| Clone Name | bags27j08 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|AK105121.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-101-B12, full insert sequence Length = 1099 Score = 474 bits (239), Expect = e-130 Identities = 431/495 (87%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatggggctgctgtcgaaccgggtggagcggtcggagatcaggcc 82 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 67 ggcggcggcggcggcgatggggctgctgtcgaacagggtggagcggtcggagatcaggcc 126 Query: 83 cggcgaccacatctacacctggagggccgtctacgcctactcccaccacggtatttatgt 142 || || ||||||||||| |||||||| || |||||||||||||||||||| |||||||| Sbjct: 127 gggggatcacatctacacatggagggcggtgtacgcctactcccaccacggcatttatgt 186 Query: 143 tggaggaagcaaagtggtccattttacacgaaagaaggaagttgaatcttcagattcatc 202 ||||||||| |||||||| |||||||| |||||||| |||| ||| ||||||||||| Sbjct: 187 tggaggaagtaaagtggttcattttactcgaaagaaagaagcagaaggatcagattcatc 246 Query: 203 aaactccatctctggcctgatctcacgggcttcatcagagtgcccaacattcccagactg 262 || |||| ||| |||| | | | | ||||||||||||||||||| |||||||| || Sbjct: 247 caattccacctccagcctattattagagccttcatcagagtgcccaacgttcccagattg 306 Query: 263 tggttttcagctggacgatagtggtgtcgtactcacctgcttggattgcttccttggcaa 322 ||| ||||||||| |||||||||||||| |||||||||||||||||||||||| | || Sbjct: 307 tgggtttcagctgcctgatagtggtgtcgtcctcacctgcttggattgcttccttcggaa 366 Query: 323 tggctccctctactgctttgagtatggagtgccaccagcaattttccttgcaaaatttcg 382 |||||| || |||||||| ||||| ||||||||| |||| ||||||||||||| | || Sbjct: 367 tggctctctatactgcttcgagtacggagtgccatcagccgttttccttgcaaagctgcg 426 Query: 383 tgggggaacctgcaccattgcccaatccgacccatcagaggctgtggttcggagagctat 442 ||||||||||||||||||||||||||| || |||||||| | |||||| | ||||| || Sbjct: 427 tgggggaacctgcaccattgcccaatcagatccatcagaagttgtggtacacagagccat 486 Query: 443 gcacttgcttcaaaatgggtttggcaactacgacatattcgagaagaattgcgaggactt 502 | |||| ||||||||||| ||||| || || |||||||| ||||| |||||||||||||| Sbjct: 487 gtacttacttcaaaatggctttggaaattatgacatatttgagaacaattgcgaggactt 546 Query: 503 tgcactctactgcaa 517 ||||||||||||||| Sbjct: 547 tgcactctactgcaa 561
>dbj|AK060048.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-304-H07, full insert sequence Length = 1044 Score = 474 bits (239), Expect = e-130 Identities = 431/495 (87%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatggggctgctgtcgaaccgggtggagcggtcggagatcaggcc 82 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 63 ggcggcggcggcggcgatggggctgctgtcgaacagggtggagcggtcggagatcaggcc 122 Query: 83 cggcgaccacatctacacctggagggccgtctacgcctactcccaccacggtatttatgt 142 || || ||||||||||| |||||||| || |||||||||||||||||||| |||||||| Sbjct: 123 gggggatcacatctacacatggagggcggtgtacgcctactcccaccacggcatttatgt 182 Query: 143 tggaggaagcaaagtggtccattttacacgaaagaaggaagttgaatcttcagattcatc 202 ||||||||| |||||||| |||||||| |||||||| |||| ||| ||||||||||| Sbjct: 183 tggaggaagtaaagtggttcattttactcgaaagaaagaagcagaaggatcagattcatc 242 Query: 203 aaactccatctctggcctgatctcacgggcttcatcagagtgcccaacattcccagactg 262 || |||| ||| |||| | | | | ||||||||||||||||||| |||||||| || Sbjct: 243 caattccacctccagcctattattagagccttcatcagagtgcccaacgttcccagattg 302 Query: 263 tggttttcagctggacgatagtggtgtcgtactcacctgcttggattgcttccttggcaa 322 ||| ||||||||| |||||||||||||| |||||||||||||||||||||||| | || Sbjct: 303 tgggtttcagctgcctgatagtggtgtcgtcctcacctgcttggattgcttccttcggaa 362 Query: 323 tggctccctctactgctttgagtatggagtgccaccagcaattttccttgcaaaatttcg 382 |||||| || |||||||| ||||| ||||||||| |||| ||||||||||||| | || Sbjct: 363 tggctctctatactgcttcgagtacggagtgccatcagccgttttccttgcaaagctgcg 422 Query: 383 tgggggaacctgcaccattgcccaatccgacccatcagaggctgtggttcggagagctat 442 ||||||||||||||||||||||||||| || |||||||| | |||||| | ||||| || Sbjct: 423 tgggggaacctgcaccattgcccaatcagatccatcagaagttgtggtacacagagccat 482 Query: 443 gcacttgcttcaaaatgggtttggcaactacgacatattcgagaagaattgcgaggactt 502 | |||| ||||||||||| ||||| || || |||||||| ||||| |||||||||||||| Sbjct: 483 gtacttacttcaaaatggctttggaaattatgacatatttgagaacaattgcgaggactt 542 Query: 503 tgcactctactgcaa 517 ||||||||||||||| Sbjct: 543 tgcactctactgcaa 557
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 315 bits (159), Expect = 8e-83 Identities = 327/383 (85%) Strand = Plus / Minus Query: 135 atttatgttggaggaagcaaagtggtccattttacacgaaagaaggaagttgaatcttca 194 ||||||||||||||||| |||||||| |||||||| |||||||| |||| ||| ||| Sbjct: 20305587 atttatgttggaggaagtaaagtggttcattttactcgaaagaaagaagcagaaggatca 20305528 Query: 195 gattcatcaaactccatctctggcctgatctcacgggcttcatcagagtgcccaacattc 254 |||||||| || |||| ||| |||| | | | | ||||||||||||||||||| ||| Sbjct: 20305527 gattcatccaattccacctccagcctattattagagccttcatcagagtgcccaacgttc 20305468 Query: 255 ccagactgtggttttcagctggacgatagtggtgtcgtactcacctgcttggattgcttc 314 ||||| ||||| ||||||||| |||||||||||||| ||||||||||||||||||||| Sbjct: 20305467 ccagattgtgggtttcagctgcctgatagtggtgtcgtcctcacctgcttggattgcttc 20305408 Query: 315 cttggcaatggctccctctactgctttgagtatggagtgccaccagcaattttccttgca 374 ||| | |||||||| || |||||||| ||||| ||||||||| |||| ||||||||||| Sbjct: 20305407 cttcggaatggctctctatactgcttcgagtacggagtgccatcagccgttttccttgca 20305348 Query: 375 aaatttcgtgggggaacctgcaccattgcccaatccgacccatcagaggctgtggttcgg 434 || | ||||||||||||||||||||||||||||| || |||||||| | |||||| | Sbjct: 20305347 aagctgcgtgggggaacctgcaccattgcccaatcagatccatcagaagttgtggtacac 20305288 Query: 435 agagctatgcacttgcttcaaaatgggtttggcaactacgacatattcgagaagaattgc 494 ||||| ||| |||| ||||||||||| ||||| || || |||||||| ||||| |||||| Sbjct: 20305287 agagccatgtacttacttcaaaatggctttggaaattatgacatatttgagaacaattgc 20305228 Query: 495 gaggactttgcactctactgcaa 517 ||||||||||||||||||||||| Sbjct: 20305227 gaggactttgcactctactgcaa 20305205 Score = 168 bits (85), Expect = 1e-38 Identities = 106/113 (93%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatggggctgctgtcgaaccgggtggagcggtcggagatcaggcc 82 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 20307604 ggcggcggcggcggcgatggggctgctgtcgaacagggtggagcggtcggagatcaggcc 20307545 Query: 83 cggcgaccacatctacacctggagggccgtctacgcctactcccaccacggta 135 || || ||||||||||| |||||||| || |||||||||||||||||||||| Sbjct: 20307544 gggggatcacatctacacatggagggcggtgtacgcctactcccaccacggta 20307492 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatggggc 45 ||||||||||||||||||||||| Sbjct: 9597587 ggcggcggcggcggcgatggggc 9597609 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgggg 44 |||||||||||||||||||||| Sbjct: 16774742 ggcggcggcggcggcgatgggg 16774763 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 22 gggcggcggcggcggcgatggg 43 |||||||||||||||||||||| Sbjct: 14571382 gggcggcggcggcggcgatggg 14571403 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 16 gctggggggcggcggcggcggc 37 |||||||||||||||||||||| Sbjct: 6863712 gctggggggcggcggcggcggc 6863733 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatggggctg 47 ||||||| ||||||||||||||||| Sbjct: 20907544 ggcggcgccggcggcgatggggctg 20907568 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 18 tggggggcggcggcggcggcg 38 ||||||||||||||||||||| Sbjct: 16070695 tggggggcggcggcggcggcg 16070715 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 19138574 ggcggcggcggcggcgatgg 19138593 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 19 ggggggcggcggcggcggcg 38 |||||||||||||||||||| Sbjct: 14907711 ggggggcggcggcggcggcg 14907692 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 13124266 ggcggcggcggcggcgatgg 13124285 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 5977089 ggcggcggcggcggcgatgg 5977070 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 20 gggggcggcggcggcggcga 39 |||||||||||||||||||| Sbjct: 4332268 gggggcggcggcggcggcga 4332287 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 20 gggggcggcggcggcggcga 39 |||||||||||||||||||| Sbjct: 1788891 gggggcggcggcggcggcga 1788872
>dbj|AP005681.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OJ1439_F07 Length = 153743 Score = 315 bits (159), Expect = 8e-83 Identities = 327/383 (85%) Strand = Plus / Minus Query: 135 atttatgttggaggaagcaaagtggtccattttacacgaaagaaggaagttgaatcttca 194 ||||||||||||||||| |||||||| |||||||| |||||||| |||| ||| ||| Sbjct: 84714 atttatgttggaggaagtaaagtggttcattttactcgaaagaaagaagcagaaggatca 84655 Query: 195 gattcatcaaactccatctctggcctgatctcacgggcttcatcagagtgcccaacattc 254 |||||||| || |||| ||| |||| | | | | ||||||||||||||||||| ||| Sbjct: 84654 gattcatccaattccacctccagcctattattagagccttcatcagagtgcccaacgttc 84595 Query: 255 ccagactgtggttttcagctggacgatagtggtgtcgtactcacctgcttggattgcttc 314 ||||| ||||| ||||||||| |||||||||||||| ||||||||||||||||||||| Sbjct: 84594 ccagattgtgggtttcagctgcctgatagtggtgtcgtcctcacctgcttggattgcttc 84535 Query: 315 cttggcaatggctccctctactgctttgagtatggagtgccaccagcaattttccttgca 374 ||| | |||||||| || |||||||| ||||| ||||||||| |||| ||||||||||| Sbjct: 84534 cttcggaatggctctctatactgcttcgagtacggagtgccatcagccgttttccttgca 84475 Query: 375 aaatttcgtgggggaacctgcaccattgcccaatccgacccatcagaggctgtggttcgg 434 || | ||||||||||||||||||||||||||||| || |||||||| | |||||| | Sbjct: 84474 aagctgcgtgggggaacctgcaccattgcccaatcagatccatcagaagttgtggtacac 84415 Query: 435 agagctatgcacttgcttcaaaatgggtttggcaactacgacatattcgagaagaattgc 494 ||||| ||| |||| ||||||||||| ||||| || || |||||||| ||||| |||||| Sbjct: 84414 agagccatgtacttacttcaaaatggctttggaaattatgacatatttgagaacaattgc 84355 Query: 495 gaggactttgcactctactgcaa 517 ||||||||||||||||||||||| Sbjct: 84354 gaggactttgcactctactgcaa 84332 Score = 168 bits (85), Expect = 1e-38 Identities = 106/113 (93%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatggggctgctgtcgaaccgggtggagcggtcggagatcaggcc 82 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 86731 ggcggcggcggcggcgatggggctgctgtcgaacagggtggagcggtcggagatcaggcc 86672 Query: 83 cggcgaccacatctacacctggagggccgtctacgcctactcccaccacggta 135 || || ||||||||||| |||||||| || |||||||||||||||||||||| Sbjct: 86671 gggggatcacatctacacatggagggcggtgtacgcctactcccaccacggta 86619
>dbj|AK072174.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013135P13, full insert sequence Length = 3195 Score = 315 bits (159), Expect = 8e-83 Identities = 327/383 (85%) Strand = Plus / Plus Query: 135 atttatgttggaggaagcaaagtggtccattttacacgaaagaaggaagttgaatcttca 194 ||||||||||||||||| |||||||| |||||||| |||||||| |||| ||| ||| Sbjct: 2085 atttatgttggaggaagtaaagtggttcattttactcgaaagaaagaagcagaaggatca 2144 Query: 195 gattcatcaaactccatctctggcctgatctcacgggcttcatcagagtgcccaacattc 254 |||||||| || |||| ||| |||| | | | | ||||||||||||||||||| ||| Sbjct: 2145 gattcatccaattccacctccagcctattattagagccttcatcagagtgcccaacgttc 2204 Query: 255 ccagactgtggttttcagctggacgatagtggtgtcgtactcacctgcttggattgcttc 314 ||||| ||||| ||||||||| |||||||||||||| ||||||||||||||||||||| Sbjct: 2205 ccagattgtgggtttcagctgcctgatagtggtgtcgtcctcacctgcttggattgcttc 2264 Query: 315 cttggcaatggctccctctactgctttgagtatggagtgccaccagcaattttccttgca 374 ||| | |||||||| || |||||||| ||||| ||||||||| |||| ||||||||||| Sbjct: 2265 cttcggaatggctctctatactgcttcgagtacggagtgccatcagccgttttccttgca 2324 Query: 375 aaatttcgtgggggaacctgcaccattgcccaatccgacccatcagaggctgtggttcgg 434 || | ||||||||||||||||||||||||||||| || |||||||| | |||||| | Sbjct: 2325 aagctgcgtgggggaacctgcaccattgcccaatcagatccatcagaagttgtggtacac 2384 Query: 435 agagctatgcacttgcttcaaaatgggtttggcaactacgacatattcgagaagaattgc 494 ||||| ||| |||| ||||||||||| ||||| || || |||||||| ||||| |||||| Sbjct: 2385 agagccatgtacttacttcaaaatggctttggaaattatgacatatttgagaacaattgc 2444 Query: 495 gaggactttgcactctactgcaa 517 ||||||||||||||||||||||| Sbjct: 2445 gaggactttgcactctactgcaa 2467 Score = 168 bits (85), Expect = 1e-38 Identities = 106/113 (93%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatggggctgctgtcgaaccgggtggagcggtcggagatcaggcc 82 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 68 ggcggcggcggcggcgatggggctgctgtcgaacagggtggagcggtcggagatcaggcc 127 Query: 83 cggcgaccacatctacacctggagggccgtctacgcctactcccaccacggta 135 || || ||||||||||| |||||||| || |||||||||||||||||||||| Sbjct: 128 gggggatcacatctacacatggagggcggtgtacgcctactcccaccacggta 180
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 137 bits (69), Expect = 4e-29 Identities = 96/105 (91%) Strand = Plus / Minus Query: 31 cggcggcgatggggctgctgtcgaaccgggtggagcggtcggagatcaggcccggcgacc 90 ||||||||||||||||||||||| |||| ||||||||||||||||| | ||||||||||| Sbjct: 27388732 cggcggcgatggggctgctgtcgcaccgcgtggagcggtcggagatgaagcccggcgacc 27388673 Query: 91 acatctacacctggagggccgtctacgcctactcccaccacggta 135 |||||||||| ||| | |||| |||| |||||||||||||||||| Sbjct: 27388672 acatctacacatggcgcgccgcctacacctactcccaccacggta 27388628 Score = 63.9 bits (32), Expect = 5e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 441 atgcacttgcttcaaaatgggtttggcaactacgacatattcgagaagaattgcgaggac 500 |||||| |||| || || ||||| |||| ||||||| | |||||||| || ||||||||| Sbjct: 27386732 atgcacctgctccagaacgggttcggcagctacgacgtgttcgagaacaactgcgaggac 27386673 Query: 501 tttgcactctactgcaagac 520 || || |||||||||||||| Sbjct: 27386672 ttcgcgctctactgcaagac 27386653 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 22 gggcggcggcggcggcgatgggg 44 ||||||||||||||||||||||| Sbjct: 20137150 gggcggcggcggcggcgatgggg 20137172 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgggg 44 |||||||||||||||||||||| Sbjct: 25589471 ggcggcggcggcggcgatgggg 25589450 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgggg 44 |||||||||||||||||||||| Sbjct: 677717 ggcggcggcggcggcgatgggg 677696 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatggg 43 ||||||||||||||||||||| Sbjct: 15189887 ggcggcggcggcggcgatggg 15189907 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 21 ggggcggcggcggcggcgatg 41 ||||||||||||||||||||| Sbjct: 7772723 ggggcggcggcggcggcgatg 7772743 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatggg 43 ||||||||||||||||||||| Sbjct: 576043 ggcggcggcggcggcgatggg 576023 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tgctggggggcggcggcggcggcg 38 ||||| |||||||||||||||||| Sbjct: 27452489 tgctgcggggcggcggcggcggcg 27452466 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 16 gctggggggcggcggcggcg 35 |||||||||||||||||||| Sbjct: 26566348 gctggggggcggcggcggcg 26566329 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 19 ggggggcggcggcggcggcg 38 |||||||||||||||||||| Sbjct: 21561778 ggggggcggcggcggcggcg 21561759 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 19327966 ggcggcggcggcggcgatgg 19327947 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 19 ggggggcggcggcggcggcg 38 |||||||||||||||||||| Sbjct: 13960387 ggggggcggcggcggcggcg 13960368 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 10775941 ggcggcggcggcggcgatgg 10775922 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 10465441 ggcggcggcggcggcgatgg 10465422 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 19 ggggggcggcggcggcggcg 38 |||||||||||||||||||| Sbjct: 10048817 ggggggcggcggcggcggcg 10048798 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 8791432 ggcggcggcggcggcgatgg 8791413 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 5314454 ggcggcggcggcggcgatgg 5314435 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 25 cggcggcggcggcgatgggg 44 |||||||||||||||||||| Sbjct: 3414281 cggcggcggcggcgatgggg 3414262 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 19 ggggggcggcggcggcggcg 38 |||||||||||||||||||| Sbjct: 2427754 ggggggcggcggcggcggcg 2427773 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 119142 ggcggcggcggcggcgatgg 119161
>dbj|AP004704.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0544G09 Length = 137481 Score = 137 bits (69), Expect = 4e-29 Identities = 96/105 (91%) Strand = Plus / Minus Query: 31 cggcggcgatggggctgctgtcgaaccgggtggagcggtcggagatcaggcccggcgacc 90 ||||||||||||||||||||||| |||| ||||||||||||||||| | ||||||||||| Sbjct: 15527 cggcggcgatggggctgctgtcgcaccgcgtggagcggtcggagatgaagcccggcgacc 15468 Query: 91 acatctacacctggagggccgtctacgcctactcccaccacggta 135 |||||||||| ||| | |||| |||| |||||||||||||||||| Sbjct: 15467 acatctacacatggcgcgccgcctacacctactcccaccacggta 15423 Score = 63.9 bits (32), Expect = 5e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 441 atgcacttgcttcaaaatgggtttggcaactacgacatattcgagaagaattgcgaggac 500 |||||| |||| || || ||||| |||| ||||||| | |||||||| || ||||||||| Sbjct: 13527 atgcacctgctccagaacgggttcggcagctacgacgtgttcgagaacaactgcgaggac 13468 Query: 501 tttgcactctactgcaagac 520 || || |||||||||||||| Sbjct: 13467 ttcgcgctctactgcaagac 13448 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tgctggggggcggcggcggcggcg 38 ||||| |||||||||||||||||| Sbjct: 79284 tgctgcggggcggcggcggcggcg 79261
>dbj|AP004163.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1323_A06 Length = 95665 Score = 137 bits (69), Expect = 4e-29 Identities = 96/105 (91%) Strand = Plus / Minus Query: 31 cggcggcgatggggctgctgtcgaaccgggtggagcggtcggagatcaggcccggcgacc 90 ||||||||||||||||||||||| |||| ||||||||||||||||| | ||||||||||| Sbjct: 90259 cggcggcgatggggctgctgtcgcaccgcgtggagcggtcggagatgaagcccggcgacc 90200 Query: 91 acatctacacctggagggccgtctacgcctactcccaccacggta 135 |||||||||| ||| | |||| |||| |||||||||||||||||| Sbjct: 90199 acatctacacatggcgcgccgcctacacctactcccaccacggta 90155 Score = 63.9 bits (32), Expect = 5e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 441 atgcacttgcttcaaaatgggtttggcaactacgacatattcgagaagaattgcgaggac 500 |||||| |||| || || ||||| |||| ||||||| | |||||||| || ||||||||| Sbjct: 88259 atgcacctgctccagaacgggttcggcagctacgacgtgttcgagaacaactgcgaggac 88200 Query: 501 tttgcactctactgcaagac 520 || || |||||||||||||| Sbjct: 88199 ttcgcgctctactgcaagac 88180
>ref|XM_483638.1| Oryza sativa (japonica cultivar-group), mRNA Length = 909 Score = 115 bits (58), Expect = 1e-22 Identities = 85/94 (90%) Strand = Plus / Plus Query: 39 atggggctgctgtcgaaccgggtggagcggtcggagatcaggcccggcgaccacatctac 98 ||||||||||||||| |||| ||||||||||||||||| | ||||||||||||||||||| Sbjct: 1 atggggctgctgtcgcaccgcgtggagcggtcggagatgaagcccggcgaccacatctac 60 Query: 99 acctggagggccgtctacgcctactcccaccacg 132 || ||| | |||| |||| ||||||||||||||| Sbjct: 61 acatggcgcgccgcctacacctactcccaccacg 94 Score = 63.9 bits (32), Expect = 5e-07 Identities = 68/80 (85%) Strand = Plus / Plus Query: 441 atgcacttgcttcaaaatgggtttggcaactacgacatattcgagaagaattgcgaggac 500 |||||| |||| || || ||||| |||| ||||||| | |||||||| || ||||||||| Sbjct: 457 atgcacctgctccagaacgggttcggcagctacgacgtgttcgagaacaactgcgaggac 516 Query: 501 tttgcactctactgcaagac 520 || || |||||||||||||| Sbjct: 517 ttcgcgctctactgcaagac 536
>ref|NM_100005.2| Arabidopsis thaliana unknown protein AT1G01225 mRNA, complete cds Length = 1025 Score = 48.1 bits (24), Expect = 0.029 Identities = 57/68 (83%) Strand = Plus / Plus Query: 453 caaaatgggtttggcaactacgacatattcgagaagaattgcgaggactttgcactctac 512 ||||| || ||||||||||||||||| ||| |||| || || ||||| || || ||||| Sbjct: 483 caaaacggatttggcaactacgacattttcaagaacaactgtgaggatttcgcgctctat 542 Query: 513 tgcaagac 520 |||||||| Sbjct: 543 tgcaagac 550
>ref|NM_001035351.1| Bos taurus similar to actinin, alpha 1 (MGC128689), mRNA Length = 3555 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Minus Query: 15 tgctggggggcggcggcggcggcg 38 |||||||||||||||||||||||| Sbjct: 83 tgctggggggcggcggcggcggcg 60
>gb|BC107533.1| Bos taurus similar to actinin, alpha 1, mRNA (cDNA clone MGC:128689 IMAGE:7987391), complete cds Length = 3555 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Minus Query: 15 tgctggggggcggcggcggcggcg 38 |||||||||||||||||||||||| Sbjct: 83 tgctggggggcggcggcggcggcg 60
>gb|BT024776.1| Arabidopsis thaliana At1g01225 mRNA, complete cds Length = 783 Score = 48.1 bits (24), Expect = 0.029 Identities = 57/68 (83%) Strand = Plus / Plus Query: 453 caaaatgggtttggcaactacgacatattcgagaagaattgcgaggactttgcactctac 512 ||||| || ||||||||||||||||| ||| |||| || || ||||| || || ||||| Sbjct: 406 caaaacggatttggcaactacgacattttcaagaacaactgtgaggatttcgcgctctat 465 Query: 513 tgcaagac 520 |||||||| Sbjct: 466 tgcaagac 473
>emb|BX818287.1|CNS0AAMT Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL70ZH04 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1021 Score = 48.1 bits (24), Expect = 0.029 Identities = 57/68 (83%) Strand = Plus / Plus Query: 453 caaaatgggtttggcaactacgacatattcgagaagaattgcgaggactttgcactctac 512 ||||| || ||||||||||||||||| ||| |||| || || ||||| || || ||||| Sbjct: 483 caaaacggatttggcaactacgacattttcaagaacaactgtgaggatttcgcgctctat 542 Query: 513 tgcaagac 520 |||||||| Sbjct: 543 tgcaagac 550
>gb|AY087072.1| Arabidopsis thaliana clone 31323 mRNA, complete sequence Length = 982 Score = 48.1 bits (24), Expect = 0.029 Identities = 57/68 (83%) Strand = Plus / Plus Query: 453 caaaatgggtttggcaactacgacatattcgagaagaattgcgaggactttgcactctac 512 ||||| || ||||||||||||||||| ||| |||| || || ||||| || || ||||| Sbjct: 450 caaaacggatttggcaactacgacattttcaagaacaactgtgaggatttcgcgctctat 509 Query: 513 tgcaagac 520 |||||||| Sbjct: 510 tgcaagac 517
>gb|AC023628.3|AC023628 Arabidopsis thaliana chromosome I BAC F6F3 genomic sequence, complete sequence Length = 104001 Score = 48.1 bits (24), Expect = 0.029 Identities = 57/68 (83%) Strand = Plus / Plus Query: 453 caaaatgggtttggcaactacgacatattcgagaagaattgcgaggactttgcactctac 512 ||||| || ||||||||||||||||| ||| |||| || || ||||| || || ||||| Sbjct: 37773 caaaacggatttggcaactacgacattttcaagaacaactgtgaggatttcgcgctctat 37832 Query: 513 tgcaagac 520 |||||||| Sbjct: 37833 tgcaagac 37840
>emb|AL606649.4|OSJN00094 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0003B01, complete sequence Length = 153643 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatggggc 45 ||||||||||||||||||||||| Sbjct: 111619 ggcggcggcggcggcgatggggc 111597
>emb|AJ430632.1|ZMA430632 Zea mays mRNA for putative MADS-domain transcription factor (m15 gene) Length = 1216 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatggggc 45 ||||||||||||||||||||||| Sbjct: 281 ggcggcggcggcggcgatggggc 303
>emb|AJ310426.1|HVU310426 Hordeum vulgare mRNA for cathepsin B (cathB gene) Length = 1277 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 16 gctggggggcggcggcggcggcg 38 ||||||||||||||||||||||| Sbjct: 137 gctggggggcggcggcggcggcg 115
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatggggc 45 ||||||||||||||||||||||| Sbjct: 32592885 ggcggcggcggcggcgatggggc 32592863 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 21 ggggcggcggcggcggcgatg 41 ||||||||||||||||||||| Sbjct: 24054983 ggggcggcggcggcggcgatg 24054963 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 24 gcggcggcggcggcgatggg 43 |||||||||||||||||||| Sbjct: 33471188 gcggcggcggcggcgatggg 33471169 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 31450345 ggcggcggcggcggcgatgg 31450364 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 20807825 ggcggcggcggcggcgatgg 20807806 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 19 ggggggcggcggcggcggcg 38 |||||||||||||||||||| Sbjct: 20596478 ggggggcggcggcggcggcg 20596497 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 19 ggggggcggcggcggcggcg 38 |||||||||||||||||||| Sbjct: 20252470 ggggggcggcggcggcggcg 20252451 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 19384760 ggcggcggcggcggcgatgg 19384779 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 8432963 ggcggcggcggcggcgatgg 8432944 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 956721 ggcggcggcggcggcgatgg 956702
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 16 gctggggggcggcggcggcggcg 38 ||||||||||||||||||||||| Sbjct: 26328154 gctggggggcggcggcggcggcg 26328132 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgggg 44 |||||||||||||||||||||| Sbjct: 20060500 ggcggcggcggcggcgatgggg 20060521 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatggg 43 ||||||||||||||||||||| Sbjct: 25809435 ggcggcggcggcggcgatggg 25809415 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatggggctg 47 |||||||||||||||| |||||||| Sbjct: 18962938 ggcggcggcggcggcggtggggctg 18962914 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 26697278 ggcggcggcggcggcgatgg 26697297 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 20 gggggcggcggcggcggcga 39 |||||||||||||||||||| Sbjct: 26120697 gggggcggcggcggcggcga 26120678 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 25803698 ggcggcggcggcggcgatgg 25803717 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 25566258 ggcggcggcggcggcgatgg 25566239 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 25137235 ggcggcggcggcggcgatgg 25137216 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 24854715 ggcggcggcggcggcgatgg 24854734 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 23550360 ggcggcggcggcggcgatgg 23550379 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 23009741 ggcggcggcggcggcgatgg 23009722 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 15749397 ggcggcggcggcggcgatgg 15749416 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 9610603 ggcggcggcggcggcgatgg 9610584 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 24 gcggcggcggcggcgatggg 43 |||||||||||||||||||| Sbjct: 9374080 gcggcggcggcggcgatggg 9374099
>dbj|AP005811.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0706E03 Length = 188028 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatggggc 45 ||||||||||||||||||||||| Sbjct: 37684 ggcggcggcggcggcgatggggc 37706
>dbj|AP005301.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJNBa0077M12 Length = 145337 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 22 gggcggcggcggcggcgatgggg 44 ||||||||||||||||||||||| Sbjct: 2936 gggcggcggcggcggcgatgggg 2958
>dbj|AP004005.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1188_F05 Length = 117045 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 22 gggcggcggcggcggcgatgggg 44 ||||||||||||||||||||||| Sbjct: 83696 gggcggcggcggcggcgatgggg 83718
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 16 gctggggggcggcggcggcggcg 38 ||||||||||||||||||||||| Sbjct: 26256322 gctggggggcggcggcggcggcg 26256300 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgggg 44 |||||||||||||||||||||| Sbjct: 19986714 ggcggcggcggcggcgatgggg 19986735 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatggg 43 ||||||||||||||||||||| Sbjct: 25737611 ggcggcggcggcggcgatggg 25737591 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatggggctg 47 |||||||||||||||| |||||||| Sbjct: 18889165 ggcggcggcggcggcggtggggctg 18889141 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 26625447 ggcggcggcggcggcgatgg 26625466 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 20 gggggcggcggcggcggcga 39 |||||||||||||||||||| Sbjct: 26048873 gggggcggcggcggcggcga 26048854 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 25731874 ggcggcggcggcggcgatgg 25731893 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 25494434 ggcggcggcggcggcgatgg 25494415 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 25065411 ggcggcggcggcggcgatgg 25065392 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 24782921 ggcggcggcggcggcgatgg 24782940 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 23478551 ggcggcggcggcggcgatgg 23478570 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 22937932 ggcggcggcggcggcgatgg 22937913 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 15702630 ggcggcggcggcggcgatgg 15702649 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 9610488 ggcggcggcggcggcgatgg 9610469 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 24 gcggcggcggcggcgatggg 43 |||||||||||||||||||| Sbjct: 9373965 gcggcggcggcggcgatggg 9373984
>emb|AL731885.4|CNS08C8P Oryza sativa chromosome 12, . BAC OSJNBb0016A10 of library OSJNBb from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 133978 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 16 gctggggggcggcggcggcggcg 38 ||||||||||||||||||||||| Sbjct: 92138 gctggggggcggcggcggcggcg 92116
>emb|AL845347.4|CNS08CB9 Oryza sativa chromosome 12, . BAC OSJNBb0101I10 of library OSJNBb from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 131689 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 16 gctggggggcggcggcggcggcg 38 ||||||||||||||||||||||| Sbjct: 42426 gctggggggcggcggcggcggcg 42404
>ref|NM_189000.2| Oryza sativa (japonica cultivar-group), mRNA Length = 2966 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgggg 44 |||||||||||||||||||||| Sbjct: 233 ggcggcggcggcggcgatgggg 254
>ref|XM_479753.1| Oryza sativa (japonica cultivar-group), mRNA Length = 830 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgggg 44 |||||||||||||||||||||| Sbjct: 74 ggcggcggcggcggcgatgggg 95
>ref|XM_520299.1| PREDICTED: Pan troglodytes similar to TBC1 domain family, member 13 (LOC464776), mRNA Length = 1353 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 17 ctggggggcggcggcggcggcg 38 |||||||||||||||||||||| Sbjct: 68 ctggggggcggcggcggcggcg 89
>ref|XM_467434.1| Oryza sativa (japonica cultivar-group), mRNA Length = 792 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgggg 44 |||||||||||||||||||||| Sbjct: 98 ggcggcggcggcggcgatgggg 119
>ref|NM_001002973.1| Canis familiaris basic helix-loop-helix domain containing, class B, 3 (BHLHB3), mRNA Length = 3455 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 17 ctggggggcggcggcggcggcg 38 |||||||||||||||||||||| Sbjct: 1187 ctggggggcggcggcggcggcg 1208
>gb|AY953870.1| Oryza sativa (japonica cultivar-group) undeveloped tapetum 1 (UDT1) gene, udt1-1 allele, complete cds Length = 2051 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgggg 44 |||||||||||||||||||||| Sbjct: 392 ggcggcggcggcggcgatgggg 413
>ref|NM_185754.1| Oryza sativa (japonica cultivar-group), mRNA Length = 684 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgggg 44 |||||||||||||||||||||| Sbjct: 156 ggcggcggcggcggcgatgggg 177
>gb|BT017981.1| Zea mays clone EL01N0525C06.c mRNA sequence Length = 1073 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgggg 44 |||||||||||||||||||||| Sbjct: 51 ggcggcggcggcggcgatgggg 72
>gb|AY016020.1| Gallus gallus alpha globin gene cluster, complete sequence Length = 103190 Score = 44.1 bits (22), Expect = 0.45 Identities = 25/26 (96%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatggggctgc 48 |||||||||||||||||||| ||||| Sbjct: 59770 ggcggcggcggcggcgatggcgctgc 59795
>gb|AY023294.1| Oryza sativa microsatellite MRG5619 containing (GGC)X10, closest to marker RM152, genomic sequence Length = 230 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgggg 44 |||||||||||||||||||||| Sbjct: 116 ggcggcggcggcggcgatgggg 137
>ref|XM_417497.1| PREDICTED: Gallus gallus similar to Tcfap2c protein (LOC419327), mRNA Length = 2014 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 gctggggggcggcggcggcggc 37 |||||||||||||||||||||| Sbjct: 342 gctggggggcggcggcggcggc 321
>ref|XM_416633.1| PREDICTED: Gallus gallus similar to hypothetical protein FLJ11342 (LOC418419), mRNA Length = 1350 Score = 44.1 bits (22), Expect = 0.45 Identities = 25/26 (96%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatggggctgc 48 |||||||||||||||| ||||||||| Sbjct: 3 ggcggcggcggcggcgctggggctgc 28
>ref|XM_864654.1| PREDICTED: Bos taurus similar to gametogenetin isoform 1 (LOC613654), mRNA Length = 1851 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 17 ctggggggcggcggcggcggcg 38 |||||||||||||||||||||| Sbjct: 889 ctggggggcggcggcggcggcg 910
>gb|AC128646.5| Oryza sativa chromosome 3 BAC OSJNBb0029I19 genomic sequence, complete sequence Length = 120254 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Minus Query: 20 gggggcggcggcggcggcgatg 41 |||||||||||||||||||||| Sbjct: 39749 gggggcggcggcggcggcgatg 39728
>ref|XM_957960.1| Neurospora crassa OR74A hypothetical protein (NCU05691.1) partial mRNA Length = 1515 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgggg 44 |||||||||||||||||||||| Sbjct: 1381 ggcggcggcggcggcgatgggg 1402
>ref|XM_325545.1| Neurospora crassa OR74A hypothetical protein (NCU05691.1) partial mRNA Length = 1515 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgggg 44 |||||||||||||||||||||| Sbjct: 1381 ggcggcggcggcggcgatgggg 1402
>gb|AC149429.1| Populus trichocarpa clone Pop1-109D09, complete sequence Length = 94633 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 187 aatcttcagattcatcaaactc 208 |||||||||||||||||||||| Sbjct: 602 aatcttcagattcatcaaactc 623
>gb|AC145396.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0042F15, complete sequence Length = 162959 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgggg 44 |||||||||||||||||||||| Sbjct: 51079 ggcggcggcggcggcgatgggg 51100
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 20 gggggcggcggcggcggcgatg 41 |||||||||||||||||||||| Sbjct: 24434208 gggggcggcggcggcggcgatg 24434229 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatggg 43 ||||||||||||||||||||| Sbjct: 8736441 ggcggcggcggcggcgatggg 8736461 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 gcggcggcggcggcgatgggg 44 ||||||||||||||||||||| Sbjct: 5947922 gcggcggcggcggcgatgggg 5947902 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 32237350 ggcggcggcggcggcgatgg 32237331 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 22140575 ggcggcggcggcggcgatgg 22140556 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 21048697 ggcggcggcggcggcgatgg 21048678 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 17560614 ggcggcggcggcggcgatgg 17560633 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 19 ggggggcggcggcggcggcg 38 |||||||||||||||||||| Sbjct: 11947923 ggggggcggcggcggcggcg 11947942 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 9168120 ggcggcggcggcggcgatgg 9168139 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 19 ggggggcggcggcggcggcg 38 |||||||||||||||||||| Sbjct: 5812994 ggggggcggcggcggcggcg 5813013 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 5426676 ggcggcggcggcggcgatgg 5426657 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 3097751 ggcggcggcggcggcgatgg 3097770 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 3073599 ggcggcggcggcggcgatgg 3073618 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 325297 ggcggcggcggcggcgatgg 325316
>ref|XR_002529.1| PREDICTED: Mus musculus similar to AT rich interactive domain 1A isoform a (LOC669477), mRNA Length = 7992 Score = 44.1 bits (22), Expect = 0.45 Identities = 25/26 (96%) Strand = Plus / Plus Query: 13 agtgctggggggcggcggcggcggcg 38 ||||||||||||| |||||||||||| Sbjct: 1007 agtgctggggggctgcggcggcggcg 1032
>ref|XM_992330.1| PREDICTED: Mus musculus AT rich interactive domain 1A (Swi1 like), transcript variant 2 (Arid1a), mRNA Length = 7524 Score = 44.1 bits (22), Expect = 0.45 Identities = 25/26 (96%) Strand = Plus / Plus Query: 13 agtgctggggggcggcggcggcggcg 38 ||||||||||||| |||||||||||| Sbjct: 1007 agtgctggggggctgcggcggcggcg 1032
>ref|XM_992362.1| PREDICTED: Mus musculus AT rich interactive domain 1A (Swi1 like), transcript variant 3 (Arid1a), mRNA Length = 8175 Score = 44.1 bits (22), Expect = 0.45 Identities = 25/26 (96%) Strand = Plus / Plus Query: 13 agtgctggggggcggcggcggcggcg 38 ||||||||||||| |||||||||||| Sbjct: 1007 agtgctggggggctgcggcggcggcg 1032
>ref|XM_986119.1| PREDICTED: Mus musculus similar to AT rich interactive domain 1A isoform a (LOC675933), mRNA Length = 7416 Score = 44.1 bits (22), Expect = 0.45 Identities = 25/26 (96%) Strand = Plus / Plus Query: 13 agtgctggggggcggcggcggcggcg 38 ||||||||||||| |||||||||||| Sbjct: 248 agtgctggggggctgcggcggcggcg 273
>ref|XM_860856.1| PREDICTED: Canis familiaris similar to AT rich interactive domain 1A (SWI- like) isoform c, transcript variant 3 (LOC487352), mRNA Length = 7836 Score = 44.1 bits (22), Expect = 0.45 Identities = 25/26 (96%) Strand = Plus / Plus Query: 13 agtgctggggggcggcggcggcggcg 38 ||||||||||||| |||||||||||| Sbjct: 1373 agtgctggggggctgcggcggcggcg 1398
>ref|XM_860834.1| PREDICTED: Canis familiaris similar to AT rich interactive domain 1A (SWI- like) isoform c, transcript variant 2 (LOC487352), mRNA Length = 7595 Score = 44.1 bits (22), Expect = 0.45 Identities = 25/26 (96%) Strand = Plus / Plus Query: 13 agtgctggggggcggcggcggcggcg 38 ||||||||||||| |||||||||||| Sbjct: 1373 agtgctggggggctgcggcggcggcg 1398
>ref|XM_847453.1| PREDICTED: Canis familiaris similar to AT rich interactive domain 1A (SWI- like) isoform c, transcript variant 1 (LOC487352), mRNA Length = 8487 Score = 44.1 bits (22), Expect = 0.45 Identities = 25/26 (96%) Strand = Plus / Plus Query: 13 agtgctggggggcggcggcggcggcg 38 ||||||||||||| |||||||||||| Sbjct: 1373 agtgctggggggctgcggcggcggcg 1398
>gb|BC079591.1| Mus musculus cDNA clone IMAGE:6406949, **** WARNING: chimeric clone **** Length = 5972 Score = 44.1 bits (22), Expect = 0.45 Identities = 25/26 (96%) Strand = Plus / Plus Query: 13 agtgctggggggcggcggcggcggcg 38 ||||||||||||| |||||||||||| Sbjct: 148 agtgctggggggctgcggcggcggcg 173
>emb|AJ007665.1|ZMA7665 Zea mays mRNA for cytosolic seryl-tRNA synthetase Length = 1907 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgggg 44 |||||||||||||||||||||| Sbjct: 35 ggcggcggcggcggcgatgggg 14
>emb|AL441992.17| Human DNA sequence from clone RP11-545E17 on chromosome 9 Contains the gene for protein kinase PKNbeta (pknbeta), a novel gene, the ZDHHC12 gene for zinc finger, DHHC domain containing 12 (ZNF400, FLJ14524), the gene for ZYG homolog, a novel gene (FLJ10743), the ENDOG gene for endonuclease G, a novel gene (HSPC109), the 3' end of the CCBL1 gene for cysteine conjugate-beta lyase; cytoplasmic (glutamine transaminase K, kyneurenine aminotransferase) and six CpG islands, complete sequence Length = 166664 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 17 ctggggggcggcggcggcggcg 38 |||||||||||||||||||||| Sbjct: 87857 ctggggggcggcggcggcggcg 87878
>gb|AY204568.1| Canis familiaris SHARP1 protein (SHARP1) mRNA, complete cds Length = 3455 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 17 ctggggggcggcggcggcggcg 38 |||||||||||||||||||||| Sbjct: 1187 ctggggggcggcggcggcggcg 1208
>gb|AY204567.1| Canis familiaris SHARP1 protein (SHARP1) gene, complete cds Length = 5245 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 17 ctggggggcggcggcggcggcg 38 |||||||||||||||||||||| Sbjct: 2803 ctggggggcggcggcggcggcg 2824
>ref|XM_964159.1| PREDICTED: Tribolium castaneum similar to Alpha-fetoprotein enhancer-binding protein (AT motif-binding factor) (AT-binding transcription factor 1) (LOC657717), mRNA Length = 7833 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Minus Query: 20 gggggcggcggcggcggcgatg 41 |||||||||||||||||||||| Sbjct: 155 gggggcggcggcggcggcgatg 134
>gb|AF236372.1| Zea mays variety Hi-II stomatin-like protein (STM1) mRNA, complete cds Length = 1677 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgggg 44 |||||||||||||||||||||| Sbjct: 147 ggcggcggcggcggcgatgggg 126
>emb|CR925752.5| Mouse DNA sequence from clone RP24-106O24 on chromosome 4, complete sequence Length = 103739 Score = 44.1 bits (22), Expect = 0.45 Identities = 25/26 (96%) Strand = Plus / Minus Query: 13 agtgctggggggcggcggcggcggcg 38 ||||||||||||| |||||||||||| Sbjct: 31112 agtgctggggggctgcggcggcggcg 31087
>gb|AC018521.8| Homo sapiens chromosome 17, clone RP11-6N17, complete sequence Length = 143494 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgggg 44 |||||||||||||||||||||| Sbjct: 124714 ggcggcggcggcggcgatgggg 124693
>gb|AF220137.1|AF220137 Homo sapiens tripartite motif protein TRIM33 beta mRNA, complete cds; alternatively spliced Length = 3458 Score = 44.1 bits (22), Expect = 0.45 Identities = 25/26 (96%) Strand = Plus / Plus Query: 20 gggggcggcggcggcggcgatggggc 45 |||||||||||||||||||| ||||| Sbjct: 16 gggggcggcggcggcggcgacggggc 41
>gb|AF220136.1|AF220136 Homo sapiens tripartite motif protein TRIM33 alpha (TRIM33) mRNA, complete cds; alternatively spliced Length = 3509 Score = 44.1 bits (22), Expect = 0.45 Identities = 25/26 (96%) Strand = Plus / Plus Query: 20 gggggcggcggcggcggcgatggggc 45 |||||||||||||||||||| ||||| Sbjct: 16 gggggcggcggcggcggcgacggggc 41
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgggg 44 |||||||||||||||||||||| Sbjct: 21760810 ggcggcggcggcggcgatgggg 21760831 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatggg 43 ||||||||||||||||||||| Sbjct: 29287073 ggcggcggcggcggcgatggg 29287093 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatggg 43 ||||||||||||||||||||| Sbjct: 27724378 ggcggcggcggcggcgatggg 27724358 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 gcggcggcggcggcgatgggg 44 ||||||||||||||||||||| Sbjct: 25315186 gcggcggcggcggcgatgggg 25315166 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 18 tggggggcggcggcggcggcg 38 ||||||||||||||||||||| Sbjct: 8529220 tggggggcggcggcggcggcg 8529240 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatggg 43 ||||||||||||||||||||| Sbjct: 7450182 ggcggcggcggcggcgatggg 7450202 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 28839612 ggcggcggcggcggcgatgg 28839631 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 23155268 ggcggcggcggcggcgatgg 23155249 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 14479780 ggcggcggcggcggcgatgg 14479799 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 8369701 ggcggcggcggcggcgatgg 8369682 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 20 gggggcggcggcggcggcga 39 |||||||||||||||||||| Sbjct: 7438380 gggggcggcggcggcggcga 7438361 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 3151043 ggcggcggcggcggcgatgg 3151062 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 532955 ggcggcggcggcggcgatgg 532936
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Minus Query: 17 ctggggggcggcggcggcggcg 38 |||||||||||||||||||||| Sbjct: 4205128 ctggggggcggcggcggcggcg 4205107 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 22 gggcggcggcggcggcgatgg 42 ||||||||||||||||||||| Sbjct: 28814726 gggcggcggcggcggcgatgg 28814706 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 tggggggcggcggcggcggcg 38 ||||||||||||||||||||| Sbjct: 3375681 tggggggcggcggcggcggcg 3375661 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 29865343 ggcggcggcggcggcgatgg 29865362 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 29765788 ggcggcggcggcggcgatgg 29765769 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 27805966 ggcggcggcggcggcgatgg 27805985 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 27464040 ggcggcggcggcggcgatgg 27464059 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 18 tggggggcggcggcggcggcgatg 41 ||||||||| |||||||||||||| Sbjct: 26415317 tggggggcgacggcggcggcgatg 26415294 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 21301569 ggcggcggcggcggcgatgg 21301588 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 19494667 ggcggcggcggcggcgatgg 19494648 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 20 gggggcggcggcggcggcga 39 |||||||||||||||||||| Sbjct: 8966697 gggggcggcggcggcggcga 8966678 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 5649165 ggcggcggcggcggcgatgg 5649184 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 5190817 ggcggcggcggcggcgatgg 5190836 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 5079060 ggcggcggcggcggcgatgg 5079079 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 19 ggggggcggcggcggcggcg 38 |||||||||||||||||||| Sbjct: 4030822 ggggggcggcggcggcggcg 4030841 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 22 gggcggcggcggcggcgatggggc 45 ||||||| |||||||||||||||| Sbjct: 3109667 gggcggcagcggcggcgatggggc 3109644 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 2897916 ggcggcggcggcggcgatgg 2897935 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 20 gggggcggcggcggcggcga 39 |||||||||||||||||||| Sbjct: 2682576 gggggcggcggcggcggcga 2682557 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 20 gggggcggcggcggcggcgatggg 43 ||||||||||||||||||| |||| Sbjct: 550254 gggggcggcggcggcggcgttggg 550231
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgggg 44 |||||||||||||||||||||| Sbjct: 7866304 ggcggcggcggcggcgatgggg 7866325 Score = 42.1 bits (21), Expect = 1.8 Identities = 33/37 (89%) Strand = Plus / Minus Query: 484 agaagaattgcgaggactttgcactctactgcaagac 520 |||| ||||||||||||||||| | ||||||||||| Sbjct: 14032983 agaacaattgcgaggactttgcgatatactgcaagac 14032947 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 21 ggggcggcggcggcggcgatg 41 ||||||||||||||||||||| Sbjct: 6638039 ggggcggcggcggcggcgatg 6638019 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 28872111 ggcggcggcggcggcgatgg 28872092 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 28251532 ggcggcggcggcggcgatgg 28251551 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 24 gcggcggcggcggcgatggg 43 |||||||||||||||||||| Sbjct: 26781481 gcggcggcggcggcgatggg 26781462 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 20 gggggcggcggcggcggcga 39 |||||||||||||||||||| Sbjct: 26599178 gggggcggcggcggcggcga 26599197 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 25266048 ggcggcggcggcggcgatgg 25266029 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 21 ggggcggcggcggcggcgatgggg 44 |||||||||||||||||| ||||| Sbjct: 23033581 ggggcggcggcggcggcggtgggg 23033558 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 20273695 ggcggcggcggcggcgatgg 20273676 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 16154165 ggcggcggcggcggcgatgg 16154146 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 4113889 ggcggcggcggcggcgatgg 4113908 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 2673768 ggcggcggcggcggcgatgg 2673749 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ggcggcggcggcgatggggc 45 |||||||||||||||||||| Sbjct: 2563643 ggcggcggcggcgatggggc 2563624 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 1984704 ggcggcggcggcggcgatgg 1984723 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 1750457 ggcggcggcggcggcgatgg 1750476 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 21 ggggcggcggcggcggcgatgggg 44 |||||||||||||||||| ||||| Sbjct: 670357 ggggcggcggcggcggcggtgggg 670380
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 20 gggggcggcggcggcggcgatg 41 |||||||||||||||||||||| Sbjct: 24351677 gggggcggcggcggcggcgatg 24351698 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatggg 43 ||||||||||||||||||||| Sbjct: 8734276 ggcggcggcggcggcgatggg 8734296 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 gcggcggcggcggcgatgggg 44 ||||||||||||||||||||| Sbjct: 5947135 gcggcggcggcggcgatgggg 5947115 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 32327862 ggcggcggcggcggcgatgg 32327843 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 22133604 ggcggcggcggcggcgatgg 22133585 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 21041726 ggcggcggcggcggcgatgg 21041707 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 17554155 ggcggcggcggcggcgatgg 17554174 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 19 ggggggcggcggcggcggcg 38 |||||||||||||||||||| Sbjct: 11944686 ggggggcggcggcggcggcg 11944705 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 9165953 ggcggcggcggcggcgatgg 9165972 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 19 ggggggcggcggcggcggcg 38 |||||||||||||||||||| Sbjct: 5812207 ggggggcggcggcggcggcg 5812226 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 5425891 ggcggcggcggcggcgatgg 5425872 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 3097862 ggcggcggcggcggcgatgg 3097881 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 3073710 ggcggcggcggcggcgatgg 3073729 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 325295 ggcggcggcggcggcgatgg 325314
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgggg 44 |||||||||||||||||||||| Sbjct: 29490966 ggcggcggcggcggcgatgggg 29490945 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatggggctg 47 ||||||| ||||||||||||||||| Sbjct: 27577878 ggcggcgacggcggcgatggggctg 27577902 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatggg 43 ||||||||||||||||||||| Sbjct: 11126060 ggcggcggcggcggcgatggg 11126040 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 34383916 ggcggcggcggcggcgatgg 34383935 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 32343765 ggcggcggcggcggcgatgg 32343784 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 30775160 ggcggcggcggcggcgatgg 30775141 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 25 cggcggcggcggcgatggggctgc 48 |||||||||||||| ||||||||| Sbjct: 28778469 cggcggcggcggcgctggggctgc 28778492 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 18 tggggggcggcggcggcggcgatg 41 ||||||||| |||||||||||||| Sbjct: 28169683 tggggggcgacggcggcggcgatg 28169660 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 26708412 ggcggcggcggcggcgatgg 26708431 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 20 gggggcggcggcggcggcga 39 |||||||||||||||||||| Sbjct: 26275824 gggggcggcggcggcggcga 26275805 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 23536830 ggcggcggcggcggcgatgg 23536811 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 19 ggggggcggcggcggcggcg 38 |||||||||||||||||||| Sbjct: 23192439 ggggggcggcggcggcggcg 23192458 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 19940436 ggcggcggcggcggcgatgg 19940455 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 18545983 ggcggcggcggcggcgatgg 18546002 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 12489433 ggcggcggcggcggcgatgg 12489452 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 20 gggggcggcggcggcggcga 39 |||||||||||||||||||| Sbjct: 9501628 gggggcggcggcggcggcga 9501609 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 20 gggggcggcggcggcggcga 39 |||||||||||||||||||| Sbjct: 8741872 gggggcggcggcggcggcga 8741853 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 19 ggggggcggcggcggcggcg 38 |||||||||||||||||||| Sbjct: 6999960 ggggggcggcggcggcggcg 6999979 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 2037596 ggcggcggcggcggcgatgg 2037577 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 1302348 ggcggcggcggcggcgatgg 1302329 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 887643 ggcggcggcggcggcgatgg 887624 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 21 ggggcggcggcggcggcgatgggg 44 |||||||||||||||| ||||||| Sbjct: 633605 ggggcggcggcggcggagatgggg 633582
>gb|AC172304.2| Gallus gallus BAC clone CH261-75C12 from chromosome ul, complete sequence Length = 227366 Score = 44.1 bits (22), Expect = 0.45 Identities = 25/26 (96%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatggggctgc 48 |||||||||||||||||||| ||||| Sbjct: 80422 ggcggcggcggcggcgatggcgctgc 80397
>dbj|AP004401.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0534A03 Length = 153170 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgggg 44 |||||||||||||||||||||| Sbjct: 77993 ggcggcggcggcggcgatgggg 78014
>dbj|AP005919.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0554A06 Length = 165311 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Minus Query: 17 ctggggggcggcggcggcggcg 38 |||||||||||||||||||||| Sbjct: 50349 ctggggggcggcggcggcggcg 50328
>dbj|AP003983.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1038_A06 Length = 147836 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgggg 44 |||||||||||||||||||||| Sbjct: 85996 ggcggcggcggcggcgatgggg 85975
>dbj|AP005093.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OJ1294_G06 Length = 115468 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 22 gggcggcggcggcggcgatggg 43 |||||||||||||||||||||| Sbjct: 69671 gggcggcggcggcggcgatggg 69692
>dbj|AP005308.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0047B10 Length = 158798 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgggg 44 |||||||||||||||||||||| Sbjct: 123436 ggcggcggcggcggcgatgggg 123457
>dbj|AP006156.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:B1043F11 Length = 167137 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 16 gctggggggcggcggcggcggc 37 |||||||||||||||||||||| Sbjct: 91607 gctggggggcggcggcggcggc 91628
>gb|AC151311.2| Xenopus tropicalis clone ISB-158O8, complete sequence Length = 87840 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 19 ggggggcggcggcggcggcgat 40 |||||||||||||||||||||| Sbjct: 75221 ggggggcggcggcggcggcgat 75242
>dbj|AP004761.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0686C03 Length = 164529 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgggg 44 |||||||||||||||||||||| Sbjct: 76162 ggcggcggcggcggcgatgggg 76141
>dbj|AP004566.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0498H04 Length = 151046 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgggg 44 |||||||||||||||||||||| Sbjct: 105095 ggcggcggcggcggcgatgggg 105074 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatggg 43 ||||||||||||||||||||| Sbjct: 3421 ggcggcggcggcggcgatggg 3401
>dbj|AK121176.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023083C18, full insert sequence Length = 830 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgggg 44 |||||||||||||||||||||| Sbjct: 74 ggcggcggcggcggcgatgggg 95
>dbj|AK111342.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-181-F09, full insert sequence Length = 1289 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgggg 44 |||||||||||||||||||||| Sbjct: 209 ggcggcggcggcggcgatgggg 230
>dbj|AK105197.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-107-G03, full insert sequence Length = 791 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgggg 44 |||||||||||||||||||||| Sbjct: 98 ggcggcggcggcggcgatgggg 119
>emb|AJ338148.1|HSA338148 Homo sapiens genomic sequence surrounding NotI site, clone NL1-DH14R Length = 961 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 16 gctggggggcggcggcggcggc 37 |||||||||||||||||||||| Sbjct: 12 gctggggggcggcggcggcggc 33
>dbj|AK072130.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013127L10, full insert sequence Length = 2964 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgggg 44 |||||||||||||||||||||| Sbjct: 233 ggcggcggcggcggcgatgggg 254
>dbj|AK060505.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-018-H11, full insert sequence Length = 2134 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 20 gggggcggcggcggcggcgatg 41 |||||||||||||||||||||| Sbjct: 1506 gggggcggcggcggcggcgatg 1527
>gb|AY107408.1| Zea mays PCO142888 mRNA sequence Length = 1677 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgggg 44 |||||||||||||||||||||| Sbjct: 147 ggcggcggcggcggcgatgggg 126
>gb|AY104206.1| Zea mays PCO118554 mRNA sequence Length = 1181 Score = 44.1 bits (22), Expect = 0.45 Identities = 49/58 (84%) Strand = Plus / Plus Query: 90 cacatctacacctggagggccgtctacgcctactcccaccacggtatttatgttggag 147 ||||||||||| ||| |||||| |||| |||| |||||||||| || |||| ||||| Sbjct: 401 cacatctacacttggcgggccgcctacatctacgcccaccacggaatatatgctggag 458
>gb|AY104029.1| Zea mays PCO076082 mRNA sequence Length = 1018 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgggg 44 |||||||||||||||||||||| Sbjct: 45 ggcggcggcggcggcgatgggg 66
>gb|AF119043.1|AF119043 Homo sapiens transcriptional intermediary factor 1 gamma mRNA, complete cds Length = 3510 Score = 44.1 bits (22), Expect = 0.45 Identities = 25/26 (96%) Strand = Plus / Plus Query: 20 gggggcggcggcggcggcgatggggc 45 |||||||||||||||||||| ||||| Sbjct: 16 gggggcggcggcggcggcgacggggc 41
>gb|AC159020.2| Pan troglodytes BAC clone CH251-530A5 from chromosome unknown, complete sequence Length = 219428 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Minus Query: 17 ctggggggcggcggcggcggcg 38 |||||||||||||||||||||| Sbjct: 208547 ctggggggcggcggcggcggcg 208526
>emb|AL713900.4|CNS07YQ0 Oryza sativa chromosome 12, . BAC OJ1126_F07 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 99791 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgggg 44 |||||||||||||||||||||| Sbjct: 40662 ggcggcggcggcggcgatgggg 40683
>emb|AL596384.17| Mouse DNA sequence from clone RP23-353J21 on chromosome 11, complete sequence Length = 219695 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgggg 44 |||||||||||||||||||||| Sbjct: 216318 ggcggcggcggcggcgatgggg 216297
>ref|NM_188289.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2106 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 22 gggcggcggcggcggcgatgg 42 ||||||||||||||||||||| Sbjct: 182 gggcggcggcggcggcgatgg 202
>ref|XM_550363.1| Oryza sativa (japonica cultivar-group), mRNA Length = 3082 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 tggggggcggcggcggcggcg 38 ||||||||||||||||||||| Sbjct: 114 tggggggcggcggcggcggcg 94
>ref|XM_481746.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1833 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatggg 43 ||||||||||||||||||||| Sbjct: 697 ggcggcggcggcggcgatggg 717
>ref|XM_479737.1| Oryza sativa (japonica cultivar-group), mRNA Length = 3088 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatggg 43 ||||||||||||||||||||| Sbjct: 1653 ggcggcggcggcggcgatggg 1673
>ref|XM_476129.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1137 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 21 ggggcggcggcggcggcgatg 41 ||||||||||||||||||||| Sbjct: 1116 ggggcggcggcggcggcgatg 1136
>ref|XM_465048.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1184 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatggg 43 ||||||||||||||||||||| Sbjct: 469 ggcggcggcggcggcgatggg 489
>ref|NM_197775.1| Oryza sativa (japonica cultivar-group) putative ribosomal protein L27 (OSJNBa0027P10.10), mRNA Length = 676 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatggg 43 ||||||||||||||||||||| Sbjct: 464 ggcggcggcggcggcgatggg 484
>ref|NM_191394.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1908 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 24 gcggcggcggcggcgatggggctgc 48 ||||| ||||||||||||||||||| Sbjct: 392 gcggccgcggcggcgatggggctgc 416
>ref|NM_189502.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1473 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 19 ggggggcggcggcggcggcga 39 ||||||||||||||||||||| Sbjct: 60 ggggggcggcggcggcggcga 80
>ref|XM_479608.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2204 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatggg 43 ||||||||||||||||||||| Sbjct: 1706 ggcggcggcggcggcgatggg 1726
>ref|XM_479162.1| Oryza sativa (japonica cultivar-group), mRNA Length = 351 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 gcggcggcggcggcgatgggg 44 ||||||||||||||||||||| Sbjct: 55 gcggcggcggcggcgatgggg 35
>ref|XM_477282.1| Oryza sativa (japonica cultivar-group), mRNA Length = 3746 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 18 tggggggcggcggcggcggcg 38 ||||||||||||||||||||| Sbjct: 598 tggggggcggcggcggcggcg 618
>ref|XM_477202.1| Oryza sativa (japonica cultivar-group), mRNA Length = 679 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatggg 43 ||||||||||||||||||||| Sbjct: 30 ggcggcggcggcggcgatggg 10
>ref|NM_186688.2| Oryza sativa (japonica cultivar-group), mRNA Length = 1155 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatggg 43 ||||||||||||||||||||| Sbjct: 35 ggcggcggcggcggcgatggg 15
>ref|XM_472915.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 336 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 21 ggggcggcggcggcggcgatg 41 ||||||||||||||||||||| Sbjct: 92 ggggcggcggcggcggcgatg 112
>gb|AY023541.1| Oryza sativa microsatellite MRG5866 containing (TGG)X8, closest to marker C226A, genomic sequence Length = 224 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 18 tggggggcggcggcggcggcg 38 ||||||||||||||||||||| Sbjct: 34 tggggggcggcggcggcggcg 54
>gb|AY023262.1| Oryza sativa microsatellite MRG5587 containing (GGC)X8, closest to marker C226A, genomic sequence Length = 224 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 18 tggggggcggcggcggcggcg 38 ||||||||||||||||||||| Sbjct: 96 tggggggcggcggcggcggcg 116
>gb|AC092387.6| Oryza sativa (japonica cultivar-group) chromosome 10 clone OJ1004_F02 map C8, complete sequence Length = 116304 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 21 ggggcggcggcggcggcgatg 41 ||||||||||||||||||||| Sbjct: 76161 ggggcggcggcggcggcgatg 76181
>gb|AC132490.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0570A02, complete sequence Length = 146541 Score = 42.1 bits (21), Expect = 1.8 Identities = 33/37 (89%) Strand = Plus / Minus Query: 484 agaagaattgcgaggactttgcactctactgcaagac 520 |||| ||||||||||||||||| | ||||||||||| Sbjct: 113060 agaacaattgcgaggactttgcgatatactgcaagac 113024
>gb|AC130599.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0016G07, complete sequence Length = 123167 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 21 ggggcggcggcggcggcgatg 41 ||||||||||||||||||||| Sbjct: 9201 ggggcggcggcggcggcgatg 9181
>gb|AC125780.2| Oryza sativa (japonica culitvar-group) chromosome 11 BAC clone OSJNBa0030I15, complete sequence Length = 148498 Score = 42.1 bits (21), Expect = 1.8 Identities = 27/29 (93%) Strand = Plus / Minus Query: 76 tcaggcccggcgaccacatctacacctgg 104 ||||||||||||| ||||||||| ||||| Sbjct: 105686 tcaggcccggcgatcacatctacgcctgg 105658
>ref|XM_445830.1| Candida glabrata CBS138, CAGL0E03245g partial mRNA Length = 1278 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 174 aagaaggaagttgaatcttca 194 ||||||||||||||||||||| Sbjct: 52 aagaaggaagttgaatcttca 72
>ref|XM_538574.2| PREDICTED: Canis familiaris similar to ADAMTS-2 precursor (A disintegrin and metalloproteinase with thrombospondin motifs 2) (ADAM-TS 2) (ADAM-TS2) (Procollagen I/II amino-propeptide processing enzyme) (Procollagen I N-proteinase) (PC I-NP) (Procollagen N-endopeptidase) (pNPI..., transcript variant 2 (LOC481453), mRNA Length = 3282 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 19 ggggggcggcggcggcggcga 39 ||||||||||||||||||||| Sbjct: 127 ggggggcggcggcggcggcga 107
>ref|XM_843844.1| PREDICTED: Canis familiaris similar to ADAMTS-2 precursor (A disintegrin and metalloproteinase with thrombospondin motifs 2) (ADAM-TS 2) (ADAM-TS2) (Procollagen I/II amino-propeptide processing enzyme) (Procollagen I N-proteinase) (PC I-NP) (Procollagen N-endopeptidase) (pNPI..., transcript variant 3 (LOC481453), mRNA Length = 3645 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 19 ggggggcggcggcggcggcga 39 ||||||||||||||||||||| Sbjct: 127 ggggggcggcggcggcggcga 107
>gb|AF480884.1| Chimpanzee cytomegalovirus, complete genome Length = 241087 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 tggggggcggcggcggcggcg 38 ||||||||||||||||||||| Sbjct: 85677 tggggggcggcggcggcggcg 85657
>ref|XM_546111.2| PREDICTED: Canis familiaris similar to coiled-coil domain containing 6 (LOC488993), mRNA Length = 1776 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 tggggggcggcggcggcggcg 38 ||||||||||||||||||||| Sbjct: 1696 tggggggcggcggcggcggcg 1676
>ref|XM_541235.2| PREDICTED: Canis familiaris similar to C34E11.3 (LOC484118), mRNA Length = 3449 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 18 tggggggcggcggcggcggcg 38 ||||||||||||||||||||| Sbjct: 734 tggggggcggcggcggcggcg 754
>emb|AL162591.16| Human DNA sequence from clone RP11-350G8 on chromosome 1 Contains the 3' end of the AQP10 gene for aquaporin 10, the ATP8B2 gene for ATPase, Class I, type 8B, member 2, a mitochondrial ribosomal protein S33 (MRPS33) pseudogene, a novel gene, the IL6R gene for interleukin 6 receptor, a proteasome (prosome, macropain) 26S subunit, non-ATPase, 8 (PSMD8) pseduogene, a novel gene (LOC126669), the 5' end of a novel gene (DKFZp434M202) and a CpG island, complete sequence Length = 201167 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 tggggggcggcggcggcggcg 38 ||||||||||||||||||||| Sbjct: 195114 tggggggcggcggcggcggcg 195094
>emb|AL121758.24|HSDJ850E9 Human DNA sequence from clone RP5-850E9 on chromosome 20 Contains part of the gene for a novel C2H2 type zinc finger protein similar to Drosophila Scratch (Scrt), Slug and Xenopus Snail, the C20orf139 gene for a novel protein similar to Drosophila CG6762 and five CpG islands, complete sequence Length = 114791 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 24 gcggcggcggcggcgatggggctgc 48 |||||||||||| |||||||||||| Sbjct: 37330 gcggcggcggcgacgatggggctgc 37306
>ref|XM_966269.1| PREDICTED: Tribolium castaneum similar to CG8127-PB, isoform B (LOC660005), mRNA Length = 2310 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 tggggggcggcggcggcggcg 38 ||||||||||||||||||||| Sbjct: 103 tggggggcggcggcggcggcg 83
>ref|XM_965399.1| PREDICTED: Tribolium castaneum similar to 65 kDa Yes-associated protein (YAP65) (LOC659065), mRNA Length = 1341 Score = 42.1 bits (21), Expect = 1.8 Identities = 27/29 (93%) Strand = Plus / Minus Query: 20 gggggcggcggcggcggcgatggggctgc 48 ||||||||||||||||||| ||| ||||| Sbjct: 273 gggggcggcggcggcggcggtggagctgc 245
>emb|CR380951.1| Candida glabrata strain CBS138 chromosome E complete sequence Length = 687501 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 174 aagaaggaagttgaatcttca 194 ||||||||||||||||||||| Sbjct: 300462 aagaaggaagttgaatcttca 300442
>emb|AL833944.1|HSM805120 Homo sapiens mRNA; cDNA DKFZp727A181 (from clone DKFZp727A181) Length = 2580 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 24 gcggcggcggcggcgatggggctgc 48 |||||||||||| |||||||||||| Sbjct: 47 gcggcggcggcgacgatggggctgc 71
>emb|AL603707.5| Mouse DNA sequence from clone RP23-422L16 on chromosome 11 Contains the 3' end of the Sat2 gene for spermidine/spermine N1-acetyl transferase 2, a ribosomal potein S15A (Rps15a) pseudogene, a ubiquitin-like 5 (Ubl5) pseudogene, the Fxr2h gene for autosomal homolog of fragile X mental retardation gene 2, the Sox15 gene for SRY-box containing gene 15, the Mpdu1 gene for mannose-P-dolichol utilization defect 1, the Cd68 gene for CD68 antigen, the Eif4a1 gene for eukaryotic translation initiation factor 4A1, the gene for sentrin/SUMO-specific protease Smt3ip1, the Tnfsf13 and Tnfsf12 genes for tumor necrosis factor (ligand) superfamily members 13 and 12, three novel genes, a ribosomal protein L13 (Rpl13) pseudogene, the Polr2a gene for polymerase (RNA) II (DNA directed) polypeptide A, the Amac1 gene for acyl-malonyl condensing enzyme, the gene for a novel BTB/POZ domain containing C2H2 type zinc finger protein, the Chrnb1 gene for nicotinic cholinergic receptor beta polypeptide 1 (muscle), the Fgf11 gene for fibroblast growth factor 11, a novel pseudogene, the gene for the ortholog of human and rat neuroligin 2 NLGN2, the gene for a novel protein of unknown function (DUF423) family member, the Plscr3 gene for phospholipid scramblase 3, the 3' end of the Tnk1 gene for non-receptor tyrosine kinase 1 and nine CpG islands, complete sequence Length = 234182 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatggggctg 47 |||||||||||||||| |||||||| Sbjct: 145153 ggcggcggcggcggcggtggggctg 145177
>emb|AL606614.3|OSJN00047 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0011N17, complete sequence Length = 129498 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 21 ggggcggcggcggcggcgatg 41 ||||||||||||||||||||| Sbjct: 51962 ggggcggcggcggcggcgatg 51942
>dbj|AK127435.1| Homo sapiens cDNA FLJ45527 fis, clone BRTHA2027229 Length = 2532 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 24 gcggcggcggcggcgatggggctgc 48 |||||||||||| |||||||||||| Sbjct: 16 gcggcggcggcgacgatggggctgc 40
>gb|AC092172.3| Oryza sativa (japonica cultivar-group) chromosome 10 clone OSJNBa0014J14, complete sequence Length = 191397 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 21 ggggcggcggcggcggcgatg 41 ||||||||||||||||||||| Sbjct: 44902 ggggcggcggcggcggcgatg 44922
>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome Length = 4967148 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatggg 43 ||||||||||||||||||||| Sbjct: 14733 ggcggcggcggcggcgatggg 14713 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 20 gggggcggcggcggcggcga 39 |||||||||||||||||||| Sbjct: 3168169 gggggcggcggcggcggcga 3168150
>gb|AC112513.1| Oryza sativa chromosome 10 clone OSJNAa0029P06, complete sequence Length = 122319 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 19 ggggggcggcggcggcggcga 39 ||||||||||||||||||||| Sbjct: 14099 ggggggcggcggcggcggcga 14119
>gb|AC090873.4| Oryza sativa chromosome 10 clone OSJNBa0029P06, complete sequence Length = 151533 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 19 ggggggcggcggcggcggcga 39 ||||||||||||||||||||| Sbjct: 105632 ggggggcggcggcggcggcga 105652
>dbj|AK163593.1| Mus musculus 4 days neonate male adipose cDNA, RIKEN full-length enriched library, clone:B430111I02 product:KAISO-like zinc finger protein 1 homolog [Homo sapiens], full insert sequence Length = 4075 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatggggctg 47 |||||||||||||||| |||||||| Sbjct: 14 ggcggcggcggcggcggtggggctg 38
>gb|AC084763.4| Oryza sativa chromosome 10 BAC OSJNBa0027P10 genomic sequence, complete sequence Length = 141307 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatggg 43 ||||||||||||||||||||| Sbjct: 84012 ggcggcggcggcggcgatggg 83992
>gb|AC135205.4| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1012B02, complete sequence Length = 115270 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatggg 43 ||||||||||||||||||||| Sbjct: 80092 ggcggcggcggcggcgatggg 80112
>gb|AC134241.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBb0085F02, complete sequence Length = 128535 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 gcggcggcggcggcgatgggg 44 ||||||||||||||||||||| Sbjct: 97544 gcggcggcggcggcgatgggg 97524
>gb|AC135158.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1193C08, complete sequence Length = 111961 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 gcggcggcggcggcgatgggg 44 ||||||||||||||||||||| Sbjct: 6457 gcggcggcggcggcgatgggg 6437
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 42.1 bits (21), Expect = 1.8 Identities = 27/29 (93%) Strand = Plus / Minus Query: 76 tcaggcccggcgaccacatctacacctgg 104 ||||||||||||| ||||||||| ||||| Sbjct: 24037819 tcaggcccggcgatcacatctacgcctgg 24037791 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 25548798 ggcggcggcggcggcgatgg 25548817 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 20070963 ggcggcggcggcggcgatgg 20070944 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 19940543 ggcggcggcggcggcgatgg 19940524 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 11809090 ggcggcggcggcggcgatgg 11809071 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 3338101 ggcggcggcggcggcgatgg 3338120 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 2473850 ggcggcggcggcggcgatgg 2473831 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 19 ggggggcggcggcggcggcg 38 |||||||||||||||||||| Sbjct: 2152269 ggggggcggcggcggcggcg 2152288 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 19 ggggggcggcggcggcggcg 38 |||||||||||||||||||| Sbjct: 1859986 ggggggcggcggcggcggcg 1860005
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatggg 43 ||||||||||||||||||||| Sbjct: 21769329 ggcggcggcggcggcgatggg 21769309 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 21 ggggcggcggcggcggcgatg 41 ||||||||||||||||||||| Sbjct: 7219543 ggggcggcggcggcggcgatg 7219563 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 19 ggggggcggcggcggcggcga 39 ||||||||||||||||||||| Sbjct: 2448900 ggggggcggcggcggcggcga 2448920 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 21953032 ggcggcggcggcggcgatgg 21953051 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 17263543 ggcggcggcggcggcgatgg 17263524
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 19 ggggggcggcggcggcggcga 39 ||||||||||||||||||||| Sbjct: 43136222 ggggggcggcggcggcggcga 43136242 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 24 gcggcggcggcggcgatggggctgc 48 ||||| ||||||||||||||||||| Sbjct: 32361868 gcggccgcggcggcgatggggctgc 32361892 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 22 gggcggcggcggcggcgatgg 42 ||||||||||||||||||||| Sbjct: 5492570 gggcggcggcggcggcgatgg 5492590 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 43181548 ggcggcggcggcggcgatgg 43181567 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 40591354 ggcggcggcggcggcgatgg 40591335 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 38987005 ggcggcggcggcggcgatgg 38986986 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 37522973 ggcggcggcggcggcgatgg 37522992 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 36415960 ggcggcggcggcggcgatgg 36415941 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 19 ggggggcggcggcggcggcg 38 |||||||||||||||||||| Sbjct: 35531869 ggggggcggcggcggcggcg 35531888 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 35316381 ggcggcggcggcggcgatgg 35316400 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 24330613 ggcggcggcggcggcgatgg 24330594 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 22994317 ggcggcggcggcggcgatgg 22994298 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 22672225 ggcggcggcggcggcgatgg 22672244 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 19 ggggggcggcggcggcggcg 38 |||||||||||||||||||| Sbjct: 21957083 ggggggcggcggcggcggcg 21957102 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 18 tggggggcggcggcggcggcgatg 41 ||||||||| |||||||||||||| Sbjct: 14987011 tggggggcgacggcggcggcgatg 14986988 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 13328179 ggcggcggcggcggcgatgg 13328160 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 18 tggggggcggcggcggcggcgatg 41 ||||||||| |||||||||||||| Sbjct: 12992550 tggggggcgacggcggcggcgatg 12992527 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 8758470 ggcggcggcggcggcgatgg 8758489 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 25 cggcggcggcggcgatggggctgc 48 ||||||||||||||||| |||||| Sbjct: 7804395 cggcggcggcggcgatgaggctgc 7804418 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 20 gggggcggcggcggcggcga 39 |||||||||||||||||||| Sbjct: 7581586 gggggcggcggcggcggcga 7581605 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 21 ggggcggcggcggcggcgat 40 |||||||||||||||||||| Sbjct: 3848510 ggggcggcggcggcggcgat 3848491 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 3312109 ggcggcggcggcggcgatgg 3312128
>gb|AC009973.10| Homo sapiens BAC clone RP11-457P23 from 2, complete sequence Length = 202383 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 360 gcaattttccttgcaaaattt 380 ||||||||||||||||||||| Sbjct: 114732 gcaattttccttgcaaaattt 114752
>emb|BX934451.1| Gallus gallus finished cDNA, clone ChEST963a2 Length = 934 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatggg 43 ||||||||||||||||||||| Sbjct: 12 ggcggcggcggcggcgatggg 32
>dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0459B04 Length = 142475 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 19 ggggggcggcggcggcggcga 39 ||||||||||||||||||||| Sbjct: 133251 ggggggcggcggcggcggcga 133271
>dbj|AP003228.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0020E09 Length = 149195 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 19 ggggggcggcggcggcggcga 39 ||||||||||||||||||||| Sbjct: 23677 ggggggcggcggcggcggcga 23697 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 69003 ggcggcggcggcggcgatgg 69022
>emb|BX930224.1| Gallus gallus finished cDNA, clone ChEST1019f6 Length = 922 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatggg 43 ||||||||||||||||||||| Sbjct: 2 ggcggcggcggcggcgatggg 22
>ref|NM_080725.1| Homo sapiens sulfiredoxin 1 homolog (S. cerevisiae) (SRXN1), mRNA Length = 2580 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 24 gcggcggcggcggcgatggggctgc 48 |||||||||||| |||||||||||| Sbjct: 47 gcggcggcggcgacgatggggctgc 71
>dbj|AP004378.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0496C02 Length = 148419 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatggg 43 ||||||||||||||||||||| Sbjct: 16757 ggcggcggcggcggcgatggg 16737
>dbj|AP004316.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0597G07 Length = 152928 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatggg 43 ||||||||||||||||||||| Sbjct: 75762 ggcggcggcggcggcgatggg 75782
>dbj|AP004574.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0702G08 Length = 144596 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatggg 43 ||||||||||||||||||||| Sbjct: 37712 ggcggcggcggcggcgatggg 37732
>dbj|AP003833.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1477_F01 Length = 158792 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatggg 43 ||||||||||||||||||||| Sbjct: 103480 ggcggcggcggcggcgatggg 103460
>dbj|AP003197.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1015E06 Length = 164583 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 22 gggcggcggcggcggcgatgg 42 ||||||||||||||||||||| Sbjct: 89410 gggcggcggcggcggcgatgg 89430
>dbj|AP006060.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0135D07 Length = 170587 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatggggctg 47 ||||||| ||||||||||||||||| Sbjct: 57547 ggcggcgacggcggcgatggggctg 57571
>dbj|AB023482.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, clone P0680A03 Length = 156054 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 tggggggcggcggcggcggcg 38 ||||||||||||||||||||| Sbjct: 67235 tggggggcggcggcggcggcg 67215
>dbj|AP003371.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1143G03 Length = 137770 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 24 gcggcggcggcggcgatggggctgc 48 ||||| ||||||||||||||||||| Sbjct: 41365 gcggccgcggcggcgatggggctgc 41389
>dbj|AP005445.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0028E05 Length = 157631 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 22 gggcggcggcggcggcgatgg 42 ||||||||||||||||||||| Sbjct: 122501 gggcggcggcggcggcgatgg 122481
>dbj|AP003377.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJNBb0053G03 Length = 101901 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 24 gcggcggcggcggcgatggggctgc 48 ||||| ||||||||||||||||||| Sbjct: 94153 gcggccgcggcggcgatggggctgc 94177
>dbj|AP005833.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OJ1328_D07 Length = 155007 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 18 tggggggcggcggcggcggcg 38 ||||||||||||||||||||| Sbjct: 70908 tggggggcggcggcggcggcg 70928
>dbj|AP006174.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0229B10 Length = 114509 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatggggctg 47 ||||||| ||||||||||||||||| Sbjct: 99770 ggcggcgccggcggcgatggggctg 99794
>dbj|AP005824.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0669H03 Length = 167878 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 18 tggggggcggcggcggcggcg 38 ||||||||||||||||||||| Sbjct: 61688 tggggggcggcggcggcggcg 61708
>dbj|AP005198.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0616D06 Length = 153800 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 gcggcggcggcggcgatgggg 44 ||||||||||||||||||||| Sbjct: 131857 gcggcggcggcggcgatgggg 131837
>dbj|AP004988.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:B1056G08 Length = 168173 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 gcggcggcggcggcgatgggg 44 ||||||||||||||||||||| Sbjct: 8276 gcggcggcggcggcgatgggg 8256
>dbj|AP004229.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1124_E11 Length = 133524 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatggg 43 ||||||||||||||||||||| Sbjct: 108754 ggcggcggcggcggcgatggg 108734
>dbj|AP003988.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1057_D08 Length = 119557 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatggg 43 ||||||||||||||||||||| Sbjct: 45239 ggcggcggcggcggcgatggg 45219
>dbj|AP004584.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0007D08 Length = 183142 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatggg 43 ||||||||||||||||||||| Sbjct: 166003 ggcggcggcggcggcgatggg 165983
>dbj|AP005517.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJNBb0090H20 Length = 132628 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 21 ggggcggcggcggcggcgatg 41 ||||||||||||||||||||| Sbjct: 4010 ggggcggcggcggcggcgatg 4030
>dbj|AP004183.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1221_H04 Length = 129387 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 21 ggggcggcggcggcggcgatg 41 ||||||||||||||||||||| Sbjct: 113446 ggggcggcggcggcggcgatg 113466
>dbj|AK119570.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-117-A09, full insert sequence Length = 1725 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 21 ggggcggcggcggcggcgatg 41 ||||||||||||||||||||| Sbjct: 518 ggggcggcggcggcggcgatg 538
>dbj|AP005246.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJNBa0061L20 Length = 138926 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatggg 43 ||||||||||||||||||||| Sbjct: 28496 ggcggcggcggcggcgatggg 28516 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 20 gggggcggcggcggcggcga 39 |||||||||||||||||||| Sbjct: 16694 gggggcggcggcggcggcga 16675
>dbj|AK111142.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-176-E03, full insert sequence Length = 679 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatggg 43 ||||||||||||||||||||| Sbjct: 30 ggcggcggcggcggcgatggg 10
>dbj|AK099735.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013090G16, full insert sequence Length = 2064 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 18 tggggggcggcggcggcggcg 38 ||||||||||||||||||||| Sbjct: 598 tggggggcggcggcggcggcg 618
>dbj|AK106941.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-119-D05, full insert sequence Length = 1184 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatggg 43 ||||||||||||||||||||| Sbjct: 469 ggcggcggcggcggcgatggg 489
>dbj|AK101686.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033058P13, full insert sequence Length = 3082 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 tggggggcggcggcggcggcg 38 ||||||||||||||||||||| Sbjct: 114 tggggggcggcggcggcggcg 94
>dbj|AK100914.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023133D04, full insert sequence Length = 3746 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 18 tggggggcggcggcggcggcg 38 ||||||||||||||||||||| Sbjct: 598 tggggggcggcggcggcggcg 618
>dbj|AK100789.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023121A18, full insert sequence Length = 1706 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 21 ggggcggcggcggcggcgatg 41 ||||||||||||||||||||| Sbjct: 518 ggggcggcggcggcggcgatg 538
>dbj|AK100694.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023114I18, full insert sequence Length = 2924 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatggg 43 ||||||||||||||||||||| Sbjct: 688 ggcggcggcggcggcgatggg 708
>dbj|AK073916.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033071M20, full insert sequence Length = 1753 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatggggctg 47 ||||||| ||||||||||||||||| Sbjct: 103 ggcggcgacggcggcgatggggctg 127
>dbj|AK073637.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033048B22, full insert sequence Length = 1155 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatggg 43 ||||||||||||||||||||| Sbjct: 35 ggcggcggcggcggcgatggg 15
>dbj|AK072300.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023020B06, full insert sequence Length = 3088 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatggg 43 ||||||||||||||||||||| Sbjct: 1653 ggcggcggcggcggcgatggg 1673
>dbj|AK071235.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023086P13, full insert sequence Length = 2221 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatggg 43 ||||||||||||||||||||| Sbjct: 1723 ggcggcggcggcggcgatggg 1743
>dbj|AK068459.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013151C17, full insert sequence Length = 3464 Score = 42.1 bits (21), Expect = 1.8 Identities = 33/37 (89%) Strand = Plus / Minus Query: 484 agaagaattgcgaggactttgcactctactgcaagac 520 |||| ||||||||||||||||| | ||||||||||| Sbjct: 2617 agaacaattgcgaggactttgcgatatactgcaagac 2581
>dbj|AK067198.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013098D13, full insert sequence Length = 2679 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 24 gcggcggcggcggcgatggggctgc 48 ||||| ||||||||||||||||||| Sbjct: 874 gcggccgcggcggcgatggggctgc 898
>dbj|AK066392.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013065E20, full insert sequence Length = 2300 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatggg 43 ||||||||||||||||||||| Sbjct: 105 ggcggcggcggcggcgatggg 125
>dbj|AK066340.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013064A22, full insert sequence Length = 723 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatggg 43 ||||||||||||||||||||| Sbjct: 478 ggcggcggcggcggcgatggg 498
>dbj|AK060582.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-023-H05, full insert sequence Length = 2221 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 gcggcggcggcggcgatgggg 44 ||||||||||||||||||||| Sbjct: 48 gcggcggcggcggcgatgggg 28
>emb|AL442104.2| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0510A06, complete sequence Length = 90767 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 21 ggggcggcggcggcggcgatg 41 ||||||||||||||||||||| Sbjct: 21075 ggggcggcggcggcggcgatg 21055
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatggg 43 ||||||||||||||||||||| Sbjct: 21780992 ggcggcggcggcggcgatggg 21780972 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 21 ggggcggcggcggcggcgatg 41 ||||||||||||||||||||| Sbjct: 7222840 ggggcggcggcggcggcgatg 7222860 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 19 ggggggcggcggcggcggcga 39 ||||||||||||||||||||| Sbjct: 2448851 ggggggcggcggcggcggcga 2448871 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 21964695 ggcggcggcggcggcgatgg 21964714 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 17272583 ggcggcggcggcggcgatgg 17272564
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 42.1 bits (21), Expect = 1.8 Identities = 27/29 (93%) Strand = Plus / Minus Query: 76 tcaggcccggcgaccacatctacacctgg 104 ||||||||||||| ||||||||| ||||| Sbjct: 24349488 tcaggcccggcgatcacatctacgcctgg 24349460 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 25867468 ggcggcggcggcggcgatgg 25867487 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 20357639 ggcggcggcggcggcgatgg 20357620 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 20225522 ggcggcggcggcggcgatgg 20225503 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 11887501 ggcggcggcggcggcgatgg 11887482 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 3346806 ggcggcggcggcggcgatgg 3346825 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 2481586 ggcggcggcggcggcgatgg 2481567 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 19 ggggggcggcggcggcggcg 38 |||||||||||||||||||| Sbjct: 2160050 ggggggcggcggcggcggcg 2160069 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 19 ggggggcggcggcggcggcg 38 |||||||||||||||||||| Sbjct: 1857707 ggggggcggcggcggcggcg 1857726
>emb|AL831808.4|CNS08CAL Oryza sativa chromosome 12, . BAC OSJNBa0028H02 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 153064 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatggggctg 47 |||||||||||||||| |||||||| Sbjct: 7441 ggcggcggcggcggcggtggggctg 7465
>emb|AL928780.5|CNS08CCA Oryza sativa chromosome 12, . BAC OSJNBa0018C20 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 137492 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatggg 43 ||||||||||||||||||||| Sbjct: 30886 ggcggcggcggcggcgatggg 30866 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 25149 ggcggcggcggcggcgatgg 25168
>emb|BX255875.3|CNS09S4W Oryza sativa chromosome 12, . BAC OSJNBa0018L16 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 151203 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatggggctg 47 |||||||||||||||| |||||||| Sbjct: 59055 ggcggcggcggcggcggtggggctg 59031
>gb|AC009749.9| Drosophila melanogaster clone BACR40I04, complete sequence Length = 161276 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 19 ggggggcggcggcggcggcg 38 |||||||||||||||||||| Sbjct: 128842 ggggggcggcggcggcggcg 128823
>gb|AY633767.1| Bos taurus relaxin-3/INSL7 receptor 2 (GPCR142) mRNA, complete cds Length = 1122 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 692 ggcggcggcggcggcgatgg 711
>ref|NM_004952.3| Homo sapiens ephrin-A3 (EFNA3), mRNA Length = 1798 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 19 ggggggcggcggcggcggcg 38 |||||||||||||||||||| Sbjct: 42 ggggggcggcggcggcggcg 61
>ref|XM_476051.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 3372 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 21 ggcggcggcggcggcgatgg 40
>ref|XM_482299.1| Oryza sativa (japonica cultivar-group), mRNA Length = 474 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 259 ggcggcggcggcggcgatgg 278
>gb|BC002822.2| Homo sapiens PHD finger protein 20-like 1, mRNA (cDNA clone IMAGE:3659595) Length = 1895 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 11 ggcggcggcggcggcgatgg 30
>ref|XM_550240.1| Oryza sativa (japonica cultivar-group), mRNA Length = 453 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 98 ggcggcggcggcggcgatgg 79
>ref|XM_550302.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1184 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 21 ggggcggcggcggcggcgat 40 |||||||||||||||||||| Sbjct: 155 ggggcggcggcggcggcgat 174
>ref|XM_550475.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2663 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 20 gggggcggcggcggcggcgatggg 43 ||||||||||||||||||| |||| Sbjct: 320 gggggcggcggcggcggcgttggg 297
>ref|XM_550650.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1626 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 20 gggggcggcggcggcggcga 39 |||||||||||||||||||| Sbjct: 198 gggggcggcggcggcggcga 217
>ref|NM_188714.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1152 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 25 cggcggcggcggcgatggggctgc 48 ||||||||||||||||| |||||| Sbjct: 1037 cggcggcggcggcgatgaggctgc 1060
>ref|NM_191595.2| Oryza sativa (japonica cultivar-group), mRNA Length = 1285 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 21 ggggcggcggcggcggcgat 40 |||||||||||||||||||| Sbjct: 129 ggggcggcggcggcggcgat 148
>ref|NM_188236.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 957 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 19 ggggggcggcggcggcggcg 38 |||||||||||||||||||| Sbjct: 18 ggggggcggcggcggcggcg 37
>ref|XM_476334.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1260 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 19 ggggggcggcggcggcggcg 38 |||||||||||||||||||| Sbjct: 123 ggggggcggcggcggcggcg 142
>gb|AC119291.5| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0052K01, complete sequence Length = 144395 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 20 gggggcggcggcggcggcga 39 |||||||||||||||||||| Sbjct: 112653 gggggcggcggcggcggcga 112672
>gb|AC130604.4| Oryza sativa (japonica cultivar-group) chromosome 5 clone B1155G07, complete sequence Length = 146712 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 128889 ggcggcggcggcggcgatgg 128870
>ref|XM_481229.1| Oryza sativa (japonica cultivar-group), mRNA Length = 921 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 123 ggcggcggcggcggcgatgg 142
>ref|XM_483648.1| Oryza sativa (japonica cultivar-group), mRNA Length = 975 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tgctggggggcggcggcggcggcg 38 ||||| |||||||||||||||||| Sbjct: 8 tgctgcggggcggcggcggcggcg 31
>ref|XM_483505.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1428 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 16 gctggggggcggcggcggcg 35 |||||||||||||||||||| Sbjct: 769 gctggggggcggcggcggcg 750
>ref|XM_482635.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1314 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 19 ggggggcggcggcggcggcg 38 |||||||||||||||||||| Sbjct: 80 ggggggcggcggcggcggcg 61
>ref|XM_480940.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2141 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 55 ggcggcggcggcggcgatgg 74
>ref|XM_480193.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1572 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 25 cggcggcggcggcgatgggg 44 |||||||||||||||||||| Sbjct: 55 cggcggcggcggcgatgggg 36
>ref|XM_507137.1| PREDICTED Oryza sativa (japonica cultivar-group), P0498E12.110 mRNA Length = 1578 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 25 cggcggcggcggcgatgggg 44 |||||||||||||||||||| Sbjct: 61 cggcggcggcggcgatgggg 42
>ref|XM_480056.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1410 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 19 ggggggcggcggcggcggcg 38 |||||||||||||||||||| Sbjct: 242 ggggggcggcggcggcggcg 261
>ref|XM_475794.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1092 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 20 gggggcggcggcggcggcga 39 |||||||||||||||||||| Sbjct: 3 gggggcggcggcggcggcga 22
>ref|XM_475707.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1251 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 66 ggcggcggcggcggcgatgg 85
>ref|XM_474174.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 420 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 24 gcggcggcggcggcgatggg 43 |||||||||||||||||||| Sbjct: 319 gcggcggcggcggcgatggg 338
>ref|XM_472431.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2328 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 19 ggggggcggcggcggcggcg 38 |||||||||||||||||||| Sbjct: 372 ggggggcggcggcggcggcg 391
>ref|XM_472466.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 387 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 138 ggcggcggcggcggcgatgg 157
>ref|XM_471040.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 900 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 16 ggcggcggcggcggcgatgg 35
>ref|NM_187534.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1179 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 19 ggggggcggcggcggcggcg 38 |||||||||||||||||||| Sbjct: 802 ggggggcggcggcggcggcg 783
>ref|NM_185019.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1389 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 1078 ggcggcggcggcggcgatgg 1097
>ref|XM_468288.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1893 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 113 ggcggcggcggcggcgatgg 94
>ref|XM_467971.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1023 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 799 ggcggcggcggcggcgatgg 818
>gb|DQ216262.1| Taeniopygia guttata clone 0058P0045G09 calcium/calmodulin-dependent protein kinase II variant 2-like mRNA, complete sequence Length = 781 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 19 ggggggcggcggcggcggcg 38 |||||||||||||||||||| Sbjct: 88 ggggggcggcggcggcggcg 107
>gb|DQ216261.1| Taeniopygia guttata clone 0062P0001H05 calcium/calmodulin-dependent protein kinase II variant 2-like mRNA, complete sequence Length = 1060 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 19 ggggggcggcggcggcggcg 38 |||||||||||||||||||| Sbjct: 116 ggggggcggcggcggcggcg 135
>gb|DQ216260.1| Taeniopygia guttata clone 0058P0003H01 calcium/calmodulin-dependent protein kinase II variant 2-like mRNA, complete sequence Length = 1278 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 19 ggggggcggcggcggcggcg 38 |||||||||||||||||||| Sbjct: 114 ggggggcggcggcggcggcg 133
>gb|DQ216259.1| Taeniopygia guttata clone 0058P0056E09 calcium/calmodulin-dependent protein kinase II variant 2-like mRNA, complete sequence Length = 990 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 19 ggggggcggcggcggcggcg 38 |||||||||||||||||||| Sbjct: 117 ggggggcggcggcggcggcg 136
>gb|DQ216258.1| Taeniopygia guttata clone 0058P0003G01 calcium/calmodulin-dependent protein kinase II variant 2-like mRNA, complete sequence Length = 1276 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 19 ggggggcggcggcggcggcg 38 |||||||||||||||||||| Sbjct: 99 ggggggcggcggcggcggcg 118
>gb|DQ216257.1| Taeniopygia guttata clone 0058P0018F02 calcium/calmodulin-dependent protein kinase II variant 2-like mRNA, complete sequence Length = 1464 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 19 ggggggcggcggcggcggcg 38 |||||||||||||||||||| Sbjct: 100 ggggggcggcggcggcggcg 119
>ref|XM_467308.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2319 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 25 cggcggcggcggcgatggggctgc 48 |||||||||||||| ||||||||| Sbjct: 32 cggcggcggcggcgctggggctgc 55
>ref|XM_467152.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1475 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 494 ggcggcggcggcggcgatgg 513
>ref|XM_466580.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1068 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 13 ggcggcggcggcggcgatgg 32
>ref|XM_466540.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1086 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 19 ggggggcggcggcggcggcg 38 |||||||||||||||||||| Sbjct: 230 ggggggcggcggcggcggcg 249
>ref|XM_465954.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2120 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 199 ggcggcggcggcggcgatgg 218
>ref|XM_465236.1| Oryza sativa (japonica cultivar-group), mRNA Length = 852 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 566 ggcggcggcggcggcgatgg 547
>ref|XM_464733.1| Oryza sativa (japonica cultivar-group), mRNA Length = 819 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 19 ggggggcggcggcggcggcg 38 |||||||||||||||||||| Sbjct: 264 ggggggcggcggcggcggcg 245
>ref|XM_464072.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2109 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 68 ggcggcggcggcggcgatgg 49
>ref|XM_463951.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1161 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 76 ggcggcggcggcggcgatgg 57
>ref|XM_463879.1| Oryza sativa (japonica cultivar-group), mRNA Length = 3356 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 3320 ggcggcggcggcggcgatgg 3301
>ref|XM_518924.1| PREDICTED: Pan troglodytes similar to RIKEN cDNA 1110007L15 (LOC463209), mRNA Length = 1871 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 80 ggcggcggcggcggcgatgg 99
>ref|XM_450842.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1543 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 147 ggcggcggcggcggcgatgg 128
>ref|XM_450350.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2392 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 20 gggggcggcggcggcggcga 39 |||||||||||||||||||| Sbjct: 174 gggggcggcggcggcggcga 155
>ref|NM_183924.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1716 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 28 ggcggcggcggcggcgatgg 47
>ref|NM_193800.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 879 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 18 tggggggcggcggcggcggcgatg 41 ||||||||| |||||||||||||| Sbjct: 2 tggggggcgacggcggcggcgatg 25
>ref|XM_479655.1| Oryza sativa (japonica cultivar-group), mRNA Length = 642 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 51 ggcggcggcggcggcgatgg 70
>ref|NM_190755.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 873 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 742 ggcggcggcggcggcgatgg 723
>ref|NM_190601.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1143 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 486 ggcggcggcggcggcgatgg 505
>ref|NM_190441.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1569 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 19 ggggggcggcggcggcggcg 38 |||||||||||||||||||| Sbjct: 30 ggggggcggcggcggcggcg 49
>ref|NM_190405.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1377 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ggcggcggcggcggcgatgg 42 |||||||||||||||||||| Sbjct: 39 ggcggcggcggcggcgatgg 20 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,249,362 Number of Sequences: 3902068 Number of extensions: 5249362 Number of successful extensions: 314795 Number of sequences better than 10.0: 757 Number of HSP's better than 10.0 without gapping: 823 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 261146 Number of HSP's gapped (non-prelim): 53522 length of query: 520 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 497 effective length of database: 17,143,297,704 effective search space: 8520218958888 effective search space used: 8520218958888 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)