SGA-72M (LOC426394), partial mRNA
          Length = 2174

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 32  acaaaattgagaaagatctc 51
           ||||||||||||||||||||
Sbjct: 395 acaaaattgagaaagatctc 414

---

>ref|XM_423329.1| PREDICTED: Gallus gallus similar to synaptotagmin-like 2
           (LOC425581), partial mRNA
          Length = 274

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 32  acaaaattgagaaagatctc 51
           ||||||||||||||||||||
Sbjct: 105 acaaaattgagaaagatctc 124

---

>ref|NM_021998.4| Homo sapiens zinc finger protein 6 (ZNF6), mRNA
          Length = 4182

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 411 gattcaagctgctggaggtgttcc 434
           ||||||||| ||||||||||||||
Sbjct: 863 gattcaagcagctggaggtgttcc 886

---

>ref|XM_706047.1| Candida albicans SC5314 hypothetical protein (CaO19.6282), mRNA
          Length = 675

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 147 atcttcatattcatgaaaaaattg 170
           |||||||||||||||| |||||||
Sbjct: 222 atcttcatattcatgataaaattg 199

---

>ref|XM_706029.1| Candida albicans SC5314 hypothetical protein (CaO19.13661), mRNA
          Length = 675

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 147 atcttcatattcatgaaaaaattg 170
           |||||||||||||||| |||||||
Sbjct: 222 atcttcatattcatgataaaattg 199

---

>ref|XM_705116.1| Candida albicans SC5314 hypothetical protein (CaO19.3486), mRNA
          Length = 2448

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 147  atcttcatattcatgaaaaaattg 170
            |||||||||||||||| |||||||
Sbjct: 1842 atcttcatattcatgataaaattg 1819

---

>gb|U40409.2| Caenorhabditis elegans cosmid F32A6, complete sequence
          Length = 39851

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 34    aaaattgagaaagatctcgatgag 57
             ||||||||||||||| ||||||||
Sbjct: 18558 aaaattgagaaagatgtcgatgag 18581

---

>gb|AC144540.7| Medicago truncatula clone mth2-19p16, complete sequence
          Length = 78737

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 146   tatcttcatattcatgaaaaaatt 169
             |||||||||||||||||| |||||
Sbjct: 64406 tatcttcatattcatgaataaatt 64383

---

>gb|BC006349.2| Homo sapiens zinc finger protein 6 (CMPX1), mRNA (cDNA clone
           IMAGE:4111424), partial cds
          Length = 1490

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 411 gattcaagctgctggaggtgttcc 434
           ||||||||| ||||||||||||||
Sbjct: 822 gattcaagcagctggaggtgttcc 845

---

>gb|AC144657.6| Medicago truncatula clone mth2-16a6, complete sequence
          Length = 92738

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 146   tatcttcatattcatgaaaaaatt 169
             |||||||||||||||||| |||||
Sbjct: 46435 tatcttcatattcatgaataaatt 46458

---

>gb|AC124954.14| Medicago truncatula clone mth2-10g9, complete sequence
          Length = 115040

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 35     aaattgagaaagatctcgat 54
              ||||||||||||||||||||
Sbjct: 114368 aaattgagaaagatctcgat 114349

---

>emb|Z82216.1|HS75N13 Human DNA sequence from clone RP1-75N13 on chromosome Xq21.1, complete
             sequence
          Length = 141851

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 411   gattcaagctgctggaggtgttcc 434
             ||||||||| ||||||||||||||
Sbjct: 19860 gattcaagcagctggaggtgttcc 19883

---

>emb|AL671136.3| Human DNA sequence from clone RP11-434D13 on chromosome 9, complete
             sequence
          Length = 20280

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 334   catgtgtatgccttctcttg 353
             ||||||||||||||||||||
Sbjct: 18861 catgtgtatgccttctcttg 18842

---

>emb|AL603841.4| Human DNA sequence from clone RP11-408E1 on chromosome 1 Contains a
            35 kDa subunit 1 alpha eukaryotic translation initiation
            factor 3 (EIF3S1) pseudogene, complete sequence
          Length = 41617

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 69   tttggtgtgaggactttgaa 88
            ||||||||||||||||||||
Sbjct: 9788 tttggtgtgaggactttgaa 9769

---

>emb|AL390965.15| Human DNA sequence from clone RP11-640E11 on chromosome 13 Contains a
             solute carrier family 25 (mitochondrial carrier; adenine
             nucleotide translocator), member 5 (SLC25A5) pseudogene,
             complete sequence
          Length = 92179

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 155   attcatgaaaaaattggaaa 174
             ||||||||||||||||||||
Sbjct: 26865 attcatgaaaaaattggaaa 26884

---

>emb|AL137847.12| Human DNA sequence from clone RP11-439K3 on chromosome 9q22.2-31.1
           Contains two novel genes, the 3' end of a novel gene
           (MGC20553) and a CpG island, complete sequence
          Length = 143372

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 334 catgtgtatgccttctcttg 353
           ||||||||||||||||||||
Sbjct: 581 catgtgtatgccttctcttg 562

---

>emb|AL033378.12|HS323M4 Human DNA sequence from clone RP3-323M4 on chromosome 6q24.1-25.2
            Contains part of the gene for KIAA0790 protein, a
            cytochrome p450 51 (lanosterol 14-alpha-demethylase)
            (CYP51) pseudogene, a small nuclear ribonucleoprotein
            polypeptide E (SNRPE) pseudogene and a CpG island,
            complete sequence
          Length = 151938

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 155  attcatgaaaaaattggaaaatat 178
            |||| |||||||||||||||||||
Sbjct: 4734 attcttgaaaaaattggaaaatat 4757

---

>emb|AL035603.11|HS179E13 Human DNA sequence from clone RP1-179E13 on chromosome 6q22.1-22.33
             Contains ribosomal protein S4, X-linked (cell cycle gene
             2, single-copy abundant mRNA, ribosomal protein S4X
             variant, 40S ribosomal protein S4, X variant)
             (RPS4X)(CCG2, SCAR, SCR10, DXS306) pseudogene, complete
             sequence
          Length = 138443

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 302   ctacaatttgatgaggaaga 321
             ||||||||||||||||||||
Sbjct: 14546 ctacaatttgatgaggaaga 14527

---

>emb|AL031257.1|HS796I11 Human DNA sequence from clone RP4-796I11 on chromosome 20q12 Contains
            the 5' end of the TIX1 gene for triple homeobox 1 and a
            CpG island, complete sequence
          Length = 77402

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 3    agaaatttttggaagagctt 22
            ||||||||||||||||||||
Sbjct: 9078 agaaatttttggaagagctt 9097

---

>emb|X56465.1|HSZNF Human znf6 mRNA for zinc finger transcription factor
          Length = 3455

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 411  gattcaagctgctggaggtgttcc 434
            ||||||||| ||||||||||||||
Sbjct: 1592 gattcaagcagctggaggtgttcc 1615

---

>gb|AC003001.1| Homo sapiens chromosome X, clone HRPC928E24, complete sequence
          Length = 101981

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 411   gattcaagctgctggaggtgttcc 434
             ||||||||| ||||||||||||||
Sbjct: 81169 gattcaagcagctggaggtgttcc 81192

---

>gb|BC067294.1| Homo sapiens zinc finger protein 6 (CMPX1), mRNA (cDNA clone
           MGC:75452 IMAGE:30386278), complete cds
          Length = 3866

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 411 gattcaagctgctggaggtgttcc 434
           ||||||||| ||||||||||||||
Sbjct: 547 gattcaagcagctggaggtgttcc 570

---

>gb|CP000282.1| Saccharophagus degradans 2-40, complete genome
          Length = 5057531

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 65     tggctttggtgtgaggactttgaa 88
              |||||||||||||| |||||||||
Sbjct: 169647 tggctttggtgtgatgactttgaa 169624

---

>ref|NM_205887.1| Drosophila melanogaster Excitatory amino acid transporter 2
           CG3159-RB, transcript variant B (Eaat2), mRNA
          Length = 3122

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 258 gaatggcctccctaaccaacatcctcaa 285
           ||||||||| ||||| ||||||||||||
Sbjct: 494 gaatggcctacctaatcaacatcctcaa 521

---

>gb|AY069083.1| Drosophila melanogaster GH09856 full length cDNA
          Length = 3142

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 258 gaatggcctccctaaccaacatcctcaa 285
           ||||||||| ||||| ||||||||||||
Sbjct: 494 gaatggcctacctaatcaacatcctcaa 521

---

>gb|AE015928.1| Bacteroides thetaiotaomicron VPI-5482, complete genome
          Length = 6260361

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 69      tttggtgtgaggactttgaa 88
               ||||||||||||||||||||
Sbjct: 4873746 tttggtgtgaggactttgaa 4873765

---

>gb|AC092235.1|AC092235 Drosophila melanogaster, chromosome 2L, region 21E-21F, BAC clone
             BACR30G21, complete sequence
          Length = 168370

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 258   gaatggcctccctaaccaacatcctcaa 285
             ||||||||| ||||| ||||||||||||
Sbjct: 92306 gaatggcctacctaatcaacatcctcaa 92279

---

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
               sequence
          Length = 22685906

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 52      gatgagtttgttatggcttt 71
               ||||||||||||||||||||
Sbjct: 3542658 gatgagtttgttatggcttt 3542677

---

>emb|BX648117.1|HSM808264 Homo sapiens mRNA; cDNA DKFZp686J2232 (from clone DKFZp686J2232)
          Length = 4854

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 411  gattcaagctgctggaggtgttcc 434
            ||||||||| ||||||||||||||
Sbjct: 1402 gattcaagcagctggaggtgttcc 1425

---

>gb|AE003588.3| Drosophila melanogaster chromosome 2L, section 3 of 83 of the complete
              sequence
          Length = 308447

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 258    gaatggcctccctaaccaacatcctcaa 285
              ||||||||| ||||| ||||||||||||
Sbjct: 129429 gaatggcctacctaatcaacatcctcaa 129402

---

>emb|BX004787.8| Zebrafish DNA sequence from clone DKEY-28B17 in linkage group 23,
             complete sequence
          Length = 198036

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 414   tcaagctgctggaggtgttc 433
             ||||||||||||||||||||
Sbjct: 98094 tcaagctgctggaggtgttc 98075

---

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 52      gatgagtttgttatggcttt 71
               ||||||||||||||||||||
Sbjct: 3542579 gatgagtttgttatggcttt 3542598

---

>gb|AC004420.1|AC004420 Drosophila melanogaster DNA sequence (P1 DS02649 (D132)), complete
             sequence
          Length = 79987

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 258   gaatggcctccctaaccaacatcctcaa 285
             ||||||||| ||||| ||||||||||||
Sbjct: 75045 gaatggcctacctaatcaacatcctcaa 75072


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,113,615
Number of Sequences: 3902068
Number of extensions: 5113615
Number of successful extensions: 104500
Number of sequences better than 10.0: 39
Number of HSP's better than 10.0 without gapping: 39
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 104292
Number of HSP's gapped (non-prelim): 208
length of query: 500
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 478
effective length of database: 17,147,199,772
effective search space: 8196361491016
effective search space used: 8196361491016
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---