ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags29n05
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_465979.1| Oryza sativa (japonica cultivar-group), mRNA 436 e-119
2dbj|AK103390.1| Oryza sativa (japonica cultivar-group) cDNA clon... 428 e-117
3dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 131 3e-27
4dbj|AP006850.2| Oryza sativa (japonica cultivar-group) genomic D... 131 3e-27
5dbj|AP005845.2| Oryza sativa (japonica cultivar-group) genomic D... 131 3e-27
6ref|NM_113578.3| Arabidopsis thaliana unknown protein AT3G26670 ... 70 9e-09
7ref|NM_202638.1| Arabidopsis thaliana unknown protein AT3G26670 ... 70 9e-09
8ref|NM_180303.1| Arabidopsis thaliana unknown protein AT3G26670 ... 70 9e-09
9gb|AY093129.1| Arabidopsis thaliana unknown protein (At3g26670) ... 70 9e-09
10gb|BT006587.1| Arabidopsis thaliana At3g26670 mRNA, complete cds 70 9e-09
11emb|BX824813.1|CNS0A6OZ Arabidopsis thaliana Full-length cDNA Co... 70 9e-09
12emb|X98130.1|AT81KBGEN Arabidopsis thaliana 81kb genomic sequence 68 4e-08
13emb|X56114.1|ATTAR10 A.thaliana target DNA 10 68 4e-08
14dbj|AB026648.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 68 4e-08
15emb|BX649279.7| Zebrafish DNA sequence from clone CH211-212D10 i... 46 0.13
16gb|AC123072.4| Mus musculus BAC clone RP23-87D8 from chromosome ... 42 2.1
17gb|AC092120.4| Homo sapiens chromosome 16 clone RP1-168P16, comp... 42 2.1
18gb|AC092123.4| Homo sapiens chromosome 16 clone RP11-104N10, com... 42 2.1
19emb|AL109934.22|HSDJ81L22 Human DNA sequence from clone RP1-81L2... 42 2.1
20gb|BC106875.1| Homo sapiens zinc finger protein 21 (KOX 14), tra... 40 8.2
21ref|NM_178804.2| Mus musculus slit homolog 2 (Drosophila) (Slit2... 40 8.2
22ref|NM_006962.1| Homo sapiens zinc finger protein 182 (ZNF182), ... 40 8.2
23ref|NM_001007088.1| Homo sapiens zinc finger protein 182 (ZNF182... 40 8.2
24gb|AC147343.2| Pan troglodytes BAC clone CH251-14P15 from Y, com... 40 8.2
25gb|AC147117.2| Pan troglodytes BAC clone CH251-532B3 from Y, com... 40 8.2
26gb|BC059267.1| Mus musculus slit homolog 2 (Drosophila), mRNA (c... 40 8.2
27gb|AC133212.2| Mus musculus chromosome UNK clone RP23-45E17, com... 40 8.2
28gb|BC114216.1| Homo sapiens zinc finger protein 21 (KOX 14), tra... 40 8.2
29emb|AL591667.7| Human DNA sequence from clone RP11-389N9 on chro... 40 8.2
30emb|AL450306.14| Human DNA sequence from clone RP13-39P12 on chr... 40 8.2
31emb|AL049589.15|HSJ570L12 Human DNA sequence from clone RP4-570L... 40 8.2
32gb|AC101004.6| Mus musculus, clone RP23-79E5, complete sequence 40 8.2
33gb|AC007917.15| Homo sapiens 3 BAC RP11-379C23 (Roswell Park Can... 40 8.2
34dbj|AK220505.1| Mus musculus mRNA for mKIAA4141 protein 40 8.2
35dbj|BS000666.1| Pan troglodytes chromosome Y clone:PTBY-003G06, ... 40 8.2
36dbj|BS000578.1| Pan troglodytes chromosome Y clone:PTB-519P18, c... 40 8.2
37gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence 40 8.2
38dbj|AK122874.1| Homo sapiens cDNA FLJ16508 fis, clone HCHON20004... 40 8.2
39ref|XM_925841.1| PREDICTED: Homo sapiens similar to TBP-associat... 40 8.2
40gb|AC099008.1| Drosophila melanogaster, chromosome 2R, region 50... 40 8.2
41gb|S75476.1| PGK1=phosphoglycerate kinase 1 {3' nuclease-sensiti... 40 8.2
42gb|AC091387.2| Drosophila melanogaster, chromosome 2R, region 50... 40 8.2
43gb|AF144628.1|AF144628 Mus musculus SLIT2 (Slit2) mRNA, complete... 40 8.2
44emb|BX005167.12| Mouse DNA sequence from clone RP23-247K19 on ch... 40 8.2
45dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.2
46gb|AC068943.4| Homo sapiens BAC clone RP11-769M2 from 2, complet... 40 8.2
47gb|AC110770.4| Homo sapiens BAC clone RP11-159P15 from 2, comple... 40 8.2
48gb|AC016889.28| Homo sapiens chromosome 17, clone RP11-506G7, co... 40 8.2
49gb|AC128737.4| Mus musculus BAC clone RP23-99A8 from chromosome ... 40 8.2
50dbj|AP004333.3| Oryza sativa (japonica cultivar-group) genomic D... 40 8.2
51gb|AC153883.6| Mus musculus 10 BAC RP23-368G20 (Roswell Park Can... 40 8.2
52gb|AC153368.5| Mus musculus 10 BAC RP23-269H21 (Roswell Park Can... 40 8.2
53gb|AE003817.3| Drosophila melanogaster chromosome 2R, section 33... 40 8.2
54gb|AF074960.1|AF074960 Mus musculus neurogenic extracellular sli... 40 8.2
55gb|AC005643.1|AC005643 Drosophila melanogaster, chromosome 2R, r... 40 8.2
56emb|Z82263.1|CEC47A4 Caenorhabditis elegans Cosmid C47A4, comple... 40 8.2
57emb|CT025633.3| Pan troglodytes chromosome X clone RP43-007L03 m... 40 8.2
58emb|Z98304.1|HS54B20 Human DNA sequence from clone RP1-54B20 on ... 40 8.2 
>ref|XM_465979.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1892

 Score =  436 bits (220), Expect = e-119
 Identities = 405/466 (86%), Gaps = 3/466 (0%)
 Strand = Plus / Plus

                                                                       
Query: 141 gactcatggccgactggattataggagcgttgatcaatatcgtgggtagtgttgccataa 200
           ||||||||| ||||||| ||||||||||  ||||||| || ||||| |||||||||||||
Sbjct: 349 gactcatgggcgactgggttataggagcactgatcaacattgtggggagtgttgccataa 408

                                                                       
Query: 201 attttggtactaaccttctcaaattgggccatgatcagagagaaaagttgtactcaagta 260
           | |||||||| |||||||| ||||||||||||||||||||||| ||| | |   |||  |
Sbjct: 409 actttggtaccaaccttctgaaattgggccatgatcagagagagaagctttcgacaacca 468

                                                                       
Query: 261 a---caatcaagtcgatggcaaatttgtcccaaaatcagttatgtatttccagacttgga 317
           |   |||||||| | ||| ||||||||| || || ||||||||| |||| || |||||||
Sbjct: 469 acaacaatcaaggcaatgacaaatttgttccgaagtcagttatgcattttcaaacttgga 528

                                                                       
Query: 318 gaataggtatactctttttcgctgtggggaactgcctaaacttcatgtccttcgcatatg 377
           ||||||| ||||| || || |||| ||| |||||||| ||||||||||||||||||||||
Sbjct: 529 gaataggcatactgttctttgctgcgggaaactgcctcaacttcatgtccttcgcatatg 588

                                                                       
Query: 378 ccgcacagtcacttcttgcagcccttggatcaattcagtttgtatccaatattgcatttg 437
           |||||||||||||||||||||| |||||||| ||||| ||||| ||||||||||||||||
Sbjct: 589 ccgcacagtcacttcttgcagctcttggatcgattcaatttgtgtccaatattgcatttg 648

                                                                       
Query: 438 cctacgttgtgttgaacaagaccatttcagtgaaggtcatggttgccacaacttttattg 497
           | ||| |||||||||||||||||||||||||||| |||||||| || ||||| |||||||
Sbjct: 649 cttactttgtgttgaacaagaccatttcagtgaaagtcatggtagcaacaacatttattg 708

                                                                       
Query: 498 tctttggcaatgtcttcttggtttccttcggcaatcatcaatctcctgtttatactccgg 557
           | ||||||||| ||||| | |||||||| || |||||||||||||| ||||| || ||||
Sbjct: 709 tatttggcaatatcttcctagtttcctttggtaatcatcaatctccagtttacaccccgg 768

                                                         
Query: 558 agcagctgattgcgaaatacagcaacttggtctttgttctctattg 603
           |||||||  |||||||||||||||| || || ||||||||||||||
Sbjct: 769 agcagctagttgcgaaatacagcaatttagtgtttgttctctattg 814
to top
>dbj|AK103390.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033127K21, full
           insert sequence
          Length = 1892

 Score =  428 bits (216), Expect = e-117
 Identities = 404/466 (86%), Gaps = 3/466 (0%)
 Strand = Plus / Plus

                                                                       
Query: 141 gactcatggccgactggattataggagcgttgatcaatatcgtgggtagtgttgccataa 200
           ||||||||| ||||||| ||||||||||  ||||||| || ||||| |||||||||||||
Sbjct: 349 gactcatgggcgactgggttataggagcactgatcaacattgtggggagtgttgccataa 408

                                                                       
Query: 201 attttggtactaaccttctcaaattgggccatgatcagagagaaaagttgtactcaagta 260
           | |||||||| |||||||| ||||||||||||||||||||||| ||| | |   |||  |
Sbjct: 409 actttggtaccaaccttctgaaattgggccatgatcagagagagaagctttcgacaacca 468

                                                                       
Query: 261 a---caatcaagtcgatggcaaatttgtcccaaaatcagttatgtatttccagacttgga 317
           |   |||||||| | ||| ||||||||| |  || ||||||||| |||| || |||||||
Sbjct: 469 acaacaatcaaggcaatgacaaatttgttcagaagtcagttatgcattttcaaacttgga 528

                                                                       
Query: 318 gaataggtatactctttttcgctgtggggaactgcctaaacttcatgtccttcgcatatg 377
           ||||||| ||||| || || |||| ||| |||||||| ||||||||||||||||||||||
Sbjct: 529 gaataggcatactgttctttgctgcgggaaactgcctcaacttcatgtccttcgcatatg 588

                                                                       
Query: 378 ccgcacagtcacttcttgcagcccttggatcaattcagtttgtatccaatattgcatttg 437
           |||||||||||||||||||||| |||||||| ||||| ||||| ||||||||||||||||
Sbjct: 589 ccgcacagtcacttcttgcagctcttggatcgattcaatttgtgtccaatattgcatttg 648

                                                                       
Query: 438 cctacgttgtgttgaacaagaccatttcagtgaaggtcatggttgccacaacttttattg 497
           | ||| |||||||||||||||||||||||||||| |||||||| || ||||| |||||||
Sbjct: 649 cttactttgtgttgaacaagaccatttcagtgaaagtcatggtagcaacaacatttattg 708

                                                                       
Query: 498 tctttggcaatgtcttcttggtttccttcggcaatcatcaatctcctgtttatactccgg 557
           | ||||||||| ||||| | |||||||| || |||||||||||||| ||||| || ||||
Sbjct: 709 tatttggcaatatcttcctagtttcctttggtaatcatcaatctccagtttacaccccgg 768

                                                         
Query: 558 agcagctgattgcgaaatacagcaacttggtctttgttctctattg 603
           |||||||  |||||||||||||||| || || ||||||||||||||
Sbjct: 769 agcagctagttgcgaaatacagcaatttagtgtttgttctctattg 814
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  131 bits (66), Expect = 3e-27
 Identities = 84/90 (93%)
 Strand = Plus / Minus

                                                                            
Query: 383      cagtcacttcttgcagcccttggatcaattcagtttgtatccaatattgcatttgcctac 442
                ||||||||||||||||| |||||||| ||||| ||||| ||||||||||||||||| |||
Sbjct: 18848936 cagtcacttcttgcagctcttggatcgattcaatttgtgtccaatattgcatttgcttac 18848877

                                              
Query: 443      gttgtgttgaacaagaccatttcagtgaag 472
                 |||||||||||||||||||||||||||||
Sbjct: 18848876 tttgtgttgaacaagaccatttcagtgaag 18848847



 Score =  115 bits (58), Expect = 2e-22
 Identities = 88/98 (89%)
 Strand = Plus / Minus

                                                                            
Query: 141      gactcatggccgactggattataggagcgttgatcaatatcgtgggtagtgttgccataa 200
                ||||||||| ||||||| ||||||||||  ||||||| || ||||| |||||||||||||
Sbjct: 18850034 gactcatgggcgactgggttataggagcactgatcaacattgtggggagtgttgccataa 18849975

                                                      
Query: 201      attttggtactaaccttctcaaattgggccatgatcag 238
                | |||||||| |||||||| ||||||||||||||||||
Sbjct: 18849974 actttggtaccaaccttctgaaattgggccatgatcag 18849937



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                                
Query: 338      gctgtggggaactgcctaaacttcatgtccttcgcatatgccgcacag 385
                |||| ||| |||||||| ||||||||||||||||||||||||||||||
Sbjct: 18849344 gctgcgggaaactgcctcaacttcatgtccttcgcatatgccgcacag 18849297



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                            
Query: 473      gtcatggttgccacaacttttattgtctttggcaatgtcttcttggtttccttcggcaat 532
                |||||||| || ||||| |||||||| ||||||||| ||||| | |||||||| || |||
Sbjct: 18848742 gtcatggtagcaacaacatttattgtatttggcaatatcttcctagtttcctttggtaat 18848683

                           
Query: 533      catcaatctcc 543
                |||||||||||
Sbjct: 18848682 catcaatctcc 18848672



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Minus

                                                                            
Query: 260      aacaatcaagtcgatggcaaatttgtcccaaaatcagttatgtatttccagacttggaga 319
                |||||||||| | ||| ||||||||| || || ||||||||| |||| || |||||||||
Sbjct: 18849517 aacaatcaaggcaatgacaaatttgttccgaagtcagttatgcattttcaaacttggaga 18849458

                       
Query: 320      ataggta 326
                |||||||
Sbjct: 18849457 ataggta 18849451



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                           
Query: 545      gtttatactccggagcagctgattgcgaaatacagcaacttggtctttgttctctattg 603
                ||||| || |||||||||||  |||||||||||||||| || || ||||||||||||||
Sbjct: 18848202 gtttacaccccggagcagctagttgcgaaatacagcaatttagtgtttgttctctattg 18848144
to top
>dbj|AP006850.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2,
             fosmid clone:OSJNOa257A21
          Length = 34833

 Score =  131 bits (66), Expect = 3e-27
 Identities = 84/90 (93%)
 Strand = Plus / Minus

                                                                         
Query: 383   cagtcacttcttgcagcccttggatcaattcagtttgtatccaatattgcatttgcctac 442
             ||||||||||||||||| |||||||| ||||| ||||| ||||||||||||||||| |||
Sbjct: 33178 cagtcacttcttgcagctcttggatcgattcaatttgtgtccaatattgcatttgcttac 33119

                                           
Query: 443   gttgtgttgaacaagaccatttcagtgaag 472
              |||||||||||||||||||||||||||||
Sbjct: 33118 tttgtgttgaacaagaccatttcagtgaag 33089



 Score =  115 bits (58), Expect = 2e-22
 Identities = 88/98 (89%)
 Strand = Plus / Minus

                                                                         
Query: 141   gactcatggccgactggattataggagcgttgatcaatatcgtgggtagtgttgccataa 200
             ||||||||| ||||||| ||||||||||  ||||||| || ||||| |||||||||||||
Sbjct: 34276 gactcatgggcgactgggttataggagcactgatcaacattgtggggagtgttgccataa 34217

                                                   
Query: 201   attttggtactaaccttctcaaattgggccatgatcag 238
             | |||||||| |||||||| ||||||||||||||||||
Sbjct: 34216 actttggtaccaaccttctgaaattgggccatgatcag 34179



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                             
Query: 338   gctgtggggaactgcctaaacttcatgtccttcgcatatgccgcacag 385
             |||| ||| |||||||| ||||||||||||||||||||||||||||||
Sbjct: 33586 gctgcgggaaactgcctcaacttcatgtccttcgcatatgccgcacag 33539



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                         
Query: 473   gtcatggttgccacaacttttattgtctttggcaatgtcttcttggtttccttcggcaat 532
             |||||||| || ||||| |||||||| ||||||||| ||||| | |||||||| || |||
Sbjct: 32984 gtcatggtagcaacaacatttattgtatttggcaatatcttcctagtttcctttggtaat 32925

                        
Query: 533   catcaatctcc 543
             |||||||||||
Sbjct: 32924 catcaatctcc 32914



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Minus

                                                                         
Query: 260   aacaatcaagtcgatggcaaatttgtcccaaaatcagttatgtatttccagacttggaga 319
             |||||||||| | ||| ||||||||| || || ||||||||| |||| || |||||||||
Sbjct: 33759 aacaatcaaggcaatgacaaatttgttccgaagtcagttatgcattttcaaacttggaga 33700

                    
Query: 320   ataggta 326
             |||||||
Sbjct: 33699 ataggta 33693



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                        
Query: 545   gtttatactccggagcagctgattgcgaaatacagcaacttggtctttgttctctattg 603
             ||||| || |||||||||||  |||||||||||||||| || || ||||||||||||||
Sbjct: 32444 gtttacaccccggagcagctagttgcgaaatacagcaatttagtgtttgttctctattg 32386
to top
>dbj|AP005845.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0461D06
          Length = 112895

 Score =  131 bits (66), Expect = 3e-27
 Identities = 84/90 (93%)
 Strand = Plus / Minus

                                                                         
Query: 383   cagtcacttcttgcagcccttggatcaattcagtttgtatccaatattgcatttgcctac 442
             ||||||||||||||||| |||||||| ||||| ||||| ||||||||||||||||| |||
Sbjct: 12469 cagtcacttcttgcagctcttggatcgattcaatttgtgtccaatattgcatttgcttac 12410

                                           
Query: 443   gttgtgttgaacaagaccatttcagtgaag 472
              |||||||||||||||||||||||||||||
Sbjct: 12409 tttgtgttgaacaagaccatttcagtgaag 12380



 Score =  115 bits (58), Expect = 2e-22
 Identities = 88/98 (89%)
 Strand = Plus / Minus

                                                                         
Query: 141   gactcatggccgactggattataggagcgttgatcaatatcgtgggtagtgttgccataa 200
             ||||||||| ||||||| ||||||||||  ||||||| || ||||| |||||||||||||
Sbjct: 13567 gactcatgggcgactgggttataggagcactgatcaacattgtggggagtgttgccataa 13508

                                                   
Query: 201   attttggtactaaccttctcaaattgggccatgatcag 238
             | |||||||| |||||||| ||||||||||||||||||
Sbjct: 13507 actttggtaccaaccttctgaaattgggccatgatcag 13470



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                             
Query: 338   gctgtggggaactgcctaaacttcatgtccttcgcatatgccgcacag 385
             |||| ||| |||||||| ||||||||||||||||||||||||||||||
Sbjct: 12877 gctgcgggaaactgcctcaacttcatgtccttcgcatatgccgcacag 12830



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                         
Query: 473   gtcatggttgccacaacttttattgtctttggcaatgtcttcttggtttccttcggcaat 532
             |||||||| || ||||| |||||||| ||||||||| ||||| | |||||||| || |||
Sbjct: 12275 gtcatggtagcaacaacatttattgtatttggcaatatcttcctagtttcctttggtaat 12216

                        
Query: 533   catcaatctcc 543
             |||||||||||
Sbjct: 12215 catcaatctcc 12205



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Minus

                                                                         
Query: 260   aacaatcaagtcgatggcaaatttgtcccaaaatcagttatgtatttccagacttggaga 319
             |||||||||| | ||| ||||||||| || || ||||||||| |||| || |||||||||
Sbjct: 13050 aacaatcaaggcaatgacaaatttgttccgaagtcagttatgcattttcaaacttggaga 12991

                    
Query: 320   ataggta 326
             |||||||
Sbjct: 12990 ataggta 12984



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                        
Query: 545   gtttatactccggagcagctgattgcgaaatacagcaacttggtctttgttctctattg 603
             ||||| || |||||||||||  |||||||||||||||| || || ||||||||||||||
Sbjct: 11735 gtttacaccccggagcagctagttgcgaaatacagcaatttagtgtttgttctctattg 11677
to top
>ref|NM_113578.3| Arabidopsis thaliana unknown protein AT3G26670 transcript variant
           AT3G26670.1 mRNA, complete cds
          Length = 1794

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 71/83 (85%)
 Strand = Plus / Plus

                                                                       
Query: 374 tatgccgcacagtcacttcttgcagcccttggatcaattcagtttgtatccaatattgca 433
           ||||| || ||||| ||||| ||||| |||||||| ||||| ||||||||||| || |||
Sbjct: 441 tatgctgctcagtcccttctagcagctcttggatccattcaatttgtatccaacatagca 500

                                  
Query: 434 tttgcctacgttgtgttgaacaa 456
           ||||| || ||||| ||||||||
Sbjct: 501 tttgcttatgttgtattgaacaa 523



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 51/58 (87%)
 Strand = Plus / Plus

                                                                     
Query: 188 agtgttgccataaattttggtactaaccttctcaaattgggccatgatcagagagaaa 245
           |||||||| || |||||||| || ||||||||||||||||| ||| || |||||||||
Sbjct: 261 agtgttgctattaattttggcacaaaccttctcaaattgggacataatgagagagaaa 318
to top
>ref|NM_202638.1| Arabidopsis thaliana unknown protein AT3G26670 transcript variant
           AT3G26670.3 mRNA, complete cds
          Length = 1851

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 71/83 (85%)
 Strand = Plus / Plus

                                                                       
Query: 374 tatgccgcacagtcacttcttgcagcccttggatcaattcagtttgtatccaatattgca 433
           ||||| || ||||| ||||| ||||| |||||||| ||||| ||||||||||| || |||
Sbjct: 498 tatgctgctcagtcccttctagcagctcttggatccattcaatttgtatccaacatagca 557

                                  
Query: 434 tttgcctacgttgtgttgaacaa 456
           ||||| || ||||| ||||||||
Sbjct: 558 tttgcttatgttgtattgaacaa 580



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 51/58 (87%)
 Strand = Plus / Plus

                                                                     
Query: 188 agtgttgccataaattttggtactaaccttctcaaattgggccatgatcagagagaaa 245
           |||||||| || |||||||| || ||||||||||||||||| ||| || |||||||||
Sbjct: 318 agtgttgctattaattttggcacaaaccttctcaaattgggacataatgagagagaaa 375
to top
>ref|NM_180303.1| Arabidopsis thaliana unknown protein AT3G26670 transcript variant
           AT3G26670.2 mRNA, complete cds
          Length = 1953

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 71/83 (85%)
 Strand = Plus / Plus

                                                                       
Query: 374 tatgccgcacagtcacttcttgcagcccttggatcaattcagtttgtatccaatattgca 433
           ||||| || ||||| ||||| ||||| |||||||| ||||| ||||||||||| || |||
Sbjct: 600 tatgctgctcagtcccttctagcagctcttggatccattcaatttgtatccaacatagca 659

                                  
Query: 434 tttgcctacgttgtgttgaacaa 456
           ||||| || ||||| ||||||||
Sbjct: 660 tttgcttatgttgtattgaacaa 682



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 51/58 (87%)
 Strand = Plus / Plus

                                                                     
Query: 188 agtgttgccataaattttggtactaaccttctcaaattgggccatgatcagagagaaa 245
           |||||||| || |||||||| || ||||||||||||||||| ||| || |||||||||
Sbjct: 420 agtgttgctattaattttggcacaaaccttctcaaattgggacataatgagagagaaa 477
to top
>gb|AY093129.1| Arabidopsis thaliana unknown protein (At3g26670) mRNA, complete cds
          Length = 1791

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 71/83 (85%)
 Strand = Plus / Plus

                                                                       
Query: 374 tatgccgcacagtcacttcttgcagcccttggatcaattcagtttgtatccaatattgca 433
           ||||| || ||||| ||||| ||||| |||||||| ||||| ||||||||||| || |||
Sbjct: 441 tatgctgctcagtcccttctagcagctcttggatccattcaatttgtatccaacatagca 500

                                  
Query: 434 tttgcctacgttgtgttgaacaa 456
           ||||| || ||||| ||||||||
Sbjct: 501 tttgcttatgttgtattgaacaa 523



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 51/58 (87%)
 Strand = Plus / Plus

                                                                     
Query: 188 agtgttgccataaattttggtactaaccttctcaaattgggccatgatcagagagaaa 245
           |||||||| || |||||||| || ||||||||||||||||| ||| || |||||||||
Sbjct: 261 agtgttgctattaattttggcacaaaccttctcaaattgggacataatgagagagaaa 318
to top
>gb|BT006587.1| Arabidopsis thaliana At3g26670 mRNA, complete cds
          Length = 1326

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 71/83 (85%)
 Strand = Plus / Plus

                                                                       
Query: 374 tatgccgcacagtcacttcttgcagcccttggatcaattcagtttgtatccaatattgca 433
           ||||| || ||||| ||||| ||||| |||||||| ||||| ||||||||||| || |||
Sbjct: 223 tatgctgctcagtcccttctagcagctcttggatccattcaatttgtatccaacatagca 282

                                  
Query: 434 tttgcctacgttgtgttgaacaa 456
           ||||| || ||||| ||||||||
Sbjct: 283 tttgcttatgttgtattgaacaa 305



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 51/58 (87%)
 Strand = Plus / Plus

                                                                     
Query: 188 agtgttgccataaattttggtactaaccttctcaaattgggccatgatcagagagaaa 245
           |||||||| || |||||||| || ||||||||||||||||| ||| || |||||||||
Sbjct: 43  agtgttgctattaattttggcacaaaccttctcaaattgggacataatgagagagaaa 100
to top
>emb|BX824813.1|CNS0A6OZ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH74ZG07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1788

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 71/83 (85%)
 Strand = Plus / Plus

                                                                       
Query: 374 tatgccgcacagtcacttcttgcagcccttggatcaattcagtttgtatccaatattgca 433
           ||||| || ||||| ||||| ||||| |||||||| ||||| ||||||||||| || |||
Sbjct: 498 tatgctgctcagtcccttctagcagctcttggatccattcaatttgtatccaacatagca 557

                                  
Query: 434 tttgcctacgttgtgttgaacaa 456
           ||||| || ||||| ||||||||
Sbjct: 558 tttgcttatgttgtattgaacaa 580



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 51/58 (87%)
 Strand = Plus / Plus

                                                                     
Query: 188 agtgttgccataaattttggtactaaccttctcaaattgggccatgatcagagagaaa 245
           |||||||| || |||||||| || ||||||||||||||||| ||| || |||||||||
Sbjct: 318 agtgttgctattaattttggcacaaaccttctcaaattgggacataatgagagagaaa 375
to top
>emb|X98130.1|AT81KBGEN Arabidopsis thaliana 81kb genomic sequence
          Length = 81493

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 64/74 (86%)
 Strand = Plus / Minus

                                                                         
Query: 383   cagtcacttcttgcagcccttggatcaattcagtttgtatccaatattgcatttgcctac 442
             ||||| ||||| ||||| |||||||| ||||| ||||||||||| || |||||||| || 
Sbjct: 52254 cagtcccttctagcagctcttggatccattcaatttgtatccaacatagcatttgcttat 52195

                           
Query: 443   gttgtgttgaacaa 456
             ||||| ||||||||
Sbjct: 52194 gttgtattgaacaa 52181



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                      
Query: 188   agtgttgccataaattttggtactaaccttctcaaattggg 228
             |||||||| || |||||||| || |||||||||||||||||
Sbjct: 52707 agtgttgctattaattttggcacaaaccttctcaaattggg 52667
to top
>emb|X56114.1|ATTAR10 A.thaliana target DNA 10
          Length = 552

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 64/74 (86%)
 Strand = Plus / Plus

                                                                       
Query: 383 cagtcacttcttgcagcccttggatcaattcagtttgtatccaatattgcatttgcctac 442
           ||||| ||||| ||||| |||||||| ||||| ||||||||||| || |||||||| || 
Sbjct: 472 cagtcccttctagcagctcttggatccattcaatttgtatccaacatagcatttgcttat 531

                         
Query: 443 gttgtgttgaacaa 456
           ||||| ||||||||
Sbjct: 532 gttgtattgaacaa 545



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 188 agtgttgccataaattttggtactaaccttctcaaattggg 228
           |||||||| || |||||||| || |||||||||||||||||
Sbjct: 19  agtgttgctattaattttggcacaaaccttctcaaattggg 59
to top
>dbj|AB026648.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MLJ15
          Length = 43481

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 64/74 (86%)
 Strand = Plus / Minus

                                                                         
Query: 383   cagtcacttcttgcagcccttggatcaattcagtttgtatccaatattgcatttgcctac 442
             ||||| ||||| ||||| |||||||| ||||| ||||||||||| || |||||||| || 
Sbjct: 10015 cagtcccttctagcagctcttggatccattcaatttgtatccaacatagcatttgcttat 9956

                           
Query: 443   gttgtgttgaacaa 456
             ||||| ||||||||
Sbjct: 9955  gttgtattgaacaa 9942



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                      
Query: 188   agtgttgccataaattttggtactaaccttctcaaattggg 228
             |||||||| || |||||||| || |||||||||||||||||
Sbjct: 10468 agtgttgctattaattttggcacaaaccttctcaaattggg 10428
to top
>emb|BX649279.7| Zebrafish DNA sequence from clone CH211-212D10 in linkage group 22,
              complete sequence
          Length = 124384

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 489    cttttattgtctttggcaatgtc 511
              |||||||||||||||||||||||
Sbjct: 115651 cttttattgtctttggcaatgtc 115673
to top
>gb|AC123072.4| Mus musculus BAC clone RP23-87D8 from chromosome 1, complete sequence
          Length = 248675

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 272    gatggcaaatttgtcccaaaa 292
              |||||||||||||||||||||
Sbjct: 180494 gatggcaaatttgtcccaaaa 180514
to top
>gb|AC092120.4| Homo sapiens chromosome 16 clone RP1-168P16, complete sequence
          Length = 113368

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 576    acagcaacttggtctttgttc 596
              |||||||||||||||||||||
Sbjct: 111754 acagcaacttggtctttgttc 111774
to top
>gb|AC092123.4| Homo sapiens chromosome 16 clone RP11-104N10, complete sequence
          Length = 112519

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 576   acagcaacttggtctttgttc 596
             |||||||||||||||||||||
Sbjct: 97488 acagcaacttggtctttgttc 97468
to top
>emb|AL109934.22|HSDJ81L22 Human DNA sequence from clone RP1-81L22 on chromosome 6, complete
            sequence
          Length = 95347

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 280  atttgtcccaaaatcagttat 300
            |||||||||||||||||||||
Sbjct: 7928 atttgtcccaaaatcagttat 7908
to top
>gb|BC106875.1| Homo sapiens zinc finger protein 21 (KOX 14), transcript variant 1,
           mRNA (cDNA clone MGC:125383 IMAGE:40011764), complete
           cds
          Length = 2542

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 575 tacagcaacttggtctttgt 594
           ||||||||||||||||||||
Sbjct: 394 tacagcaacttggtctttgt 413
to top
>ref|NM_178804.2| Mus musculus slit homolog 2 (Drosophila) (Slit2), mRNA
          Length = 6083

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 490  ttttattgtctttggcaatg 509
            ||||||||||||||||||||
Sbjct: 5372 ttttattgtctttggcaatg 5391
to top
>ref|NM_006962.1| Homo sapiens zinc finger protein 182 (ZNF182), transcript variant
           1, mRNA
          Length = 3598

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 575 tacagcaacttggtctttgt 594
           ||||||||||||||||||||
Sbjct: 524 tacagcaacttggtctttgt 543
to top
>ref|NM_001007088.1| Homo sapiens zinc finger protein 182 (ZNF182), transcript variant
           2, mRNA
          Length = 3504

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 575 tacagcaacttggtctttgt 594
           ||||||||||||||||||||
Sbjct: 430 tacagcaacttggtctttgt 449
to top
>gb|AC147343.2| Pan troglodytes BAC clone CH251-14P15 from Y, complete sequence
          Length = 277007

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 465    cagtgaaggtcatggttgcc 484
              ||||||||||||||||||||
Sbjct: 143879 cagtgaaggtcatggttgcc 143898
to top
>gb|AC147117.2| Pan troglodytes BAC clone CH251-532B3 from Y, complete sequence
          Length = 207020

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 465   cagtgaaggtcatggttgcc 484
             ||||||||||||||||||||
Sbjct: 36860 cagtgaaggtcatggttgcc 36841
to top
>gb|BC059267.1| Mus musculus slit homolog 2 (Drosophila), mRNA (cDNA clone
            IMAGE:6410513), partial cds
          Length = 4125

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 490  ttttattgtctttggcaatg 509
            ||||||||||||||||||||
Sbjct: 3399 ttttattgtctttggcaatg 3418
to top
>gb|AC133212.2| Mus musculus chromosome UNK clone RP23-45E17, complete sequence
          Length = 141857

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 490   ttttattgtctttggcaatg 509
             ||||||||||||||||||||
Sbjct: 41761 ttttattgtctttggcaatg 41780
to top
>gb|BC114216.1| Homo sapiens zinc finger protein 21 (KOX 14), transcript variant 2,
           mRNA (cDNA clone MGC:131713 IMAGE:6069900), complete cds
          Length = 3533

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 575 tacagcaacttggtctttgt 594
           ||||||||||||||||||||
Sbjct: 407 tacagcaacttggtctttgt 426
to top
>emb|AL591667.7| Human DNA sequence from clone RP11-389N9 on chromosome 6, complete
            sequence
          Length = 15019

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 31   aaaataaacacttccagttg 50
            ||||||||||||||||||||
Sbjct: 9859 aaaataaacacttccagttg 9878
to top
>emb|AL450306.14| Human DNA sequence from clone RP13-39P12 on chromosome 10 Contains a
             IMP (inosine monophosphate) dehydrogenase 2 (IMPDH2)
             pseudogene, a novel gene and  the 3' end of the DLG5 gene
             for discs large (Drosophila) homolog 5 (DLG5) (P-dlg,
             KIAA0583), complete sequence
          Length = 48537

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 462   tttcagtgaaggtcatggtt 481
             ||||||||||||||||||||
Sbjct: 16334 tttcagtgaaggtcatggtt 16315
to top
>emb|AL049589.15|HSJ570L12 Human DNA sequence from clone RP4-570L12 on chromosome Xq13.1-21.1
             Contains the PGK1 gene for phosphoglycerate kinase 1, the
             TAF9L gene for TAF9-like RNA polymerase II TATA box
             binding protein (TBP)-associated factor 31kDa, a novel
             pseudogene and a CpG island, complete sequence
          Length = 143508

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 487   aacttttattgtctttggca 506
             ||||||||||||||||||||
Sbjct: 73351 aacttttattgtctttggca 73370
to top
>gb|AC101004.6| Mus musculus, clone RP23-79E5, complete sequence
          Length = 220468

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 490    ttttattgtctttggcaatg 509
              ||||||||||||||||||||
Sbjct: 143764 ttttattgtctttggcaatg 143745
to top
>gb|AC007917.15| Homo sapiens 3 BAC RP11-379C23 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 186968

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 302   tatttccagacttggagaat 321
             ||||||||||||||||||||
Sbjct: 83515 tatttccagacttggagaat 83496
to top
>dbj|AK220505.1| Mus musculus mRNA for mKIAA4141 protein
          Length = 5762

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 490  ttttattgtctttggcaatg 509
            ||||||||||||||||||||
Sbjct: 5607 ttttattgtctttggcaatg 5626
to top
>dbj|BS000666.1| Pan troglodytes chromosome Y clone:PTBY-003G06, complete sequences
          Length = 102559

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 465   cagtgaaggtcatggttgcc 484
             ||||||||||||||||||||
Sbjct: 24014 cagtgaaggtcatggttgcc 23995
to top
>dbj|BS000578.1| Pan troglodytes chromosome Y clone:PTB-519P18, complete sequences
          Length = 175850

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 465   cagtgaaggtcatggttgcc 484
             ||||||||||||||||||||
Sbjct: 17019 cagtgaaggtcatggttgcc 17038
to top
>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence
          Length = 23952694

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 465    cagtgaaggtcatggttgcc 484
              ||||||||||||||||||||
Sbjct: 212898 cagtgaaggtcatggttgcc 212917
to top
>dbj|AK122874.1| Homo sapiens cDNA FLJ16508 fis, clone HCHON2000473, moderately
           similar to Zinc finger protein 84
          Length = 3588

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 575 tacagcaacttggtctttgt 594
           ||||||||||||||||||||
Sbjct: 529 tacagcaacttggtctttgt 548
to top
>ref|XM_925841.1| PREDICTED: Homo sapiens similar to TBP-associated factor 9L
            (LOC653068), mRNA
          Length = 6660

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 487  aacttttattgtctttggca 506
            ||||||||||||||||||||
Sbjct: 5627 aacttttattgtctttggca 5608
to top
>gb|AC099008.1| Drosophila melanogaster, chromosome 2R, region 50B-50C, BAC clone
              BACR16G12, complete sequence
          Length = 154681

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 490    ttttattgtctttggcaatg 509
              ||||||||||||||||||||
Sbjct: 149135 ttttattgtctttggcaatg 149116
to top
>gb|S75476.1| PGK1=phosphoglycerate kinase 1 {3' nuclease-sensitive region} [human,
            Genomic, 3571 nt]
          Length = 3571

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 487  aacttttattgtctttggca 506
            ||||||||||||||||||||
Sbjct: 1041 aacttttattgtctttggca 1060
to top
>gb|AC091387.2| Drosophila melanogaster, chromosome 2R, region 50C-50D, BAC clone
             BACR13P15, complete sequence
          Length = 171222

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 490   ttttattgtctttggcaatg 509
             ||||||||||||||||||||
Sbjct: 18100 ttttattgtctttggcaatg 18081
to top
>gb|AF144628.1|AF144628 Mus musculus SLIT2 (Slit2) mRNA, complete cds
          Length = 6083

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 490  ttttattgtctttggcaatg 509
            ||||||||||||||||||||
Sbjct: 5372 ttttattgtctttggcaatg 5391
to top
>emb|BX005167.12| Mouse DNA sequence from clone RP23-247K19 on chromosome X, complete
             sequence
          Length = 212046

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 416   tttgtatccaatattgcatt 435
             ||||||||||||||||||||
Sbjct: 28740 tttgtatccaatattgcatt 28759
to top
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 208      tactaaccttctcaaattgg 227
                ||||||||||||||||||||
Sbjct: 29428756 tactaaccttctcaaattgg 29428737
to top
>gb|AC068943.4| Homo sapiens BAC clone RP11-769M2 from 2, complete sequence
          Length = 72719

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 30    caaaataaacacttccagtt 49
             ||||||||||||||||||||
Sbjct: 72682 caaaataaacacttccagtt 72701
to top
>gb|AC110770.4| Homo sapiens BAC clone RP11-159P15 from 2, complete sequence
          Length = 81099

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 30   caaaataaacacttccagtt 49
            ||||||||||||||||||||
Sbjct: 1963 caaaataaacacttccagtt 1982
to top
>gb|AC016889.28| Homo sapiens chromosome 17, clone RP11-506G7, complete sequence
          Length = 187723

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 505   caatgtcttcttggtttcct 524
             ||||||||||||||||||||
Sbjct: 66179 caatgtcttcttggtttcct 66160
to top
>gb|AC128737.4| Mus musculus BAC clone RP23-99A8 from chromosome unknown, complete
             sequence
          Length = 211960

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 416   tttgtatccaatattgcatt 435
             ||||||||||||||||||||
Sbjct: 36558 tttgtatccaatattgcatt 36539
to top
>dbj|AP004333.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0034A04
          Length = 151263

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 208   tactaaccttctcaaattgg 227
             ||||||||||||||||||||
Sbjct: 91678 tactaaccttctcaaattgg 91659
to top
>gb|AC153883.6| Mus musculus 10 BAC RP23-368G20 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 181524

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 91    cttgttggaggagtatgcca 110
             ||||||||||||||||||||
Sbjct: 19125 cttgttggaggagtatgcca 19106
to top
>gb|AC153368.5| Mus musculus 10 BAC RP23-269H21 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 163268

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 91     cttgttggaggagtatgcca 110
              ||||||||||||||||||||
Sbjct: 111605 cttgttggaggagtatgcca 111586
to top
>gb|AE003817.3| Drosophila melanogaster chromosome 2R, section 33 of 73 of the complete
              sequence
          Length = 265472

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 490    ttttattgtctttggcaatg 509
              ||||||||||||||||||||
Sbjct: 205086 ttttattgtctttggcaatg 205105
to top
>gb|AF074960.1|AF074960 Mus musculus neurogenic extracellular slit protein (Slit2) mRNA,
            partial cds
          Length = 5121

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 490  ttttattgtctttggcaatg 509
            ||||||||||||||||||||
Sbjct: 3638 ttttattgtctttggcaatg 3657
to top
>gb|AC005643.1|AC005643 Drosophila melanogaster, chromosome 2R, region 50C5-50C8, P1 clone
             DS02972, complete sequence
          Length = 80389

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 490   ttttattgtctttggcaatg 509
             ||||||||||||||||||||
Sbjct: 39779 ttttattgtctttggcaatg 39760
to top
>emb|Z82263.1|CEC47A4 Caenorhabditis elegans Cosmid C47A4, complete sequence
          Length = 40664

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 288   caaaatcagttatgtatttc 307
             ||||||||||||||||||||
Sbjct: 36912 caaaatcagttatgtatttc 36893
to top
>emb|CT025633.3| Pan troglodytes chromosome X clone RP43-007L03 map Xq28, complete
              sequence
          Length = 205943

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 487    aacttttattgtctttggca 506
              ||||||||||||||||||||
Sbjct: 147162 aacttttattgtctttggca 147181
to top
>emb|Z98304.1|HS54B20 Human DNA sequence from clone RP1-54B20 on chromosome Xp11.1-11.3
              Contains the 5' end of the SSX6 gene for synovial sarcoma X
              breakpoint 6, two novel genes similar to a C2H2 type zinc
              finger protein, a novel gene, a novel gene similar to
              lysozyme C (1,4-beta-N-acetylmuramidase), the ZNF81 gene
              for zinc finger protein 81 (HFZ20) and three CpG islands,
              complete sequence
          Length = 209618

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 575    tacagcaacttggtctttgt 594
              ||||||||||||||||||||
Sbjct: 133822 tacagcaacttggtctttgt 133841


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,703,437
Number of Sequences: 3902068
Number of extensions: 5703437
Number of successful extensions: 115699
Number of sequences better than 10.0: 58
Number of HSP's better than 10.0 without gapping: 58
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 115461
Number of HSP's gapped (non-prelim): 238
length of query: 603
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 580
effective length of database: 17,143,297,704
effective search space: 9943112668320
effective search space used: 9943112668320
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top