ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags28p15
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_479931.1| Oryza sativa (japonica cultivar-group), mRNA 882 0.0
2dbj|D21130.1|RICYK704 Oryza sativa (japonica cultivar-group) YK7... 882 0.0
3dbj|AK064857.1| Oryza sativa (japonica cultivar-group) cDNA clon... 882 0.0
4dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 426 e-116
5dbj|AP004591.3| Oryza sativa (japonica cultivar-group) genomic D... 426 e-116
6emb|Y07959.1|ZMRPP0 Z.mays mRNA for acidic ribosomal protein P0 406 e-110
7gb|AC123528.2| Oryza sativa chromosome 11 clone OSJNBa0078E03, ... 402 e-109
8dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 402 e-109
9gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 402 e-109
10gb|BT016531.1| Zea mays clone Contig364 mRNA sequence 398 e-108
11dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 391 e-105
12gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 391 e-105
13emb|BX000508.1|CNS08CDY Oryza sativa chromosome 12, . BAC OJ1575... 391 e-105
14emb|BX000498.1|CNS08CDO Oryza sativa chromosome 12, . BAC OSJNBa... 391 e-105
15gb|L46848.1|SOYARPP Glycine max acidic ribosomal protein P0 mRNA... 250 5e-63
16ref|NM_111754.2| Arabidopsis thaliana structural constituent of ... 234 3e-58
17gb|AY059117.1| Arabidopsis thaliana putative 60S acidic ribosoma... 234 3e-58
18gb|AF370225.1| Arabidopsis thaliana putative 60S acidic ribosoma... 234 3e-58
19emb|BX823923.1|CNS0A6KD Arabidopsis thaliana Full-length cDNA Co... 234 3e-58
20dbj|AB091076.1| Zinnia elegans ZeRPP0 mRNA for putative 60S acid... 234 3e-58
21ref|NM_111960.2| Arabidopsis thaliana structural constituent of ... 230 5e-57
22gb|AY091201.1| Arabidopsis thaliana putative 60S acidic ribosoma... 230 5e-57
23gb|AY056150.1| Arabidopsis thaliana putative 60S acidic ribosoma... 230 5e-57
24gb|AY087728.1| Arabidopsis thaliana clone 38036 mRNA, complete s... 230 5e-57
25gb|DQ235176.1| Solanum tuberosum clone 156H10 P0 ribosomal prote... 228 2e-56
26gb|DQ241840.1| Solanum tuberosum clone 181G12 P0 ribosomal prote... 228 2e-56
27gb|BT018921.1| Zea mays clone Contig30.F mRNA sequence 226 8e-56
28gb|AY086582.1| Arabidopsis thaliana clone 2595 mRNA, complete se... 226 8e-56
29emb|BX824039.1|CNS0A6RI Arabidopsis thaliana Full-length cDNA Co... 224 3e-55
30gb|AF227622.1|AF227622 Euphorbia esula 60S acidic ribosomal prot... 198 2e-47
31emb|X93587.1|LLP0 L.luteus mRNA for P0 ribosomal protein 186 7e-44
32dbj|AB236824.1| Trifolium pratense RNA for putative 60S acidic r... 176 6e-41
33dbj|AB236811.1| Trifolium pratense RNA for putative 60S acidic r... 176 6e-41
34emb|X15206.1|CRCRE2 C.rubrum mRNA for light-induced 34kD protein 170 4e-39
35gb|AC011436.7|ATAC011436 Arabidopsis thaliana chromosome III BAC... 149 1e-32
36gb|AC009326.8|ATAC009326 Arabidopsis thaliana chromosome III P1 ... 149 1e-32
37ref|NM_129559.2| Arabidopsis thaliana structural constituent of ... 137 5e-29
38gb|AY070448.1| Arabidopsis thaliana At2g40010 mRNA sequence 137 5e-29
39emb|BX819391.1|CNS0A9W8 Arabidopsis thaliana Full-length cDNA Co... 137 5e-29
40gb|BT001919.1| Arabidopsis thaliana clone C105444 putative 60S a... 137 5e-29
41gb|AC073395.6|AC073395 Arabidopsis thaliana chromosome 3 BAC F11... 121 3e-24
42gb|AF002109.3| Arabidopsis thaliana chromosome 2 clone T28M21 ma... 113 8e-22
43gb|AC130799.19| Medicago truncatula clone mth2-34b13, complete s... 109 1e-20
44ref|XM_479932.1| Oryza sativa (japonica cultivar-group), mRNA 103 8e-19
45emb|BX816288.1|CNS0AE9F Arabidopsis thaliana Full-length cDNA Co... 103 8e-19
46dbj|AK062008.1| Oryza sativa (japonica cultivar-group) cDNA clon... 103 8e-19
47gb|DQ306774.1| Hevea brasiliensis isolate SSH45 mRNA sequence 54 6e-04
48gb|DQ306752.1| Hevea brasiliensis isolate SSH23 mRNA sequence 54 6e-04
49gb|CP000079.1| Leishmania major strain Friedlin chromosome 27, c... 52 0.002
50gb|AY702006.1| Leishmania donovani strain MHOM/IN/1983/AG83 60S ... 52 0.002
51ref|XM_843003.1| Leishmania major strain Friedlin 60S acidic rib... 52 0.002
52ref|XM_843004.1| Leishmania major strain Friedlin 60S acidic rib... 52 0.002
53emb|X72714.1|LILIPOA L. infantum LiPO-A and LiPO-B gene 52 0.002
54gb|AY180912.1| Leishmania donovani ribosomal protein P0-like mRN... 52 0.002
55gb|AY880417.1| Gekko japonicus GekBS186P mRNA, complete cds 52 0.002
56gb|L29300.1|LEIRIBPP Leishmania chagasi (clone C1) ribosomal pro... 52 0.002
57emb|AJ783861.1| Carabus granulatus partial mRNA for acidic p0 ri... 50 0.010
58gb|AF401551.1| Ictalurus punctatus ribosomal protein P0 mRNA, co... 50 0.010
59dbj|AB113109.1| Aotus trivirgatus Aotr-B1 gene for MHC class I a... 50 0.010
60gb|AC164402.3| Mus musculus chromosome 15, clone RP23-463G20, co... 48 0.039
61ref|XM_787003.1| PREDICTED: Strongylocentrotus purpuratus simila... 48 0.039
62emb|BX032675.1|CNS08XDJ Single read from an extremity of a full-... 48 0.039
63emb|BX019003.1|CNS08MTR Single read from an extremity of a full-... 48 0.039
64emb|BX018793.1|CNS08MNX Single read from an extremity of a full-... 48 0.039
65emb|BX013777.1|CNS08ISL Single read from an extremity of a full-... 48 0.039
66emb|BX006032.1|CNS08CTG Single read from an extremity of a full-... 48 0.039
67emb|BX005998.1|CNS08CSI Single read from an extremity of a full-... 48 0.039
68ref|XM_789716.1| PREDICTED: Strongylocentrotus purpuratus simila... 48 0.039
69gb|AC106843.11| Mus musculus chromosome 15, clone RP24-151M4, co... 48 0.039
70ref|XM_655246.1| Aspergillus nidulans FGSC A4 60S acidic ribosom... 46 0.15
71emb|BX053469.1|CNS09DF5 Single read from an extremity of a full-... 46 0.15
72emb|BX072148.1|CNS09RU0 Single read from an extremity of a full-... 46 0.15
73emb|BX072146.1|CNS09RTY Single read from an extremity of a full-... 46 0.15
74emb|BX072055.1|CNS09RRF Single read from an extremity of a full-... 46 0.15
75emb|BX072031.1|CNS09RQR Single read from an extremity of a full-... 46 0.15
76emb|BX071993.1|CNS09RPP Single read from an extremity of a full-... 46 0.15
77emb|BX071847.1|CNS09RLN Single read from an extremity of a full-... 46 0.15
78emb|BX071747.1|CNS09RIV Single read from an extremity of a full-... 46 0.15
79emb|BX071518.1|CNS09RCI Single read from an extremity of a full-... 46 0.15
80emb|BX071226.1|CNS09R4E Single read from an extremity of a full-... 46 0.15
81emb|BX071175.1|CNS09R2Z Single read from an extremity of a full-... 46 0.15
82emb|BX071445.1|CNS09RAH Single read from an extremity of a full-... 46 0.15
83emb|BX071386.1|CNS09R8U Single read from an extremity of a full-... 46 0.15
84emb|BX071318.1|CNS09R6Y Single read from an extremity of a full-... 46 0.15
85emb|BX071251.1|CNS09R53 Single read from an extremity of a full-... 46 0.15
86emb|BX071039.1|CNS09QZ7 Single read from an extremity of a full-... 46 0.15
87emb|BX070973.1|CNS09QXD Single read from an extremity of a full-... 46 0.15
88emb|BX070930.1|CNS09QW6 Single read from an extremity of a full-... 46 0.15
89emb|BX070900.1|CNS09QVC Single read from an extremity of a full-... 46 0.15
90emb|BX070894.1|CNS09QV6 Single read from an extremity of a full-... 46 0.15
91emb|BX070751.1|CNS09QR7 Single read from an extremity of a full-... 46 0.15
92emb|BX070745.1|CNS09QR1 Single read from an extremity of a full-... 46 0.15
93emb|BX070622.1|CNS09QNM Single read from an extremity of a full-... 46 0.15
94emb|BX070589.1|CNS09QMP Single read from an extremity of a full-... 46 0.15
95emb|BX070541.1|CNS09QLD Single read from an extremity of a full-... 46 0.15
96emb|BX070099.1|CNS09Q93 Single read from an extremity of a full-... 46 0.15
97emb|BX069823.1|CNS09Q1F Single read from an extremity of a full-... 46 0.15
98emb|BX069791.1|CNS09Q0J Single read from an extremity of a full-... 46 0.15
99emb|BX061098.1|CNS09JB2 Single read from an extremity of a full-... 46 0.15
100emb|BX061090.1|CNS09JAU Single read from an extremity of a full-... 46 0.15
101emb|BX061061.1|CNS09JA1 Single read from an extremity of a full-... 46 0.15
102emb|BX061042.1|CNS09J9I Single read from an extremity of a full-... 46 0.15
103emb|BX069588.1|CNS09PUW Single read from an extremity of a full-... 46 0.15
104emb|BX069403.1|CNS09PPR Single read from an extremity of a full-... 46 0.15
105emb|BX069336.1|CNS09PNW Single read from an extremity of a full-... 46 0.15
106emb|BX069235.1|CNS09PL3 Single read from an extremity of a full-... 46 0.15
107emb|BX069142.1|CNS09PII Single read from an extremity of a full-... 46 0.15
108emb|BX069126.1|CNS09PI2 Single read from an extremity of a full-... 46 0.15
109emb|BX068988.1|CNS09PE8 Single read from an extremity of a full-... 46 0.15
110emb|BX068833.1|CNS09P9X Single read from an extremity of a full-... 46 0.15
111emb|BX068815.1|CNS09P9F Single read from an extremity of a full-... 46 0.15
112emb|BX068760.1|CNS09P7W Single read from an extremity of a full-... 46 0.15
113emb|BX068607.1|CNS09P3N Single read from an extremity of a full-... 46 0.15
114emb|BX068471.1|CNS09OZV Single read from an extremity of a full-... 46 0.15
115emb|BX068229.1|CNS09OT5 Single read from an extremity of a full-... 46 0.15
116emb|BX068019.1|CNS09ONB Single read from an extremity of a full-... 46 0.15
117emb|BX067891.1|CNS09OJR Single read from an extremity of a full-... 46 0.15
118emb|BX067841.1|CNS09OID Single read from an extremity of a full-... 46 0.15
119emb|BX067819.1|CNS09OHR Single read from an extremity of a full-... 46 0.15
120emb|BX067775.1|CNS09OGJ Single read from an extremity of a full-... 46 0.15
121emb|BX067752.1|CNS09OFW Single read from an extremity of a full-... 46 0.15
122emb|BX067707.1|CNS09OEN Single read from an extremity of a full-... 46 0.15
123emb|BX067564.1|CNS09OAO Single read from an extremity of a full-... 46 0.15
124emb|BX067487.1|CNS09O8J Single read from an extremity of a full-... 46 0.15
125emb|BX067429.1|CNS09O6X Single read from an extremity of a full-... 46 0.15
126emb|BX066992.1|CNS09NUS Single read from an extremity of a full-... 46 0.15
127emb|BX067216.1|CNS09O10 Single read from an extremity of a full-... 46 0.15
128emb|BX067179.1|CNS09NZZ Single read from an extremity of a full-... 46 0.15
129emb|BX066854.1|CNS09NQY Single read from an extremity of a full-... 46 0.15
130emb|BX066645.1|CNS09NL5 Single read from an extremity of a full-... 46 0.15
131emb|BX066623.1|CNS09NKJ Single read from an extremity of a full-... 46 0.15
132emb|BX066597.1|CNS09NJT Single read from an extremity of a full-... 46 0.15
133emb|BX066426.1|CNS09NF2 Single read from an extremity of a full-... 46 0.15
134emb|BX066412.1|CNS09NEO Single read from an extremity of a full-... 46 0.15
135emb|BX066390.1|CNS09NE2 Single read from an extremity of a full-... 46 0.15
136emb|BX066329.1|CNS09NCD Single read from an extremity of a full-... 46 0.15
137emb|BX065816.1|CNS09MY4 Single read from an extremity of a full-... 46 0.15
138emb|BX065714.1|CNS09MVA Single read from an extremity of a full-... 46 0.15
139emb|BX065713.1|CNS09MV9 Single read from an extremity of a full-... 46 0.15
140emb|BX065465.1|CNS09MOD Single read from an extremity of a full-... 46 0.15
141emb|BX065359.1|CNS09MLF Single read from an extremity of a full-... 46 0.15
142emb|BX065269.1|CNS09MIX Single read from an extremity of a full-... 46 0.15
143emb|BX065249.1|CNS09MID Single read from an extremity of a full-... 46 0.15
144emb|BX065042.1|CNS09MCM Single read from an extremity of a full-... 46 0.15
145emb|BX065015.1|CNS09MBV Single read from an extremity of a full-... 46 0.15
146emb|BX065006.1|CNS09MBM Single read from an extremity of a full-... 46 0.15
147emb|BX065005.1|CNS09MBL Single read from an extremity of a full-... 46 0.15
148emb|BX064952.1|CNS09MA4 Single read from an extremity of a full-... 46 0.15
149emb|BX064796.1|CNS09M5S Single read from an extremity of a full-... 46 0.15
150emb|BX064760.1|CNS09M4S Single read from an extremity of a full-... 46 0.15
151emb|BX064725.1|CNS09M3T Single read from an extremity of a full-... 46 0.15
152emb|BX064530.1|CNS09LYE Single read from an extremity of a full-... 46 0.15
153emb|BX064423.1|CNS09LVF Single read from an extremity of a full-... 46 0.15
154emb|BX064284.1|CNS09LRK Single read from an extremity of a full-... 46 0.15
155emb|BX064164.1|CNS09LO8 Single read from an extremity of a full-... 46 0.15
156emb|BX064121.1|CNS09LN1 Single read from an extremity of a full-... 46 0.15
157emb|BX064120.1|CNS09LN0 Single read from an extremity of a full-... 46 0.15
158emb|BX064068.1|CNS09LLK Single read from an extremity of a full-... 46 0.15
159emb|BX063872.1|CNS09LG4 Single read from an extremity of a full-... 46 0.15
160emb|BX063577.1|CNS09L7X Single read from an extremity of a full-... 46 0.15
161emb|BX063467.1|CNS09L4V Single read from an extremity of a full-... 46 0.15
162emb|BX063466.1|CNS09L4U Single read from an extremity of a full-... 46 0.15
163emb|BX063434.1|CNS09L3Y Single read from an extremity of a full-... 46 0.15
164emb|BX063420.1|CNS09L3K Single read from an extremity of a full-... 46 0.15
165emb|BX063227.1|CNS09KY7 Single read from an extremity of a full-... 46 0.15
166emb|BX062791.1|CNS09KM3 Single read from an extremity of a full-... 46 0.15
167emb|BX062552.1|CNS09KFG Single read from an extremity of a full-... 46 0.15
168emb|BX062546.1|CNS09KFA Single read from an extremity of a full-... 46 0.15
169emb|BX062387.1|CNS09KAV Single read from an extremity of a full-... 46 0.15
170emb|BX062299.1|CNS09K8F Single read from an extremity of a full-... 46 0.15
171emb|BX062297.1|CNS09K8D Single read from an extremity of a full-... 46 0.15
172emb|BX062183.1|CNS09K57 Single read from an extremity of a full-... 46 0.15
173emb|BX062169.1|CNS09K4T Single read from an extremity of a full-... 46 0.15
174emb|BX062048.1|CNS09K1G Single read from an extremity of a full-... 46 0.15
175emb|BX061878.1|CNS09JWQ Single read from an extremity of a full-... 46 0.15
176emb|BX061190.1|CNS09JDM Single read from an extremity of a full-... 46 0.15
177emb|BX061164.1|CNS09JCW Single read from an extremity of a full-... 46 0.15
178emb|BX061163.1|CNS09JCV Single read from an extremity of a full-... 46 0.15
179emb|BX061137.1|CNS09JC5 Single read from an extremity of a full-... 46 0.15
180emb|BX061133.1|CNS09JC1 Single read from an extremity of a full-... 46 0.15
181emb|BX060642.1|CNS09IYE Single read from an extremity of a full-... 46 0.15
182emb|BX060527.1|CNS09IV7 Single read from an extremity of a full-... 46 0.15
183emb|BX060489.1|CNS09IU5 Single read from an extremity of a full-... 46 0.15
184emb|BX060488.1|CNS09IU4 Single read from an extremity of a full-... 46 0.15
185emb|BX060443.1|CNS09ISV Single read from an extremity of a full-... 46 0.15
186emb|BX060185.1|CNS09ILP Single read from an extremity of a full-... 46 0.15
187emb|BX059916.1|CNS09IE8 Single read from an extremity of a full-... 46 0.15
188emb|BX059866.1|CNS09ICU Single read from an extremity of a full-... 46 0.15
189emb|BX059758.1|CNS09I9U Single read from an extremity of a full-... 46 0.15
190emb|BX059741.1|CNS09I9D Single read from an extremity of a full-... 46 0.15
191emb|BX059642.1|CNS09I6M Single read from an extremity of a full-... 46 0.15
192emb|BX059587.1|CNS09I53 Single read from an extremity of a full-... 46 0.15
193emb|BX059585.1|CNS09I51 Single read from an extremity of a full-... 46 0.15
194emb|BX059469.1|CNS09I1T Single read from an extremity of a full-... 46 0.15
195emb|BX059305.1|CNS09HX9 Single read from an extremity of a full-... 46 0.15
196emb|BX059220.1|CNS09HUW Single read from an extremity of a full-... 46 0.15
197emb|BX059184.1|CNS09HTW Single read from an extremity of a full-... 46 0.15
198emb|BX059095.1|CNS09HRF Single read from an extremity of a full-... 46 0.15
199emb|BX058971.1|CNS09HNZ Single read from an extremity of a full-... 46 0.15
200emb|BX058839.1|CNS09HKB Single read from an extremity of a full-... 46 0.15
201emb|BX058760.1|CNS09HI4 Single read from an extremity of a full-... 46 0.15
202emb|BX058740.1|CNS09HHK Single read from an extremity of a full-... 46 0.15
203emb|BX058729.1|CNS09HH9 Single read from an extremity of a full-... 46 0.15
204emb|BX058315.1|CNS09H5R Single read from an extremity of a full-... 46 0.15
205emb|BX058203.1|CNS09H2N Single read from an extremity of a full-... 46 0.15
206emb|BX056754.1|CNS09FYE Single read from an extremity of a full-... 46 0.15
207emb|BX057924.1|CNS09GUW Single read from an extremity of a full-... 46 0.15
208emb|BX057796.1|CNS09GRC Single read from an extremity of a full-... 46 0.15
209emb|BX057631.1|CNS09GMR Single read from an extremity of a full-... 46 0.15
210emb|BX057605.1|CNS09GM1 Single read from an extremity of a full-... 46 0.15
211emb|BX057468.1|CNS09GI8 Single read from an extremity of a full-... 46 0.15
212emb|BX057218.1|CNS09GBA Single read from an extremity of a full-... 46 0.15
213emb|BX057213.1|CNS09GB5 Single read from an extremity of a full-... 46 0.15
214emb|BX057133.1|CNS09G8X Single read from an extremity of a full-... 46 0.15
215emb|BX057094.1|CNS09G7U Single read from an extremity of a full-... 46 0.15
216emb|BX057074.1|CNS09G7A Single read from an extremity of a full-... 46 0.15
217emb|BX056996.1|CNS09G54 Single read from an extremity of a full-... 46 0.15
218emb|BX056958.1|CNS09G42 Single read from an extremity of a full-... 46 0.15
219emb|BX056914.1|CNS09G2U Single read from an extremity of a full-... 46 0.15
220emb|BX056483.1|CNS09FQV Single read from an extremity of a full-... 46 0.15
221emb|BX055960.1|CNS09FCC Single read from an extremity of a full-... 46 0.15
222emb|BX055808.1|CNS09F84 Single read from an extremity of a full-... 46 0.15
223emb|BX056320.1|CNS09FMC Single read from an extremity of a full-... 46 0.15
224emb|BX056288.1|CNS09FLG Single read from an extremity of a full-... 46 0.15
225emb|BX056287.1|CNS09FLF Single read from an extremity of a full-... 46 0.15
226emb|BX056283.1|CNS09FLB Single read from an extremity of a full-... 46 0.15
227emb|BX055999.1|CNS09FDF Single read from an extremity of a full-... 46 0.15
228emb|BX055725.1|CNS09F5T Single read from an extremity of a full-... 46 0.15
229emb|BX055721.1|CNS09F5P Single read from an extremity of a full-... 46 0.15
230emb|BX055621.1|CNS09F2X Single read from an extremity of a full-... 46 0.15
231emb|BX055603.1|CNS09F2F Single read from an extremity of a full-... 46 0.15
232emb|BX055567.1|CNS09F1F Single read from an extremity of a full-... 46 0.15
233emb|BX053214.1|CNS09D82 Single read from an extremity of a full-... 46 0.15
234emb|BX053185.1|CNS09D79 Single read from an extremity of a full-... 46 0.15
235emb|BX053146.1|CNS09D66 Single read from an extremity of a full-... 46 0.15
236emb|BX052948.1|CNS09D0O Single read from an extremity of a full-... 46 0.15
237emb|BX052946.1|CNS09D0M Single read from an extremity of a full-... 46 0.15
238emb|BX054654.1|CNS09EC2 Single read from an extremity of a full-... 46 0.15
239emb|BX054435.1|CNS09E5Z Single read from an extremity of a full-... 46 0.15
240emb|BX054345.1|CNS09E3H Single read from an extremity of a full-... 46 0.15
241emb|BX054246.1|CNS09E0Q Single read from an extremity of a full-... 46 0.15
242emb|BX054186.1|CNS09DZ2 Single read from an extremity of a full-... 46 0.15
243emb|BX054114.1|CNS09DX2 Single read from an extremity of a full-... 46 0.15
244emb|BX054048.1|CNS09DV8 Single read from an extremity of a full-... 46 0.15
245emb|BX053890.1|CNS09DQU Single read from an extremity of a full-... 46 0.15
246emb|BX053889.1|CNS09DQT Single read from an extremity of a full-... 46 0.15
247emb|BX053751.1|CNS09DMZ Single read from an extremity of a full-... 46 0.15
248emb|BX053704.1|CNS09DLO Single read from an extremity of a full-... 46 0.15
249emb|BX053693.1|CNS09DLD Single read from an extremity of a full-... 46 0.15
250emb|BX053532.1|CNS09DGW Single read from an extremity of a full-... 46 0.15
251emb|BX052874.1|CNS09CYM Single read from an extremity of a full-... 46 0.15
252emb|BX052836.1|CNS09CXK Single read from an extremity of a full-... 46 0.15
253emb|BX052835.1|CNS09CXJ Single read from an extremity of a full-... 46 0.15
254emb|BX052777.1|CNS09CVX Single read from an extremity of a full-... 46 0.15
255emb|BX052724.1|CNS09CUG Single read from an extremity of a full-... 46 0.15
256emb|BX052368.1|CNS09CKK Single read from an extremity of a full-... 46 0.15
257emb|BX052263.1|CNS09CHN Single read from an extremity of a full-... 46 0.15
258emb|BX052235.1|CNS09CGV Single read from an extremity of a full-... 46 0.15
259emb|BX052085.1|CNS09CCP Single read from an extremity of a full-... 46 0.15
260emb|BX052064.1|CNS09CC4 Single read from an extremity of a full-... 46 0.15
261emb|BX052006.1|CNS09CAI Single read from an extremity of a full-... 46 0.15
262emb|BX051964.1|CNS09C9C Single read from an extremity of a full-... 46 0.15
263emb|BX051899.1|CNS09C7J Single read from an extremity of a full-... 46 0.15
264emb|BX051866.1|CNS09C6M Single read from an extremity of a full-... 46 0.15
265emb|BX051626.1|CNS09BZY Single read from an extremity of a full-... 46 0.15
266emb|BX051618.1|CNS09BZQ Single read from an extremity of a full-... 46 0.15
267emb|BX051600.1|CNS09BZ8 Single read from an extremity of a full-... 46 0.15
268emb|BX051577.1|CNS09BYL Single read from an extremity of a full-... 46 0.15
269emb|BX051509.1|CNS09BWP Single read from an extremity of a full-... 46 0.15
270emb|BX051472.1|CNS09BVO Single read from an extremity of a full-... 46 0.15
271emb|BX051379.1|CNS09BT3 Single read from an extremity of a full-... 46 0.15
272emb|BX051301.1|CNS09BQX Single read from an extremity of a full-... 46 0.15
273emb|BX050244.1|CNS09AXK Single read from an extremity of a full-... 46 0.15
274emb|BX050212.1|CNS09AWO Single read from an extremity of a full-... 46 0.15
275emb|BX050202.1|CNS09AWE Single read from an extremity of a full-... 46 0.15
276emb|BX050196.1|CNS09AW8 Single read from an extremity of a full-... 46 0.15
277emb|BX050804.1|CNS09BD4 Single read from an extremity of a full-... 46 0.15
278emb|BX050797.1|CNS09BCX Single read from an extremity of a full-... 46 0.15
279emb|BX050762.1|CNS09BBY Single read from an extremity of a full-... 46 0.15
280emb|BX050723.1|CNS09BAV Single read from an extremity of a full-... 46 0.15
281emb|BX050711.1|CNS09BAJ Single read from an extremity of a full-... 46 0.15
282emb|BX050679.1|CNS09B9N Single read from an extremity of a full-... 46 0.15
283emb|BX050552.1|CNS09B64 Single read from an extremity of a full-... 46 0.15
284emb|BX050545.1|CNS09B5X Single read from an extremity of a full-... 46 0.15
285emb|BX050514.1|CNS09B52 Single read from an extremity of a full-... 46 0.15
286emb|BX050479.1|CNS09B43 Single read from an extremity of a full-... 46 0.15
287emb|BX050437.1|CNS09B2X Single read from an extremity of a full-... 46 0.15
288emb|BX050412.1|CNS09B28 Single read from an extremity of a full-... 46 0.15
289emb|BX050290.1|CNS09AYU Single read from an extremity of a full-... 46 0.15
290emb|BX049856.1|CNS09AMS Single read from an extremity of a full-... 46 0.15
291emb|BX049758.1|CNS09AK2 Single read from an extremity of a full-... 46 0.15
292emb|BX049674.1|CNS09AHQ Single read from an extremity of a full-... 46 0.15
293emb|BX030999.1|CNS08W2Z Single read from an extremity of a full-... 46 0.15
294emb|BX030941.1|CNS08W1D Single read from an extremity of a full-... 46 0.15
295emb|BX030929.1|CNS08W11 Single read from an extremity of a full-... 46 0.15
296emb|BX030903.1|CNS08W0B Single read from an extremity of a full-... 46 0.15
297emb|BX049615.1|CNS09AG3 Single read from an extremity of a full-... 46 0.15
298emb|BX049546.1|CNS09AE6 Single read from an extremity of a full-... 46 0.15
299emb|BX049524.1|CNS09ADK Single read from an extremity of a full-... 46 0.15
300emb|BX049466.1|CNS09ABY Single read from an extremity of a full-... 46 0.15
301emb|BX049240.1|CNS09A5O Single read from an extremity of a full-... 46 0.15
302emb|BX049187.1|CNS09A47 Single read from an extremity of a full-... 46 0.15
303emb|BX048525.1|CNS099LT Single read from an extremity of a full-... 46 0.15
304emb|BX048433.1|CNS099J9 Single read from an extremity of a full-... 46 0.15
305emb|BX048234.1|CNS099DQ Single read from an extremity of a full-... 46 0.15
306emb|BX048199.1|CNS099CR Single read from an extremity of a full-... 46 0.15
307emb|BX047999.1|CNS09977 Single read from an extremity of a full-... 46 0.15
308emb|BX047946.1|CNS0995Q Single read from an extremity of a full-... 46 0.15
309emb|BX047843.1|CNS0992V Single read from an extremity of a full-... 46 0.15
310emb|BX047734.1|CNS098ZU Single read from an extremity of a full-... 46 0.15
311emb|BX047732.1|CNS098ZS Single read from an extremity of a full-... 46 0.15
312emb|BX047714.1|CNS098ZA Single read from an extremity of a full-... 46 0.15
313emb|BX047691.1|CNS098YN Single read from an extremity of a full-... 46 0.15
314emb|BX047277.1|CNS098N5 Single read from an extremity of a full-... 46 0.15
315emb|BX047157.1|CNS098JT Single read from an extremity of a full-... 46 0.15
316emb|BX047017.1|CNS098FX Single read from an extremity of a full-... 46 0.15
317emb|BX046849.1|CNS098B9 Single read from an extremity of a full-... 46 0.15
318emb|BX046679.1|CNS0986J Single read from an extremity of a full-... 46 0.15
319emb|BX046353.1|CNS097XH Single read from an extremity of a full-... 46 0.15
320emb|BX046290.1|CNS097VQ Single read from an extremity of a full-... 46 0.15
321emb|BX046163.1|CNS097S7 Single read from an extremity of a full-... 46 0.15
322emb|BX046117.1|CNS097QX Single read from an extremity of a full-... 46 0.15
323emb|BX046099.1|CNS097QF Single read from an extremity of a full-... 46 0.15
324emb|BX046025.1|CNS097OD Single read from an extremity of a full-... 46 0.15
325emb|BX045705.1|CNS097FH Single read from an extremity of a full-... 46 0.15
326emb|BX045497.1|CNS0979P Single read from an extremity of a full-... 46 0.15
327emb|BX045440.1|CNS09784 Single read from an extremity of a full-... 46 0.15
328emb|BX045432.1|CNS0977W Single read from an extremity of a full-... 46 0.15
329emb|BX045074.1|CNS096XY Single read from an extremity of a full-... 46 0.15
330emb|BX045040.1|CNS096X0 Single read from an extremity of a full-... 46 0.15
331emb|BX045257.1|CNS09731 Single read from an extremity of a full-... 46 0.15
332emb|BX044857.1|CNS096RX Single read from an extremity of a full-... 46 0.15
333emb|BX044741.1|CNS096OP Single read from an extremity of a full-... 46 0.15
334emb|BX044735.1|CNS096OJ Single read from an extremity of a full-... 46 0.15
335emb|BX043090.1|CNS095EU Single read from an extremity of a full-... 46 0.15
336emb|BX043059.1|CNS095DZ Single read from an extremity of a full-... 46 0.15
337emb|BX042955.1|CNS095B3 Single read from an extremity of a full-... 46 0.15
338emb|BX044619.1|CNS096LB Single read from an extremity of a full-... 46 0.15
339emb|BX044429.1|CNS096G1 Single read from an extremity of a full-... 46 0.15
340emb|BX044185.1|CNS09699 Single read from an extremity of a full-... 46 0.15
341emb|BX044159.1|CNS0968J Single read from an extremity of a full-... 46 0.15
342emb|BX044153.1|CNS0968D Single read from an extremity of a full-... 46 0.15
343emb|BX044099.1|CNS0966V Single read from an extremity of a full-... 46 0.15
344emb|BX044052.1|CNS0965K Single read from an extremity of a full-... 46 0.15
345emb|BX044026.1|CNS0964U Single read from an extremity of a full-... 46 0.15
346emb|BX043798.1|CNS095YI Single read from an extremity of a full-... 46 0.15
347emb|BX043757.1|CNS095XD Single read from an extremity of a full-... 46 0.15
348emb|BX043472.1|CNS095PG Single read from an extremity of a full-... 46 0.15
349emb|BX043702.1|CNS095VU Single read from an extremity of a full-... 46 0.15
350emb|BX043623.1|CNS095TN Single read from an extremity of a full-... 46 0.15
351emb|BX043251.1|CNS095JB Single read from an extremity of a full-... 46 0.15
352emb|BX043128.1|CNS095FW Single read from an extremity of a full-... 46 0.15
353emb|BX043127.1|CNS095FV Single read from an extremity of a full-... 46 0.15
354emb|BX043118.1|CNS095FM Single read from an extremity of a full-... 46 0.15
355emb|BX042609.1|CNS0951H Single read from an extremity of a full-... 46 0.15
356emb|BX042524.1|CNS094Z4 Single read from an extremity of a full-... 46 0.15
357emb|BX042434.1|CNS094WM Single read from an extremity of a full-... 46 0.15
358emb|BX042404.1|CNS094VS Single read from an extremity of a full-... 46 0.15
359emb|BX042353.1|CNS094UD Single read from an extremity of a full-... 46 0.15
360emb|BX041748.1|CNS094DK Single read from an extremity of a full-... 46 0.15
361emb|BX041651.1|CNS094AV Single read from an extremity of a full-... 46 0.15
362emb|BX041602.1|CNS0949I Single read from an extremity of a full-... 46 0.15
363emb|BX041467.1|CNS0945R Single read from an extremity of a full-... 46 0.15
364emb|BX041389.1|CNS0943L Single read from an extremity of a full-... 46 0.15
365emb|BX041365.1|CNS0942X Single read from an extremity of a full-... 46 0.15
366emb|BX041135.1|CNS093WJ Single read from an extremity of a full-... 46 0.15
367emb|BX041109.1|CNS093VT Single read from an extremity of a full-... 46 0.15
368emb|BX041108.1|CNS093VS Single read from an extremity of a full-... 46 0.15
369emb|BX040887.1|CNS093PN Single read from an extremity of a full-... 46 0.15
370emb|BX040837.1|CNS093O9 Single read from an extremity of a full-... 46 0.15
371emb|BX040799.1|CNS093N7 Single read from an extremity of a full-... 46 0.15
372emb|BX040616.1|CNS093I4 Single read from an extremity of a full-... 46 0.15
373emb|BX040351.1|CNS093AR Single read from an extremity of a full-... 46 0.15
374emb|BX040297.1|CNS09399 Single read from an extremity of a full-... 46 0.15
375emb|BX040236.1|CNS0937K Single read from an extremity of a full-... 46 0.15
376emb|BX040137.1|CNS0934T Single read from an extremity of a full-... 46 0.15
377emb|BX040069.1|CNS0932X Single read from an extremity of a full-... 46 0.15
378emb|BX039907.1|CNS092YF Single read from an extremity of a full-... 46 0.15
379emb|BX039734.1|CNS092TM Single read from an extremity of a full-... 46 0.15
380emb|BX039373.1|CNS092JL Single read from an extremity of a full-... 46 0.15
381emb|BX039309.1|CNS092HT Single read from an extremity of a full-... 46 0.15
382emb|BX039262.1|CNS092GI Single read from an extremity of a full-... 46 0.15
383emb|BX037386.1|CNS0910E Single read from an extremity of a full-... 46 0.15
384emb|BX037345.1|CNS090Z9 Single read from an extremity of a full-... 46 0.15
385emb|BX037247.1|CNS090WJ Single read from an extremity of a full-... 46 0.15
386emb|BX037215.1|CNS090VN Single read from an extremity of a full-... 46 0.15
387emb|BX036759.1|CNS090IZ Single read from an extremity of a full-... 46 0.15
388emb|BX036700.1|CNS090HC Single read from an extremity of a full-... 46 0.15
389emb|BX036670.1|CNS090GI Single read from an extremity of a full-... 46 0.15
390emb|BX037189.1|CNS090UX Single read from an extremity of a full-... 46 0.15
391emb|BX037187.1|CNS090UV Single read from an extremity of a full-... 46 0.15
392emb|BX037165.1|CNS090U9 Single read from an extremity of a full-... 46 0.15
393emb|BX037106.1|CNS090SM Single read from an extremity of a full-... 46 0.15
394emb|BX037012.1|CNS090Q0 Single read from an extremity of a full-... 46 0.15
395emb|BX036831.1|CNS090KZ Single read from an extremity of a full-... 46 0.15
396emb|BX036518.1|CNS090CA Single read from an extremity of a full-... 46 0.15
397emb|BX036428.1|CNS0909S Single read from an extremity of a full-... 46 0.15
398emb|BX036405.1|CNS09095 Single read from an extremity of a full-... 46 0.15
399emb|BX036358.1|CNS0907U Single read from an extremity of a full-... 46 0.15
400emb|BX036158.1|CNS0902A Single read from an extremity of a full-... 46 0.15
401emb|BX036109.1|CNS0900X Single read from an extremity of a full-... 46 0.15
402emb|BX035782.1|CNS08ZRU Single read from an extremity of a full-... 46 0.15
403emb|BX035671.1|CNS08ZOR Single read from an extremity of a full-... 46 0.15
404emb|BX035626.1|CNS08ZNI Single read from an extremity of a full-... 46 0.15
405emb|BX035617.1|CNS08ZN9 Single read from an extremity of a full-... 46 0.15
406emb|BX035548.1|CNS08ZLC Single read from an extremity of a full-... 46 0.15
407emb|BX035515.1|CNS08ZKF Single read from an extremity of a full-... 46 0.15
408emb|BX035485.1|CNS08ZJL Single read from an extremity of a full-... 46 0.15
409emb|BX035372.1|CNS08ZGG Single read from an extremity of a full-... 46 0.15
410emb|BX035343.1|CNS08ZFN Single read from an extremity of a full-... 46 0.15
411emb|BX035328.1|CNS08ZF8 Single read from an extremity of a full-... 46 0.15
412emb|BX035267.1|CNS08ZDJ Single read from an extremity of a full-... 46 0.15
413emb|BX035228.1|CNS08ZCG Single read from an extremity of a full-... 46 0.15
414emb|BX035165.1|CNS08ZAP Single read from an extremity of a full-... 46 0.15
415emb|BX034803.1|CNS08Z0N Single read from an extremity of a full-... 46 0.15
416emb|BX034670.1|CNS08YWY Single read from an extremity of a full-... 46 0.15
417emb|BX035008.1|CNS08Z6C Single read from an extremity of a full-... 46 0.15
418emb|BX034906.1|CNS08Z3I Single read from an extremity of a full-... 46 0.15
419emb|BX034904.1|CNS08Z3G Single read from an extremity of a full-... 46 0.15
420emb|BX034886.1|CNS08Z2Y Single read from an extremity of a full-... 46 0.15
421emb|BX034882.1|CNS08Z2U Single read from an extremity of a full-... 46 0.15
422emb|BX034881.1|CNS08Z2T Single read from an extremity of a full-... 46 0.15
423emb|BX034538.1|CNS08YTA Single read from an extremity of a full-... 46 0.15
424emb|BX034506.1|CNS08YSE Single read from an extremity of a full-... 46 0.15
425emb|BX034480.1|CNS08YRO Single read from an extremity of a full-... 46 0.15
426emb|BX034370.1|CNS08YOM Single read from an extremity of a full-... 46 0.15
427emb|BX034264.1|CNS08YLO Single read from an extremity of a full-... 46 0.15
428emb|BX034229.1|CNS08YKP Single read from an extremity of a full-... 46 0.15
429emb|BX034221.1|CNS08YKH Single read from an extremity of a full-... 46 0.15
430emb|BX034196.1|CNS08YJS Single read from an extremity of a full-... 46 0.15
431emb|BX034144.1|CNS08YIC Single read from an extremity of a full-... 46 0.15
432emb|BX034142.1|CNS08YIA Single read from an extremity of a full-... 46 0.15
433emb|BX034126.1|CNS08YHU Single read from an extremity of a full-... 46 0.15
434emb|BX034110.1|CNS08YHE Single read from an extremity of a full-... 46 0.15
435emb|BX034108.1|CNS08YHC Single read from an extremity of a full-... 46 0.15
436emb|BX034106.1|CNS08YHA Single read from an extremity of a full-... 46 0.15
437emb|BX034010.1|CNS08YEM Single read from an extremity of a full-... 46 0.15
438emb|BX034008.1|CNS08YEK Single read from an extremity of a full-... 46 0.15
439emb|BX033976.1|CNS08YDO Single read from an extremity of a full-... 46 0.15
440emb|BX033938.1|CNS08YCM Single read from an extremity of a full-... 46 0.15
441emb|BX033860.1|CNS08YAG Single read from an extremity of a full-... 46 0.15
442emb|BX033846.1|CNS08YA2 Single read from an extremity of a full-... 46 0.15
443emb|BX033821.1|CNS08Y9D Single read from an extremity of a full-... 46 0.15
444emb|BX033820.1|CNS08Y9C Single read from an extremity of a full-... 46 0.15
445emb|BX033818.1|CNS08Y9A Single read from an extremity of a full-... 46 0.15
446emb|BX033673.1|CNS08Y59 Single read from an extremity of a full-... 46 0.15
447emb|BX033647.1|CNS08Y4J Single read from an extremity of a full-... 46 0.15
448emb|BX033618.1|CNS08Y3Q Single read from an extremity of a full-... 46 0.15
449emb|BX033569.1|CNS08Y2D Single read from an extremity of a full-... 46 0.15
450emb|BX033479.1|CNS08XZV Single read from an extremity of a full-... 46 0.15
451emb|BX033311.1|CNS08XV7 Single read from an extremity of a full-... 46 0.15
452emb|BX033238.1|CNS08XT6 Single read from an extremity of a full-... 46 0.15
453emb|BX033237.1|CNS08XT5 Single read from an extremity of a full-... 46 0.15
454emb|BX033218.1|CNS08XSM Single read from an extremity of a full-... 46 0.15
455emb|BX033076.1|CNS08XOO Single read from an extremity of a full-... 46 0.15
456emb|BX033023.1|CNS08XN7 Single read from an extremity of a full-... 46 0.15
457emb|BX032861.1|CNS08XIP Single read from an extremity of a full-... 46 0.15
458emb|BX032848.1|CNS08XIC Single read from an extremity of a full-... 46 0.15
459emb|BX032759.1|CNS08XFV Single read from an extremity of a full-... 46 0.15
460emb|BX032572.1|CNS08XAO Single read from an extremity of a full-... 46 0.15
461emb|BX032456.1|CNS08X7G Single read from an extremity of a full-... 46 0.15
462emb|BX032454.1|CNS08X7E Single read from an extremity of a full-... 46 0.15
463emb|BX032379.1|CNS08X5B Single read from an extremity of a full-... 46 0.15
464emb|BX032309.1|CNS08X3D Single read from an extremity of a full-... 46 0.15
465emb|BX032149.1|CNS08WYX Single read from an extremity of a full-... 46 0.15
466emb|BX032101.1|CNS08WXL Single read from an extremity of a full-... 46 0.15
467emb|BX032100.1|CNS08WXK Single read from an extremity of a full-... 46 0.15
468emb|BX031868.1|CNS08WR4 Single read from an extremity of a full-... 46 0.15
469emb|BX031826.1|CNS08WPY Single read from an extremity of a full-... 46 0.15
470emb|BX031749.1|CNS08WNT Single read from an extremity of a full-... 46 0.15
471emb|BX031528.1|CNS08WHO Single read from an extremity of a full-... 46 0.15
472emb|BX031481.1|CNS08WGD Single read from an extremity of a full-... 46 0.15
473emb|BX031424.1|CNS08WES Single read from an extremity of a full-... 46 0.15
474emb|BX031365.1|CNS08WD5 Single read from an extremity of a full-... 46 0.15
475emb|BX031330.1|CNS08WC6 Single read from an extremity of a full-... 46 0.15
476emb|BX030842.1|CNS08VYM Single read from an extremity of a full-... 46 0.15
477emb|BX030693.1|CNS08VUH Single read from an extremity of a full-... 46 0.15
478emb|BX031290.1|CNS08WB2 Single read from an extremity of a full-... 46 0.15
479emb|BX031264.1|CNS08WAC Single read from an extremity of a full-... 46 0.15
480emb|BX031187.1|CNS08W87 Single read from an extremity of a full-... 46 0.15
481emb|BX031162.1|CNS08W7I Single read from an extremity of a full-... 46 0.15
482emb|BX031150.1|CNS08W76 Single read from an extremity of a full-... 46 0.15
483emb|BX030510.1|CNS08VPE Single read from an extremity of a full-... 46 0.15
484emb|BX030498.1|CNS08VP2 Single read from an extremity of a full-... 46 0.15
485emb|BX030436.1|CNS08VNC Single read from an extremity of a full-... 46 0.15
486emb|BX030414.1|CNS08VMQ Single read from an extremity of a full-... 46 0.15
487emb|BX030353.1|CNS08VL1 Single read from an extremity of a full-... 46 0.15
488emb|BX030216.1|CNS08VH8 Single read from an extremity of a full-... 46 0.15
489emb|BX030189.1|CNS08VGH Single read from an extremity of a full-... 46 0.15
490emb|BX030043.1|CNS08VCF Single read from an extremity of a full-... 46 0.15
491emb|BX030039.1|CNS08VCB Single read from an extremity of a full-... 46 0.15
492emb|BX029932.1|CNS08V9C Single read from an extremity of a full-... 46 0.15
493emb|BX029856.1|CNS08V78 Single read from an extremity of a full-... 46 0.15
494emb|BX029781.1|CNS08V55 Single read from an extremity of a full-... 46 0.15
495emb|BX029776.1|CNS08V50 Single read from an extremity of a full-... 46 0.15
496emb|BX029391.1|CNS08UUB Single read from an extremity of a full-... 46 0.15
497emb|BX029322.1|CNS08USE Single read from an extremity of a full-... 46 0.15
498emb|BX029190.1|CNS08UOQ Single read from an extremity of a full-... 46 0.15
499emb|BX029189.1|CNS08UOP Single read from an extremity of a full-... 46 0.15
500emb|BX029177.1|CNS08UOD Single read from an extremity of a full-... 46 0.15

>ref|XM_479931.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1236

 Score =  882 bits (445), Expect = 0.0
 Identities = 628/689 (91%)
 Strand = Plus / Plus

                                                                       
Query: 2   gagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagcagctccaggag 61
           ||||||||||||||||||||||||||||||||||| ||||| ||||| ||||| ||||||
Sbjct: 199 gagtacaccaaggtgctcatcgccgtcgccgacaacgtcgggtccaaccagctgcaggag 258

                                                                       
Query: 62  atccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaacaccctgatccgc 121
           ||||||||||| ||| | || ||||||||||| |||||||| ||||||||||| ||||||
Sbjct: 259 atccgcaagggcctcaggggcgactccatcgtcctcatggggaagaacaccctcatccgc 318

                                                                       
Query: 122 cgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcgagctcagcaac 181
           |||||||||||||||||| | || || || ||||||||||| |||||||||||||    |
Sbjct: 319 cgctgcatcaaggtgcacgccgacaacaccggcaacaaggagttcctcgagctcatgccc 378

                                                                       
Query: 182 ctcctcgtcggtaacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcgag 241
           ||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 379 ctcctcgtcggaaacgttggcctcatcttcaccaagggtgacctcaaggaggtccgcgag 438

                                                                       
Query: 242 gaggtcgccaagtacaaggttggcgctcctgctcgtgttgggctagttgcacctgttgat 301
           ||||| ||||||||||||||||| ||||||||||||||||| || ||||| |||||||||
Sbjct: 439 gaggttgccaagtacaaggttggagctcctgctcgtgttggtcttgttgctcctgttgat 498

                                                                       
Query: 302 gtggtggttccccctggcaacactggtctggatccctcccagacgtccttcttccaggtg 361
           ||||||||||||||||||||||||||||||||||| |||||||| || ||||||||||||
Sbjct: 499 gtggtggttccccctggcaacactggtctggatccatcccagacctctttcttccaggtg 558

                                                                       
Query: 362 cttaacattcccaccaagattaacaagggtactgtggaaattaccatcccagtggagctg 421
           |||||||| |||||||||||||||||||||||||||||||||| || ||| |||||||| 
Sbjct: 559 cttaacatccccaccaagattaacaagggtactgtggaaattatcacccctgtggagctc 618

                                                                       
Query: 422 atcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgccaagcttggtatc 481
           || |||||||||||||||||||||||||| |||||||| |||||||||||||||||||||
Sbjct: 619 attaagaagggtgacaaggtgggctcctccgagtctgctctgcttgccaagcttggtatc 678

                                                                       
Query: 482 cgccccttctcatatggactggtcatctgcaatgtctatgacagtgggtcagtcttcagc 541
           ||||||||||||||||| ||||| ||   |||||||||||||||||||||||||||||||
Sbjct: 679 cgccccttctcatatgggctggttattaccaatgtctatgacagtgggtcagtcttcagc 738

                                                                       
Query: 542 cccgaggttcttgacctcactgaggaagatctgatggacaagtttgcttctggtgtttcc 601
           || ||||| ||||||||||||||||| || |||||||| |||||||||||||||||||| 
Sbjct: 739 cctgaggtgcttgacctcactgaggatgacctgatggagaagtttgcttctggtgtttct 798

                                                                       
Query: 602 atggttgcctcactgtccctggcgatctcataccccaccatggctgctgcaccgcacatg 661
           |||||||||||| | |||||||| ||||| ||||| || || ||||||||||| ||||||
Sbjct: 799 atggttgcctcagtctccctggcaatctcgtacccaactattgctgctgcaccacacatg 858

                                        
Query: 662 ttcctcaatgcatacaagaatgttcttgc 690
           ||||||||||  ||||||||||| |||||
Sbjct: 859 ttcctcaatgggtacaagaatgtgcttgc 887



to top

>dbj|D21130.1|RICYK704 Oryza sativa (japonica cultivar-group) YK704 mRNA for acidic
           ribosomal protein P0, complete cds
          Length = 1220

 Score =  882 bits (445), Expect = 0.0
 Identities = 628/689 (91%)
 Strand = Plus / Plus

                                                                       
Query: 2   gagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagcagctccaggag 61
           ||||||||||||||||||||||||||||||||||| ||||| ||||| ||||| ||||||
Sbjct: 181 gagtacaccaaggtgctcatcgccgtcgccgacaacgtcgggtccaaccagctgcaggag 240

                                                                       
Query: 62  atccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaacaccctgatccgc 121
           ||||||||||| ||| | || ||||||||||| |||||||| ||||||||||| ||||||
Sbjct: 241 atccgcaagggcctcaggggcgactccatcgtcctcatggggaagaacaccctcatccgc 300

                                                                       
Query: 122 cgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcgagctcagcaac 181
           |||||||||||||||||| | || || || ||||||||||| |||||||||||||    |
Sbjct: 301 cgctgcatcaaggtgcacgccgacaacaccggcaacaaggagttcctcgagctcatgccc 360

                                                                       
Query: 182 ctcctcgtcggtaacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcgag 241
           ||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 361 ctcctcgtcggaaacgttggcctcatcttcaccaagggtgacctcaaggaggtccgcgag 420

                                                                       
Query: 242 gaggtcgccaagtacaaggttggcgctcctgctcgtgttgggctagttgcacctgttgat 301
           ||||| ||||||||||||||||| ||||||||||||||||| || ||||| |||||||||
Sbjct: 421 gaggttgccaagtacaaggttggagctcctgctcgtgttggtcttgttgctcctgttgat 480

                                                                       
Query: 302 gtggtggttccccctggcaacactggtctggatccctcccagacgtccttcttccaggtg 361
           ||||||||||||||||||||||||||||||||||| |||||||| || ||||||||||||
Sbjct: 481 gtggtggttccccctggcaacactggtctggatccatcccagacctctttcttccaggtg 540

                                                                       
Query: 362 cttaacattcccaccaagattaacaagggtactgtggaaattaccatcccagtggagctg 421
           |||||||| |||||||||||||||||||||||||||||||||| || ||| |||||||| 
Sbjct: 541 cttaacatccccaccaagattaacaagggtactgtggaaattatcacccctgtggagctc 600

                                                                       
Query: 422 atcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgccaagcttggtatc 481
           || |||||||||||||||||||||||||| |||||||| |||||||||||||||||||||
Sbjct: 601 attaagaagggtgacaaggtgggctcctccgagtctgctctgcttgccaagcttggtatc 660

                                                                       
Query: 482 cgccccttctcatatggactggtcatctgcaatgtctatgacagtgggtcagtcttcagc 541
           ||||||||||||||||| ||||| ||   |||||||||||||||||||||||||||||||
Sbjct: 661 cgccccttctcatatgggctggttattaccaatgtctatgacagtgggtcagtcttcagc 720

                                                                       
Query: 542 cccgaggttcttgacctcactgaggaagatctgatggacaagtttgcttctggtgtttcc 601
           || ||||| ||||||||||||||||| || |||||||| |||||||||||||||||||| 
Sbjct: 721 cctgaggtgcttgacctcactgaggatgacctgatggagaagtttgcttctggtgtttct 780

                                                                       
Query: 602 atggttgcctcactgtccctggcgatctcataccccaccatggctgctgcaccgcacatg 661
           |||||||||||| | |||||||| ||||| ||||| || || ||||||||||| ||||||
Sbjct: 781 atggttgcctcagtctccctggcaatctcgtacccaactattgctgctgcaccacacatg 840

                                        
Query: 662 ttcctcaatgcatacaagaatgttcttgc 690
           ||||||||||  ||||||||||| |||||
Sbjct: 841 ttcctcaatgggtacaagaatgtgcttgc 869



to top

>dbj|AK064857.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000H12, full
           insert sequence
          Length = 1236

 Score =  882 bits (445), Expect = 0.0
 Identities = 628/689 (91%)
 Strand = Plus / Plus

                                                                       
Query: 2   gagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagcagctccaggag 61
           ||||||||||||||||||||||||||||||||||| ||||| ||||| ||||| ||||||
Sbjct: 199 gagtacaccaaggtgctcatcgccgtcgccgacaacgtcgggtccaaccagctgcaggag 258

                                                                       
Query: 62  atccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaacaccctgatccgc 121
           ||||||||||| ||| | || ||||||||||| |||||||| ||||||||||| ||||||
Sbjct: 259 atccgcaagggcctcaggggcgactccatcgtcctcatggggaagaacaccctcatccgc 318

                                                                       
Query: 122 cgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcgagctcagcaac 181
           |||||||||||||||||| | || || || ||||||||||| |||||||||||||    |
Sbjct: 319 cgctgcatcaaggtgcacgccgacaacaccggcaacaaggagttcctcgagctcatgccc 378

                                                                       
Query: 182 ctcctcgtcggtaacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcgag 241
           ||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 379 ctcctcgtcggaaacgttggcctcatcttcaccaagggtgacctcaaggaggtccgcgag 438

                                                                       
Query: 242 gaggtcgccaagtacaaggttggcgctcctgctcgtgttgggctagttgcacctgttgat 301
           ||||| ||||||||||||||||| ||||||||||||||||| || ||||| |||||||||
Sbjct: 439 gaggttgccaagtacaaggttggagctcctgctcgtgttggtcttgttgctcctgttgat 498

                                                                       
Query: 302 gtggtggttccccctggcaacactggtctggatccctcccagacgtccttcttccaggtg 361
           ||||||||||||||||||||||||||||||||||| |||||||| || ||||||||||||
Sbjct: 499 gtggtggttccccctggcaacactggtctggatccatcccagacctctttcttccaggtg 558

                                                                       
Query: 362 cttaacattcccaccaagattaacaagggtactgtggaaattaccatcccagtggagctg 421
           |||||||| |||||||||||||||||||||||||||||||||| || ||| |||||||| 
Sbjct: 559 cttaacatccccaccaagattaacaagggtactgtggaaattatcacccctgtggagctc 618

                                                                       
Query: 422 atcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgccaagcttggtatc 481
           || |||||||||||||||||||||||||| |||||||| |||||||||||||||||||||
Sbjct: 619 attaagaagggtgacaaggtgggctcctccgagtctgctctgcttgccaagcttggtatc 678

                                                                       
Query: 482 cgccccttctcatatggactggtcatctgcaatgtctatgacagtgggtcagtcttcagc 541
           ||||||||||||||||| ||||| ||   |||||||||||||||||||||||||||||||
Sbjct: 679 cgccccttctcatatgggctggttattaccaatgtctatgacagtgggtcagtcttcagc 738

                                                                       
Query: 542 cccgaggttcttgacctcactgaggaagatctgatggacaagtttgcttctggtgtttcc 601
           || ||||| ||||||||||||||||| || |||||||| |||||||||||||||||||| 
Sbjct: 739 cctgaggtgcttgacctcactgaggatgacctgatggagaagtttgcttctggtgtttct 798

                                                                       
Query: 602 atggttgcctcactgtccctggcgatctcataccccaccatggctgctgcaccgcacatg 661
           |||||||||||| | |||||||| ||||| ||||| || || ||||||||||| ||||||
Sbjct: 799 atggttgcctcagtctccctggcaatctcgtacccaactattgctgctgcaccacacatg 858

                                        
Query: 662 ttcctcaatgcatacaagaatgttcttgc 690
           ||||||||||  ||||||||||| |||||
Sbjct: 859 ttcctcaatgggtacaagaatgtgcttgc 887



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
               sequence
          Length = 28434780

 Score =  426 bits (215), Expect = e-116
 Identities = 305/335 (91%)
 Strand = Plus / Minus

                                                                           
Query: 356     caggtgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcccagtg 415
               |||||||||||||| |||||||||||||||||||||||||||||||||| || ||| |||
Sbjct: 1715190 caggtgcttaacatccccaccaagattaacaagggtactgtggaaattatcacccctgtg 1715131

                                                                           
Query: 416     gagctgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgccaagctt 475
               ||||| || |||||||||||||||||||||||||| |||||||| |||||||||||||||
Sbjct: 1715130 gagctcattaagaagggtgacaaggtgggctcctccgagtctgctctgcttgccaagctt 1715071

                                                                           
Query: 476     ggtatccgccccttctcatatggactggtcatctgcaatgtctatgacagtgggtcagtc 535
               ||||||||||||||||||||||| ||||| ||   |||||||||||||||||||||||||
Sbjct: 1715070 ggtatccgccccttctcatatgggctggttattaccaatgtctatgacagtgggtcagtc 1715011

                                                                           
Query: 536     ttcagccccgaggttcttgacctcactgaggaagatctgatggacaagtttgcttctggt 595
               |||||||| ||||| ||||||||||||||||| || |||||||| |||||||||||||||
Sbjct: 1715010 ttcagccctgaggtgcttgacctcactgaggatgacctgatggagaagtttgcttctggt 1714951

                                                                           
Query: 596     gtttccatggttgcctcactgtccctggcgatctcataccccaccatggctgctgcaccg 655
               ||||| |||||||||||| | |||||||| ||||| ||||| || || ||||||||||| 
Sbjct: 1714950 gtttctatggttgcctcagtctccctggcaatctcgtacccaactattgctgctgcacca 1714891

                                                  
Query: 656     cacatgttcctcaatgcatacaagaatgttcttgc 690
               ||||||||||||||||  ||||||||||| |||||
Sbjct: 1714890 cacatgttcctcaatgggtacaagaatgtgcttgc 1714856



 Score =  212 bits (107), Expect = 1e-51
 Identities = 158/175 (90%)
 Strand = Plus / Minus

                                                                           
Query: 2       gagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagcagctccaggag 61
               ||||||||||||||||||||||||||||||||||| ||||| ||||| ||||| ||||||
Sbjct: 1716596 gagtacaccaaggtgctcatcgccgtcgccgacaacgtcgggtccaaccagctgcaggag 1716537

                                                                           
Query: 62      atccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaacaccctgatccgc 121
               ||||||||||| ||| | || ||||||||||| |||||||| ||||||||||| ||||||
Sbjct: 1716536 atccgcaagggcctcaggggcgactccatcgtcctcatggggaagaacaccctcatccgc 1716477

                                                                      
Query: 122     cgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcgagctca 176
               |||||||||||||||||| | || || || ||||||||||| |||||||||||||
Sbjct: 1716476 cgctgcatcaaggtgcacgccgacaacaccggcaacaaggagttcctcgagctca 1716422



 Score =  151 bits (76), Expect = 4e-33
 Identities = 97/104 (93%)
 Strand = Plus / Minus

                                                                           
Query: 258     aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 317
               ||||||| ||||||||||||||||| || ||||| |||||||||||||||||||||||||
Sbjct: 1715379 aggttggagctcctgctcgtgttggtcttgttgctcctgttgatgtggtggttccccctg 1715320

                                                           
Query: 318     gcaacactggtctggatccctcccagacgtccttcttccaggtg 361
               ||||||||||||||||||| |||||||| || ||||||||||||
Sbjct: 1715319 gcaacactggtctggatccatcccagacctctttcttccaggtg 1715276



 Score =  119 bits (60), Expect = 1e-23
 Identities = 66/68 (97%)
 Strand = Plus / Minus

                                                                           
Query: 194     aacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaag 253
               ||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||
Sbjct: 1716313 aacgttggcctcatcttcaccaagggtgacctcaaggaggtccgcgaggaggttgccaag 1716254

                       
Query: 254     tacaaggt 261
               ||||||||
Sbjct: 1716253 tacaaggt 1716246



to top

>dbj|AP004591.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
              clone:P0582D05
          Length = 150483

 Score =  426 bits (215), Expect = e-116
 Identities = 305/335 (91%)
 Strand = Plus / Minus

                                                                          
Query: 356    caggtgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcccagtg 415
              |||||||||||||| |||||||||||||||||||||||||||||||||| || ||| |||
Sbjct: 114690 caggtgcttaacatccccaccaagattaacaagggtactgtggaaattatcacccctgtg 114631

                                                                          
Query: 416    gagctgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgccaagctt 475
              ||||| || |||||||||||||||||||||||||| |||||||| |||||||||||||||
Sbjct: 114630 gagctcattaagaagggtgacaaggtgggctcctccgagtctgctctgcttgccaagctt 114571

                                                                          
Query: 476    ggtatccgccccttctcatatggactggtcatctgcaatgtctatgacagtgggtcagtc 535
              ||||||||||||||||||||||| ||||| ||   |||||||||||||||||||||||||
Sbjct: 114570 ggtatccgccccttctcatatgggctggttattaccaatgtctatgacagtgggtcagtc 114511

                                                                          
Query: 536    ttcagccccgaggttcttgacctcactgaggaagatctgatggacaagtttgcttctggt 595
              |||||||| ||||| ||||||||||||||||| || |||||||| |||||||||||||||
Sbjct: 114510 ttcagccctgaggtgcttgacctcactgaggatgacctgatggagaagtttgcttctggt 114451

                                                                          
Query: 596    gtttccatggttgcctcactgtccctggcgatctcataccccaccatggctgctgcaccg 655
              ||||| |||||||||||| | |||||||| ||||| ||||| || || ||||||||||| 
Sbjct: 114450 gtttctatggttgcctcagtctccctggcaatctcgtacccaactattgctgctgcacca 114391

                                                 
Query: 656    cacatgttcctcaatgcatacaagaatgttcttgc 690
              ||||||||||||||||  ||||||||||| |||||
Sbjct: 114390 cacatgttcctcaatgggtacaagaatgtgcttgc 114356



 Score =  212 bits (107), Expect = 1e-51
 Identities = 158/175 (90%)
 Strand = Plus / Minus

                                                                          
Query: 2      gagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagcagctccaggag 61
              ||||||||||||||||||||||||||||||||||| ||||| ||||| ||||| ||||||
Sbjct: 116096 gagtacaccaaggtgctcatcgccgtcgccgacaacgtcgggtccaaccagctgcaggag 116037

                                                                          
Query: 62     atccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaacaccctgatccgc 121
              ||||||||||| ||| | || ||||||||||| |||||||| ||||||||||| ||||||
Sbjct: 116036 atccgcaagggcctcaggggcgactccatcgtcctcatggggaagaacaccctcatccgc 115977

                                                                     
Query: 122    cgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcgagctca 176
              |||||||||||||||||| | || || || ||||||||||| |||||||||||||
Sbjct: 115976 cgctgcatcaaggtgcacgccgacaacaccggcaacaaggagttcctcgagctca 115922



 Score =  151 bits (76), Expect = 4e-33
 Identities = 97/104 (93%)
 Strand = Plus / Minus

                                                                          
Query: 258    aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 317
              ||||||| ||||||||||||||||| || ||||| |||||||||||||||||||||||||
Sbjct: 114879 aggttggagctcctgctcgtgttggtcttgttgctcctgttgatgtggtggttccccctg 114820

                                                          
Query: 318    gcaacactggtctggatccctcccagacgtccttcttccaggtg 361
              ||||||||||||||||||| |||||||| || ||||||||||||
Sbjct: 114819 gcaacactggtctggatccatcccagacctctttcttccaggtg 114776



 Score =  119 bits (60), Expect = 1e-23
 Identities = 66/68 (97%)
 Strand = Plus / Minus

                                                                          
Query: 194    aacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaag 253
              ||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||
Sbjct: 115813 aacgttggcctcatcttcaccaagggtgacctcaaggaggtccgcgaggaggttgccaag 115754

                      
Query: 254    tacaaggt 261
              ||||||||
Sbjct: 115753 tacaaggt 115746



to top

>emb|Y07959.1|ZMRPP0 Z.mays mRNA for acidic ribosomal protein P0
          Length = 1253

 Score =  406 bits (205), Expect = e-110
 Identities = 286/313 (91%)
 Strand = Plus / Plus

                                                                       
Query: 180 acctcctcgtcggtaacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcg 239
           ||||||| ||||| ||||| |||||||||||||||||||| |||||||||||||| ||||
Sbjct: 380 acctcctggtcggcaacgtaggcctcatcttcaccaagggagacctcaaggaggtgcgcg 439

                                                                       
Query: 240 aggaggtcgccaagtacaaggttggcgctcctgctcgtgttgggctagttgcacctgttg 299
           |||||||||||||||||||||| || ||||||||||||||||| || ||||| || ||||
Sbjct: 440 aggaggtcgccaagtacaaggtgggggctcctgctcgtgttggtctggttgctccagttg 499

                                                                       
Query: 300 atgtggtggttccccctggcaacactggtctggatccctcccagacgtccttcttccagg 359
           |||| || || ||||||||||||||||| |||||||| |||||||| || ||||||||||
Sbjct: 500 atgttgttgtgccccctggcaacactgggctggatccgtcccagacctctttcttccagg 559

                                                                       
Query: 360 tgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcccagtggagc 419
           |||||||||| ||||||||||||||||||||||| |||||||||| || ||| |||||||
Sbjct: 560 tgcttaacatccccaccaagattaacaagggtaccgtggaaattatcacccctgtggagc 619

                                                                       
Query: 420 tgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgccaagcttggta 479
           |||||||||||||||| ||||||||||| ||||||||||||||||| |||||||| ||||
Sbjct: 620 tgatcaagaagggtgaaaaggtgggctcgtctgagtctgccctgctcgccaagctgggta 679

                        
Query: 480 tccgccccttctc 492
           |||||||||||||
Sbjct: 680 tccgccccttctc 692



 Score =  113 bits (57), Expect = 8e-22
 Identities = 138/165 (83%)
 Strand = Plus / Plus

                                                                       
Query: 526 tgggtcagtcttcagccccgaggttcttgacctcactgaggaagatctgatggacaagtt 585
           |||||| || |||||||| ||||| ||||||||  | ||||| || ||||| || |||||
Sbjct: 726 tgggtccgtgttcagccctgaggtgcttgacctttccgaggaggacctgattgagaagtt 785

                                                                       
Query: 586 tgcttctggtgtttccatggttgcctcactgtccctggcgatctcataccccaccatggc 645
           |||  ||||||| |||||||||||||| ||||| ||||||||||| ||||| ||| | ||
Sbjct: 786 tgccactggtgtctccatggttgcctccctgtcactggcgatctcgtacccgacccttgc 845

                                                        
Query: 646 tgctgcaccgcacatgttcctcaatgcatacaagaatgttcttgc 690
           |||||  || ||||||||| ||||||  ||||||||||| |||||
Sbjct: 846 tgctgtgccccacatgttcatcaatgggtacaagaatgtgcttgc 890



 Score =  113 bits (57), Expect = 8e-22
 Identities = 126/149 (84%)
 Strand = Plus / Plus

                                                                       
Query: 2   gagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagcagctccaggag 61
           |||||||||||||||||||||||| | |||||||| ||||| ||||||||||||||||| 
Sbjct: 202 gagtacaccaaggtgctcatcgccctggccgacaacgtcggttccaagcagctccaggac 261

                                                                       
Query: 62  atccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaacaccctgatccgc 121
           ||||||  ||| ||| | || |||||  | ||||||||||| |||||||| || ||| | 
Sbjct: 262 atccgccggggcctcaggggcgactcggtggtgctcatggggaagaacacgctcatcagg 321

                                        
Query: 122 cgctgcatcaaggtgcactcggagaagac 150
           || |||||||||||| || | ||||||||
Sbjct: 322 cgttgcatcaaggtgtacgccgagaagac 350



to top

>gb|AC123528.2| Oryza sativa chromosome 11 clone  OSJNBa0078E03, complete sequence
          Length = 149493

 Score =  402 bits (203), Expect = e-109
 Identities = 302/335 (90%)
 Strand = Plus / Minus

                                                                        
Query: 356  caggtgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcccagtg 415
            |||||||||||||| ||||||||||||||||||||||| |||||||||| || ||| |||
Sbjct: 4568 caggtgcttaacatccccaccaagattaacaagggtaccgtggaaattatcacccctgtg 4509

                                                                        
Query: 416  gagctgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgccaagctt 475
            ||||| || ||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 4508 gagctcattaagaagggtgacaaggttggctcctctgagtctgccctgcttgccaagctt 4449

                                                                        
Query: 476  ggtatccgccccttctcatatggactggtcatctgcaatgtctatgacagtgggtcagtc 535
            ||||||||||||||||||||||| ||||| |||  |||||| || |||||||||||||||
Sbjct: 4448 ggtatccgccccttctcatatgggctggtgatcaccaatgtgtacgacagtgggtcagtc 4389

                                                                        
Query: 536  ttcagccccgaggttcttgacctcactgaggaagatctgatggacaagtttgcttctggt 595
            |||||||| ||||| || ||||||||||| || || |||||||| |||||||| ||||||
Sbjct: 4388 ttcagccctgaggtgctcgacctcactgaagaggacctgatggagaagtttgcatctggt 4329

                                                                        
Query: 596  gtttccatggttgcctcactgtccctggcgatctcataccccaccatggctgctgcaccg 655
            ||||| |||||||||||| |||||||||| ||||||||||| || || |||||||| || 
Sbjct: 4328 gtttcgatggttgcctcagtgtccctggcaatctcatacccaactattgctgctgcgcca 4269

                                               
Query: 656  cacatgttcctcaatgcatacaagaatgttcttgc 690
            ||||||||||||||||  ||||||||||| |||||
Sbjct: 4268 cacatgttcctcaatgggtacaagaatgtgcttgc 4234



 Score =  220 bits (111), Expect = 5e-54
 Identities = 159/175 (90%)
 Strand = Plus / Minus

                                                                        
Query: 2    gagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagcagctccaggag 61
            ||||||||||||||||||||||||||||||||||| || || ||||| ||||| ||||||
Sbjct: 5779 gagtacaccaaggtgctcatcgccgtcgccgacaacgtgggatccaaccagctgcaggag 5720

                                                                        
Query: 62   atccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaacaccctgatccgc 121
            ||||||||||| ||| | || ||||||||||| |||||||||||||||||||| ||||||
Sbjct: 5719 atccgcaaggggctcaggggcgactccatcgtcctcatgggcaagaacaccctcatccgc 5660

                                                                   
Query: 122  cgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcgagctca 176
            |||||||||||||||||| | || || || |||||||||||||||||||||||||
Sbjct: 5659 cgctgcatcaaggtgcacgccgacaacaccggcaacaaggacttcctcgagctca 5605



 Score =  143 bits (72), Expect = 9e-31
 Identities = 96/104 (92%)
 Strand = Plus / Minus

                                                                        
Query: 258  aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 317
            ||||||| ||||||||||||||||| || ||||| |||||||||||||||||||||||||
Sbjct: 4744 aggttggagctcctgctcgtgttggtctggttgctcctgttgatgtggtggttccccctg 4685

                                                        
Query: 318  gcaacactggtctggatccctcccagacgtccttcttccaggtg 361
            | |||||||||||||||||||||||||| || ||||| ||||||
Sbjct: 4684 gaaacactggtctggatccctcccagacttctttctttcaggtg 4641



 Score =  119 bits (60), Expect = 1e-23
 Identities = 69/72 (95%)
 Strand = Plus / Minus

                                                                        
Query: 194  aacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaag 253
            |||||||| |||||||||||||||||||||||||||||||| ||||| ||||||||||||
Sbjct: 5485 aacgttggtctcatcttcaccaagggtgacctcaaggaggtccgcgaagaggtcgccaag 5426

                        
Query: 254  tacaaggttggc 265
            ||||||||||||
Sbjct: 5425 tacaaggttggc 5414



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score =  402 bits (203), Expect = e-109
 Identities = 302/335 (90%)
 Strand = Plus / Minus

                                                                           
Query: 356     caggtgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcccagtg 415
               |||||||||||||| ||||||||||||||||||||||| |||||||||| || ||| |||
Sbjct: 1648854 caggtgcttaacatccccaccaagattaacaagggtaccgtggaaattatcacccctgtg 1648795

                                                                           
Query: 416     gagctgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgccaagctt 475
               ||||| || ||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 1648794 gagctcattaagaagggtgacaaggttggctcctctgagtctgccctgcttgccaagctt 1648735

                                                                           
Query: 476     ggtatccgccccttctcatatggactggtcatctgcaatgtctatgacagtgggtcagtc 535
               ||||||||||||||||||||||| ||||| |||  |||||| || |||||||||||||||
Sbjct: 1648734 ggtatccgccccttctcatatgggctggtgatcaccaatgtgtacgacagtgggtcagtc 1648675

                                                                           
Query: 536     ttcagccccgaggttcttgacctcactgaggaagatctgatggacaagtttgcttctggt 595
               |||||||| ||||| || ||||||||||| || || |||||||| |||||||| ||||||
Sbjct: 1648674 ttcagccctgaggtgctcgacctcactgaagaggacctgatggagaagtttgcatctggt 1648615

                                                                           
Query: 596     gtttccatggttgcctcactgtccctggcgatctcataccccaccatggctgctgcaccg 655
               ||||| |||||||||||| |||||||||| ||||||||||| || || |||||||| || 
Sbjct: 1648614 gtttcgatggttgcctcagtgtccctggcaatctcatacccaactattgctgctgcgcca 1648555

                                                  
Query: 656     cacatgttcctcaatgcatacaagaatgttcttgc 690
               ||||||||||||||||  ||||||||||| |||||
Sbjct: 1648554 cacatgttcctcaatgggtacaagaatgtgcttgc 1648520



 Score =  220 bits (111), Expect = 5e-54
 Identities = 159/175 (90%)
 Strand = Plus / Minus

                                                                           
Query: 2       gagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagcagctccaggag 61
               ||||||||||||||||||||||||||||||||||| || || ||||| ||||| ||||||
Sbjct: 1650065 gagtacaccaaggtgctcatcgccgtcgccgacaacgtgggatccaaccagctgcaggag 1650006

                                                                           
Query: 62      atccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaacaccctgatccgc 121
               ||||||||||| ||| | || ||||||||||| |||||||||||||||||||| ||||||
Sbjct: 1650005 atccgcaaggggctcaggggcgactccatcgtcctcatgggcaagaacaccctcatccgc 1649946

                                                                      
Query: 122     cgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcgagctca 176
               |||||||||||||||||| | || || || |||||||||||||||||||||||||
Sbjct: 1649945 cgctgcatcaaggtgcacgccgacaacaccggcaacaaggacttcctcgagctca 1649891



 Score =  143 bits (72), Expect = 9e-31
 Identities = 96/104 (92%)
 Strand = Plus / Minus

                                                                           
Query: 258     aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 317
               ||||||| ||||||||||||||||| || ||||| |||||||||||||||||||||||||
Sbjct: 1649030 aggttggagctcctgctcgtgttggtctggttgctcctgttgatgtggtggttccccctg 1648971

                                                           
Query: 318     gcaacactggtctggatccctcccagacgtccttcttccaggtg 361
               | |||||||||||||||||||||||||| || ||||| ||||||
Sbjct: 1648970 gaaacactggtctggatccctcccagacttctttctttcaggtg 1648927



 Score =  119 bits (60), Expect = 1e-23
 Identities = 69/72 (95%)
 Strand = Plus / Minus

                                                                           
Query: 194     aacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaag 253
               |||||||| |||||||||||||||||||||||||||||||| ||||| ||||||||||||
Sbjct: 1649771 aacgttggtctcatcttcaccaagggtgacctcaaggaggtccgcgaagaggtcgccaag 1649712

                           
Query: 254     tacaaggttggc 265
               ||||||||||||
Sbjct: 1649711 tacaaggttggc 1649700



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  402 bits (203), Expect = e-109
 Identities = 302/335 (90%)
 Strand = Plus / Minus

                                                                           
Query: 356     caggtgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcccagtg 415
               |||||||||||||| ||||||||||||||||||||||| |||||||||| || ||| |||
Sbjct: 1646575 caggtgcttaacatccccaccaagattaacaagggtaccgtggaaattatcacccctgtg 1646516

                                                                           
Query: 416     gagctgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgccaagctt 475
               ||||| || ||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 1646515 gagctcattaagaagggtgacaaggttggctcctctgagtctgccctgcttgccaagctt 1646456

                                                                           
Query: 476     ggtatccgccccttctcatatggactggtcatctgcaatgtctatgacagtgggtcagtc 535
               ||||||||||||||||||||||| ||||| |||  |||||| || |||||||||||||||
Sbjct: 1646455 ggtatccgccccttctcatatgggctggtgatcaccaatgtgtacgacagtgggtcagtc 1646396

                                                                           
Query: 536     ttcagccccgaggttcttgacctcactgaggaagatctgatggacaagtttgcttctggt 595
               |||||||| ||||| || ||||||||||| || || |||||||| |||||||| ||||||
Sbjct: 1646395 ttcagccctgaggtgctcgacctcactgaagaggacctgatggagaagtttgcatctggt 1646336

                                                                           
Query: 596     gtttccatggttgcctcactgtccctggcgatctcataccccaccatggctgctgcaccg 655
               ||||| |||||||||||| |||||||||| ||||||||||| || || |||||||| || 
Sbjct: 1646335 gtttcgatggttgcctcagtgtccctggcaatctcatacccaactattgctgctgcgcca 1646276

                                                  
Query: 656     cacatgttcctcaatgcatacaagaatgttcttgc 690
               ||||||||||||||||  ||||||||||| |||||
Sbjct: 1646275 cacatgttcctcaatgggtacaagaatgtgcttgc 1646241



 Score =  220 bits (111), Expect = 5e-54
 Identities = 159/175 (90%)
 Strand = Plus / Minus

                                                                           
Query: 2       gagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagcagctccaggag 61
               ||||||||||||||||||||||||||||||||||| || || ||||| ||||| ||||||
Sbjct: 1647786 gagtacaccaaggtgctcatcgccgtcgccgacaacgtgggatccaaccagctgcaggag 1647727

                                                                           
Query: 62      atccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaacaccctgatccgc 121
               ||||||||||| ||| | || ||||||||||| |||||||||||||||||||| ||||||
Sbjct: 1647726 atccgcaaggggctcaggggcgactccatcgtcctcatgggcaagaacaccctcatccgc 1647667

                                                                      
Query: 122     cgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcgagctca 176
               |||||||||||||||||| | || || || |||||||||||||||||||||||||
Sbjct: 1647666 cgctgcatcaaggtgcacgccgacaacaccggcaacaaggacttcctcgagctca 1647612



 Score =  143 bits (72), Expect = 9e-31
 Identities = 96/104 (92%)
 Strand = Plus / Minus

                                                                           
Query: 258     aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 317
               ||||||| ||||||||||||||||| || ||||| |||||||||||||||||||||||||
Sbjct: 1646751 aggttggagctcctgctcgtgttggtctggttgctcctgttgatgtggtggttccccctg 1646692

                                                           
Query: 318     gcaacactggtctggatccctcccagacgtccttcttccaggtg 361
               | |||||||||||||||||||||||||| || ||||| ||||||
Sbjct: 1646691 gaaacactggtctggatccctcccagacttctttctttcaggtg 1646648



 Score =  119 bits (60), Expect = 1e-23
 Identities = 69/72 (95%)
 Strand = Plus / Minus

                                                                           
Query: 194     aacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaag 253
               |||||||| |||||||||||||||||||||||||||||||| ||||| ||||||||||||
Sbjct: 1647492 aacgttggtctcatcttcaccaagggtgacctcaaggaggtccgcgaagaggtcgccaag 1647433

                           
Query: 254     tacaaggttggc 265
               ||||||||||||
Sbjct: 1647432 tacaaggttggc 1647421



to top

>gb|BT016531.1| Zea mays clone Contig364 mRNA sequence
          Length = 1230

 Score =  398 bits (201), Expect = e-108
 Identities = 285/313 (91%)
 Strand = Plus / Plus

                                                                       
Query: 180 acctcctcgtcggtaacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcg 239
           ||||||| ||||| ||||| |||||||||||||||||||| |||||||||||||| ||||
Sbjct: 361 acctcctggtcggcaacgtaggcctcatcttcaccaagggagacctcaaggaggtgcgcg 420

                                                                       
Query: 240 aggaggtcgccaagtacaaggttggcgctcctgctcgtgttgggctagttgcacctgttg 299
           |||||||||||||||||||||| || ||||||||||||||||| || ||||| || ||||
Sbjct: 421 aggaggtcgccaagtacaaggtgggggctcctgctcgtgttggtctggttgctccagttg 480

                                                                       
Query: 300 atgtggtggttccccctggcaacactggtctggatccctcccagacgtccttcttccagg 359
           |||| || || ||||||||||||||||| |||||||| |||||||| || ||||||||||
Sbjct: 481 atgttgttgtgccccctggcaacactgggctggatccgtcccagacctctttcttccagg 540

                                                                       
Query: 360 tgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcccagtggagc 419
           |||||||||| ||||||||||||||||||||||| |||||||||| || ||| |||||||
Sbjct: 541 tgcttaacatccccaccaagattaacaagggtaccgtggaaattatcacccctgtggagc 600

                                                                       
Query: 420 tgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgccaagcttggta 479
           |||||||||||||||| ||||||||||| || |||||||||||||| |||||||| ||||
Sbjct: 601 tgatcaagaagggtgaaaaggtgggctcgtccgagtctgccctgctcgccaagctgggta 660

                        
Query: 480 tccgccccttctc 492
           |||||||||||||
Sbjct: 661 tccgccccttctc 673



 Score =  129 bits (65), Expect = 1e-26
 Identities = 128/149 (85%)
 Strand = Plus / Plus

                                                                       
Query: 2   gagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagcagctccaggag 61
           |||||||||||||||||||||||| |||||||||| ||||| ||||||||||||||||| 
Sbjct: 183 gagtacaccaaggtgctcatcgccctcgccgacaacgtcggttccaagcagctccaggac 242

                                                                       
Query: 62  atccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaacaccctgatccgc 121
           ||||||  ||| ||| | || |||||  | ||||||||||| |||||||| || ||| | 
Sbjct: 243 atccgccggggcctcaggggcgactcggtggtgctcatggggaagaacacgctcatcagg 302

                                        
Query: 122 cgctgcatcaaggtgcactcggagaagac 150
           ||||||||||||||| || | ||||||||
Sbjct: 303 cgctgcatcaaggtgtacgccgagaagac 331



 Score =  113 bits (57), Expect = 8e-22
 Identities = 138/165 (83%)
 Strand = Plus / Plus

                                                                       
Query: 526 tgggtcagtcttcagccccgaggttcttgacctcactgaggaagatctgatggacaagtt 585
           |||||| || |||||||| ||||| || |||||  ||||||| || ||||| || |||||
Sbjct: 707 tgggtccgtgttcagccctgaggtgctcgacctttctgaggaggacctgattgagaagtt 766

                                                                       
Query: 586 tgcttctggtgtttccatggttgcctcactgtccctggcgatctcataccccaccatggc 645
           |||  ||||||| |||||||||||||| ||||| ||||||||||| ||||| ||| | ||
Sbjct: 767 tgccactggtgtctccatggttgcctccctgtcactggcgatctcgtacccgacccttgc 826

                                                        
Query: 646 tgctgcaccgcacatgttcctcaatgcatacaagaatgttcttgc 690
           |||||  || ||||||||| ||||||  ||||||||||| |||||
Sbjct: 827 tgctgtgccccacatgttcatcaatgggtacaagaatgtgcttgc 871



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
               sequence
          Length = 27566993

 Score =  391 bits (197), Expect = e-105
 Identities = 296/329 (89%)
 Strand = Plus / Minus

                                                                           
Query: 356     caggtgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcccagtg 415
               |||||||||||||| |||||||||||||||||||||||||||||||||| || ||| || 
Sbjct: 1602065 caggtgcttaacatccccaccaagattaacaagggtactgtggaaattatcacccctgta 1602006

                                                                           
Query: 416     gagctgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgccaagctt 475
               ||||| || ||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 1602005 gagctcattaagaagggtgacaaggttggctcctctgagtctgccctgcttgccaagctt 1601946

                                                                           
Query: 476     ggtatccgccccttctcatatggactggtcatctgcaatgtctatgacagtgggtcagtc 535
               ||||||||||||||||||||||| ||||| |||  |||||| || |||||||||||||||
Sbjct: 1601945 ggtatccgccccttctcatatgggctggtgatcaccaatgtgtacgacagtgggtcagtc 1601886

                                                                           
Query: 536     ttcagccccgaggttcttgacctcactgaggaagatctgatggacaagtttgcttctggt 595
               |||||||| ||||| || ||||||||||| || || |||||||| |||||||| ||||||
Sbjct: 1601885 ttcagccctgaggtgctcgacctcactgaagaggacctgatggagaagtttgcatctggt 1601826

                                                                           
Query: 596     gtttccatggttgcctcactgtccctggcgatctcataccccaccatggctgctgcaccg 655
               ||||| |||||||||||| |||||||||| ||||||||||| || || || ||||| || 
Sbjct: 1601825 gtttcgatggttgcctcagtgtccctggcaatctcatacccaactatcgcagctgcgcca 1601766

                                            
Query: 656     cacatgttcctcaatgcatacaagaatgt 684
               ||||||||||||||||  |||||||||||
Sbjct: 1601765 cacatgttcctcaatgggtacaagaatgt 1601737



 Score =  212 bits (107), Expect = 1e-51
 Identities = 158/175 (90%)
 Strand = Plus / Minus

                                                                           
Query: 2       gagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagcagctccaggag 61
               ||||||||||||||||||||||||||||||||||| || || ||||| ||||| ||||||
Sbjct: 1603259 gagtacaccaaggtgctcatcgccgtcgccgacaacgtgggatccaaccagctgcaggag 1603200

                                                                           
Query: 62      atccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaacaccctgatccgc 121
               ||||||||||| ||| | || ||||||||||| |||||||| ||||||||||| ||||||
Sbjct: 1603199 atccgcaaggggctcaggggcgactccatcgtcctcatggggaagaacaccctcatccgc 1603140

                                                                      
Query: 122     cgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcgagctca 176
               |||||||||||||||||| | || || || |||||||||||||||||||||||||
Sbjct: 1603139 cgctgcatcaaggtgcacgccgacaacaccggcaacaaggacttcctcgagctca 1603085



 Score =  135 bits (68), Expect = 2e-28
 Identities = 95/104 (91%)
 Strand = Plus / Minus

                                                                           
Query: 258     aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 317
               ||||||| ||||||||||||||||| || ||||| |||||||||||||| ||||||||||
Sbjct: 1602242 aggttggagctcctgctcgtgttggtctggttgctcctgttgatgtggttgttccccctg 1602183

                                                           
Query: 318     gcaacactggtctggatccctcccagacgtccttcttccaggtg 361
               | ||||||||||| |||||||||||||| || ||||||||||||
Sbjct: 1602182 gaaacactggtctcgatccctcccagacttctttcttccaggtg 1602139



 Score =  125 bits (63), Expect = 2e-25
 Identities = 69/71 (97%)
 Strand = Plus / Minus

                                                                           
Query: 191     ggtaacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgcc 250
               ||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 1602988 ggtaacgttggtctcatcttcaccaagggtgacctcaaggaggtccgcgaggaggtcgcc 1602929

                          
Query: 251     aagtacaaggt 261
               |||||||||||
Sbjct: 1602928 aagtacaaggt 1602918



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  391 bits (197), Expect = e-105
 Identities = 296/329 (89%)
 Strand = Plus / Minus

                                                                           
Query: 356     caggtgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcccagtg 415
               |||||||||||||| |||||||||||||||||||||||||||||||||| || ||| || 
Sbjct: 1602065 caggtgcttaacatccccaccaagattaacaagggtactgtggaaattatcacccctgta 1602006

                                                                           
Query: 416     gagctgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgccaagctt 475
               ||||| || ||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 1602005 gagctcattaagaagggtgacaaggttggctcctctgagtctgccctgcttgccaagctt 1601946

                                                                           
Query: 476     ggtatccgccccttctcatatggactggtcatctgcaatgtctatgacagtgggtcagtc 535
               ||||||||||||||||||||||| ||||| |||  |||||| || |||||||||||||||
Sbjct: 1601945 ggtatccgccccttctcatatgggctggtgatcaccaatgtgtacgacagtgggtcagtc 1601886

                                                                           
Query: 536     ttcagccccgaggttcttgacctcactgaggaagatctgatggacaagtttgcttctggt 595
               |||||||| ||||| || ||||||||||| || || |||||||| |||||||| ||||||
Sbjct: 1601885 ttcagccctgaggtgctcgacctcactgaagaggacctgatggagaagtttgcatctggt 1601826

                                                                           
Query: 596     gtttccatggttgcctcactgtccctggcgatctcataccccaccatggctgctgcaccg 655
               ||||| |||||||||||| |||||||||| ||||||||||| || || || ||||| || 
Sbjct: 1601825 gtttcgatggttgcctcagtgtccctggcaatctcatacccaactatcgcagctgcgcca 1601766

                                            
Query: 656     cacatgttcctcaatgcatacaagaatgt 684
               ||||||||||||||||  |||||||||||
Sbjct: 1601765 cacatgttcctcaatgggtacaagaatgt 1601737



 Score =  212 bits (107), Expect = 1e-51
 Identities = 158/175 (90%)
 Strand = Plus / Minus

                                                                           
Query: 2       gagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagcagctccaggag 61
               ||||||||||||||||||||||||||||||||||| || || ||||| ||||| ||||||
Sbjct: 1603259 gagtacaccaaggtgctcatcgccgtcgccgacaacgtgggatccaaccagctgcaggag 1603200

                                                                           
Query: 62      atccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaacaccctgatccgc 121
               ||||||||||| ||| | || ||||||||||| |||||||| ||||||||||| ||||||
Sbjct: 1603199 atccgcaaggggctcaggggcgactccatcgtcctcatggggaagaacaccctcatccgc 1603140

                                                                      
Query: 122     cgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcgagctca 176
               |||||||||||||||||| | || || || |||||||||||||||||||||||||
Sbjct: 1603139 cgctgcatcaaggtgcacgccgacaacaccggcaacaaggacttcctcgagctca 1603085



 Score =  135 bits (68), Expect = 2e-28
 Identities = 95/104 (91%)
 Strand = Plus / Minus

                                                                           
Query: 258     aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 317
               ||||||| ||||||||||||||||| || ||||| |||||||||||||| ||||||||||
Sbjct: 1602242 aggttggagctcctgctcgtgttggtctggttgctcctgttgatgtggttgttccccctg 1602183

                                                           
Query: 318     gcaacactggtctggatccctcccagacgtccttcttccaggtg 361
               | ||||||||||| |||||||||||||| || ||||||||||||
Sbjct: 1602182 gaaacactggtctcgatccctcccagacttctttcttccaggtg 1602139



 Score =  125 bits (63), Expect = 2e-25
 Identities = 69/71 (97%)
 Strand = Plus / Minus

                                                                           
Query: 191     ggtaacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgcc 250
               ||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 1602988 ggtaacgttggtctcatcttcaccaagggtgacctcaaggaggtccgcgaggaggtcgcc 1602929

                          
Query: 251     aagtacaaggt 261
               |||||||||||
Sbjct: 1602928 aagtacaaggt 1602918



to top

>emb|BX000508.1|CNS08CDY Oryza sativa chromosome 12, . BAC OJ1575_G05 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 91883

 Score =  391 bits (197), Expect = e-105
 Identities = 296/329 (89%)
 Strand = Plus / Plus

                                                                         
Query: 356   caggtgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcccagtg 415
             |||||||||||||| |||||||||||||||||||||||||||||||||| || ||| || 
Sbjct: 90857 caggtgcttaacatccccaccaagattaacaagggtactgtggaaattatcacccctgta 90916

                                                                         
Query: 416   gagctgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgccaagctt 475
             ||||| || ||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 90917 gagctcattaagaagggtgacaaggttggctcctctgagtctgccctgcttgccaagctt 90976

                                                                         
Query: 476   ggtatccgccccttctcatatggactggtcatctgcaatgtctatgacagtgggtcagtc 535
             ||||||||||||||||||||||| ||||| |||  |||||| || |||||||||||||||
Sbjct: 90977 ggtatccgccccttctcatatgggctggtgatcaccaatgtgtacgacagtgggtcagtc 91036

                                                                         
Query: 536   ttcagccccgaggttcttgacctcactgaggaagatctgatggacaagtttgcttctggt 595
             |||||||| ||||| || ||||||||||| || || |||||||| |||||||| ||||||
Sbjct: 91037 ttcagccctgaggtgctcgacctcactgaagaggacctgatggagaagtttgcatctggt 91096

                                                                         
Query: 596   gtttccatggttgcctcactgtccctggcgatctcataccccaccatggctgctgcaccg 655
             ||||| |||||||||||| |||||||||| ||||||||||| || || || ||||| || 
Sbjct: 91097 gtttcgatggttgcctcagtgtccctggcaatctcatacccaactatcgcagctgcgcca 91156

                                          
Query: 656   cacatgttcctcaatgcatacaagaatgt 684
             ||||||||||||||||  |||||||||||
Sbjct: 91157 cacatgttcctcaatgggtacaagaatgt 91185



 Score =  212 bits (107), Expect = 1e-51
 Identities = 158/175 (90%)
 Strand = Plus / Plus

                                                                         
Query: 2     gagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagcagctccaggag 61
             ||||||||||||||||||||||||||||||||||| || || ||||| ||||| ||||||
Sbjct: 89663 gagtacaccaaggtgctcatcgccgtcgccgacaacgtgggatccaaccagctgcaggag 89722

                                                                         
Query: 62    atccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaacaccctgatccgc 121
             ||||||||||| ||| | || ||||||||||| |||||||| ||||||||||| ||||||
Sbjct: 89723 atccgcaaggggctcaggggcgactccatcgtcctcatggggaagaacaccctcatccgc 89782

                                                                    
Query: 122   cgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcgagctca 176
             |||||||||||||||||| | || || || |||||||||||||||||||||||||
Sbjct: 89783 cgctgcatcaaggtgcacgccgacaacaccggcaacaaggacttcctcgagctca 89837



 Score =  135 bits (68), Expect = 2e-28
 Identities = 95/104 (91%)
 Strand = Plus / Plus

                                                                         
Query: 258   aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 317
             ||||||| ||||||||||||||||| || ||||| |||||||||||||| ||||||||||
Sbjct: 90680 aggttggagctcctgctcgtgttggtctggttgctcctgttgatgtggttgttccccctg 90739

                                                         
Query: 318   gcaacactggtctggatccctcccagacgtccttcttccaggtg 361
             | ||||||||||| |||||||||||||| || ||||||||||||
Sbjct: 90740 gaaacactggtctcgatccctcccagacttctttcttccaggtg 90783



 Score =  125 bits (63), Expect = 2e-25
 Identities = 69/71 (97%)
 Strand = Plus / Plus

                                                                         
Query: 191   ggtaacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgcc 250
             ||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 89934 ggtaacgttggtctcatcttcaccaagggtgacctcaaggaggtccgcgaggaggtcgcc 89993

                        
Query: 251   aagtacaaggt 261
             |||||||||||
Sbjct: 89994 aagtacaaggt 90004



to top

>emb|BX000498.1|CNS08CDO Oryza sativa chromosome 12, . BAC OSJNBa0009F13 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 183385

 Score =  391 bits (197), Expect = e-105
 Identities = 296/329 (89%)
 Strand = Plus / Plus

                                                                         
Query: 356   caggtgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcccagtg 415
             |||||||||||||| |||||||||||||||||||||||||||||||||| || ||| || 
Sbjct: 23667 caggtgcttaacatccccaccaagattaacaagggtactgtggaaattatcacccctgta 23726

                                                                         
Query: 416   gagctgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgccaagctt 475
             ||||| || ||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 23727 gagctcattaagaagggtgacaaggttggctcctctgagtctgccctgcttgccaagctt 23786

                                                                         
Query: 476   ggtatccgccccttctcatatggactggtcatctgcaatgtctatgacagtgggtcagtc 535
             ||||||||||||||||||||||| ||||| |||  |||||| || |||||||||||||||
Sbjct: 23787 ggtatccgccccttctcatatgggctggtgatcaccaatgtgtacgacagtgggtcagtc 23846

                                                                         
Query: 536   ttcagccccgaggttcttgacctcactgaggaagatctgatggacaagtttgcttctggt 595
             |||||||| ||||| || ||||||||||| || || |||||||| |||||||| ||||||
Sbjct: 23847 ttcagccctgaggtgctcgacctcactgaagaggacctgatggagaagtttgcatctggt 23906

                                                                         
Query: 596   gtttccatggttgcctcactgtccctggcgatctcataccccaccatggctgctgcaccg 655
             ||||| |||||||||||| |||||||||| ||||||||||| || || || ||||| || 
Sbjct: 23907 gtttcgatggttgcctcagtgtccctggcaatctcatacccaactatcgcagctgcgcca 23966

                                          
Query: 656   cacatgttcctcaatgcatacaagaatgt 684
             ||||||||||||||||  |||||||||||
Sbjct: 23967 cacatgttcctcaatgggtacaagaatgt 23995



 Score =  212 bits (107), Expect = 1e-51
 Identities = 158/175 (90%)
 Strand = Plus / Plus

                                                                         
Query: 2     gagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagcagctccaggag 61
             ||||||||||||||||||||||||||||||||||| || || ||||| ||||| ||||||
Sbjct: 22473 gagtacaccaaggtgctcatcgccgtcgccgacaacgtgggatccaaccagctgcaggag 22532

                                                                         
Query: 62    atccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaacaccctgatccgc 121
             ||||||||||| ||| | || ||||||||||| |||||||| ||||||||||| ||||||
Sbjct: 22533 atccgcaaggggctcaggggcgactccatcgtcctcatggggaagaacaccctcatccgc 22592

                                                                    
Query: 122   cgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcgagctca 176
             |||||||||||||||||| | || || || |||||||||||||||||||||||||
Sbjct: 22593 cgctgcatcaaggtgcacgccgacaacaccggcaacaaggacttcctcgagctca 22647



 Score =  135 bits (68), Expect = 2e-28
 Identities = 95/104 (91%)
 Strand = Plus / Plus

                                                                         
Query: 258   aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 317
             ||||||| ||||||||||||||||| || ||||| |||||||||||||| ||||||||||
Sbjct: 23490 aggttggagctcctgctcgtgttggtctggttgctcctgttgatgtggttgttccccctg 23549

                                                         
Query: 318   gcaacactggtctggatccctcccagacgtccttcttccaggtg 361
             | ||||||||||| |||||||||||||| || ||||||||||||
Sbjct: 23550 gaaacactggtctcgatccctcccagacttctttcttccaggtg 23593



 Score =  125 bits (63), Expect = 2e-25
 Identities = 69/71 (97%)
 Strand = Plus / Plus

                                                                         
Query: 191   ggtaacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgcc 250
             ||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 22744 ggtaacgttggtctcatcttcaccaagggtgacctcaaggaggtccgcgaggaggtcgcc 22803

                        
Query: 251   aagtacaaggt 261
             |||||||||||
Sbjct: 22804 aagtacaaggt 22814



to top

>gb|L46848.1|SOYARPP Glycine max acidic ribosomal protein P0 mRNA, complete cds
          Length = 1247

 Score =  250 bits (126), Expect = 5e-63
 Identities = 393/482 (81%)
 Strand = Plus / Plus

                                                                       
Query: 209 ttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggcgct 268
           ||||||||||||||||| ||||||||  | |||||||| || |||||||||||||| |||
Sbjct: 404 ttcaccaagggtgacctgaaggaggtcagtgaggaggttgctaagtacaaggttggagct 463

                                                                       
Query: 269 cctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacactggt 328
           ||||||||||||||  | ||||| ||  ||||||| || ||||| ||||||||||| || 
Sbjct: 464 cctgctcgtgttggtttggttgctccaattgatgtcgttgttcctcctggcaacacaggg 523

                                                                       
Query: 329 ctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaacaag 388
           || |||||||| ||||| || ||||||||||||||||||||||| |||||||||||||||
Sbjct: 524 ctcgatccctctcagacctctttcttccaggtgcttaacattcctaccaagattaacaag 583

                                                                       
Query: 389 ggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggctcc 448
           |||||||||||||| |  |  || ||||| || || | |||||| |||||||| || || 
Sbjct: 584 ggtactgtggaaatcattacacctgtggaactcattaggaagggagacaaggttggatct 643

                                                                       
Query: 449 tctgagtctgccctgcttgccaagcttggtatccgccccttctcatatggactggtcatc 508
           |||||  ||||  ||||||||||||| || ||  | |||||||||||||| || ||  | 
Sbjct: 644 tctgaagctgcattgcttgccaagctaggcataaggcccttctcatatgggcttgtggtt 703

                                                                       
Query: 509 tgcaatgtctatgacagtgggtcagtcttcagccccgaggttcttgacctcactgaggaa 568
             |   || ||||| | ||| ||||| |||||||| ||||||||||| || |||||||| 
Sbjct: 704 ctctccgtttatgataatggttcagtgttcagccctgaggttcttgatcttactgaggat 763

                                                                       
Query: 569 gatctgatggacaagtttgcttctggtgtttccatggttgcctcactgtccctggcgatc 628
           ||||| || |  ||||||||| ||||||| || |||||| | ||||| ||  |||| || 
Sbjct: 764 gatctcattgggaagtttgctgctggtgtctcaatggttacttcactttcattggctatt 823

                                                                       
Query: 629 tcataccccaccatggctgctgcaccgcacatgttcctcaatgcatacaagaatgttctt 688
           ||||| || ||  | ||||| ||||| ||||||||  ||||||| |||||||||||||||
Sbjct: 824 tcatatccaacacttgctgcagcaccacacatgtttgtcaatgcctacaagaatgttctt 883

             
Query: 689 gc 690
           ||
Sbjct: 884 gc 885



 Score = 48.1 bits (24), Expect = 0.039
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                       
Query: 50  cagctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaac 109
           ||||||||| | || ||||||||||| ||||| |||||  | || |||||||| ||||||
Sbjct: 245 cagctccagaacattcgcaagggtcttcgcggcgactctgttgtcctcatggggaagaac 304

                   
Query: 110 accctgat 117
           ||| ||||
Sbjct: 305 accatgat 312



to top

>ref|NM_111754.2| Arabidopsis thaliana structural constituent of ribosome AT3G09200
           mRNA, complete cds
          Length = 1307

 Score =  234 bits (118), Expect = 3e-58
 Identities = 388/478 (81%)
 Strand = Plus / Plus

                                                                       
Query: 206 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 265
           ||||| ||||| |||||||||||||| ||  |||||||||| || |||||||||||||| 
Sbjct: 341 atctttaccaaaggtgacctcaaggaagtgagcgaggaggttgctaagtacaaggttggt 400

                                                                       
Query: 266 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 325
           || ||||||||||| ||  | || || ||  |||||||||| || |  ||||||||||||
Sbjct: 401 gcccctgctcgtgtgggtttggtggctccaattgatgtggttgtccaacctggcaacact 460

                                                                       
Query: 326 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 385
           ||||| || || ||||| || || |||||||||||||||||||| || ||||||||||||
Sbjct: 461 ggtctcgacccatcccaaacatctttcttccaggtgcttaacatcccaaccaagattaac 520

                                                                       
Query: 386 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 445
           |||||||| || ||||| | || |||||| ||||| |||||| | ||||||||||| || 
Sbjct: 521 aagggtaccgtcgaaatcatcaccccagttgagcttatcaagcaaggtgacaaggtcggg 580

                                                                       
Query: 446 tcctctgagtctgccctgcttgccaagcttggtatccgccccttctcatatggactggtc 505
           || |||||| |||| || || ||||||||||| ||| | || ||||||||||| || || 
Sbjct: 581 tcttctgaggctgcgcttctagccaagcttggcatcaggccgttctcatatggtcttgtt 640

                                                                       
Query: 506 atctgcaatgtctatgacagtgggtcagtcttcagccccgaggttcttgacctcactgag 565
            ||     ||||||||||| ||| |||||||||||||| ||||||||||| || ||||| 
Sbjct: 641 gtccagtctgtctatgacaatggctcagtcttcagcccagaggttcttgatcttactgaa 700

                                                                       
Query: 566 gaagatctgatggacaagtttgcttctggtgtttccatggttgcctcactgtccctggcg 625
           ||  | ||  |||| ||||||||||||||| | ||||||||  | ||  || | || || 
Sbjct: 701 gaccaacttgtggagaagtttgcttctggtatctccatggtcacttccttggctcttgct 760

                                                                     
Query: 626 atctcataccccaccatggctgctgcaccgcacatgttcctcaatgcatacaagaatg 683
            | || ||||| ||| | |||||||||||||| |||||| ||||||| ||||||||||
Sbjct: 761 gtgtcgtaccctacccttgctgctgcaccgcatatgttcatcaatgcgtacaagaatg 818



to top

>gb|AY059117.1| Arabidopsis thaliana putative 60S acidic ribosomal protein P0
           (At3g09200) mRNA, complete cds
          Length = 994

 Score =  234 bits (118), Expect = 3e-58
 Identities = 388/478 (81%)
 Strand = Plus / Plus

                                                                       
Query: 206 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 265
           ||||| ||||| |||||||||||||| ||  |||||||||| || |||||||||||||| 
Sbjct: 271 atctttaccaaaggtgacctcaaggaagtgagcgaggaggttgctaagtacaaggttggt 330

                                                                       
Query: 266 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 325
           || ||||||||||| ||  | || || ||  |||||||||| || |  ||||||||||||
Sbjct: 331 gcccctgctcgtgtgggtttggtggctccaattgatgtggttgtccaacctggcaacact 390

                                                                       
Query: 326 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 385
           ||||| || || ||||| || || |||||||||||||||||||| || ||||||||||||
Sbjct: 391 ggtctcgacccatcccaaacatctttcttccaggtgcttaacatcccaaccaagattaac 450

                                                                       
Query: 386 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 445
           |||||||| || ||||| | || |||||| ||||| |||||| | ||||||||||| || 
Sbjct: 451 aagggtaccgtcgaaatcatcaccccagttgagcttatcaagcaaggtgacaaggtcggg 510

                                                                       
Query: 446 tcctctgagtctgccctgcttgccaagcttggtatccgccccttctcatatggactggtc 505
           || |||||| |||| || || ||||||||||| ||| | || ||||||||||| || || 
Sbjct: 511 tcttctgaggctgcgcttctagccaagcttggcatcaggccgttctcatatggtcttgtt 570

                                                                       
Query: 506 atctgcaatgtctatgacagtgggtcagtcttcagccccgaggttcttgacctcactgag 565
            ||     ||||||||||| ||| |||||||||||||| ||||||||||| || ||||| 
Sbjct: 571 gtccagtctgtctatgacaatggctcagtcttcagcccagaggttcttgatcttactgaa 630

                                                                       
Query: 566 gaagatctgatggacaagtttgcttctggtgtttccatggttgcctcactgtccctggcg 625
           ||  | ||  |||| ||||||||||||||| | ||||||||  | ||  || | || || 
Sbjct: 631 gaccaacttgtggagaagtttgcttctggtatctccatggtcacttccttggctcttgct 690

                                                                     
Query: 626 atctcataccccaccatggctgctgcaccgcacatgttcctcaatgcatacaagaatg 683
            | || ||||| ||| | |||||||||||||| |||||| ||||||| ||||||||||
Sbjct: 691 gtgtcgtaccctacccttgctgctgcaccgcatatgttcatcaatgcgtacaagaatg 748



to top

>gb|AF370225.1| Arabidopsis thaliana putative 60S acidic ribosomal protein P0
           (At3g09200) mRNA, complete cds
          Length = 1160

 Score =  234 bits (118), Expect = 3e-58
 Identities = 388/478 (81%)
 Strand = Plus / Plus

                                                                       
Query: 206 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 265
           ||||| ||||| |||||||||||||| ||  |||||||||| || |||||||||||||| 
Sbjct: 341 atctttaccaaaggtgacctcaaggaagtgagcgaggaggttgctaagtacaaggttggt 400

                                                                       
Query: 266 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 325
           || ||||||||||| ||  | || || ||  |||||||||| || |  ||||||||||||
Sbjct: 401 gcccctgctcgtgtgggtttggtggctccaattgatgtggttgtccaacctggcaacact 460

                                                                       
Query: 326 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 385
           ||||| || || ||||| || || |||||||||||||||||||| || ||||||||||||
Sbjct: 461 ggtctcgacccatcccaaacatctttcttccaggtgcttaacatcccaaccaagattaac 520

                                                                       
Query: 386 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 445
           |||||||| || ||||| | || |||||| ||||| |||||| | ||||||||||| || 
Sbjct: 521 aagggtaccgtcgaaatcatcaccccagttgagcttatcaagcaaggtgacaaggtcggg 580

                                                                       
Query: 446 tcctctgagtctgccctgcttgccaagcttggtatccgccccttctcatatggactggtc 505
           || |||||| |||| || || ||||||||||| ||| | || ||||||||||| || || 
Sbjct: 581 tcttctgaggctgcgcttctagccaagcttggcatcaggccgttctcatatggtcttgtt 640

                                                                       
Query: 506 atctgcaatgtctatgacagtgggtcagtcttcagccccgaggttcttgacctcactgag 565
            ||     ||||||||||| ||| |||||||||||||| ||||||||||| || ||||| 
Sbjct: 641 gtccagtctgtctatgacaatggctcagtcttcagcccagaggttcttgatcttactgaa 700

                                                                       
Query: 566 gaagatctgatggacaagtttgcttctggtgtttccatggttgcctcactgtccctggcg 625
           ||  | ||  |||| ||||||||||||||| | ||||||||  | ||  || | || || 
Sbjct: 701 gaccaacttgtggagaagtttgcttctggtatctccatggtcacttccttggctcttgct 760

                                                                     
Query: 626 atctcataccccaccatggctgctgcaccgcacatgttcctcaatgcatacaagaatg 683
            | || ||||| ||| | |||||||||||||| |||||| ||||||| ||||||||||
Sbjct: 761 gtgtcgtaccctacccttgctgctgcaccgcatatgttcatcaatgcgtacaagaatg 818



to top

>emb|BX823923.1|CNS0A6KD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS92ZG11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1136

 Score =  234 bits (118), Expect = 3e-58
 Identities = 388/478 (81%)
 Strand = Plus / Plus

                                                                       
Query: 206 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 265
           ||||| ||||| |||||||||||||| ||  |||||||||| || |||||||||||||| 
Sbjct: 308 atctttaccaaaggtgacctcaaggaagtgagcgaggaggttgctaagtacaaggttggt 367

                                                                       
Query: 266 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 325
           || ||||||||||| ||  | || || ||  |||||||||| || |  ||||||||||||
Sbjct: 368 gcccctgctcgtgtgggtttggtggctccaattgatgtggttgtccaacctggcaacact 427

                                                                       
Query: 326 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 385
           ||||| || || ||||| || || |||||||||||||||||||| || ||||||||||||
Sbjct: 428 ggtctcgacccatcccaaacatctttcttccaggtgcttaacatcccaaccaagattaac 487

                                                                       
Query: 386 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 445
           |||||||| || ||||| | || |||||| ||||| |||||| | ||||||||||| || 
Sbjct: 488 aagggtaccgtcgaaatcatcaccccagttgagcttatcaagcaaggtgacaaggtcggg 547

                                                                       
Query: 446 tcctctgagtctgccctgcttgccaagcttggtatccgccccttctcatatggactggtc 505
           || |||||| |||| || || ||||||||||| ||| | || ||||||||||| || || 
Sbjct: 548 tcttctgaggctgcgcttctagccaagcttggcatcaggccgttctcatatggtcttgtt 607

                                                                       
Query: 506 atctgcaatgtctatgacagtgggtcagtcttcagccccgaggttcttgacctcactgag 565
            ||     ||||||||||| ||| |||||||||||||| ||||||||||| || ||||| 
Sbjct: 608 gtccagtctgtctatgacaatggctcagtcttcagcccagaggttcttgatcttactgaa 667

                                                                       
Query: 566 gaagatctgatggacaagtttgcttctggtgtttccatggttgcctcactgtccctggcg 625
           ||  | ||  |||| ||||||||||||||| | ||||||||  | ||  || | || || 
Sbjct: 668 gaccaacttgtggagaagtttgcttctggtatctccatggtcacttccttggctcttgct 727

                                                                     
Query: 626 atctcataccccaccatggctgctgcaccgcacatgttcctcaatgcatacaagaatg 683
            | || ||||| ||| | |||||||||||||| |||||| ||||||| ||||||||||
Sbjct: 728 gtgtcgtaccctacccttgctgctgcaccgcatatgttcatcaatgcgtacaagaatg 785



to top

>dbj|AB091076.1| Zinnia elegans ZeRPP0 mRNA for putative 60S acidic ribosomal
           protein P0, partial cds
          Length = 820

 Score =  234 bits (118), Expect = 3e-58
 Identities = 220/254 (86%)
 Strand = Plus / Plus

                                                                       
Query: 206 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 265
           |||||||| ||||||||| | ||||||||||| || ||||| || ||||||||||| || 
Sbjct: 481 atcttcacaaagggtgacttgaaggaggttcgtgaagaggttgctaagtacaaggtcgga 540

                                                                       
Query: 266 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 325
           || ||||||||||| ||  | || || || ||||||||||| || || ||||||||||||
Sbjct: 541 gcacctgctcgtgtcggtttggtggctccagttgatgtggttgtccctcctggcaacact 600

                                                                       
Query: 326 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 385
           ||||| || || || ||||| || ||||||||||||||||||||||||||||||||||||
Sbjct: 601 ggtcttgacccatctcagacctctttcttccaggtgcttaacattcccaccaagattaac 660

                                                                       
Query: 386 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 445
           ||||||||||| ||||||| || |||||||||||| ||||||||||||||||| ||||| 
Sbjct: 661 aagggtactgttgaaattatcaccccagtggagcttatcaagaagggtgacaaagtgggt 720

                         
Query: 446 tcctctgagtctgc 459
           || |||||| ||||
Sbjct: 721 tcatctgaggctgc 734



to top

>ref|NM_111960.2| Arabidopsis thaliana structural constituent of ribosome AT3G11250
           mRNA, complete cds
          Length = 1239

 Score =  230 bits (116), Expect = 5e-57
 Identities = 233/272 (85%)
 Strand = Plus / Plus

                                                                       
Query: 206 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 265
           |||||||| || ||||| |||||||| ||  |||||||||| ||||| ||||||||||| 
Sbjct: 364 atcttcactaaaggtgatctcaaggaagtgagcgaggaggttgccaaatacaaggttggt 423

                                                                       
Query: 266 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 325
           |||||||||||||| ||  ||||||| ||| |||||||||| ||||  ||||||||||||
Sbjct: 424 gctcctgctcgtgtgggtttagttgctcctattgatgtggttgttcaacctggcaacact 483

                                                                       
Query: 326 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 385
           ||||| || || || || || || |||||||||||||||||||||||||| |||||||||
Sbjct: 484 ggtcttgacccatctcaaacatcgttcttccaggtgcttaacattcccactaagattaac 543

                                                                       
Query: 386 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 445
           ||||||||||| ||||||| || ||| |||||||| |||||| | ||||||||||| || 
Sbjct: 544 aagggtactgttgaaattatcacccctgtggagcttatcaagcaaggtgacaaggttggg 603

                                           
Query: 446 tcctctgagtctgccctgcttgccaagcttgg 477
           || |||||| ||||||| || || ||||||||
Sbjct: 604 tcttctgaggctgcccttctagctaagcttgg 635



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                
Query: 647 gctgcaccgcacatgttcctcaatgcatacaagaatg 683
           ||||||||||| |||||| ||||||| ||||||||||
Sbjct: 805 gctgcaccgcatatgttcatcaatgcctacaagaatg 841



to top

>gb|AY091201.1| Arabidopsis thaliana putative 60S acidic ribosomal protein
           (At3g11250) mRNA, complete cds
          Length = 1003

 Score =  230 bits (116), Expect = 5e-57
 Identities = 233/272 (85%)
 Strand = Plus / Plus

                                                                       
Query: 206 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 265
           |||||||| || ||||| |||||||| ||  |||||||||| ||||| ||||||||||| 
Sbjct: 271 atcttcactaaaggtgatctcaaggaagtgagcgaggaggttgccaaatacaaggttggt 330

                                                                       
Query: 266 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 325
           |||||||||||||| ||  ||||||| ||| |||||||||| ||||  ||||||||||||
Sbjct: 331 gctcctgctcgtgtgggtttagttgctcctattgatgtggttgttcaacctggcaacact 390

                                                                       
Query: 326 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 385
           ||||| || || || || || || |||||||||||||||||||||||||| |||||||||
Sbjct: 391 ggtcttgacccatctcaaacatcgttcttccaggtgcttaacattcccactaagattaac 450

                                                                       
Query: 386 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 445
           ||||||||||| ||||||| || ||| |||||||| |||||| | ||||||||||| || 
Sbjct: 451 aagggtactgttgaaattatcacccctgtggagcttatcaagcaaggtgacaaggttggg 510

                                           
Query: 446 tcctctgagtctgccctgcttgccaagcttgg 477
           || |||||| ||||||| || || ||||||||
Sbjct: 511 tcttctgaggctgcccttctagctaagcttgg 542



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                
Query: 647 gctgcaccgcacatgttcctcaatgcatacaagaatg 683
           ||||||||||| |||||| ||||||| ||||||||||
Sbjct: 712 gctgcaccgcatatgttcatcaatgcctacaagaatg 748



to top

>gb|AY056150.1| Arabidopsis thaliana putative 60S acidic ribosomal protein
           (At3g11250) mRNA, complete cds
          Length = 1174

 Score =  230 bits (116), Expect = 5e-57
 Identities = 233/272 (85%)
 Strand = Plus / Plus

                                                                       
Query: 206 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 265
           |||||||| || ||||| |||||||| ||  |||||||||| ||||| ||||||||||| 
Sbjct: 334 atcttcactaaaggtgatctcaaggaagtgagcgaggaggttgccaaatacaaggttggt 393

                                                                       
Query: 266 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 325
           |||||||||||||| ||  ||||||| ||| |||||||||| ||||  ||||||||||||
Sbjct: 394 gctcctgctcgtgtgggtttagttgctcctattgatgtggttgttcaacctggcaacact 453

                                                                       
Query: 326 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 385
           ||||| || || || || || || |||||||||||||||||||||||||| |||||||||
Sbjct: 454 ggtcttgacccatctcaaacatcgttcttccaggtgcttaacattcccactaagattaac 513

                                                                       
Query: 386 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 445
           ||||||||||| ||||||| || ||| |||||||| |||||| | ||||||||||| || 
Sbjct: 514 aagggtactgttgaaattatcacccctgtggagcttatcaagcaaggtgacaaggttggg 573

                                           
Query: 446 tcctctgagtctgccctgcttgccaagcttgg 477
           || |||||| ||||||| || || ||||||||
Sbjct: 574 tcttctgaggctgcccttctagctaagcttgg 605



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                
Query: 647 gctgcaccgcacatgttcctcaatgcatacaagaatg 683
           ||||||||||| |||||| ||||||| ||||||||||
Sbjct: 775 gctgcaccgcatatgttcatcaatgcctacaagaatg 811



to top

>gb|AY087728.1| Arabidopsis thaliana clone 38036 mRNA, complete sequence
          Length = 1185

 Score =  230 bits (116), Expect = 5e-57
 Identities = 233/272 (85%)
 Strand = Plus / Plus

                                                                       
Query: 206 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 265
           |||||||| || ||||| |||||||| ||  |||||||||| ||||| ||||||||||| 
Sbjct: 311 atcttcactaaaggtgatctcaaggaagtgagcgaggaggttgccaaatacaaggttggt 370

                                                                       
Query: 266 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 325
           |||||||||||||| ||  ||||||| ||| |||||||||| ||||  ||||||||||||
Sbjct: 371 gctcctgctcgtgtgggtttagttgctcctattgatgtggttgttcaacctggcaacact 430

                                                                       
Query: 326 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 385
           ||||| || || || || || || |||||||||||||||||||||||||| |||||||||
Sbjct: 431 ggtcttgacccatctcaaacatcgttcttccaggtgcttaacattcccactaagattaac 490

                                                                       
Query: 386 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 445
           ||||||||||| ||||||| || ||| |||||||| |||||| | ||||||||||| || 
Sbjct: 491 aagggtactgttgaaattatcacccctgtggagcttatcaagcaaggtgacaaggttggg 550

                                           
Query: 446 tcctctgagtctgccctgcttgccaagcttgg 477
           || |||||| ||||||| || || ||||||||
Sbjct: 551 tcttctgaggctgcccttctagctaagcttgg 582



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                
Query: 647 gctgcaccgcacatgttcctcaatgcatacaagaatg 683
           ||||||||||| |||||| ||||||| ||||||||||
Sbjct: 752 gctgcaccgcatatgttcatcaatgcctacaagaatg 788



to top

>gb|DQ235176.1| Solanum tuberosum clone 156H10 P0 ribosomal protein-like mRNA,
           complete cds
          Length = 1254

 Score =  228 bits (115), Expect = 2e-56
 Identities = 316/383 (82%)
 Strand = Plus / Plus

                                                                       
Query: 206 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 265
           |||||||||||||||||||||||||| ||  | ||||| ||||| |||||||||||||| 
Sbjct: 437 atcttcaccaagggtgacctcaaggaagtgagtgaggaagtcgcaaagtacaaggttgga 496

                                                                       
Query: 266 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 325
           || ||||||||||||||  | || || || |||||||| || || || ||||| ||||||
Sbjct: 497 gcacctgctcgtgttggtttggtggctccagttgatgttgttgtccctcctggtaacact 556

                                                                       
Query: 326 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 385
           ||||| ||||| || ||||| || |||||||||||||| ||||| || || |||||||||
Sbjct: 557 ggtcttgatccatctcagacctctttcttccaggtgctcaacatcccaactaagattaac 616

                                                                       
Query: 386 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 445
           ||||||||||| ||||||| ||  || || || || ||||||||||||||||| || || 
Sbjct: 617 aagggtactgttgaaattatcactcctgttgaactcatcaagaagggtgacaaagttggt 676

                                                                       
Query: 446 tcctctgagtctgccctgcttgccaagcttggtatccgccccttctcatatggactggtc 505
           ||||||||  |||||||||||||||| ||||| ||  | || ||||||||||| || || 
Sbjct: 677 tcctctgaagctgccctgcttgccaaacttggaattaggccattctcatatggtcttgtt 736

                                                                       
Query: 506 atctgcaatgtctatgacagtgggtcagtcttcagccccgaggttcttgacctcactgag 565
            |   |  ||| || |||| ||| || ||||||||||| |||||||||||||| ||||||
Sbjct: 737 gttgtctctgtttacgacaatggatccgtcttcagccctgaggttcttgacctgactgag 796

                                  
Query: 566 gaagatctgatggacaagtttgc 588
           || ||||| || || ||||||||
Sbjct: 797 gatgatctcattgagaagtttgc 819



to top

>gb|DQ241840.1| Solanum tuberosum clone 181G12 P0 ribosomal protein-like mRNA,
           complete cds
          Length = 1253

 Score =  228 bits (115), Expect = 2e-56
 Identities = 316/383 (82%)
 Strand = Plus / Plus

                                                                       
Query: 206 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 265
           |||||||||||||||||||||||||| ||  | ||||| ||||| |||||||||||||| 
Sbjct: 415 atcttcaccaagggtgacctcaaggaagtgagtgaggaagtcgcaaagtacaaggttgga 474

                                                                       
Query: 266 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 325
           || ||||||||||||||  | || || || |||||||| || || || ||||| ||||||
Sbjct: 475 gcacctgctcgtgttggtttggtggctccagttgatgttgttgtccctcctggtaacact 534

                                                                       
Query: 326 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 385
           ||||| ||||| || ||||| || |||||||||||||| ||||| || || |||||||||
Sbjct: 535 ggtcttgatccatctcagacctctttcttccaggtgctcaacatcccaactaagattaac 594

                                                                       
Query: 386 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 445
           ||||||||||| ||||||| ||  || || || || ||||||||||||||||| || || 
Sbjct: 595 aagggtactgttgaaattatcactcctgttgaactcatcaagaagggtgacaaagttggt 654

                                                                       
Query: 446 tcctctgagtctgccctgcttgccaagcttggtatccgccccttctcatatggactggtc 505
           ||||||||  |||||||||||||||| ||||| ||  | || ||||||||||| || || 
Sbjct: 655 tcctctgaagctgccctgcttgccaaacttggaattaggccattctcatatggtcttgtt 714

                                                                       
Query: 506 atctgcaatgtctatgacagtgggtcagtcttcagccccgaggttcttgacctcactgag 565
            |   |  ||| || |||| ||| || ||||||||||| |||||||||||||| ||||||
Sbjct: 715 gttgtctctgtttacgacaatggatccgtcttcagccctgaggttcttgacctgactgag 774

                                  
Query: 566 gaagatctgatggacaagtttgc 588
           || ||||| || || ||||||||
Sbjct: 775 gatgatctcattgagaagtttgc 797



to top

>gb|BT018921.1| Zea mays clone Contig30.F mRNA sequence
          Length = 820

 Score =  226 bits (114), Expect = 8e-56
 Identities = 167/182 (91%), Gaps = 2/182 (1%)
 Strand = Plus / Plus

                                                                       
Query: 311 ccccctggcaacactggtctggatccctcccagacgtccttcttccaggtgcttaacatt 370
           ||||||||||||||||| ||||||||||||||||| || |||||| ||||||| ||||| 
Sbjct: 14  ccccctggcaacactgggctggatccctcccagacctctttcttc-aggtgct-aacatc 71

                                                                       
Query: 371 cccaccaagattaacaagggtactgtggaaattaccatcccagtggagctgatcaagaag 430
           |||||||||||||||||||||||||||||||||| || ||| ||||||||||||||||||
Sbjct: 72  cccaccaagattaacaagggtactgtggaaattatcacccctgtggagctgatcaagaag 131

                                                                       
Query: 431 ggtgacaaggtgggctcctctgagtctgccctgcttgccaagcttggtatccgccccttc 490
           ||||| ||||||||||| || |||||||||||||| |||||||| || ||||||||||||
Sbjct: 132 ggtgagaaggtgggctcgtccgagtctgccctgctcgccaagctgggcatccgccccttc 191

             
Query: 491 tc 492
           ||
Sbjct: 192 tc 193



to top

>gb|AY086582.1| Arabidopsis thaliana clone 2595 mRNA, complete sequence
          Length = 1199

 Score =  226 bits (114), Expect = 8e-56
 Identities = 387/478 (80%)
 Strand = Plus / Plus

                                                                       
Query: 206 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 265
           ||||| ||||| |||||||||||||| ||  |||||||||| || ||||||||||| || 
Sbjct: 339 atctttaccaaaggtgacctcaaggaagtgagcgaggaggttgctaagtacaaggtcggt 398

                                                                       
Query: 266 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 325
           || ||||||||||| ||  | || || ||  |||||||||| || |  ||||||||||||
Sbjct: 399 gcccctgctcgtgtgggtttggtggctccaattgatgtggttgtccaacctggcaacact 458

                                                                       
Query: 326 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 385
           ||||| || || ||||| || || |||||||||||||||||||| || ||||||||||||
Sbjct: 459 ggtctcgacccatcccaaacatctttcttccaggtgcttaacatcccaaccaagattaac 518

                                                                       
Query: 386 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 445
           |||||||| || ||||| | || |||||| ||||| |||||| | ||||||||||| || 
Sbjct: 519 aagggtaccgtcgaaatcatcaccccagttgagcttatcaagcaaggtgacaaggtcggg 578

                                                                       
Query: 446 tcctctgagtctgccctgcttgccaagcttggtatccgccccttctcatatggactggtc 505
           || |||||| |||| || || ||||||||||| ||| | || ||||||||||| || || 
Sbjct: 579 tcttctgaggctgcgcttctagccaagcttggcatcaggccgttctcatatggtcttgtt 638

                                                                       
Query: 506 atctgcaatgtctatgacagtgggtcagtcttcagccccgaggttcttgacctcactgag 565
            ||     ||||||||||| ||| |||||||||||||| ||||||||||| || ||||| 
Sbjct: 639 gtccagtctgtctatgacaatggctcagtcttcagcccagaggttcttgatcttactgaa 698

                                                                       
Query: 566 gaagatctgatggacaagtttgcttctggtgtttccatggttgcctcactgtccctggcg 625
           ||  | ||  |||| ||||||||||||||| | ||||||||  | ||  || | || || 
Sbjct: 699 gaccaacttgtggagaagtttgcttctggtatctccatggtcacttccttggctcttgct 758

                                                                     
Query: 626 atctcataccccaccatggctgctgcaccgcacatgttcctcaatgcatacaagaatg 683
            | || ||||| ||| | |||||||||||||| |||||| ||||||| ||||||||||
Sbjct: 759 gtgtcgtaccctacccttgctgctgcaccgcatatgttcatcaatgcgtacaagaatg 816



to top

>emb|BX824039.1|CNS0A6RI Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH17ZF06 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1185

 Score =  224 bits (113), Expect = 3e-55
 Identities = 329/401 (82%)
 Strand = Plus / Plus

                                                                       
Query: 206 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 265
           ||||| ||||| |||||||||||||| ||| |||||||||| || |||||||||||||| 
Sbjct: 325 atctttaccaaaggtgacctcaaggaagttagcgaggaggttgctaagtacaaggttggt 384

                                                                       
Query: 266 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 325
           || ||||||||||| ||  | || || ||  |||||||||| || |  ||||||||||||
Sbjct: 385 gcccctgctcgtgtgggtttggtggctccaattgatgtggttgtccaacctggcaacact 444

                                                                       
Query: 326 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 385
           ||||| || || ||||| || || |||||||||||||||||||| || ||||||||||||
Sbjct: 445 ggtctcgacccatcccaaacatctttcttccaggtgcttaacatcccaaccaagattaac 504

                                                                       
Query: 386 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 445
           |||||||| || ||||| | || |||||| ||||| |||||| | ||||||||||| || 
Sbjct: 505 aagggtaccgtcgaaatcatcaccccagttgagcttatcaagcaaggtgacaaggtcggg 564

                                                                       
Query: 446 tcctctgagtctgccctgcttgccaagcttggtatccgccccttctcatatggactggtc 505
           || |||||| |||| || || ||||||||||| ||| | || ||||||||||| || || 
Sbjct: 565 tcttctgaggctgcgcttctagccaagcttggcatcaggccgttctcatatggtcttgtt 624

                                                                       
Query: 506 atctgcaatgtctatgacagtgggtcagtcttcagccccgaggttcttgacctcactgag 565
            ||     ||||||||| | ||| |||||||||||||| ||||||||||| || ||||| 
Sbjct: 625 gtccagtctgtctatgaaaatggctcagtcttcagcccagaggttcttgatcttactgaa 684

                                                    
Query: 566 gaagatctgatggacaagtttgcttctggtgtttccatggt 606
           ||  | ||  |||| ||||||||||||||| | ||||||||
Sbjct: 685 gaccaacttgtggagaagtttgcttctggtatctccatggt 725



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                   
Query: 644 gctgctgcaccgcacatgttcctcaatgcatacaagaatg 683
           |||||||||||||| |||||| ||||||| ||||||||||
Sbjct: 763 gctgctgcaccgcatatgttcatcaatgcgtacaagaatg 802



to top

>gb|AF227622.1|AF227622 Euphorbia esula 60S acidic ribosomal protein PO mRNA, partial cds
          Length = 1127

 Score =  198 bits (100), Expect = 2e-47
 Identities = 220/260 (84%)
 Strand = Plus / Plus

                                                                       
Query: 206 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 265
           ||||||||||||||||| |||||||| ||  | || ||||| ||||||||||||||||| 
Sbjct: 265 atcttcaccaagggtgatctcaaggaagtcagtgaagaggttgccaagtacaaggttgga 324

                                                                       
Query: 266 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 325
           || ||||||||||||||  | ||||| ||  |||||||||| || || ||||||||||| 
Sbjct: 325 gcccctgctcgtgttggtttggttgctccaattgatgtggttgtcccacctggcaacaca 384

                                                                       
Query: 326 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 385
           || || || || |||||||| || ||||||||||| ||||||||||| ||||||||||||
Sbjct: 385 gggctcgacccttcccagacctctttcttccaggtccttaacattcctaccaagattaac 444

                                                                       
Query: 386 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 445
           ||||| || || ||||| | || ||| ||||| || ||||||||||| ||||||||||||
Sbjct: 445 aagggaacagtcgaaatcatcacccctgtggaactaatcaagaagggagacaaggtgggc 504

                               
Query: 446 tcctctgagtctgccctgct 465
           ||||| ||| ||||| ||||
Sbjct: 505 tcctccgaggctgccttgct 524



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 49/58 (84%)
 Strand = Plus / Plus

                                                                     
Query: 627 tctcataccccaccatggctgctgcaccgcacatgttcctcaatgcatacaagaatgt 684
           |||||||||| ||  | |||||||| || ||||||||| | ||||| |||||||||||
Sbjct: 686 tctcatacccaactctagctgctgccccccacatgttcattaatgcctacaagaatgt 743



to top

>emb|X93587.1|LLP0 L.luteus mRNA for P0 ribosomal protein
          Length = 1393

 Score =  186 bits (94), Expect = 7e-44
 Identities = 232/278 (83%)
 Strand = Plus / Plus

                                                                       
Query: 227 aaggaggttcgcgaggaggtcgccaagtacaaggttggcgctcctgctcgtgttgggcta 286
           ||||||||| ||||||| || || ||||||||||| || ||||||||  |||||||  | 
Sbjct: 451 aaggaggttagcgaggaagttgctaagtacaaggtcggagctcctgcctgtgttggtttg 510

                                                                       
Query: 287 gttgcacctgttgatgtggtggttccccctggcaacactggtctggatccctcccagacg 346
           ||||| ||  ||||||| || || || || ||||||||||| || ||||| || ||||| 
Sbjct: 511 gttgctccaattgatgttgttgtccctccaggcaacactgggctcgatccatctcagacc 570

                                                                       
Query: 347 tccttcttccaggtgcttaacattcccaccaagattaacaagggtactgtggaaattacc 406
           || |||||||||||||| |||||||||||||||||||||||||||||||| ||||||| |
Sbjct: 571 tctttcttccaggtgctcaacattcccaccaagattaacaagggtactgttgaaattatc 630

                                                                       
Query: 407 atcccagtggagctgatcaagaagggtgacaaggtgggctcctctgagtctgccctgctt 466
           |  || |||||||| || |||||||| |||||||| ||||| |||||  ||||  |||||
Sbjct: 631 acacccgtggagctcattaagaagggagacaaggttggctcttctgaagctgcattgctt 690

                                                 
Query: 467 gccaagcttggtatccgccccttctcatatggactggt 504
           ||||||||||| ||  | || ||||||||||| |||||
Sbjct: 691 gccaagcttggcataaggccattctcatatggtctggt 728



 Score = 40.1 bits (20), Expect = 9.5
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                   
Query: 32  gacaatgtcggctccaagcagctccaggagatccgcaagggtctccgcggtgactc 87
           |||||||| || || |||||||||||| | || ||| ||||||| || ||||||||
Sbjct: 256 gacaatgttggttcaaagcagctccagaacattcgccagggtctacgtggtgactc 311



to top

>dbj|AB236824.1| Trifolium pratense RNA for putative 60S acidic ribosomal protein
           P0, complete cds, clone: C2319
          Length = 1345

 Score =  176 bits (89), Expect = 6e-41
 Identities = 197/233 (84%)
 Strand = Plus / Plus

                                                                       
Query: 209 ttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggcgct 268
           ||||||||||||||| | ||||| ||| | |||||||| || |||||||||||||| |||
Sbjct: 433 ttcaccaagggtgacttgaaggaagttagtgaggaggttgctaagtacaaggttggagct 492

                                                                       
Query: 269 cctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacactggt 328
           ||||||||||||||  | ||||| ||  ||||||| || || || ||||| ||||| || 
Sbjct: 493 cctgctcgtgttggtttggttgctccaattgatgttgttgtgcctcctggtaacacaggg 552

                                                                       
Query: 329 ctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaacaag 388
           || || || |||||||| || |||||||||||||||||||| ||||||||||||||||||
Sbjct: 553 ctcgacccatcccagacctctttcttccaggtgcttaacatccccaccaagattaacaag 612

                                                                
Query: 389 ggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggt 441
           |||||||||||||| |  | ||| || || || ||||||||||| ||||||||
Sbjct: 613 ggtactgtggaaatcattacccctgttgaactcatcaagaagggagacaaggt 665



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 81/97 (83%)
 Strand = Plus / Plus

                                                                       
Query: 592 tggtgtttccatggttgcctcactgtccctggcgatctcataccccaccatggctgctgc 651
           ||||||||| |||||| | ||||| ||  |||| ||||| ||||| ||  | || |||||
Sbjct: 816 tggtgtttcaatggttacttcactttcgttggccatctcttacccaacacttgcagctgc 875

                                                
Query: 652 accgcacatgttcctcaatgcatacaagaatgttctt 688
           ||| ||||||||| ||||||| |||||||||||||||
Sbjct: 876 acctcacatgttcgtcaatgcctacaagaatgttctt 912



to top

>dbj|AB236811.1| Trifolium pratense RNA for putative 60S acidic ribosomal protein
           P0, complete cds, clone: C212
          Length = 1326

 Score =  176 bits (89), Expect = 6e-41
 Identities = 197/233 (84%)
 Strand = Plus / Plus

                                                                       
Query: 209 ttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggcgct 268
           ||||||||||||||| | ||||| ||| | |||||||| || |||||||||||||| |||
Sbjct: 440 ttcaccaagggtgacttgaaggaagttagtgaggaggttgctaagtacaaggttggagct 499

                                                                       
Query: 269 cctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacactggt 328
           ||||||||||||||  | ||||| ||  ||||||| || || || ||||| ||||| || 
Sbjct: 500 cctgctcgtgttggtttggttgctccaattgatgttgttgtgcctcctggtaacacaggg 559

                                                                       
Query: 329 ctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaacaag 388
           || || || |||||||| || |||||||||||||||||||| ||||||||||||||||||
Sbjct: 560 ctcgacccatcccagacctctttcttccaggtgcttaacatccccaccaagattaacaag 619

                                                                
Query: 389 ggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggt 441
           |||||||||||||| |  | ||| || || || ||||||||||| ||||||||
Sbjct: 620 ggtactgtggaaatcattacccctgttgaactcatcaagaagggagacaaggt 672



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 80/97 (82%)
 Strand = Plus / Plus

                                                                       
Query: 592 tggtgtttccatggttgcctcactgtccctggcgatctcataccccaccatggctgctgc 651
           ||||||||| |||||| | ||||| ||  |||| ||||| ||||| ||  | || |||||
Sbjct: 823 tggtgtttcaatggttacttcactttcgttggccatctcttacccaacacttgcagctgc 882

                                                
Query: 652 accgcacatgttcctcaatgcatacaagaatgttctt 688
           ||| ||||||||| | ||||| |||||||||||||||
Sbjct: 883 acctcacatgttcgtgaatgcctacaagaatgttctt 919



to top

>emb|X15206.1|CRCRE2 C.rubrum mRNA for light-induced 34kD protein
          Length = 1332

 Score =  170 bits (86), Expect = 4e-39
 Identities = 209/250 (83%)
 Strand = Plus / Plus

                                                                       
Query: 249 ccaagtacaaggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtgg 308
           |||||||||||||||| |||||||||||| ||||  | ||||||||  ||||||| || |
Sbjct: 556 ccaagtacaaggttggagctcctgctcgttttggtttggttgcaccaattgatgttgttg 615

                                                                       
Query: 309 ttccccctggcaacactggtctggatccctcccagacgtccttcttccaggtgcttaaca 368
           | || || |||||||||||||| || ||||||||||| || ||||||||||| |||||||
Sbjct: 616 tcccaccaggcaacactggtcttgacccctcccagacatctttcttccaggttcttaaca 675

                                                                       
Query: 369 ttcccaccaagattaacaagggtactgtggaaattaccatcccagtggagctgatcaaga 428
           | ||||| |||||||||||||||||||| ||||||| ||   | || ||||| |||||||
Sbjct: 676 tccccactaagattaacaagggtactgtcgaaattatcactgctgtagagctcatcaaga 735

                                                                       
Query: 429 agggtgacaaggtgggctcctctgagtctgccctgcttgccaagcttggtatccgcccct 488
           |||| || |||||||| || |||||| | || || ||||| |||||||| ||  | || |
Sbjct: 736 agggcgaaaaggtgggttcttctgaggcagctctacttgcaaagcttggaattaggcctt 795

                     
Query: 489 tctcatatgg 498
           ||||||||||
Sbjct: 796 tctcatatgg 805



to top

>gb|AC011436.7|ATAC011436 Arabidopsis thaliana chromosome III BAC F3L24 genomic sequence,
             complete sequence
          Length = 106688

 Score =  149 bits (75), Expect = 1e-32
 Identities = 264/327 (80%)
 Strand = Plus / Minus

                                                                         
Query: 357   aggtgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcccagtgg 416
             ||||||||||||| || |||||||||||||||||||| || ||||| | || |||||| |
Sbjct: 20578 aggtgcttaacatcccaaccaagattaacaagggtaccgtcgaaatcatcaccccagttg 20519

                                                                         
Query: 417   agctgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgccaagcttg 476
             |||| |||||| | ||||||||||| || || |||||| |||| || || ||||||||||
Sbjct: 20518 agcttatcaagcaaggtgacaaggtcgggtcttctgaggctgcgcttctagccaagcttg 20459

                                                                         
Query: 477   gtatccgccccttctcatatggactggtcatctgcaatgtctatgacagtgggtcagtct 536
             | ||| | || ||||||||||| || ||  ||     ||||||||||| ||| |||||||
Sbjct: 20458 gcatcaggccgttctcatatggtcttgttgtccagtctgtctatgacaatggctcagtct 20399

                                                                         
Query: 537   tcagccccgaggttcttgacctcactgaggaagatctgatggacaagtttgcttctggtg 596
             ||||||| ||||||||||| || ||||| ||  | ||  |||| ||||||||||||||| 
Sbjct: 20398 tcagcccagaggttcttgatcttactgaagaccaacttgtggagaagtttgcttctggta 20339

                                                                         
Query: 597   tttccatggttgcctcactgtccctggcgatctcataccccaccatggctgctgcaccgc 656
             | ||||||||  | ||  || | || ||  | || ||||| ||| | |||||||||||||
Sbjct: 20338 tctccatggtcacttccttggctcttgctgtgtcgtaccctacccttgctgctgcaccgc 20279

                                        
Query: 657   acatgttcctcaatgcatacaagaatg 683
             | |||||| ||||||| ||||||||||
Sbjct: 20278 atatgttcatcaatgcgtacaagaatg 20252



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                      
Query: 206   atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggtt 262
             ||||| ||||| |||||||||||||| ||  |||||||||| || ||||||||||||
Sbjct: 21237 atctttaccaaaggtgacctcaaggaagtgagcgaggaggttgctaagtacaaggtt 21181



 Score = 48.1 bits (24), Expect = 0.039
 Identities = 54/64 (84%)
 Strand = Plus / Minus

                                                                         
Query: 297   ttgatgtggtggttccccctggcaacactggtctggatccctcccagacgtccttcttcc 356
             |||||||||| || |  ||||||||||||||||| || || ||||| || || |||||||
Sbjct: 20730 ttgatgtggttgtccaacctggcaacactggtctcgacccatcccaaacatctttcttcc 20671

                 
Query: 357   aggt 360
             ||||
Sbjct: 20670 aggt 20667



to top

>gb|AC009326.8|ATAC009326 Arabidopsis thaliana chromosome III P1 MZB10 genomic sequence, complete
             sequence
          Length = 85561

 Score =  149 bits (75), Expect = 1e-32
 Identities = 264/327 (80%)
 Strand = Plus / Minus

                                                                         
Query: 357   aggtgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcccagtgg 416
             ||||||||||||| || |||||||||||||||||||| || ||||| | || |||||| |
Sbjct: 84901 aggtgcttaacatcccaaccaagattaacaagggtaccgtcgaaatcatcaccccagttg 84842

                                                                         
Query: 417   agctgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgccaagcttg 476
             |||| |||||| | ||||||||||| || || |||||| |||| || || ||||||||||
Sbjct: 84841 agcttatcaagcaaggtgacaaggtcgggtcttctgaggctgcgcttctagccaagcttg 84782

                                                                         
Query: 477   gtatccgccccttctcatatggactggtcatctgcaatgtctatgacagtgggtcagtct 536
             | ||| | || ||||||||||| || ||  ||     ||||||||||| ||| |||||||
Sbjct: 84781 gcatcaggccgttctcatatggtcttgttgtccagtctgtctatgacaatggctcagtct 84722

                                                                         
Query: 537   tcagccccgaggttcttgacctcactgaggaagatctgatggacaagtttgcttctggtg 596
             ||||||| ||||||||||| || ||||| ||  | ||  |||| ||||||||||||||| 
Sbjct: 84721 tcagcccagaggttcttgatcttactgaagaccaacttgtggagaagtttgcttctggta 84662

                                                                         
Query: 597   tttccatggttgcctcactgtccctggcgatctcataccccaccatggctgctgcaccgc 656
             | ||||||||  | ||  || | || ||  | || ||||| ||| | |||||||||||||
Sbjct: 84661 tctccatggtcacttccttggctcttgctgtgtcgtaccctacccttgctgctgcaccgc 84602

                                        
Query: 657   acatgttcctcaatgcatacaagaatg 683
             | |||||| ||||||| ||||||||||
Sbjct: 84601 atatgttcatcaatgcgtacaagaatg 84575



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                      
Query: 206   atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggtt 262
             ||||| ||||| |||||||||||||| ||  |||||||||| || ||||||||||||
Sbjct: 85560 atctttaccaaaggtgacctcaaggaagtgagcgaggaggttgctaagtacaaggtt 85504



 Score = 48.1 bits (24), Expect = 0.039
 Identities = 54/64 (84%)
 Strand = Plus / Minus

                                                                         
Query: 297   ttgatgtggtggttccccctggcaacactggtctggatccctcccagacgtccttcttcc 356
             |||||||||| || |  ||||||||||||||||| || || ||||| || || |||||||
Sbjct: 85053 ttgatgtggttgtccaacctggcaacactggtctcgacccatcccaaacatctttcttcc 84994

                 
Query: 357   aggt 360
             ||||
Sbjct: 84993 aggt 84990



to top

>ref|NM_129559.2| Arabidopsis thaliana structural constituent of ribosome AT2G40010
           mRNA, complete cds
          Length = 1153

 Score =  137 bits (69), Expect = 5e-29
 Identities = 237/293 (80%)
 Strand = Plus / Plus

                                                                       
Query: 206 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 265
           |||||||| ||||||||| | ||||| ||  | || ||||| || |||||||||||||| 
Sbjct: 274 atcttcactaagggtgacttgaaggaagtcagtgaagaggttgctaagtacaaggttgga 333

                                                                       
Query: 266 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 325
           |||||||||||||| ||  |||| || ||  |||||||||| || |  || |||||||||
Sbjct: 334 gctcctgctcgtgtaggtttagtcgctccaattgatgtggtcgtgcaaccaggcaacact 393

                                                                       
Query: 326 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 385
           ||||| || || || ||||| |||||||||||||||||||||||||| ||||| || |||
Sbjct: 394 ggtcttgacccttcacagacctccttcttccaggtgcttaacattccaaccaaaatcaac 453

                                                                       
Query: 386 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 445
           || ||||| || || || |  | ||| |||||||| |||||||| || ||||| || || 
Sbjct: 454 aaaggtacggttgagatcataacccctgtggagctcatcaagaaaggcgacaaagtcggt 513

                                                                
Query: 446 tcctctgagtctgccctgcttgccaagcttggtatccgccccttctcatatgg 498
           || || ||| |||| || |||||||||||||| ||| | ||||| || |||||
Sbjct: 514 tcatccgaggctgcgcttcttgccaagcttggaatcaggcccttttcgtatgg 566



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 626 atctcataccccaccatggctgctgcaccgcacatgttcctcaatgcatacaagaatgtt 685
           ||||| ||||| ||| | || ||||| || ||||||||||||||||| |||||||| |||
Sbjct: 694 atctcttacccaaccgtagcagctgcgcctcacatgttcctcaatgcttacaagaacgtt 753

                
Query: 686 cttgc 690
           |||||
Sbjct: 754 cttgc 758



to top

>gb|AY070448.1| Arabidopsis thaliana At2g40010 mRNA sequence
          Length = 1373

 Score =  137 bits (69), Expect = 5e-29
 Identities = 237/293 (80%)
 Strand = Plus / Plus

                                                                       
Query: 206 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 265
           |||||||| ||||||||| | ||||| ||  | || ||||| || |||||||||||||| 
Sbjct: 478 atcttcactaagggtgacttgaaggaagtcagtgaagaggttgctaagtacaaggttgga 537

                                                                       
Query: 266 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 325
           |||||||||||||| ||  |||| || ||  |||||||||| || |  || |||||||||
Sbjct: 538 gctcctgctcgtgtaggtttagtcgctccaattgatgtggtcgtgcaaccaggcaacact 597

                                                                       
Query: 326 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 385
           ||||| || || || ||||| |||||||||||||||||||||||||| ||||| || |||
Sbjct: 598 ggtcttgacccttcacagacctccttcttccaggtgcttaacattccaaccaaaatcaac 657

                                                                       
Query: 386 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 445
           || ||||| || || || |  | ||| |||||||| |||||||| || ||||| || || 
Sbjct: 658 aaaggtacggttgagatcataacccctgtggagctcatcaagaaaggcgacaaagtcggt 717

                                                                
Query: 446 tcctctgagtctgccctgcttgccaagcttggtatccgccccttctcatatgg 498
           || || ||| |||| || |||||||||||||| ||| | ||||| || |||||
Sbjct: 718 tcatccgaggctgcgcttcttgccaagcttggaatcaggcccttttcgtatgg 770



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 626 atctcataccccaccatggctgctgcaccgcacatgttcctcaatgcatacaagaatgtt 685
           ||||| ||||| ||| | || ||||| || ||||||||||||||||| |||||||| |||
Sbjct: 898 atctcttacccaaccgtagcagctgcgcctcacatgttcctcaatgcttacaagaacgtt 957

                
Query: 686 cttgc 690
           |||||
Sbjct: 958 cttgc 962



to top

>emb|BX819391.1|CNS0A9W8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB74ZC11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 961

 Score =  137 bits (69), Expect = 5e-29
 Identities = 237/293 (80%)
 Strand = Plus / Plus

                                                                       
Query: 206 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 265
           |||||||| ||||||||| | ||||| ||  | || ||||| || |||||||||||||| 
Sbjct: 130 atcttcactaagggtgacttgaaggaagtcagtgaagaggttgctaagtacaaggttgga 189

                                                                       
Query: 266 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 325
           |||||||||||||| ||  |||| || ||  |||||||||| || |  || |||||||||
Sbjct: 190 gctcctgctcgtgtaggtttagtcgctccaattgatgtggtcgtgcaaccaggcaacact 249

                                                                       
Query: 326 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 385
           ||||| || || || ||||| |||||||||||||||||||||||||| ||||| || |||
Sbjct: 250 ggtcttgacccttcacagacctccttcttccaggtgcttaacattccaaccaaaatcaac 309

                                                                       
Query: 386 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 445
           || ||||| || || || |  | ||| |||||||| |||||||| || ||||| || || 
Sbjct: 310 aaaggtacggttgagatcataacccctgtggagctcatcaagaaaggcgacaaagtcggt 369

                                                                
Query: 446 tcctctgagtctgccctgcttgccaagcttggtatccgccccttctcatatgg 498
           || || ||| |||| || |||||||||||||| ||| | ||||| || |||||
Sbjct: 370 tcatccgaggctgcgcttcttgccaagcttggaatcaggcccttttcgtatgg 422



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                             
Query: 657 acatgttcctcaatgcatacaagaatgttcttgc 690
           |||||||||||||||| |||||||| ||||||||
Sbjct: 581 acatgttcctcaatgcttacaagaacgttcttgc 614



to top

>gb|BT001919.1| Arabidopsis thaliana clone C105444 putative 60S acidic ribosomal
           protein P0 (At2g40010) mRNA, complete cds
          Length = 985

 Score =  137 bits (69), Expect = 5e-29
 Identities = 237/293 (80%)
 Strand = Plus / Plus

                                                                       
Query: 206 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 265
           |||||||| ||||||||| | ||||| ||  | || ||||| || |||||||||||||| 
Sbjct: 274 atcttcactaagggtgacttgaaggaagtcagtgaagaggttgctaagtacaaggttgga 333

                                                                       
Query: 266 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 325
           |||||||||||||| ||  |||| || ||  |||||||||| || |  || |||||||||
Sbjct: 334 gctcctgctcgtgtaggtttagtcgctccaattgatgtggtcgtgcaaccaggcaacact 393

                                                                       
Query: 326 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 385
           ||||| || || || ||||| |||||||||||||||||||||||||| ||||| || |||
Sbjct: 394 ggtcttgacccttcacagacctccttcttccaggtgcttaacattccaaccaaaatcaac 453

                                                                       
Query: 386 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 445
           || ||||| || || || |  | ||| |||||||| |||||||| || ||||| || || 
Sbjct: 454 aaaggtacggttgagatcataacccctgtggagctcatcaagaaaggcgacaaagtcggt 513

                                                                
Query: 446 tcctctgagtctgccctgcttgccaagcttggtatccgccccttctcatatgg 498
           || || ||| |||| || |||||||||||||| ||| | ||||| || |||||
Sbjct: 514 tcatccgaggctgcgcttcttgccaagcttggaatcaggcccttttcgtatgg 566



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 626 atctcataccccaccatggctgctgcaccgcacatgttcctcaatgcatacaagaatgtt 685
           ||||| ||||| ||| | || ||||| || ||||||||||||||||| |||||||| |||
Sbjct: 694 atctcttacccaaccgtagcagctgcgcctcacatgttcctcaatgcttacaagaacgtt 753

                
Query: 686 cttgc 690
           |||||
Sbjct: 754 cttgc 758



to top

>gb|AC073395.6|AC073395 Arabidopsis thaliana chromosome 3 BAC F11B9 genomic sequence, complete
             sequence
          Length = 103517

 Score =  121 bits (61), Expect = 3e-24
 Identities = 106/121 (87%)
 Strand = Plus / Plus

                                                                         
Query: 357   aggtgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcccagtgg 416
             ||||||||||||||||||| |||||||||||||||||||| ||||||| || ||| ||||
Sbjct: 59343 aggtgcttaacattcccactaagattaacaagggtactgttgaaattatcacccctgtgg 59402

                                                                         
Query: 417   agctgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgccaagcttg 476
             |||| |||||| | ||||||||||| || || |||||| ||||||| || || |||||||
Sbjct: 59403 agcttatcaagcaaggtgacaaggttgggtcttctgaggctgcccttctagctaagcttg 59462

              
Query: 477   g 477
             |
Sbjct: 59463 g 59463



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 87/103 (84%)
 Strand = Plus / Plus

                                                                         
Query: 258   aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 317
             ||||||| |||||||||||||| ||  ||||||| ||| |||||||||| ||||  ||||
Sbjct: 59147 aggttggtgctcctgctcgtgtgggtttagttgctcctattgatgtggttgttcaacctg 59206

                                                        
Query: 318   gcaacactggtctggatccctcccagacgtccttcttccaggt 360
             ||||||||||||| || || || || || || |||||||||||
Sbjct: 59207 gcaacactggtcttgacccatctcaaacatcgttcttccaggt 59249



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                  
Query: 647   gctgcaccgcacatgttcctcaatgcatacaagaatg 683
             ||||||||||| |||||| ||||||| ||||||||||
Sbjct: 59633 gctgcaccgcatatgttcatcaatgcctacaagaatg 59669



to top

>gb|AF002109.3| Arabidopsis thaliana chromosome 2 clone T28M21 map CIC10A06, complete
             sequence
          Length = 108847

 Score =  113 bits (57), Expect = 8e-22
 Identities = 195/241 (80%)
 Strand = Plus / Minus

                                                                         
Query: 258   aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 317
             ||||||| |||||||||||||| ||  |||| || ||  |||||||||| || |  || |
Sbjct: 77949 aggttggagctcctgctcgtgtaggtttagtcgctccaattgatgtggtcgtgcaaccag 77890

                                                                         
Query: 318   gcaacactggtctggatccctcccagacgtccttcttccaggtgcttaacattcccacca 377
             ||||||||||||| || || || ||||| |||||||||||||||||||||||||| ||||
Sbjct: 77889 gcaacactggtcttgacccttcacagacctccttcttccaggtgcttaacattccaacca 77830

                                                                         
Query: 378   agattaacaagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgaca 437
             | || ||||| ||||| || || || |  | ||| |||||||| |||||||| || ||||
Sbjct: 77829 aaatcaacaaaggtacggttgagatcataacccctgtggagctcatcaagaaaggcgaca 77770

                                                                         
Query: 438   aggtgggctcctctgagtctgccctgcttgccaagcttggtatccgccccttctcatatg 497
             | || || || || ||| |||| || |||||||||||||| ||| | ||||| || ||||
Sbjct: 77769 aagtcggttcatccgaggctgcgcttcttgccaagcttggaatcaggcccttttcgtatg 77710

              
Query: 498   g 498
             |
Sbjct: 77709 g 77709



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                         
Query: 626   atctcataccccaccatggctgctgcaccgcacatgttcctcaatgcatacaagaatgtt 685
             ||||| ||||| ||| | || ||||| || ||||||||||||||||| |||||||| |||
Sbjct: 77581 atctcttacccaaccgtagcagctgcgcctcacatgttcctcaatgcttacaagaacgtt 77522

                  
Query: 686   cttgc 690
             |||||
Sbjct: 77521 cttgc 77517



to top

>gb|AC130799.19| Medicago truncatula clone mth2-34b13, complete sequence
          Length = 133305

 Score =  109 bits (55), Expect = 1e-20
 Identities = 172/211 (81%)
 Strand = Plus / Minus

                                                                          
Query: 357    aggtgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcccagtgg 416
              ||||||| ||||| || ||||||||||||||||||||||||||||| |  | ||||||||
Sbjct: 104236 aggtgctcaacatcccaaccaagattaacaagggtactgtggaaatcattaccccagtgg 104177

                                                                          
Query: 417    agctgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgccaagcttg 476
              | ||||| ||||| || |||||||| || || |||||  ||||  ||||||||||| | |
Sbjct: 104176 aactgattaagaaaggagacaaggttggatcttctgaagctgcattgcttgccaagttag 104117

                                                                          
Query: 477    gtatccgccccttctcatatggactggtcatctgcaatgtctatgacagtgggtcagtct 536
              ||||  | ||||| |||||||| || ||  ||     ||| ||||||| ||| ||||| |
Sbjct: 104116 gtattaggcccttttcatatgggcttgtggtcctttctgtttatgacaatggttcagtgt 104057

                                             
Query: 537    tcagccccgaggttcttgacctcactgagga 567
              | ||||| |||||||||||||||||||||||
Sbjct: 104056 ttagccctgaggttcttgacctcactgagga 104026



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 83/103 (80%)
 Strand = Plus / Minus

                                                                          
Query: 258    aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 317
              ||||||| |||||||| ||||||||  | ||||| ||  ||||||| || ||||| || |
Sbjct: 104410 aggttggagctcctgcccgtgttggtttggttgctccaattgatgtcgttgttcctccag 104351

                                                         
Query: 318    gcaacactggtctggatccctcccagacgtccttcttccaggt 360
              ||||||| || || || || || ||||| || |||||||||||
Sbjct: 104350 gcaacacagggctcgacccatctcagacctctttcttccaggt 104308



to top

>ref|XM_479932.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 451

 Score =  103 bits (52), Expect = 8e-19
 Identities = 88/100 (88%)
 Strand = Plus / Plus

                                                                       
Query: 591 ctggtgtttccatggttgcctcactgtccctggcgatctcataccccaccatggctgctg 650
           |||||||||| |||||||||||| | |||||||| ||||| ||||| || || |||||||
Sbjct: 1   ctggtgtttctatggttgcctcagtctccctggcaatctcgtacccaactattgctgctg 60

                                                   
Query: 651 caccgcacatgttcctcaatgcatacaagaatgttcttgc 690
           |||| ||||||||||||||||  ||||||||||| |||||
Sbjct: 61  caccacacatgttcctcaatgggtacaagaatgtgcttgc 100



to top

>emb|BX816288.1|CNS0AE9F Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTPGH39ZH02 of Hormone Treated Callus of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1296

 Score =  103 bits (52), Expect = 8e-19
 Identities = 178/220 (80%)
 Strand = Plus / Minus

                                                                        
Query: 258  aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 317
            ||||||| |||||||||||||| ||  |||| || ||  |||||||||| || |  || |
Sbjct: 1148 aggttggagctcctgctcgtgtaggtttagtcgctccaattgatgtggtcgtgcaaccag 1089

                                                                        
Query: 318  gcaacactggtctggatccctcccagacgtccttcttccaggtgcttaacattcccacca 377
            ||||||||||||| || || || ||||| |||||||||||||||||||||||||| ||||
Sbjct: 1088 gcaacactggtcttgacccttcacagacctccttcttccaggtgcttaacattccaacca 1029

                                                                        
Query: 378  agattaacaagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgaca 437
            | || ||||| ||||| || || || |  | ||| || ||||| |||||||| || ||||
Sbjct: 1028 aaatcaacaaaggtacggttgagatcataacccctgtagagctcatcaagaaaggcgaca 969

                                                    
Query: 438  aggtgggctcctctgagtctgccctgcttgccaagcttgg 477
            | || || || || ||| |||| || ||||||||||||||
Sbjct: 968  aagtcggttcatccgaggctgcgcttcttgccaagcttgg 929



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                       
Query: 626 atctcataccccaccatggctgctgcaccgcacatgttcctcaatgcatacaagaatgtt 685
           ||||| ||||| ||| | || ||||| || ||||||||||||||||| |||||||| |||
Sbjct: 780 atctcttacccaaccgtagcagctgcgcctcacatgttcctcaatgcttacaagaacgtt 721

                
Query: 686 cttgc 690
           |||||
Sbjct: 720 cttgc 716



to top

>dbj|AK062008.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-043-E02, full
           insert sequence
          Length = 451

 Score =  103 bits (52), Expect = 8e-19
 Identities = 88/100 (88%)
 Strand = Plus / Plus

                                                                       
Query: 591 ctggtgtttccatggttgcctcactgtccctggcgatctcataccccaccatggctgctg 650
           |||||||||| |||||||||||| | |||||||| ||||| ||||| || || |||||||
Sbjct: 1   ctggtgtttctatggttgcctcagtctccctggcaatctcgtacccaactattgctgctg 60

                                                   
Query: 651 caccgcacatgttcctcaatgcatacaagaatgttcttgc 690
           |||| ||||||||||||||||  ||||||||||| |||||
Sbjct: 61  caccacacatgttcctcaatgggtacaagaatgtgcttgc 100



to top

>gb|DQ306774.1| Hevea brasiliensis isolate SSH45 mRNA sequence
          Length = 308

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 132/167 (79%)
 Strand = Plus / Plus

                                                                       
Query: 518 tatgacagtgggtcagtcttcagccccgaggttcttgacctcactgaggaagatctgatg 577
           ||||||| ||| || || |||||||| ||||| ||||| || ||||| || |||||  | 
Sbjct: 83  tatgacaatggctctgtattcagcccagaggtgcttgatctgactgaagatgatcttgtt 142

                                                                       
Query: 578 gacaagtttgcttctggtgtttccatggttgcctcactgtccctggcgatctcatacccc 637
           || ||||||||  ||||||| ||||||||  | ||| |  |  |||| || |||||||| 
Sbjct: 143 gagaagtttgcaactggtgtctccatggtcacttcattagcattggccatatcataccca 202

                                                          
Query: 638 accatggctgctgcaccgcacatgttcctcaatgcatacaagaatgt 684
           ||  |||| |||||||| ||||||||| | ||||| |||||||||||
Sbjct: 203 actctggcagctgcaccacacatgttcgttaatgcctacaagaatgt 249



to top

>gb|DQ306752.1| Hevea brasiliensis isolate SSH23 mRNA sequence
          Length = 308

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 132/167 (79%)
 Strand = Plus / Plus

                                                                       
Query: 518 tatgacagtgggtcagtcttcagccccgaggttcttgacctcactgaggaagatctgatg 577
           ||||||| ||| || || |||||||| ||||| ||||| || ||||| || |||||  | 
Sbjct: 83  tatgacaatggctctgtattcagcccagaggtgcttgatctgactgaagatgatcttgtt 142

                                                                       
Query: 578 gacaagtttgcttctggtgtttccatggttgcctcactgtccctggcgatctcatacccc 637
           || ||||||||  ||||||| ||||||||  | ||| |  |  |||| || |||||||| 
Sbjct: 143 gagaagtttgcaactggtgtctccatggtcacttcattagcattggccatatcataccca 202

                                                          
Query: 638 accatggctgctgcaccgcacatgttcctcaatgcatacaagaatgt 684
           ||  |||| |||||||| ||||||||| | ||||| |||||||||||
Sbjct: 203 actctggcagctgcaccacacatgttcgttaatgcctacaagaatgt 249



to top

>gb|CP000079.1| Leishmania major strain Friedlin chromosome 27, complete sequence
          Length = 1130447

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                    
Query: 339    cccagacgtccttcttccaggtgcttaacattcccaccaagattaacaagggta 392
              ||||||||||||||||||||| ||| |||||| | || ||||||  ||||||||
Sbjct: 580972 cccagacgtccttcttccaggcgctgaacattgcgacgaagattgccaagggta 581025



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                    
Query: 339    cccagacgtccttcttccaggtgcttaacattcccaccaagattaacaagggta 392
              ||||||||||||||||||||| ||| |||||| | || ||||||  ||||||||
Sbjct: 578573 cccagacgtccttcttccaggcgctgaacattgcgacgaagattgccaagggta 578626



to top

>gb|AY702006.1| Leishmania donovani strain MHOM/IN/1983/AG83 60S ribosomal protein
           mRNA, partial cds
          Length = 1147

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 339 cccagacgtccttcttccaggtgcttaacattcccaccaagattaacaagggta 392
           ||||||||||||||||||||| ||| |||||| | || ||||||  ||||||||
Sbjct: 397 cccagacgtccttcttccaggcgctgaacattgcgacgaagattgccaagggta 450



to top

>ref|XM_843003.1| Leishmania major strain Friedlin 60S acidic ribosomal subunit
           protein (LMJ_0399) partial mRNA
          Length = 972

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 339 cccagacgtccttcttccaggtgcttaacattcccaccaagattaacaagggta 392
           ||||||||||||||||||||| ||| |||||| | || ||||||  ||||||||
Sbjct: 419 cccagacgtccttcttccaggcgctgaacattgcgacgaagattgccaagggta 472



to top

>ref|XM_843004.1| Leishmania major strain Friedlin 60S acidic ribosomal subunit
           protein (LMJ_0400) partial mRNA
          Length = 972

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 339 cccagacgtccttcttccaggtgcttaacattcccaccaagattaacaagggta 392
           ||||||||||||||||||||| ||| |||||| | || ||||||  ||||||||
Sbjct: 419 cccagacgtccttcttccaggcgctgaacattgcgacgaagattgccaagggta 472



to top

>emb|X72714.1|LILIPOA L. infantum LiPO-A and LiPO-B gene
          Length = 3790

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                  
Query: 339  cccagacgtccttcttccaggtgcttaacattcccaccaagattaacaagggta 392
            ||||||||||||||||||||| ||| |||||| | || ||||||  ||||||||
Sbjct: 3032 cccagacgtccttcttccaggcgctgaacattgcgacgaagattgccaagggta 3085



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 339 cccagacgtccttcttccaggtgcttaacattcccaccaagattaacaagggta 392
           ||||||||||||||||||||| ||| |||||| | || ||||||  ||||||||
Sbjct: 663 cccagacgtccttcttccaggcgctgaacattgcgacgaagattgccaagggta 716



to top

>gb|AY180912.1| Leishmania donovani ribosomal protein P0-like mRNA, complete
           sequence
          Length = 1664

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 339 cccagacgtccttcttccaggtgcttaacattcccaccaagattaacaagggta 392
           ||||||||||||||||||||| ||| |||||| | || ||||||  ||||||||
Sbjct: 452 cccagacgtccttcttccaggcgctgaacattgcgacgaagattgccaagggta 505



to top

>gb|AY880417.1| Gekko japonicus GekBS186P mRNA, complete cds
          Length = 1118

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 71/86 (82%)
 Strand = Plus / Plus

                                                                       
Query: 32  gacaatgtcggctccaagcagctccaggagatccgcaagggtctccgcggtgactccatc 91
           |||||||| |||||||||||| | ||| ||||||||| |  |||||||||  |  || | 
Sbjct: 147 gacaatgtgggctccaagcagatgcagcagatccgcatgtctctccgcgggaaagccgtg 206

                                     
Query: 92  gtgctcatgggcaagaacaccctgat 117
           ||||| ||||||||||||||| ||||
Sbjct: 207 gtgctgatgggcaagaacaccatgat 232



to top

>gb|L29300.1|LEIRIBPP Leishmania chagasi (clone C1) ribosomal protein P0 gene, complete
           cds
          Length = 1373

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 339 cccagacgtccttcttccaggtgcttaacattcccaccaagattaacaagggta 392
           ||||||||||||||||||||| ||| |||||| | || ||||||  ||||||||
Sbjct: 496 cccagacgtccttcttccaggcgctgaacattgcgacgaagattgccaagggta 549



to top

>emb|AJ783861.1| Carabus granulatus partial mRNA for acidic p0 ribosomal protein
           (rpp0 gene)
          Length = 608

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 89  atcgtgctcatgggcaagaacaccctgat 117
           |||||||||||||||||||||||| ||||
Sbjct: 154 atcgtgctcatgggcaagaacaccatgat 182



to top

>gb|AF401551.1| Ictalurus punctatus ribosomal protein P0 mRNA, complete cds
          Length = 1081

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 89  atcgtgctcatgggcaagaacaccctgat 117
           |||||||||||||||||||||||| ||||
Sbjct: 227 atcgtgctcatgggcaagaacaccatgat 255



to top

>dbj|AB113109.1| Aotus trivirgatus Aotr-B1 gene for MHC class I antigen, partial cds
            and promoter region
          Length = 3861

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                 
Query: 32   gacaatgtcggctccaagcagctccaggagatccgca 68
            |||||||| |||||||||||| | |||||||||||||
Sbjct: 1649 gacaatgtgggctccaagcagatgcaggagatccgca 1685



to top

>gb|AC164402.3| Mus musculus chromosome 15, clone RP23-463G20, complete sequence
          Length = 196916

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 575   atggacaagtttgcttctggtgtttcca 602
             ||||||||| ||||||||||||||||||
Sbjct: 96023 atggacaagcttgcttctggtgtttcca 95996



to top

>ref|XM_787003.1| PREDICTED: Strongylocentrotus purpuratus similar to acidic
           ribosomal phosphoprotein P0 (LOC587264), mRNA
          Length = 533

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 90  tcgtgctcatgggcaagaacaccctgatccgc 121
           |||| |||||||||||||||||| ||||||||
Sbjct: 196 tcgtcctcatgggcaagaacaccatgatccgc 227



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 32  gacaatgtcggctccaagcag 52
           |||||||||||||||||||||
Sbjct: 138 gacaatgtcggctccaagcag 158



to top

>emb|BX032675.1|CNS08XDJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA48CH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 960

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 74  ctccgcggtgactccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||  | |||||||||| ||||||||||||||| ||||
Sbjct: 208 ctccgcggttccgccatcgtgctgatgggcaagaacaccatgat 251



to top

>emb|BX019003.1|CNS08MTR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA28DD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 87  ccatcgtgctcatgggcaagaacaccctgatccgcc 122
           |||||||||| ||||||||||||||| |||| ||||
Sbjct: 236 ccatcgtgctgatgggcaagaacaccatgatgcgcc 271



to top

>emb|BX018793.1|CNS08MNX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA28CB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 941

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 74  ctccgcggtgactccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||  | |||||||||| ||||||||||||||| ||||
Sbjct: 208 ctccgcggttccgccatcgtgctgatgggcaagaacaccatgat 251



to top

>emb|BX013777.1|CNS08ISL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA20CH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 598

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 74  ctccgcggtgactccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||  | |||||||||| ||||||||||||||| ||||
Sbjct: 211 ctccgcggttccgccatcgtgctgatgggcaagaacaccatgat 254



to top

>emb|BX006032.1|CNS08CTG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA10BB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 909

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 74  ctccgcggtgactccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||  | |||||||||| ||||||||||||||| ||||
Sbjct: 200 ctccgcggttccgccatcgtgctgatgggcaagaacaccatgat 243



to top

>emb|BX005998.1|CNS08CSI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA10AH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 994

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 74  ctccgcggtgactccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||  | |||||||||| ||||||||||||||| ||||
Sbjct: 214 ctccgcggttccgccatcgtgctgatgggcaagaacaccatgat 257



to top

>ref|XM_789716.1| PREDICTED: Strongylocentrotus purpuratus similar to acidic
           ribosomal phosphoprotein P0 (LOC590099), mRNA
          Length = 198

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 90  tcgtgctcatgggcaagaacaccctgatccgc 121
           |||| |||||||||||||||||| ||||||||
Sbjct: 119 tcgtcctcatgggcaagaacaccatgatccgc 150



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 32 gacaatgtcggctccaagcag 52
          |||||||||||||||||||||
Sbjct: 61 gacaatgtcggctccaagcag 81



to top

>gb|AC106843.11| Mus musculus chromosome 15, clone RP24-151M4, complete sequence
          Length = 179117

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 575    atggacaagtttgcttctggtgtttcca 602
              ||||||||| ||||||||||||||||||
Sbjct: 142519 atggacaagcttgcttctggtgtttcca 142546



to top

>ref|XM_655246.1| Aspergillus nidulans FGSC A4 60S acidic ribosomal protein P0
           (AN2734.2), mRNA
          Length = 939

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 194 aacgttggcctcatcttcaccaagggtgacctcaaggag 232
           ||||||||  ||||||||||||| || ||||||||||||
Sbjct: 247 aacgttggtttcatcttcaccaacggcgacctcaaggag 285



to top

>emb|BX053469.1|CNS09DF5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 999

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 229 ccatcgtgctgatgggcaagaacaccatgat 259



to top

>emb|BX072148.1|CNS09RU0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 812

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 174 ccatcgtgctgatgggcaagaacaccatgat 204



to top

>emb|BX072146.1|CNS09RTY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 236 ccatcgtgctgatgggcaagaacaccatgat 266



to top

>emb|BX072055.1|CNS09RRF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 228 ccatcgtgctgatgggcaagaacaccatgat 258



to top

>emb|BX072031.1|CNS09RQR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 784

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 211 ccatcgtgctgatgggcaagaacaccatgat 241



to top

>emb|BX071993.1|CNS09RPP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 959

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 246 ccatcgtgctgatgggcaagaacaccatgat 276



to top

>emb|BX071847.1|CNS09RLN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9CB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1068

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 233 ccatcgtgctgatgggcaagaacaccatgat 263



to top

>emb|BX071747.1|CNS09RIV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9BF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 950

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 229 ccatcgtgctgatgggcaagaacaccatgat 259



to top

>emb|BX071518.1|CNS09RCI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9AD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 290

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 91  ccatcgtgctgatgggcaagaacaccatgat 121



to top

>emb|BX071226.1|CNS09R4E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8CF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 899

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 224 ccatcgtgctgatgggcaagaacaccatgat 254



to top

>emb|BX071175.1|CNS09R2Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8CD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 955

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 211 ccatcgtgctgatgggcaagaacaccatgat 241



to top

>emb|BX071445.1|CNS09RAH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9AA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1033

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 237 ccatcgtgctgatgggcaagaacaccatgat 267



to top

>emb|BX071386.1|CNS09R8U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8DF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 809

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 206 ccatcgtgctgatgggcaagaacaccatgat 236



to top

>emb|BX071318.1|CNS09R6Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8DC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 864

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 224 ccatcgtgctgatgggcaagaacaccatgat 254



to top

>emb|BX071251.1|CNS09R53 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8CH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 515

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX071039.1|CNS09QZ7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 221 ccatcgtgctgatgggcaagaacaccatgat 251



to top

>emb|BX070973.1|CNS09QXD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 960

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 235 ccatcgtgctgatgggcaagaacaccatgat 265



to top

>emb|BX070930.1|CNS09QW6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1029

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 228 ccatcgtgctgatgggcaagaacaccatgat 258



to top

>emb|BX070900.1|CNS09QVC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8AH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1014

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 233 ccatcgtgctgatgggcaagaacaccatgat 263



to top

>emb|BX070894.1|CNS09QV6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8AH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 538

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 55  ccatcgtgctgatgggcaagaacaccatgat 85



to top

>emb|BX070751.1|CNS09QR7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8AA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 980

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 225 ccatcgtgctgatgggcaagaacaccatgat 255



to top

>emb|BX070745.1|CNS09QR1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 837

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 102 ccatcgtgctgatgggcaagaacaccatgat 132



to top

>emb|BX070622.1|CNS09QNM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7DB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 966

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 223 ccatcgtgctgatgggcaagaacaccatgat 253



to top

>emb|BX070589.1|CNS09QMP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7DA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 215 ccatcgtgctgatgggcaagaacaccatgat 245



to top

>emb|BX070541.1|CNS09QLD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7CG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 898

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 228 ccatcgtgctgatgggcaagaacaccatgat 258



to top

>emb|BX070099.1|CNS09Q93 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7AB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 230 ccatcgtgctgatgggcaagaacaccatgat 260



to top

>emb|BX069823.1|CNS09Q1F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6CE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 916

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 230 ccatcgtgctgatgggcaagaacaccatgat 260



to top

>emb|BX069791.1|CNS09Q0J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6CD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 775

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257



to top

>emb|BX061098.1|CNS09JB2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41DA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 951

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 220 ccatcgtgctgatgggcaagaacaccatgat 250



to top

>emb|BX061090.1|CNS09JAU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41CH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 230 ccatcgtgctgatgggcaagaacaccatgat 260



to top

>emb|BX061061.1|CNS09JA1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41CG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1063

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 247 ccatcgtgctgatgggcaagaacaccatgat 277



to top

>emb|BX061042.1|CNS09J9I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41CF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 377

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 228 ccatcgtgctgatgggcaagaacaccatgat 258



to top

>emb|BX069588.1|CNS09PUW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6BC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 834

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257



to top

>emb|BX069403.1|CNS09PPR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6AC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 224 ccatcgtgctgatgggcaagaacaccatgat 254



to top

>emb|BX069336.1|CNS09PNW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53DH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 219 ccatcgtgctgatgggcaagaacaccatgat 249



to top

>emb|BX069235.1|CNS09PL3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 668

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 241 ccatcgtgctgatgggcaagaacaccatgat 271



to top

>emb|BX069142.1|CNS09PII Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 229 ccatcgtgctgatgggcaagaacaccatgat 259



to top

>emb|BX069126.1|CNS09PI2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 455

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 223 ccatcgtgctgatgggcaagaacaccatgat 253



to top

>emb|BX068988.1|CNS09PE8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53BH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 999

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 233 ccatcgtgctgatgggcaagaacaccatgat 263



to top

>emb|BX068833.1|CNS09P9X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53BA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1037

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 253 ccatcgtgctgatgggcaagaacaccatgat 283



to top

>emb|BX068815.1|CNS09P9F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53AH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 234 ccatcgtgctgatgggcaagaacaccatgat 264



to top

>emb|BX068760.1|CNS09P7W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53AF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 753

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 245 ccatcgtgctgatgggcaagaacaccatgat 275



to top

>emb|BX068607.1|CNS09P3N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52DG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 767

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 224 ccatcgtgctgatgggcaagaacaccatgat 254



to top

>emb|BX068471.1|CNS09OZV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52DA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1059

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 223 ccatcgtgctgatgggcaagaacaccatgat 253



to top

>emb|BX068229.1|CNS09OT5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52BD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 882

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 226 ccatcgtgctgatgggcaagaacaccatgat 256



to top

>emb|BX068019.1|CNS09ONB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52AB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 969

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 231 ccatcgtgctgatgggcaagaacaccatgat 261



to top

>emb|BX067891.1|CNS09OJR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51DB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 374

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 52  ccatcgtgctgatgggcaagaacaccatgat 82



to top

>emb|BX067841.1|CNS09OID Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 690

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257



to top

>emb|BX067819.1|CNS09OHR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 335

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 206 ccatcgtgctgatgggcaagaacaccatgat 236



to top

>emb|BX067775.1|CNS09OGJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1021

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 235 ccatcgtgctgatgggcaagaacaccatgat 265



to top

>emb|BX067752.1|CNS09OFW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 986

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 234 ccatcgtgctgatgggcaagaacaccatgat 264



to top

>emb|BX067707.1|CNS09OEN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1014

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 233 ccatcgtgctgatgggcaagaacaccatgat 263



to top

>emb|BX067564.1|CNS09OAO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 340

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 149 ccatcgtgctgatgggcaagaacaccatgat 179



to top

>emb|BX067487.1|CNS09O8J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51AG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 722

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 221 ccatcgtgctgatgggcaagaacaccatgat 251



to top

>emb|BX067429.1|CNS09O6X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51AE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 642

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX066992.1|CNS09NUS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50CA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 847

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 204 ccatcgtgctgatgggcaagaacaccatgat 234



to top

>emb|BX067216.1|CNS09O10 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50DC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 947

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 226 ccatcgtgctgatgggcaagaacaccatgat 256



to top

>emb|BX067179.1|CNS09NZZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50DA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1008

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257



to top

>emb|BX066854.1|CNS09NQY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1054

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 240 ccatcgtgctgatgggcaagaacaccatgat 270



to top

>emb|BX066645.1|CNS09NL5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50AB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 349

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 203 ccatcgtgctgatgggcaagaacaccatgat 233



to top

>emb|BX066623.1|CNS09NKJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50AA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 731

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 222 ccatcgtgctgatgggcaagaacaccatgat 252



to top

>emb|BX066597.1|CNS09NJT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5DH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 998

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 238 ccatcgtgctgatgggcaagaacaccatgat 268



to top

>emb|BX066426.1|CNS09NF2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5DA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 999

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 206 ccatcgtgctgatgggcaagaacaccatgat 236



to top

>emb|BX066412.1|CNS09NEO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5CH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 814

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257



to top

>emb|BX066390.1|CNS09NE2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5CG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 540

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 218 ccatcgtgctgatgggcaagaacaccatgat 248



to top

>emb|BX066329.1|CNS09NCD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5CD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 851

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 207 ccatcgtgctgatgggcaagaacaccatgat 237



to top

>emb|BX065816.1|CNS09MY4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49DD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 764

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 235 ccatcgtgctgatgggcaagaacaccatgat 265



to top

>emb|BX065714.1|CNS09MVA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49CH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 884

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 850 ccatcgtgctgatgggcaagaacaccatgat 820



to top

>emb|BX065713.1|CNS09MV9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49CH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 843

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX065465.1|CNS09MOD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49BE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 201 ccatcgtgctgatgggcaagaacaccatgat 231



to top

>emb|BX065359.1|CNS09MLF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49AH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 500

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 220 ccatcgtgctgatgggcaagaacaccatgat 250



to top

>emb|BX065269.1|CNS09MIX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49AD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 693

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 171 ccatcgtgctgatgggcaagaacaccatgat 201



to top

>emb|BX065249.1|CNS09MID Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49AC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 944

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 226 ccatcgtgctgatgggcaagaacaccatgat 256



to top

>emb|BX065042.1|CNS09MCM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48DA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 740

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 104 ccatcgtgctgatgggcaagaacaccatgat 134



to top

>emb|BX065015.1|CNS09MBV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48CH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1057

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 223 ccatcgtgctgatgggcaagaacaccatgat 253



to top

>emb|BX065006.1|CNS09MBM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48CH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1009

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 771 ccatcgtgctgatgggcaagaacaccatgat 741



to top

>emb|BX065005.1|CNS09MBL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48CH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1002

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 311 ccatcgtgctgatgggcaagaacaccatgat 341



to top

>emb|BX064952.1|CNS09MA4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48CE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1073

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 226 ccatcgtgctgatgggcaagaacaccatgat 256



to top

>emb|BX064796.1|CNS09M5S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 304

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX064760.1|CNS09M4S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48BC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1031

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 224 ccatcgtgctgatgggcaagaacaccatgat 254



to top

>emb|BX064725.1|CNS09M3T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48BA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 225 ccatcgtgctgatgggcaagaacaccatgat 255



to top

>emb|BX064530.1|CNS09LYE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46DD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 467

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX064423.1|CNS09LVF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46CG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 380

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 247 ccatcgtgctgatgggcaagaacaccatgat 277



to top

>emb|BX064284.1|CNS09LRK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46CA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 987

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 231 ccatcgtgctgatgggcaagaacaccatgat 261



to top

>emb|BX064164.1|CNS09LO8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46BD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1042

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 224 ccatcgtgctgatgggcaagaacaccatgat 254



to top

>emb|BX064121.1|CNS09LN1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46BB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 790 ccatcgtgctgatgggcaagaacaccatgat 760



to top

>emb|BX064120.1|CNS09LN0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46BB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 989

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257



to top

>emb|BX064068.1|CNS09LLK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46AG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1029

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 247 ccatcgtgctgatgggcaagaacaccatgat 277



to top

>emb|BX063872.1|CNS09LG4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1059

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 223 ccatcgtgctgatgggcaagaacaccatgat 253



to top

>emb|BX063577.1|CNS09L7X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45CA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 439

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 92  ccatcgtgctgatgggcaagaacaccatgat 122



to top

>emb|BX063467.1|CNS09L4V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45BB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 884 ccatcgtgctgatgggcaagaacaccatgat 854



to top

>emb|BX063466.1|CNS09L4U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45BB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 856

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX063434.1|CNS09L3Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45AH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 198

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX063420.1|CNS09L3K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45AH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 881

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 235 ccatcgtgctgatgggcaagaacaccatgat 265



to top

>emb|BX063227.1|CNS09KY7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 980

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 234 ccatcgtgctgatgggcaagaacaccatgat 264



to top

>emb|BX062791.1|CNS09KM3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44BA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 199 ccatcgtgctgatgggcaagaacaccatgat 229



to top

>emb|BX062552.1|CNS09KFG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1039

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 216 ccatcgtgctgatgggcaagaacaccatgat 246



to top

>emb|BX062546.1|CNS09KFA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43DE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 764

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 103 ccatcgtgctgatgggcaagaacaccatgat 133



to top

>emb|BX062387.1|CNS09KAV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43CF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 945

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 174 ccatcgtgctgatgggcaagaacaccatgat 204



to top

>emb|BX062299.1|CNS09K8F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43CB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 982

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 176 ccatcgtgctgatgggcaagaacaccatgat 206



to top

>emb|BX062297.1|CNS09K8D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43CB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1032

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 223 ccatcgtgctgatgggcaagaacaccatgat 253



to top

>emb|BX062183.1|CNS09K57 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1052

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 225 ccatcgtgctgatgggcaagaacaccatgat 255



to top

>emb|BX062169.1|CNS09K4T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 689

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 214 ccatcgtgctgatgggcaagaacaccatgat 244



to top

>emb|BX062048.1|CNS09K1G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43AF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1012

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 205 ccatcgtgctgatgggcaagaacaccatgat 235



to top

>emb|BX061878.1|CNS09JWQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42DF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 209 ccatcgtgctgatgggcaagaacaccatgat 239



to top

>emb|BX061190.1|CNS09JDM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41DE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 993

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 224 ccatcgtgctgatgggcaagaacaccatgat 254



to top

>emb|BX061164.1|CNS09JCW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41DC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 858

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 785 ccatcgtgctgatgggcaagaacaccatgat 755



to top

>emb|BX061163.1|CNS09JCV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41DC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257



to top

>emb|BX061137.1|CNS09JC5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41DB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 226 ccatcgtgctgatgggcaagaacaccatgat 256



to top

>emb|BX061133.1|CNS09JC1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41DB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 221 ccatcgtgctgatgggcaagaacaccatgat 251



to top

>emb|BX060642.1|CNS09IYE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41AD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 947

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 172 ccatcgtgctgatgggcaagaacaccatgat 202



to top

>emb|BX060527.1|CNS09IV7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 997

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 218 ccatcgtgctgatgggcaagaacaccatgat 248



to top

>emb|BX060489.1|CNS09IU5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40DE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1036

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 786 ccatcgtgctgatgggcaagaacaccatgat 756



to top

>emb|BX060488.1|CNS09IU4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40DE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1032

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 326 ccatcgtgctgatgggcaagaacaccatgat 356



to top

>emb|BX060443.1|CNS09ISV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40DC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1047

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 235 ccatcgtgctgatgggcaagaacaccatgat 265



to top

>emb|BX060185.1|CNS09ILP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40BH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1050

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 216 ccatcgtgctgatgggcaagaacaccatgat 246



to top

>emb|BX059916.1|CNS09IE8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40AC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 510

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX059866.1|CNS09ICU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40AA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 705

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 215 ccatcgtgctgatgggcaagaacaccatgat 245



to top

>emb|BX059758.1|CNS09I9U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4DC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 229 ccatcgtgctgatgggcaagaacaccatgat 259



to top

>emb|BX059741.1|CNS09I9D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4DB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 239 ccatcgtgctgatgggcaagaacaccatgat 269



to top

>emb|BX059642.1|CNS09I6M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4CD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 430

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 202 ccatcgtgctgatgggcaagaacaccatgat 232



to top

>emb|BX059587.1|CNS09I53 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4CA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 237 ccatcgtgctgatgggcaagaacaccatgat 267



to top

>emb|BX059585.1|CNS09I51 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4CA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 804

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 152 ccatcgtgctgatgggcaagaacaccatgat 182



to top

>emb|BX059469.1|CNS09I1T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4BC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1020

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 238 ccatcgtgctgatgggcaagaacaccatgat 268



to top

>emb|BX059305.1|CNS09HX9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4AD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 817

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 108 ccatcgtgctgatgggcaagaacaccatgat 138



to top

>emb|BX059220.1|CNS09HUW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1011

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 224 ccatcgtgctgatgggcaagaacaccatgat 254



to top

>emb|BX059184.1|CNS09HTW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1045

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 218 ccatcgtgctgatgggcaagaacaccatgat 248



to top

>emb|BX059095.1|CNS09HRF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1007

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257



to top

>emb|BX058971.1|CNS09HNZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39CE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 678

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 205 ccatcgtgctgatgggcaagaacaccatgat 235



to top

>emb|BX058839.1|CNS09HKB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39BG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1035

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 229 ccatcgtgctgatgggcaagaacaccatgat 259



to top

>emb|BX058760.1|CNS09HI4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39BC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1026

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 206 ccatcgtgctgatgggcaagaacaccatgat 236



to top

>emb|BX058740.1|CNS09HHK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39BC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 817

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 214 ccatcgtgctgatgggcaagaacaccatgat 244



to top

>emb|BX058729.1|CNS09HH9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39BB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 207 ccatcgtgctgatgggcaagaacaccatgat 237



to top

>emb|BX058315.1|CNS09H5R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38CF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 557

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 217 ccatcgtgctgatgggcaagaacaccatgat 247



to top

>emb|BX058203.1|CNS09H2N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 956

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 235 ccatcgtgctgatgggcaagaacaccatgat 265



to top

>emb|BX056754.1|CNS09FYE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36BC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 898

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 171 ccatcgtgctgatgggcaagaacaccatgat 201



to top

>emb|BX057924.1|CNS09GUW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38AD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1054

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 239 ccatcgtgctgatgggcaagaacaccatgat 269



to top

>emb|BX057796.1|CNS09GRC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37DF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 541

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 226 ccatcgtgctgatgggcaagaacaccatgat 256



to top

>emb|BX057631.1|CNS09GMR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37CG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 415

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 88  ccatcgtgctgatgggcaagaacaccatgat 118



to top

>emb|BX057605.1|CNS09GM1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37CF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 480

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX057468.1|CNS09GI8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37BG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 159

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 87  ccatcgtgctgatgggcaagaacaccatgat 117



to top

>emb|BX057218.1|CNS09GBA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37AC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 826

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 243 ccatcgtgctgatgggcaagaacaccatgat 273



to top

>emb|BX057213.1|CNS09GB5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37AC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 455

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 228 ccatcgtgctgatgggcaagaacaccatgat 258



to top

>emb|BX057133.1|CNS09G8X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 780

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 234 ccatcgtgctgatgggcaagaacaccatgat 264



to top

>emb|BX057094.1|CNS09G7U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36DE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 287

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 231 ccatcgtgctgatgggcaagaacaccatgat 261



to top

>emb|BX057074.1|CNS09G7A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36DE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 457

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 202 ccatcgtgctgatgggcaagaacaccatgat 232



to top

>emb|BX056996.1|CNS09G54 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36DA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 699

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 235 ccatcgtgctgatgggcaagaacaccatgat 265



to top

>emb|BX056958.1|CNS09G42 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36CG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 738

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 229 ccatcgtgctgatgggcaagaacaccatgat 259



to top

>emb|BX056914.1|CNS09G2U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36CD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 609

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 236 ccatcgtgctgatgggcaagaacaccatgat 266



to top

>emb|BX056483.1|CNS09FQV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35DC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 671

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 162 ccatcgtgctgatgggcaagaacaccatgat 192



to top

>emb|BX055960.1|CNS09FCC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34DB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 496

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX055808.1|CNS09F84 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34CC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1041

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 246 ccatcgtgctgatgggcaagaacaccatgat 276



to top

>emb|BX056320.1|CNS09FMC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35CC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 694

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 209 ccatcgtgctgatgggcaagaacaccatgat 239



to top

>emb|BX056288.1|CNS09FLG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC35CA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 939

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 889 ccatcgtgctgatgggcaagaacaccatgat 859



to top

>emb|BX056287.1|CNS09FLF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35CA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 982

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 237 ccatcgtgctgatgggcaagaacaccatgat 267



to top

>emb|BX056283.1|CNS09FLB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35CA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 856

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 98  ccatcgtgctgatgggcaagaacaccatgat 128



to top

>emb|BX055999.1|CNS09FDF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34DE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 771

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 190 ccatcgtgctgatgggcaagaacaccatgat 220



to top

>emb|BX055725.1|CNS09F5T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 820

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 225 ccatcgtgctgatgggcaagaacaccatgat 255



to top

>emb|BX055721.1|CNS09F5P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34BH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 984

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 242 ccatcgtgctgatgggcaagaacaccatgat 272



to top

>emb|BX055621.1|CNS09F2X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 450

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 225 ccatcgtgctgatgggcaagaacaccatgat 255



to top

>emb|BX055603.1|CNS09F2F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34BB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 599

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 241 ccatcgtgctgatgggcaagaacaccatgat 271



to top

>emb|BX055567.1|CNS09F1F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34AH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 832

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 242 ccatcgtgctgatgggcaagaacaccatgat 272



to top

>emb|BX053214.1|CNS09D82 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30DB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 850

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 221 ccatcgtgctgatgggcaagaacaccatgat 251



to top

>emb|BX053185.1|CNS09D79 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30DA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 362

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX053146.1|CNS09D66 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30CF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 761

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX052948.1|CNS09D0O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30BD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 813

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 210 ccatcgtgctgatgggcaagaacaccatgat 240



to top

>emb|BX052946.1|CNS09D0M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30BD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 916

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 229 ccatcgtgctgatgggcaagaacaccatgat 259



to top

>emb|BX054654.1|CNS09EC2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32DF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 813

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 216 ccatcgtgctgatgggcaagaacaccatgat 246



to top

>emb|BX054435.1|CNS09E5Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32CD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 915

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257



to top

>emb|BX054345.1|CNS09E3H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32BH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 776

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 188 ccatcgtgctgatgggcaagaacaccatgat 218



to top

>emb|BX054246.1|CNS09E0Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32BC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 803

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 243 ccatcgtgctgatgggcaagaacaccatgat 273



to top

>emb|BX054186.1|CNS09DZ2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32BA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 969

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 236 ccatcgtgctgatgggcaagaacaccatgat 266



to top

>emb|BX054114.1|CNS09DX2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32AF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1020

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 230 ccatcgtgctgatgggcaagaacaccatgat 260



to top

>emb|BX054048.1|CNS09DV8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32AC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 956

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 238 ccatcgtgctgatgggcaagaacaccatgat 268



to top

>emb|BX053890.1|CNS09DQU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31DC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 963

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 800 ccatcgtgctgatgggcaagaacaccatgat 770



to top

>emb|BX053889.1|CNS09DQT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31DC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 800

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 282 ccatcgtgctgatgggcaagaacaccatgat 312



to top

>emb|BX053751.1|CNS09DMZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31CE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 881

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 248 ccatcgtgctgatgggcaagaacaccatgat 278



to top

>emb|BX053704.1|CNS09DLO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31CB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 989

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 241 ccatcgtgctgatgggcaagaacaccatgat 271



to top

>emb|BX053693.1|CNS09DLD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31CB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 861

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 243 ccatcgtgctgatgggcaagaacaccatgat 273



to top

>emb|BX053532.1|CNS09DGW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31BA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 761

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 87  ccatcgtgctcatgggcaagaacaccctgat 117
           |||||||||| ||||||||||||||| ||||
Sbjct: 214 ccatcgtgctgatgggcaagaacaccatgat 244


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,236,172
Number of Sequences: 3902068
Number of extensions: 5236172
Number of successful extensions: 109137
Number of sequences better than 10.0: 1093
Number of HSP's better than 10.0 without gapping: 1093
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 105521
Number of HSP's gapped (non-prelim): 3584
length of query: 695
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 672
effective length of database: 17,143,297,704
effective search space: 11520296057088
effective search space used: 11520296057088
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top