ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | bags27g18 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_550447.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1937 Score = 474 bits (239), Expect = e-130 Identities = 464/539 (86%) Strand = Plus / Plus Query: 25 tctggcgggaagaagatatctataaatgatcttgtcattaaggctgcagcgttggctctt 84 ||||| || ||||||||||| |||||||||||||| || ||||| ||||| ||||||||| Sbjct: 1173 tctggtggcaagaagatatccataaatgatcttgttatcaaggccgcagcattggctctt 1232 Query: 85 cgtaaggttcctgcgtgtaacagttcctggatgaatgattttattcgccagtaccacaac 144 ||||| ||||||| |||||| || || ||||||||||||||||||||||| |||||||| Sbjct: 1233 cgtaatgttcctgagtgtaatagctcttggatgaatgattttattcgccaataccacaat 1292 Query: 145 gtgaacattaatgttgctgtacagactgagcatggtttgttcgttccagtagttagggac 204 |||||||| |||||||||||||| |||||| |||| ||||| ||||| ||| | ||||| Sbjct: 1293 gtgaacatcaatgttgctgtacaaactgaggatggcttgtttgttcccgtaataagggat 1352 Query: 205 gcggacaagaaagggttggccactattgctgatgaggtgaagcagttggctctaagagca 264 || |||||||| || | |||||||| ||||||||||||||||| |||||| |||||| Sbjct: 1353 gctgacaagaagggcctagccactatcgctgatgaggtgaagcaactggctcagagagca 1412 Query: 265 agggataacagcctaaaaccagaagattacgagggtggcactttcaccgtctcgaatctg 324 ||||| |||||||| || ||||| ||||| ||||||||||||||||| || || || || Sbjct: 1413 agggacaacagccttaagccagaggattatgagggtggcactttcactgtgtcaaacttg 1472 Query: 325 ggaggccctttcggaatcaagcaattctgtgccatcgtaaaccctccccaatcggcaatc 384 ||||||||||| ||||| ||||||||||||||||||||||| ||||| ||||| ||||| Sbjct: 1473 ggaggcccttttggaattaagcaattctgtgccatcgtaaatcctccacaatcagcaatt 1532 Query: 385 ttggctattggctctgctgagaagagggtggtccctggagttgagggccaatttgaagtc 444 |||||||||||||| ||||||||||||||| ||||||||| |||||| || |||||||| Sbjct: 1533 ttggctattggctcagctgagaagagggtgatccctggagctgagggtcagtttgaagtt 1592 Query: 445 gggtccttcatgtcagccacgctaagctgcgaccaccgggtcattgatggcgccatgggt 504 || || || |||||||| || | ||||||||||||||||||||||| || ||||| ||| Sbjct: 1593 ggttcgtttatgtcagcaacattgagctgcgaccaccgggtcattgacggtgccattggt 1652 Query: 505 gcggaatggctcaaggcattcaagagctaccttgagaacccgacgaccatgctgctgta 563 || |||||| | ||||| |||||| ||||| | ||||| || ||||||||| ||||||| Sbjct: 1653 gcagaatggatgaaggcgttcaagggctacatcgagaatccaacgaccatgttgctgta 1711
>dbj|AK071985.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013091O21, full insert sequence Length = 1936 Score = 474 bits (239), Expect = e-130 Identities = 464/539 (86%) Strand = Plus / Plus Query: 25 tctggcgggaagaagatatctataaatgatcttgtcattaaggctgcagcgttggctctt 84 ||||| || ||||||||||| |||||||||||||| || ||||| ||||| ||||||||| Sbjct: 1172 tctggtggcaagaagatatccataaatgatcttgttatcaaggccgcagcattggctctt 1231 Query: 85 cgtaaggttcctgcgtgtaacagttcctggatgaatgattttattcgccagtaccacaac 144 ||||| ||||||| |||||| || || ||||||||||||||||||||||| |||||||| Sbjct: 1232 cgtaatgttcctgagtgtaatagctcttggatgaatgattttattcgccaataccacaat 1291 Query: 145 gtgaacattaatgttgctgtacagactgagcatggtttgttcgttccagtagttagggac 204 |||||||| |||||||||||||| |||||| |||| ||||| ||||| ||| | ||||| Sbjct: 1292 gtgaacatcaatgttgctgtacaaactgaggatggcttgtttgttcccgtaataagggat 1351 Query: 205 gcggacaagaaagggttggccactattgctgatgaggtgaagcagttggctctaagagca 264 || |||||||| || | |||||||| ||||||||||||||||| |||||| |||||| Sbjct: 1352 gctgacaagaagggcctagccactatcgctgatgaggtgaagcaactggctcagagagca 1411 Query: 265 agggataacagcctaaaaccagaagattacgagggtggcactttcaccgtctcgaatctg 324 ||||| |||||||| || ||||| ||||| ||||||||||||||||| || || || || Sbjct: 1412 agggacaacagccttaagccagaggattatgagggtggcactttcactgtgtcaaacttg 1471 Query: 325 ggaggccctttcggaatcaagcaattctgtgccatcgtaaaccctccccaatcggcaatc 384 ||||||||||| ||||| ||||||||||||||||||||||| ||||| ||||| ||||| Sbjct: 1472 ggaggcccttttggaattaagcaattctgtgccatcgtaaatcctccacaatcagcaatt 1531 Query: 385 ttggctattggctctgctgagaagagggtggtccctggagttgagggccaatttgaagtc 444 |||||||||||||| ||||||||||||||| ||||||||| |||||| || |||||||| Sbjct: 1532 ttggctattggctcagctgagaagagggtgatccctggagctgagggtcagtttgaagtt 1591 Query: 445 gggtccttcatgtcagccacgctaagctgcgaccaccgggtcattgatggcgccatgggt 504 || || || |||||||| || | ||||||||||||||||||||||| || ||||| ||| Sbjct: 1592 ggttcgtttatgtcagcaacattgagctgcgaccaccgggtcattgacggtgccattggt 1651 Query: 505 gcggaatggctcaaggcattcaagagctaccttgagaacccgacgaccatgctgctgta 563 || |||||| | ||||| |||||| ||||| | ||||| || ||||||||| ||||||| Sbjct: 1652 gcagaatggatgaaggcgttcaagggctacatcgagaatccaacgaccatgttgctgta 1710
>ref|XM_463813.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2223 Score = 357 bits (180), Expect = 3e-95 Identities = 339/392 (86%) Strand = Plus / Plus Query: 23 catctggcgggaagaagatatctataaatgatcttgtcattaaggctgcagcgttggctc 82 |||||||||| |||||||||||||| || |||||||| || ||||||||||| |||||| Sbjct: 1260 catctggcggtaagaagatatctattaacgatcttgttataaaggctgcagctctggctc 1319 Query: 83 ttcgtaaggttcctgcgtgtaacagttcctggatgaatgattttattcgccagtaccaca 142 |||| ||||| ||| |||||| || || ||||||| ||||||||| ||||| ||||||| Sbjct: 1320 ttcgaaaggtccctcagtgtaatagctcgtggatgagtgattttatccgccaataccaca 1379 Query: 143 acgtgaacattaatgttgctgtacagactgagcatggtttgttcgttccagtagttaggg 202 |||||||||| |||||||||||||||||||||||||| ||||| ||||||||| |||||| Sbjct: 1380 acgtgaacatcaatgttgctgtacagactgagcatgggttgtttgttccagtaattaggg 1439 Query: 203 acgcggacaagaaagggttggccactattgctgatgaggtgaagcagttggctctaagag 262 | || |||||||| || | | || |||||||| |||||||||||| |||||| ||||| Sbjct: 1440 atgcagacaagaagggacttggtacaattgctgaggaggtgaagcaggtggctcaaagag 1499 Query: 263 caagggataacagcctaaaaccagaagattacgagggtggcactttcaccgtctcgaatc 322 |||||||||||||| ||||||| |||||||| ||||| ||||| |||||| | || || | Sbjct: 1500 caagggataacagcttaaaacctgaagattatgagggaggcacattcaccatatcaaacc 1559 Query: 323 tgggaggccctttcggaatcaagcaattctgtgccatcgtaaaccctccccaatcggcaa 382 | ||||| |||||||||||||| ||||||||||||||| |||| ||||| || || |||| Sbjct: 1560 taggaggtcctttcggaatcaaacaattctgtgccatcataaatcctcctcagtcagcaa 1619 Query: 383 tcttggctattggctctgctgagaagagggtg 414 ||||||| ||||| ||||||||||||||||| Sbjct: 1620 tcttggccattggtactgctgagaagagggtg 1651
>dbj|AK063525.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-117-A04, full insert sequence Length = 2223 Score = 357 bits (180), Expect = 3e-95 Identities = 339/392 (86%) Strand = Plus / Plus Query: 23 catctggcgggaagaagatatctataaatgatcttgtcattaaggctgcagcgttggctc 82 |||||||||| |||||||||||||| || |||||||| || ||||||||||| |||||| Sbjct: 1260 catctggcggtaagaagatatctattaacgatcttgttataaaggctgcagctctggctc 1319 Query: 83 ttcgtaaggttcctgcgtgtaacagttcctggatgaatgattttattcgccagtaccaca 142 |||| ||||| ||| |||||| || || ||||||| ||||||||| ||||| ||||||| Sbjct: 1320 ttcgaaaggtccctcagtgtaatagctcgtggatgagtgattttatccgccaataccaca 1379 Query: 143 acgtgaacattaatgttgctgtacagactgagcatggtttgttcgttccagtagttaggg 202 |||||||||| |||||||||||||||||||||||||| ||||| ||||||||| |||||| Sbjct: 1380 acgtgaacatcaatgttgctgtacagactgagcatgggttgtttgttccagtaattaggg 1439 Query: 203 acgcggacaagaaagggttggccactattgctgatgaggtgaagcagttggctctaagag 262 | || |||||||| || | | || |||||||| |||||||||||| |||||| ||||| Sbjct: 1440 atgcagacaagaagggacttggtacaattgctgaggaggtgaagcaggtggctcaaagag 1499 Query: 263 caagggataacagcctaaaaccagaagattacgagggtggcactttcaccgtctcgaatc 322 |||||||||||||| ||||||| |||||||| ||||| ||||| |||||| | || || | Sbjct: 1500 caagggataacagcttaaaacctgaagattatgagggaggcacattcaccatatcaaacc 1559 Query: 323 tgggaggccctttcggaatcaagcaattctgtgccatcgtaaaccctccccaatcggcaa 382 | ||||| |||||||||||||| ||||||||||||||| |||| ||||| || || |||| Sbjct: 1560 taggaggtcctttcggaatcaaacaattctgtgccatcataaatcctcctcagtcagcaa 1619 Query: 383 tcttggctattggctctgctgagaagagggtg 414 ||||||| ||||| ||||||||||||||||| Sbjct: 1620 tcttggccattggtactgctgagaagagggtg 1651
>gb|AF135014.1|AF135014 Zea mays dihydrolipoamide S-acetyltransferase mRNA, complete cds; nuclear gene for mitochondrial product Length = 1981 Score = 341 bits (172), Expect = 2e-90 Identities = 453/546 (82%), Gaps = 3/546 (0%) Strand = Plus / Plus Query: 20 atgcatctggcgggaagaagatatctataaatgatcttgtcattaaggctgcagcgttgg 79 |||| ||||| || ||||| ||||| || |||||||||||||| ||||||||||| |||| Sbjct: 1174 atgcttctggtggaaagaaaatatcaattaatgatcttgtcatcaaggctgcagctttgg 1233 Query: 80 ctcttcgtaaggttcctgcgtgtaacagttcctggatgaatgattttattcgccagtacc 139 | ||||| ||||| ||| ||||||||| || |||||||||||||||||||| || |||| Sbjct: 1234 cccttcgaaaggtccctcagtgtaacagctcatggatgaatgattttattcggcaatacc 1293 Query: 140 acaacgtgaacattaatgttgctgtacagactgagcatggtttgttcgttccagtagtta 199 |||| |||||||| || || |||||||||||||| ||||| ||||| ||||||||| ||| Sbjct: 1294 acaatgtgaacatcaacgtggctgtacagactgaacatggattgtttgttccagtaatta 1353 Query: 200 gggacgcggacaagaaagggttggccactattgctgatgaggtgaagcagttggctctaa 259 |||| || |||||||| || | | | |||||||| ||||||||||||||||||| || Sbjct: 1354 gggatgcagacaagaagggactcggtgcaattgctgaggaggtgaagcagttggctcaaa 1413 Query: 260 gagcaagggataacagcctaaaaccagaagattacgagggtggcactttcaccgtctcga 319 |||||| ||||| ||||||||||||| |||||||||||| ||||| ||||| || || | Sbjct: 1414 aagcaagagataatagcctaaaaccagcagattacgagggcggcaccttcactgtatcaa 1473 Query: 320 atctgggaggccctttcggaatcaagcaattctgtgccatcgtaaaccctccccaatcgg 379 || ||||||| || |||||||| || |||||||| |||||| |||| |||||||| || | Sbjct: 1474 atttgggaggtcccttcggaattaaacaattctgcgccatcataaatcctccccagtcag 1533 Query: 380 caatcttggctattggctctgctgagaagagggtggtccctgg---agttgagggccaat 436 |||| ||||| ||||| |||||||||||||||||| | ||||| | ||| ||||| | Sbjct: 1534 caattttggccattggttctgctgagaagagggtgatacctggttccgctgatggccagt 1593 Query: 437 ttgaagtcgggtccttcatgtcagccacgctaagctgcgaccaccgggtcattgatggcg 496 ||||| | || || ||||||||||| || || ||||| |||||| |||| || ||||||| Sbjct: 1594 ttgaatttggttcattcatgtcagctacactgagctgtgaccacagggttatagatggcg 1653 Query: 497 ccatgggtgcggaatggctcaaggcattcaagagctaccttgagaacccgacgaccatgc 556 | || |||||||||| || || ||||||||| | ||| | |||||||| || | |||| Sbjct: 1654 caatcggtgcggaatttctgaaagcattcaagggatacatcgagaacccaacttcaatgc 1713 Query: 557 tgctgt 562 |||||| Sbjct: 1714 tgctgt 1719
>ref|XM_477668.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2399 Score = 319 bits (161), Expect = 6e-84 Identities = 326/381 (85%) Strand = Plus / Plus Query: 34 aagaagatatctataaatgatcttgtcattaaggctgcagcgttggctcttcgtaaggtt 93 |||||||||||||| |||||||| || || ||||||||||| |||||||||| ||||| Sbjct: 1391 aagaagatatctattaatgatctagttataaaggctgcagctctggctcttcgaaaggtc 1450 Query: 94 cctgcgtgtaacagttcctggatgaatgattttattcgccagtaccacaacgtgaacatt 153 ||| |||||| || |||||||||||||||||||| ||||| ||||||||||||||||| Sbjct: 1451 cctcagtgtaatagctcctggatgaatgattttatccgccaataccacaacgtgaacatc 1510 Query: 154 aatgttgctgtacagactgagcatggtttgttcgttccagtagttagggacgcggacaag 213 |||||||||||||||||||||||||| |||| ||||||||| | ||||| || |||||| Sbjct: 1511 aatgttgctgtacagactgagcatggactgtttgttccagtaatcagggatgcagacaag 1570 Query: 214 aaagggttggccactattgctgatgaggtgaagcagttggctctaagagcaagggataac 273 ||||| | | | ||||| || ||||||||||||||||||| |||||||||||||||| Sbjct: 1571 aaaggacttggtatgattgcggaggaggtgaagcagttggctcaaagagcaagggataac 1630 Query: 274 agcctaaaaccagaagattacgagggtggcactttcaccgtctcgaatctgggaggccct 333 || | |||||||| ||||| ||||| ||||| |||||| | || || ||||||| ||| Sbjct: 1631 agtttgaaaccagatgattatgagggaggcacattcaccatatcaaacttgggaggtcct 1690 Query: 334 ttcggaatcaagcaattctgtgccatcgtaaaccctccccaatcggcaatcttggctatt 393 || ||||| |||||||| ||||||||| |||| ||||| || |||||||||||||| ||| Sbjct: 1691 tttggaattaagcaattttgtgccatcataaatcctcctcagtcggcaatcttggccatt 1750 Query: 394 ggctctgctgagaagagggtg 414 || |||||||||| ||||||| Sbjct: 1751 ggttctgctgagaggagggtg 1771
>dbj|AK070846.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023068C09, full insert sequence Length = 2398 Score = 319 bits (161), Expect = 6e-84 Identities = 326/381 (85%) Strand = Plus / Plus Query: 34 aagaagatatctataaatgatcttgtcattaaggctgcagcgttggctcttcgtaaggtt 93 |||||||||||||| |||||||| || || ||||||||||| |||||||||| ||||| Sbjct: 1391 aagaagatatctattaatgatctagttataaaggctgcagctctggctcttcgaaaggtc 1450 Query: 94 cctgcgtgtaacagttcctggatgaatgattttattcgccagtaccacaacgtgaacatt 153 ||| |||||| || |||||||||||||||||||| ||||| ||||||||||||||||| Sbjct: 1451 cctcagtgtaatagctcctggatgaatgattttatccgccaataccacaacgtgaacatc 1510 Query: 154 aatgttgctgtacagactgagcatggtttgttcgttccagtagttagggacgcggacaag 213 |||||||||||||||||||||||||| |||| ||||||||| | ||||| || |||||| Sbjct: 1511 aatgttgctgtacagactgagcatggactgtttgttccagtaatcagggatgcagacaag 1570 Query: 214 aaagggttggccactattgctgatgaggtgaagcagttggctctaagagcaagggataac 273 ||||| | | | ||||| || ||||||||||||||||||| |||||||||||||||| Sbjct: 1571 aaaggacttggtatgattgcggaggaggtgaagcagttggctcaaagagcaagggataac 1630 Query: 274 agcctaaaaccagaagattacgagggtggcactttcaccgtctcgaatctgggaggccct 333 || | |||||||| ||||| ||||| ||||| |||||| | || || ||||||| ||| Sbjct: 1631 agtttgaaaccagatgattatgagggaggcacattcaccatatcaaacttgggaggtcct 1690 Query: 334 ttcggaatcaagcaattctgtgccatcgtaaaccctccccaatcggcaatcttggctatt 393 || ||||| |||||||| ||||||||| |||| ||||| || |||||||||||||| ||| Sbjct: 1691 tttggaattaagcaattttgtgccatcataaatcctcctcagtcggcaatcttggccatt 1750 Query: 394 ggctctgctgagaagagggtg 414 || |||||||||| ||||||| Sbjct: 1751 ggttctgctgagaggagggtg 1771
>gb|AY109496.1| Zea mays CL1480_1 mRNA sequence Length = 1932 Score = 319 bits (161), Expect = 6e-84 Identities = 449/546 (82%), Gaps = 3/546 (0%) Strand = Plus / Plus Query: 20 atgcatctggcgggaagaagatatctataaatgatcttgtcattaaggctgcagcgttgg 79 |||| ||||| || ||||| ||||| || |||||||||||||| ||||||||||| |||| Sbjct: 1145 atgcttctggtggaaagaaaatatcaattaatgatcttgtcatcaaggctgcagctttgg 1204 Query: 80 ctcttcgtaaggttcctgcgtgtaacagttcctggatgaatgattttattcgccagtacc 139 | ||||| ||||| ||| ||||||||| || |||||||||||||||||||| || |||| Sbjct: 1205 cccttcgaaaggtccctcagtgtaacagctcatggatgaatgattttattcggcaatacc 1264 Query: 140 acaacgtgaacattaatgttgctgtacagactgagcatggtttgttcgttccagtagtta 199 |||| |||||||| || || |||||||||||||| ||||| ||||| ||||||||| ||| Sbjct: 1265 acaatgtgaacatcaacgtggctgtacagactgaacatggattgtttgttccagtaatta 1324 Query: 200 gggacgcggacaagaaagggttggccactattgctgatgaggtgaagcagttggctctaa 259 |||| || |||||||| || | | | |||||||| ||||||||||||||||||| Sbjct: 1325 gggatgcagacaagaagggactcggtgcaattgctgaggaggtgaagcagttggctcnnn 1384 Query: 260 gagcaagggataacagcctaaaaccagaagattacgagggtggcactttcaccgtctcga 319 ||||| ||||| ||||||||||||| |||||||||||| ||||| ||||| || || | Sbjct: 1385 nngcaagagataatagcctaaaaccagcagattacgagggcggcaccttcactgtatcaa 1444 Query: 320 atctgggaggccctttcggaatcaagcaattctgtgccatcgtaaaccctccccaatcgg 379 || ||||||| || |||||||| || |||||||| |||||| |||| |||||||| || | Sbjct: 1445 atttgggaggtcccttcggaattaaacaattctgcgccatcataaatcctccccagtcag 1504 Query: 380 caatcttggctattggctctgctgagaagagggtggtccctgg---agttgagggccaat 436 |||| ||||| ||||| |||||||||||||||||| | ||||| | ||| || || | Sbjct: 1505 caattttggccattggttctgctgagaagagggtgatacctggttccgctgatggtcagt 1564 Query: 437 ttgaagtcgggtccttcatgtcagccacgctaagctgcgaccaccgggtcattgatggcg 496 ||||| | || || ||||||||||| || || ||||| |||||| |||| || ||||||| Sbjct: 1565 ttgaatttggttcattcatgtcagcaacactgagctgtgaccacagggttatagatggcg 1624 Query: 497 ccatgggtgcggaatggctcaaggcattcaagagctaccttgagaacccgacgaccatgc 556 | || |||||||||| || || ||||||||| | ||| | |||||||| || | |||| Sbjct: 1625 caatcggtgcggaatttctgaaagcattcaagggatacatcgagaacccaacttcaatgc 1684 Query: 557 tgctgt 562 |||||| Sbjct: 1685 tgctgt 1690
>ref|XM_550448.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2201 Score = 242 bits (122), Expect = 1e-60 Identities = 236/274 (86%) Strand = Plus / Plus Query: 25 tctggcgggaagaagatatctataaatgatcttgtcattaaggctgcagcgttggctctt 84 ||||| || ||||||||||| |||||||||||||| || ||||| ||||| ||||||||| Sbjct: 1191 tctggtggcaagaagatatccataaatgatcttgttatcaaggccgcagcattggctctt 1250 Query: 85 cgtaaggttcctgcgtgtaacagttcctggatgaatgattttattcgccagtaccacaac 144 ||||| ||||||| |||||| || || ||||||||||||||||||||||| |||||||| Sbjct: 1251 cgtaatgttcctgagtgtaatagctcttggatgaatgattttattcgccaataccacaat 1310 Query: 145 gtgaacattaatgttgctgtacagactgagcatggtttgttcgttccagtagttagggac 204 |||||||| |||||||||||||| |||||| |||| ||||| ||||| ||| | ||||| Sbjct: 1311 gtgaacatcaatgttgctgtacaaactgaggatggcttgtttgttcccgtaataagggat 1370 Query: 205 gcggacaagaaagggttggccactattgctgatgaggtgaagcagttggctctaagagca 264 || |||||||| || | |||||||| ||||||||||||||||| |||||| |||||| Sbjct: 1371 gctgacaagaagggcctagccactatcgctgatgaggtgaagcaactggctcagagagca 1430 Query: 265 agggataacagcctaaaaccagaagattacgagg 298 ||||| |||||||| || ||||| ||||| |||| Sbjct: 1431 agggacaacagccttaagccagaggattatgagg 1464 Score = 238 bits (120), Expect = 2e-59 Identities = 231/268 (86%) Strand = Plus / Plus Query: 296 agggtggcactttcaccgtctcgaatctgggaggccctttcggaatcaagcaattctgtg 355 |||||||||||||||| || || || ||||||||||||| ||||| ||||||||||||| Sbjct: 1531 agggtggcactttcactgtgtcaaacttgggaggcccttttggaattaagcaattctgtg 1590 Query: 356 ccatcgtaaaccctccccaatcggcaatcttggctattggctctgctgagaagagggtgg 415 |||||||||| ||||| ||||| ||||| |||||||||||||| ||||||||||||||| Sbjct: 1591 ccatcgtaaatcctccacaatcagcaattttggctattggctcagctgagaagagggtga 1650 Query: 416 tccctggagttgagggccaatttgaagtcgggtccttcatgtcagccacgctaagctgcg 475 ||||||||| |||||| || |||||||| || || || |||||||| || | ||||||| Sbjct: 1651 tccctggagctgagggtcagtttgaagttggttcgtttatgtcagcaacattgagctgcg 1710 Query: 476 accaccgggtcattgatggcgccatgggtgcggaatggctcaaggcattcaagagctacc 535 |||||||||||||||| || ||||| ||||| |||||| | ||||| |||||| ||||| Sbjct: 1711 accaccgggtcattgacggtgccattggtgcagaatggatgaaggcgttcaagggctaca 1770 Query: 536 ttgagaacccgacgaccatgctgctgta 563 | ||||| || ||||||||| ||||||| Sbjct: 1771 tcgagaatccaacgaccatgttgctgta 1798
>dbj|AK103793.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033145O03, full insert sequence Length = 2199 Score = 242 bits (122), Expect = 1e-60 Identities = 236/274 (86%) Strand = Plus / Plus Query: 25 tctggcgggaagaagatatctataaatgatcttgtcattaaggctgcagcgttggctctt 84 ||||| || ||||||||||| |||||||||||||| || ||||| ||||| ||||||||| Sbjct: 1189 tctggtggcaagaagatatccataaatgatcttgttatcaaggccgcagcattggctctt 1248 Query: 85 cgtaaggttcctgcgtgtaacagttcctggatgaatgattttattcgccagtaccacaac 144 ||||| ||||||| |||||| || || ||||||||||||||||||||||| |||||||| Sbjct: 1249 cgtaatgttcctgagtgtaatagctcttggatgaatgattttattcgccaataccacaat 1308 Query: 145 gtgaacattaatgttgctgtacagactgagcatggtttgttcgttccagtagttagggac 204 |||||||| |||||||||||||| |||||| |||| ||||| ||||| ||| | ||||| Sbjct: 1309 gtgaacatcaatgttgctgtacaaactgaggatggcttgtttgttcccgtaataagggat 1368 Query: 205 gcggacaagaaagggttggccactattgctgatgaggtgaagcagttggctctaagagca 264 || |||||||| || | |||||||| ||||||||||||||||| |||||| |||||| Sbjct: 1369 gctgacaagaagggcctagccactatcgctgatgaggtgaagcaactggctcagagagca 1428 Query: 265 agggataacagcctaaaaccagaagattacgagg 298 ||||| |||||||| || ||||| ||||| |||| Sbjct: 1429 agggacaacagccttaagccagaggattatgagg 1462 Score = 238 bits (120), Expect = 2e-59 Identities = 231/268 (86%) Strand = Plus / Plus Query: 296 agggtggcactttcaccgtctcgaatctgggaggccctttcggaatcaagcaattctgtg 355 |||||||||||||||| || || || ||||||||||||| ||||| ||||||||||||| Sbjct: 1529 agggtggcactttcactgtgtcaaacttgggaggcccttttggaattaagcaattctgtg 1588 Query: 356 ccatcgtaaaccctccccaatcggcaatcttggctattggctctgctgagaagagggtgg 415 |||||||||| ||||| ||||| ||||| |||||||||||||| ||||||||||||||| Sbjct: 1589 ccatcgtaaatcctccacaatcagcaattttggctattggctcagctgagaagagggtga 1648 Query: 416 tccctggagttgagggccaatttgaagtcgggtccttcatgtcagccacgctaagctgcg 475 ||||||||| |||||| || |||||||| || || || |||||||| || | ||||||| Sbjct: 1649 tccctggagctgagggtcagtttgaagttggttcgtttatgtcagcaacattgagctgcg 1708 Query: 476 accaccgggtcattgatggcgccatgggtgcggaatggctcaaggcattcaagagctacc 535 |||||||||||||||| || ||||| ||||| |||||| | ||||| |||||| ||||| Sbjct: 1709 accaccgggtcattgacggtgccattggtgcagaatggatgaaggcgttcaagggctaca 1768 Query: 536 ttgagaacccgacgaccatgctgctgta 563 | ||||| || ||||||||| ||||||| Sbjct: 1769 tcgagaatccaacgaccatgttgctgta 1796
>gb|AY111798.1| Zea mays CL1480_2 mRNA sequence Length = 659 Score = 141 bits (71), Expect = 3e-30 Identities = 156/186 (83%) Strand = Plus / Plus Query: 229 attgctgatgaggtgaagcagttggctctaagagcaagggataacagcctaaaaccagaa 288 |||||||| ||||||||||||||||||| ||||| || || ||| ||||||||| | Sbjct: 10 attgctgaggaggtgaagcagttggctcnnnnngcaagagacaatagcttaaaaccagca 69 Query: 289 gattacgagggtggcactttcaccgtctcgaatctgggaggccctttcggaatcaagcaa 348 ||||| ||||||||||| ||||| | || || ||||||| || ||||||||||| ||| Sbjct: 70 gattatgagggtggcaccttcacgatatcaaacttgggaggtcccttcggaatcaaacaa 129 Query: 349 ttctgtgccatcgtaaaccctccccaatcggcaatcttggctattggctctgctgagaag 408 |||||||||||| |||| ||||| || || ||||| ||||||||||| ||||| |||||| Sbjct: 130 ttctgtgccatcataaatcctcctcagtcagcaattttggctattggttctgccgagaag 189 Query: 409 agggtg 414 |||||| Sbjct: 190 agggtg 195 Score = 71.9 bits (36), Expect = 2e-09 Identities = 93/112 (83%) Strand = Plus / Plus Query: 451 ttcatgtcagccacgctaagctgcgaccaccgggtcattgatggcgccatgggtgcggaa 510 |||||||||||||| || ||||| |||||| |||| || ||||| || || ||||||||| Sbjct: 235 ttcatgtcagccacactgagctgtgaccacagggttatagatggtgcaatcggtgcggaa 294 Query: 511 tggctcaaggcattcaagagctaccttgagaacccgacgaccatgctgctgt 562 | || || ||||||||| ||||| | ||||||||||| | |||||||||| Sbjct: 295 tttctgaaagcattcaagggctacatcgagaacccgacttcgatgctgctgt 346
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 117 bits (59), Expect = 5e-23 Identities = 92/103 (89%) Strand = Plus / Minus Query: 296 agggtggcactttcaccgtctcgaatctgggaggccctttcggaatcaagcaattctgtg 355 |||||||||||||||| || || || ||||||||||||| ||||| ||||||||||||| Sbjct: 369993 agggtggcactttcactgtgtcaaacttgggaggcccttttggaattaagcaattctgtg 369934 Query: 356 ccatcgtaaaccctccccaatcggcaatcttggctattggctc 398 |||||||||| ||||| ||||| ||||| |||||||||||||| Sbjct: 369933 ccatcgtaaatcctccacaatcagcaattttggctattggctc 369891 Score = 89.7 bits (45), Expect = 1e-14 Identities = 66/73 (90%) Strand = Plus / Minus Query: 65 aggctgcagcgttggctcttcgtaaggttcctgcgtgtaacagttcctggatgaatgatt 124 |||| ||||| |||||||||||||| ||||||| |||||| || || ||||||||||||| Sbjct: 370448 aggccgcagcattggctcttcgtaatgttcctgagtgtaatagctcttggatgaatgatt 370389 Query: 125 ttattcgccagta 137 ||||||||||||| Sbjct: 370388 ttattcgccagta 370376 Score = 87.7 bits (44), Expect = 4e-14 Identities = 80/92 (86%) Strand = Plus / Minus Query: 400 gctgagaagagggtggtccctggagttgagggccaatttgaagtcgggtccttcatgtca 459 ||||||||||||||| ||||||||| |||||| || |||||||| || || || |||||| Sbjct: 369761 gctgagaagagggtgatccctggagctgagggtcagtttgaagttggttcgtttatgtca 369702 Query: 460 gccacgctaagctgcgaccaccgggtcattga 491 || || | ||||||||||||||||||||||| Sbjct: 369701 gcaacattgagctgcgaccaccgggtcattga 369670 Score = 71.9 bits (36), Expect = 2e-09 Identities = 66/76 (86%) Strand = Plus / Minus Query: 223 gccactattgctgatgaggtgaagcagttggctctaagagcaagggataacagcctaaaa 282 |||||||| ||||||||||||||||| |||||| ||||||||||| |||||||| || Sbjct: 370135 gccactatcgctgatgaggtgaagcaactggctcagagagcaagggacaacagccttaag 370076 Query: 283 ccagaagattacgagg 298 ||||| ||||| |||| Sbjct: 370075 ccagaggattatgagg 370060 Score = 63.9 bits (32), Expect = 6e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 136 taccacaacgtgaacattaatgttgctgtacagactgagcatggtttgttcgttcc 191 |||||||| |||||||| |||||||||||||| |||||| |||| ||||| ||||| Sbjct: 370292 taccacaatgtgaacatcaatgttgctgtacaaactgaggatggcttgtttgttcc 370237 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Minus Query: 25 tctggcgggaagaagatatctataaatgatcttgt 59 ||||| || ||||||||||| |||||||||||||| Sbjct: 370647 tctggtggcaagaagatatccataaatgatcttgt 370613
>dbj|AP001129.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0644B06 Length = 194509 Score = 117 bits (59), Expect = 5e-23 Identities = 92/103 (89%) Strand = Plus / Minus Query: 296 agggtggcactttcaccgtctcgaatctgggaggccctttcggaatcaagcaattctgtg 355 |||||||||||||||| || || || ||||||||||||| ||||| ||||||||||||| Sbjct: 79946 agggtggcactttcactgtgtcaaacttgggaggcccttttggaattaagcaattctgtg 79887 Query: 356 ccatcgtaaaccctccccaatcggcaatcttggctattggctc 398 |||||||||| ||||| ||||| ||||| |||||||||||||| Sbjct: 79886 ccatcgtaaatcctccacaatcagcaattttggctattggctc 79844 Score = 89.7 bits (45), Expect = 1e-14 Identities = 66/73 (90%) Strand = Plus / Minus Query: 65 aggctgcagcgttggctcttcgtaaggttcctgcgtgtaacagttcctggatgaatgatt 124 |||| ||||| |||||||||||||| ||||||| |||||| || || ||||||||||||| Sbjct: 80401 aggccgcagcattggctcttcgtaatgttcctgagtgtaatagctcttggatgaatgatt 80342 Query: 125 ttattcgccagta 137 ||||||||||||| Sbjct: 80341 ttattcgccagta 80329 Score = 87.7 bits (44), Expect = 4e-14 Identities = 80/92 (86%) Strand = Plus / Minus Query: 400 gctgagaagagggtggtccctggagttgagggccaatttgaagtcgggtccttcatgtca 459 ||||||||||||||| ||||||||| |||||| || |||||||| || || || |||||| Sbjct: 79714 gctgagaagagggtgatccctggagctgagggtcagtttgaagttggttcgtttatgtca 79655 Query: 460 gccacgctaagctgcgaccaccgggtcattga 491 || || | ||||||||||||||||||||||| Sbjct: 79654 gcaacattgagctgcgaccaccgggtcattga 79623 Score = 71.9 bits (36), Expect = 2e-09 Identities = 66/76 (86%) Strand = Plus / Minus Query: 223 gccactattgctgatgaggtgaagcagttggctctaagagcaagggataacagcctaaaa 282 |||||||| ||||||||||||||||| |||||| ||||||||||| |||||||| || Sbjct: 80088 gccactatcgctgatgaggtgaagcaactggctcagagagcaagggacaacagccttaag 80029 Query: 283 ccagaagattacgagg 298 ||||| ||||| |||| Sbjct: 80028 ccagaggattatgagg 80013 Score = 63.9 bits (32), Expect = 6e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 136 taccacaacgtgaacattaatgttgctgtacagactgagcatggtttgttcgttcc 191 |||||||| |||||||| |||||||||||||| |||||| |||| ||||| ||||| Sbjct: 80245 taccacaatgtgaacatcaatgttgctgtacaaactgaggatggcttgtttgttcc 80190 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Minus Query: 25 tctggcgggaagaagatatctataaatgatcttgt 59 ||||| || ||||||||||| |||||||||||||| Sbjct: 80600 tctggtggcaagaagatatccataaatgatcttgt 80566
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 101 bits (51), Expect = 3e-18 Identities = 63/67 (94%) Strand = Plus / Plus Query: 136 taccacaacgtgaacattaatgttgctgtacagactgagcatggtttgttcgttccagta 195 ||||||||||||||||| |||||||||||||||||||||||||| ||||| ||||||||| Sbjct: 292431 taccacaacgtgaacatcaatgttgctgtacagactgagcatgggttgtttgttccagta 292490 Query: 196 gttaggg 202 |||||| Sbjct: 292491 attaggg 292497 Score = 91.7 bits (46), Expect = 3e-15 Identities = 64/70 (91%) Strand = Plus / Plus Query: 229 attgctgatgaggtgaagcagttggctctaagagcaagggataacagcctaaaaccagaa 288 |||||||| |||||||||||| |||||| ||||||||||||||||||| ||||||| ||| Sbjct: 292597 attgctgaggaggtgaagcaggtggctcaaagagcaagggataacagcttaaaacctgaa 292656 Query: 289 gattacgagg 298 ||||| |||| Sbjct: 292657 gattatgagg 292666 Score = 79.8 bits (40), Expect = 1e-11 Identities = 85/100 (85%) Strand = Plus / Plus Query: 296 agggtggcactttcaccgtctcgaatctgggaggccctttcggaatcaagcaattctgtg 355 |||| ||||| |||||| | || || || ||||| |||||||||||||| |||||||||| Sbjct: 292739 agggaggcacattcaccatatcaaacctaggaggtcctttcggaatcaaacaattctgtg 292798 Query: 356 ccatcgtaaaccctccccaatcggcaatcttggctattgg 395 ||||| |||| ||||| || || ||||||||||| ||||| Sbjct: 292799 ccatcataaatcctcctcagtcagcaatcttggccattgg 292838 Score = 50.1 bits (25), Expect = 0.009 Identities = 34/37 (91%) Strand = Plus / Plus Query: 23 catctggcgggaagaagatatctataaatgatcttgt 59 |||||||||| |||||||||||||| || |||||||| Sbjct: 292099 catctggcggtaagaagatatctattaacgatcttgt 292135
>dbj|AP004851.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1359_D06 Length = 146805 Score = 101 bits (51), Expect = 3e-18 Identities = 63/67 (94%) Strand = Plus / Plus Query: 136 taccacaacgtgaacattaatgttgctgtacagactgagcatggtttgttcgttccagta 195 ||||||||||||||||| |||||||||||||||||||||||||| ||||| ||||||||| Sbjct: 21215 taccacaacgtgaacatcaatgttgctgtacagactgagcatgggttgtttgttccagta 21274 Query: 196 gttaggg 202 |||||| Sbjct: 21275 attaggg 21281 Score = 91.7 bits (46), Expect = 3e-15 Identities = 64/70 (91%) Strand = Plus / Plus Query: 229 attgctgatgaggtgaagcagttggctctaagagcaagggataacagcctaaaaccagaa 288 |||||||| |||||||||||| |||||| ||||||||||||||||||| ||||||| ||| Sbjct: 21381 attgctgaggaggtgaagcaggtggctcaaagagcaagggataacagcttaaaacctgaa 21440 Query: 289 gattacgagg 298 ||||| |||| Sbjct: 21441 gattatgagg 21450 Score = 79.8 bits (40), Expect = 1e-11 Identities = 85/100 (85%) Strand = Plus / Plus Query: 296 agggtggcactttcaccgtctcgaatctgggaggccctttcggaatcaagcaattctgtg 355 |||| ||||| |||||| | || || || ||||| |||||||||||||| |||||||||| Sbjct: 21523 agggaggcacattcaccatatcaaacctaggaggtcctttcggaatcaaacaattctgtg 21582 Query: 356 ccatcgtaaaccctccccaatcggcaatcttggctattgg 395 ||||| |||| ||||| || || ||||||||||| ||||| Sbjct: 21583 ccatcataaatcctcctcagtcagcaatcttggccattgg 21622 Score = 50.1 bits (25), Expect = 0.009 Identities = 34/37 (91%) Strand = Plus / Plus Query: 23 catctggcgggaagaagatatctataaatgatcttgt 59 |||||||||| |||||||||||||| || |||||||| Sbjct: 20883 catctggcggtaagaagatatctattaacgatcttgt 20919
>dbj|AP004049.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1212_C06 Length = 110989 Score = 101 bits (51), Expect = 3e-18 Identities = 63/67 (94%) Strand = Plus / Plus Query: 136 taccacaacgtgaacattaatgttgctgtacagactgagcatggtttgttcgttccagta 195 ||||||||||||||||| |||||||||||||||||||||||||| ||||| ||||||||| Sbjct: 102406 taccacaacgtgaacatcaatgttgctgtacagactgagcatgggttgtttgttccagta 102465 Query: 196 gttaggg 202 |||||| Sbjct: 102466 attaggg 102472 Score = 91.7 bits (46), Expect = 3e-15 Identities = 64/70 (91%) Strand = Plus / Plus Query: 229 attgctgatgaggtgaagcagttggctctaagagcaagggataacagcctaaaaccagaa 288 |||||||| |||||||||||| |||||| ||||||||||||||||||| ||||||| ||| Sbjct: 102572 attgctgaggaggtgaagcaggtggctcaaagagcaagggataacagcttaaaacctgaa 102631 Query: 289 gattacgagg 298 ||||| |||| Sbjct: 102632 gattatgagg 102641 Score = 79.8 bits (40), Expect = 1e-11 Identities = 85/100 (85%) Strand = Plus / Plus Query: 296 agggtggcactttcaccgtctcgaatctgggaggccctttcggaatcaagcaattctgtg 355 |||| ||||| |||||| | || || || ||||| |||||||||||||| |||||||||| Sbjct: 102714 agggaggcacattcaccatatcaaacctaggaggtcctttcggaatcaaacaattctgtg 102773 Query: 356 ccatcgtaaaccctccccaatcggcaatcttggctattgg 395 ||||| |||| ||||| || || ||||||||||| ||||| Sbjct: 102774 ccatcataaatcctcctcagtcagcaatcttggccattgg 102813 Score = 50.1 bits (25), Expect = 0.009 Identities = 34/37 (91%) Strand = Plus / Plus Query: 23 catctggcgggaagaagatatctataaatgatcttgt 59 |||||||||| |||||||||||||| || |||||||| Sbjct: 102074 catctggcggtaagaagatatctattaacgatcttgt 102110
>dbj|AP006720.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, clone:OJA1212_C06 Length = 113554 Score = 101 bits (51), Expect = 3e-18 Identities = 63/67 (94%) Strand = Plus / Plus Query: 136 taccacaacgtgaacattaatgttgctgtacagactgagcatggtttgttcgttccagta 195 ||||||||||||||||| |||||||||||||||||||||||||| ||||| ||||||||| Sbjct: 104971 taccacaacgtgaacatcaatgttgctgtacagactgagcatgggttgtttgttccagta 105030 Query: 196 gttaggg 202 |||||| Sbjct: 105031 attaggg 105037 Score = 91.7 bits (46), Expect = 3e-15 Identities = 64/70 (91%) Strand = Plus / Plus Query: 229 attgctgatgaggtgaagcagttggctctaagagcaagggataacagcctaaaaccagaa 288 |||||||| |||||||||||| |||||| ||||||||||||||||||| ||||||| ||| Sbjct: 105137 attgctgaggaggtgaagcaggtggctcaaagagcaagggataacagcttaaaacctgaa 105196 Query: 289 gattacgagg 298 ||||| |||| Sbjct: 105197 gattatgagg 105206 Score = 79.8 bits (40), Expect = 1e-11 Identities = 85/100 (85%) Strand = Plus / Plus Query: 296 agggtggcactttcaccgtctcgaatctgggaggccctttcggaatcaagcaattctgtg 355 |||| ||||| |||||| | || || || ||||| |||||||||||||| |||||||||| Sbjct: 105279 agggaggcacattcaccatatcaaacctaggaggtcctttcggaatcaaacaattctgtg 105338 Query: 356 ccatcgtaaaccctccccaatcggcaatcttggctattgg 395 ||||| |||| ||||| || || ||||||||||| ||||| Sbjct: 105339 ccatcataaatcctcctcagtcagcaatcttggccattgg 105378 Score = 50.1 bits (25), Expect = 0.009 Identities = 34/37 (91%) Strand = Plus / Plus Query: 23 catctggcgggaagaagatatctataaatgatcttgt 59 |||||||||| |||||||||||||| || |||||||| Sbjct: 104639 catctggcggtaagaagatatctattaacgatcttgt 104675
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 87.7 bits (44), Expect = 4e-14 Identities = 56/60 (93%) Strand = Plus / Minus Query: 136 taccacaacgtgaacattaatgttgctgtacagactgagcatggtttgttcgttccagta 195 ||||||||||||||||| |||||||||||||||||||||||||| |||| ||||||||| Sbjct: 12759602 taccacaacgtgaacatcaatgttgctgtacagactgagcatggactgtttgttccagta 12759543 Score = 75.8 bits (38), Expect = 2e-10 Identities = 62/70 (88%) Strand = Plus / Minus Query: 229 attgctgatgaggtgaagcagttggctctaagagcaagggataacagcctaaaaccagaa 288 ||||| || ||||||||||||||||||| |||||||||||||||||| | |||||||| Sbjct: 12759447 attgcggaggaggtgaagcagttggctcaaagagcaagggataacagtttgaaaccagat 12759388 Query: 289 gattacgagg 298 ||||| |||| Sbjct: 12759387 gattatgagg 12759378 Score = 75.8 bits (38), Expect = 2e-10 Identities = 68/78 (87%) Strand = Plus / Minus Query: 323 tgggaggccctttcggaatcaagcaattctgtgccatcgtaaaccctccccaatcggcaa 382 ||||||| ||||| ||||| |||||||| ||||||||| |||| ||||| || ||||||| Sbjct: 12759274 tgggaggtccttttggaattaagcaattttgtgccatcataaatcctcctcagtcggcaa 12759215 Query: 383 tcttggctattggctctg 400 ||||||| ||||| |||| Sbjct: 12759214 tcttggccattggttctg 12759197 Score = 73.8 bits (37), Expect = 6e-10 Identities = 64/73 (87%) Strand = Plus / Minus Query: 65 aggctgcagcgttggctcttcgtaaggttcctgcgtgtaacagttcctggatgaatgatt 124 |||||||||| |||||||||| ||||| ||| |||||| || |||||||||||||||| Sbjct: 12759751 aggctgcagctctggctcttcgaaaggtccctcagtgtaatagctcctggatgaatgatt 12759692 Query: 125 ttattcgccagta 137 |||| |||||||| Sbjct: 12759691 ttatccgccagta 12759679
>dbj|AP005325.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0710F09 Length = 198867 Score = 87.7 bits (44), Expect = 4e-14 Identities = 56/60 (93%) Strand = Plus / Minus Query: 136 taccacaacgtgaacattaatgttgctgtacagactgagcatggtttgttcgttccagta 195 ||||||||||||||||| |||||||||||||||||||||||||| |||| ||||||||| Sbjct: 17726 taccacaacgtgaacatcaatgttgctgtacagactgagcatggactgtttgttccagta 17667 Score = 75.8 bits (38), Expect = 2e-10 Identities = 62/70 (88%) Strand = Plus / Minus Query: 229 attgctgatgaggtgaagcagttggctctaagagcaagggataacagcctaaaaccagaa 288 ||||| || ||||||||||||||||||| |||||||||||||||||| | |||||||| Sbjct: 17571 attgcggaggaggtgaagcagttggctcaaagagcaagggataacagtttgaaaccagat 17512 Query: 289 gattacgagg 298 ||||| |||| Sbjct: 17511 gattatgagg 17502 Score = 75.8 bits (38), Expect = 2e-10 Identities = 68/78 (87%) Strand = Plus / Minus Query: 323 tgggaggccctttcggaatcaagcaattctgtgccatcgtaaaccctccccaatcggcaa 382 ||||||| ||||| ||||| |||||||| ||||||||| |||| ||||| || ||||||| Sbjct: 17398 tgggaggtccttttggaattaagcaattttgtgccatcataaatcctcctcagtcggcaa 17339 Query: 383 tcttggctattggctctg 400 ||||||| ||||| |||| Sbjct: 17338 tcttggccattggttctg 17321 Score = 73.8 bits (37), Expect = 6e-10 Identities = 64/73 (87%) Strand = Plus / Minus Query: 65 aggctgcagcgttggctcttcgtaaggttcctgcgtgtaacagttcctggatgaatgatt 124 |||||||||| |||||||||| ||||| ||| |||||| || |||||||||||||||| Sbjct: 17875 aggctgcagctctggctcttcgaaaggtccctcagtgtaatagctcctggatgaatgatt 17816 Query: 125 ttattcgccagta 137 |||| |||||||| Sbjct: 17815 ttatccgccagta 17803
>dbj|AP004305.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0492E07 Length = 143794 Score = 87.7 bits (44), Expect = 4e-14 Identities = 56/60 (93%) Strand = Plus / Minus Query: 136 taccacaacgtgaacattaatgttgctgtacagactgagcatggtttgttcgttccagta 195 ||||||||||||||||| |||||||||||||||||||||||||| |||| ||||||||| Sbjct: 134072 taccacaacgtgaacatcaatgttgctgtacagactgagcatggactgtttgttccagta 134013 Score = 75.8 bits (38), Expect = 2e-10 Identities = 62/70 (88%) Strand = Plus / Minus Query: 229 attgctgatgaggtgaagcagttggctctaagagcaagggataacagcctaaaaccagaa 288 ||||| || ||||||||||||||||||| |||||||||||||||||| | |||||||| Sbjct: 133917 attgcggaggaggtgaagcagttggctcaaagagcaagggataacagtttgaaaccagat 133858 Query: 289 gattacgagg 298 ||||| |||| Sbjct: 133857 gattatgagg 133848 Score = 75.8 bits (38), Expect = 2e-10 Identities = 68/78 (87%) Strand = Plus / Minus Query: 323 tgggaggccctttcggaatcaagcaattctgtgccatcgtaaaccctccccaatcggcaa 382 ||||||| ||||| ||||| |||||||| ||||||||| |||| ||||| || ||||||| Sbjct: 133744 tgggaggtccttttggaattaagcaattttgtgccatcataaatcctcctcagtcggcaa 133685 Query: 383 tcttggctattggctctg 400 ||||||| ||||| |||| Sbjct: 133684 tcttggccattggttctg 133667 Score = 73.8 bits (37), Expect = 6e-10 Identities = 64/73 (87%) Strand = Plus / Minus Query: 65 aggctgcagcgttggctcttcgtaaggttcctgcgtgtaacagttcctggatgaatgatt 124 |||||||||| |||||||||| ||||| ||| |||||| || |||||||||||||||| Sbjct: 134221 aggctgcagctctggctcttcgaaaggtccctcagtgtaatagctcctggatgaatgatt 134162 Query: 125 ttattcgccagta 137 |||| |||||||| Sbjct: 134161 ttatccgccagta 134149
>ref|NM_112247.2| Arabidopsis thaliana acyltransferase/ dihydrolipoyllysine-residue acetyltransferase/ protein binding AT3G13930 mRNA, complete cds Length = 2147 Score = 60.0 bits (30), Expect = 9e-06 Identities = 51/58 (87%) Strand = Plus / Plus Query: 39 gatatctataaatgatcttgtcattaaggctgcagcgttggctcttcgtaaggttcct 96 ||||||| ||||||||||||| ||||||||||| || |||||||||| || |||||| Sbjct: 1293 gatatctgtaaatgatcttgttattaaggctgctgcactggctcttcgaaaagttcct 1350
>ref|NM_104300.2| Arabidopsis thaliana acyltransferase/ dihydrolipoyllysine-residue acetyltransferase/ protein binding AT1G54220 transcript variant AT1G54220.1 mRNA, complete cds Length = 2018 Score = 60.0 bits (30), Expect = 9e-06 Identities = 72/86 (83%) Strand = Plus / Plus Query: 271 aacagcctaaaaccagaagattacgagggtggcactttcaccgtctcgaatctgggaggc 330 |||||| |||| ||||||||||| ||||| || || || || ||||| || ||||||| Sbjct: 1392 aacagcttaaagccagaagattatgagggaggaacatttactgtctctaacttgggagga 1451 Query: 331 cctttcggaatcaagcaattctgtgc 356 ||||| || ||||||||||||||||| Sbjct: 1452 ccttttggcatcaagcaattctgtgc 1477
>ref|NM_001036109.1| Arabidopsis thaliana acyltransferase/ dihydrolipoyllysine-residue acetyltransferase/ protein binding AT1G54220 transcript variant AT1G54220.2 mRNA, complete cds Length = 2035 Score = 60.0 bits (30), Expect = 9e-06 Identities = 72/86 (83%) Strand = Plus / Plus Query: 271 aacagcctaaaaccagaagattacgagggtggcactttcaccgtctcgaatctgggaggc 330 |||||| |||| ||||||||||| ||||| || || || || ||||| || ||||||| Sbjct: 1426 aacagcttaaagccagaagattatgagggaggaacatttactgtctctaacttgggagga 1485 Query: 331 cctttcggaatcaagcaattctgtgc 356 ||||| || ||||||||||||||||| Sbjct: 1486 ccttttggcatcaagcaattctgtgc 1511
>gb|BT020419.1| Arabidopsis thaliana At1g54220 mRNA, complete cds Length = 1620 Score = 60.0 bits (30), Expect = 9e-06 Identities = 72/86 (83%) Strand = Plus / Plus Query: 271 aacagcctaaaaccagaagattacgagggtggcactttcaccgtctcgaatctgggaggc 330 |||||| |||| ||||||||||| ||||| || || || || ||||| || ||||||| Sbjct: 1324 aacagcttaaagccagaagattatgagggaggaacatttactgtctctaacttgggagga 1383 Query: 331 cctttcggaatcaagcaattctgtgc 356 ||||| || ||||||||||||||||| Sbjct: 1384 ccttttggcatcaagcaattctgtgc 1409
>gb|BT000702.1| Arabidopsis thaliana clone RAFL07-10-F16 (R10941) putative acetyltransferase (At3g13930) mRNA, complete cds Length = 2045 Score = 60.0 bits (30), Expect = 9e-06 Identities = 51/58 (87%) Strand = Plus / Plus Query: 39 gatatctataaatgatcttgtcattaaggctgcagcgttggctcttcgtaaggttcct 96 ||||||| ||||||||||||| ||||||||||| || |||||||||| || |||||| Sbjct: 1234 gatatctgtaaatgatcttgttattaaggctgctgcactggctcttcgaaaagttcct 1291
>gb|BT000444.1| Arabidopsis thaliana putative acetyltransferase (At3g13930) mRNA, complete cds Length = 1946 Score = 60.0 bits (30), Expect = 9e-06 Identities = 51/58 (87%) Strand = Plus / Plus Query: 39 gatatctataaatgatcttgtcattaaggctgcagcgttggctcttcgtaaggttcct 96 ||||||| ||||||||||||| ||||||||||| || |||||||||| || |||||| Sbjct: 1232 gatatctgtaaatgatcttgttattaaggctgctgcactggctcttcgaaaagttcct 1289
>gb|AY092968.1| Arabidopsis thaliana dihydrolipoamide acetyltransferase (At3g13930) mRNA, complete cds Length = 2016 Score = 60.0 bits (30), Expect = 9e-06 Identities = 51/58 (87%) Strand = Plus / Plus Query: 39 gatatctataaatgatcttgtcattaaggctgcagcgttggctcttcgtaaggttcct 96 ||||||| ||||||||||||| ||||||||||| || |||||||||| || |||||| Sbjct: 1286 gatatctgtaaatgatcttgttattaaggctgctgcactggctcttcgaaaagttcct 1343
>gb|AY091691.1| Arabidopsis thaliana AT3g13930/MDC16_5 mRNA, complete cds Length = 1620 Score = 60.0 bits (30), Expect = 9e-06 Identities = 51/58 (87%) Strand = Plus / Plus Query: 39 gatatctataaatgatcttgtcattaaggctgcagcgttggctcttcgtaaggttcct 96 ||||||| ||||||||||||| ||||||||||| || |||||||||| || |||||| Sbjct: 1092 gatatctgtaaatgatcttgttattaaggctgctgcactggctcttcgaaaagttcct 1149
>gb|AF367302.1| Arabidopsis thaliana AT3g13930/MDC16_5 mRNA, complete cds Length = 2001 Score = 60.0 bits (30), Expect = 9e-06 Identities = 51/58 (87%) Strand = Plus / Plus Query: 39 gatatctataaatgatcttgtcattaaggctgcagcgttggctcttcgtaaggttcct 96 ||||||| ||||||||||||| ||||||||||| || |||||||||| || |||||| Sbjct: 1232 gatatctgtaaatgatcttgttattaaggctgctgcactggctcttcgaaaagttcct 1289
>gb|AY033001.1| Arabidopsis thaliana mono-lipoyl E2 mRNA, complete cds; nuclear gene for mitochondrial product Length = 1620 Score = 60.0 bits (30), Expect = 9e-06 Identities = 72/86 (83%) Strand = Plus / Plus Query: 271 aacagcctaaaaccagaagattacgagggtggcactttcaccgtctcgaatctgggaggc 330 |||||| |||| ||||||||||| ||||| || || || || ||||| || ||||||| Sbjct: 1324 aacagcttaaagccagaagattatgagggaggaacatttactgtctctaacttgggagga 1383 Query: 331 cctttcggaatcaagcaattctgtgc 356 ||||| || ||||||||||||||||| Sbjct: 1384 ccttttggcatcaagcaattctgtgc 1409
>gb|BT001223.1| Arabidopsis thaliana putative acetyltransferase (At3g13930) mRNA, complete cds Length = 1687 Score = 60.0 bits (30), Expect = 9e-06 Identities = 51/58 (87%) Strand = Plus / Plus Query: 39 gatatctataaatgatcttgtcattaaggctgcagcgttggctcttcgtaaggttcct 96 ||||||| ||||||||||||| ||||||||||| || |||||||||| || |||||| Sbjct: 1092 gatatctgtaaatgatcttgttattaaggctgctgcactggctcttcgaaaagttcct 1149
>gb|AC140032.4| Medicago truncatula clone mth2-10i23, complete sequence Length = 124302 Score = 58.0 bits (29), Expect = 4e-05 Identities = 62/73 (84%) Strand = Plus / Plus Query: 65 aggctgcagcgttggctcttcgtaaggttcctgcgtgtaacagttcctggatgaatgatt 124 ||||||| || |||||||| ||||| |||||| |||||||||||| |||| ||||| | Sbjct: 75441 aggctgctgctttggctctccgtaaagttcctcagtgtaacagttcatggacaaatgact 75500 Query: 125 ttattcgccagta 137 |||||||||||| Sbjct: 75501 atattcgccagta 75513
>gb|AY136410.1| Arabidopsis thaliana dihydrolipoamide S-acetyltransferase, putative (At1g54220) mRNA, complete cds Length = 2018 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 273 cagcctaaaaccagaagattacgagggtggcactttcaccgtctcgaatctgggaggccc 332 |||| |||| ||||||||||| ||||| || || || || ||||| || ||||||| || Sbjct: 1394 cagcttaaagccagaagattatgagggaggaacatttactgtctctaacttgggaggacc 1453 Query: 333 tttcggaatcaagcaattctgtgc 356 ||| || ||||||||||||||||| Sbjct: 1454 ttttggcatcaagcaattctgtgc 1477
>gb|AC005287.4| Arabidopsis thaliana chromosome I BAC F20D21 genomic sequence, complete sequence Length = 143186 Score = 44.1 bits (22), Expect = 0.55 Identities = 31/34 (91%) Strand = Plus / Minus Query: 323 tgggaggccctttcggaatcaagcaattctgtgc 356 ||||||| ||||| || ||||||||||||||||| Sbjct: 18382 tgggaggaccttttggcatcaagcaattctgtgc 18349
>emb|BX005311.8| Zebrafish DNA sequence from clone DKEY-45J13 in linkage group 6, complete sequence Length = 40451 Score = 44.1 bits (22), Expect = 0.55 Identities = 25/26 (96%) Strand = Plus / Minus Query: 47 taaatgatcttgtcattaaggctgca 72 ||||||||||||||||||||| |||| Sbjct: 14124 taaatgatcttgtcattaaggttgca 14099
>gb|AC096938.8| Rattus norvegicus 16 BAC CH230-49B24 (Children's Hospital Oakland Research Institute) complete sequence Length = 220401 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 393 tggctctgctgagaagagggt 413 ||||||||||||||||||||| Sbjct: 39620 tggctctgctgagaagagggt 39640
>gb|AC117058.19| Rattus norvegicus 16 BAC CH230-318I9 (Children's Hospital Oakland Research Institute) complete sequence Length = 181157 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 393 tggctctgctgagaagagggt 413 ||||||||||||||||||||| Sbjct: 68712 tggctctgctgagaagagggt 68692
>emb|AL591787.1|SME591787 Sinorhizobium meliloti 1021 complete chromosome; segment 6/12 Length = 329100 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 475 gaccaccgggtcattgatggcgcca 499 |||||||||||||| |||||||||| Sbjct: 273615 gaccaccgggtcatggatggcgcca 273591
>gb|AC116772.6| Mus musculus chromosome 8, clone RP23-428C21, complete sequence Length = 232691 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 587 aatgatgatgatgagagcagttttt 611 |||||||||||||| |||||||||| Sbjct: 114405 aatgatgatgatgatagcagttttt 114381
>emb|X79328.1|RNCABP1 R.norvegicus (Wistar) CaBP1 mRNA Length = 1296 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 280 aaaccagaagattacgagggtggca 304 ||||||||||||||| ||||||||| Sbjct: 301 aaaccagaagattaccagggtggca 325
>ref|XM_576132.1| PREDICTED: Rattus norvegicus thioredoxin domain containing 7 (Txndc7), mRNA Length = 2122 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 280 aaaccagaagattacgagggtggca 304 ||||||||||||||| ||||||||| Sbjct: 372 aaaccagaagattaccagggtggca 396
>dbj|AB019229.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MDC16 Length = 84294 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Plus Query: 39 gatatctataaatgatcttgtcattaagg 67 ||||||| ||||||||||||| ||||||| Sbjct: 24414 gatatctgtaaatgatcttgttattaagg 24442
>gb|BC082063.1| Rattus norvegicus protein disulfide isomerase associated 6, mRNA (cDNA clone MGC:95222 IMAGE:7132589), complete cds Length = 1744 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 280 aaaccagaagattacgagggtggca 304 ||||||||||||||| ||||||||| Sbjct: 361 aaaccagaagattaccagggtggca 385
>ref|NM_001004442.1| Rattus norvegicus protein disulfide isomerase associated 6 (Pdia6), mRNA Length = 1744 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 280 aaaccagaagattacgagggtggca 304 ||||||||||||||| ||||||||| Sbjct: 361 aaaccagaagattaccagggtggca 385
>ref|NM_001016432.2| Xenopus tropicalis hypothetical protein LOC549186 (LOC549186), mRNA Length = 2044 Score = 40.1 bits (20), Expect = 8.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 580 tgctgtaaatgatgatgatgagag 603 |||||||| ||||||||||||||| Sbjct: 289 tgctgtaattgatgatgatgagag 312
>gb|AC110381.5| Mus musculus BAC clone RP24-198I16 from chromosome 10, complete sequence Length = 166554 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 161 ctgtacagactgagcatggt 180 |||||||||||||||||||| Sbjct: 147155 ctgtacagactgagcatggt 147174
>gb|AC167250.2| Mus musculus BAC clone RP23-69D2 from chromosome 9, complete sequence Length = 221255 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 118 aatgattttattcgccagta 137 |||||||||||||||||||| Sbjct: 209964 aatgattttattcgccagta 209983
>emb|Z54270.1|CEF11C1 Caenorhabditis elegans Cosmid F11C1, complete sequence Length = 40852 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 28 ggcgggaagaagatatctat 47 |||||||||||||||||||| Sbjct: 26066 ggcgggaagaagatatctat 26047
>gb|AC117227.3| Mus musculus BAC clone RP23-380C5 from 13, complete sequence Length = 190816 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 245 agcagttggctctaagagca 264 |||||||||||||||||||| Sbjct: 15923 agcagttggctctaagagca 15942
>gb|AC154171.5| Mus musculus BAC clone RP24-259F16 from chromosome 13, complete sequence Length = 173300 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 245 agcagttggctctaagagca 264 |||||||||||||||||||| Sbjct: 82604 agcagttggctctaagagca 82623
>gb|AC139154.3| Mus musculus chromosome 7 clone RP24-356B8, complete sequence Length = 164774 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 54 tcttgtcattaaggctgcag 73 |||||||||||||||||||| Sbjct: 106873 tcttgtcattaaggctgcag 106892
>emb|AL138849.12| Human DNA sequence from clone RP5-965L7 on chromosome 1p32.1-33 Contains the 3' ends of genes FLJ34719 and KIAA0191, complete sequence Length = 127006 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 591 atgatgatgagagcagtttt 610 |||||||||||||||||||| Sbjct: 97771 atgatgatgagagcagtttt 97752
>emb|BX072104.1|CNS09RSS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9DF05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 909 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 590 tccttcatgtcagccacgct 609
>emb|BX072103.1|CNS09RSR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9DF05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 971 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 362 tccttcatgtcagccacgct 343
>emb|BX072102.1|CNS09RSQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9DF04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 918 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 587 tccttcatgtcagccacgct 606
>emb|BX072101.1|CNS09RSP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9DF04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 985 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 370 tccttcatgtcagccacgct 351
>emb|BX072044.1|CNS09RR4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9DC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 893 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 572 tccttcatgtcagccacgct 591
>emb|BX072043.1|CNS09RR3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9DC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 965 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 358 tccttcatgtcagccacgct 339
>emb|BX071900.1|CNS09RN4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9CE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 976 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 349 tccttcatgtcagccacgct 330
>emb|BX071795.1|CNS09RK7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9BH08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1002 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 595 tccttcatgtcagccacgct 614
>emb|BX071794.1|CNS09RK6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9BH08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 992 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 347 tccttcatgtcagccacgct 328
>emb|BX071773.1|CNS09RJL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9BG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 755 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 589 tccttcatgtcagccacgct 608
>emb|BX071772.1|CNS09RJK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9BG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 804 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 350 tccttcatgtcagccacgct 331
>emb|BX071703.1|CNS09RHN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9BD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 953 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 573 tccttcatgtcagccacgct 592
>emb|BX071702.1|CNS09RHM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9BD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 946 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 334 tccttcatgtcagccacgct 315
>emb|BX071484.1|CNS09RBK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9AB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 899 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 579 tccttcatgtcagccacgct 598
>emb|BX071483.1|CNS09RBJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9AB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 983 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 357 tccttcatgtcagccacgct 338
>emb|BX071109.1|CNS09R15 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8CA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 912 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 571 tccttcatgtcagccacgct 590
>emb|BX071108.1|CNS09R14 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8CA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 969 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 349 tccttcatgtcagccacgct 330
>emb|BX071294.1|CNS09R6A Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8DB02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 685 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 332 tccttcatgtcagccacgct 313
>emb|BX070984.1|CNS09QXO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8BD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 914 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 586 tccttcatgtcagccacgct 605
>emb|BX070983.1|CNS09QXN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8BD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 815 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 378 tccttcatgtcagccacgct 359
>emb|BX070927.1|CNS09QW3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8BA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 804 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 580 tccttcatgtcagccacgct 599
>emb|BX070926.1|CNS09QW2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8BA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 685 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 336 tccttcatgtcagccacgct 317
>emb|BX070787.1|CNS09QS7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8AC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 915 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 581 tccttcatgtcagccacgct 600
>emb|BX070786.1|CNS09QS6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8AC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 959 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 363 tccttcatgtcagccacgct 344
>emb|BX070590.1|CNS09QMQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC7DA06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 930 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 587 tccttcatgtcagccacgct 606
>emb|BX070589.1|CNS09QMP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7DA06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 979 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 741 tccttcatgtcagccacgct 722
>emb|BX070475.1|CNS09QJJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7CD04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 488 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 324 tccttcatgtcagccacgct 305
>emb|BX070293.1|CNS09QEH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7BC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 505 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 342 tccttcatgtcagccacgct 323
>emb|BX070240.1|CNS09QD0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC7BA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 811 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 576 tccttcatgtcagccacgct 595
>emb|BX070239.1|CNS09QCZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7BA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 862 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 353 tccttcatgtcagccacgct 334
>emb|BX070199.1|CNS09QBV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC7AG07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 751 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 575 tccttcatgtcagccacgct 594
>emb|BX069996.1|CNS09Q68 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6DE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 955 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 571 tccttcatgtcagccacgct 590
>emb|BX069995.1|CNS09Q67 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6DE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 979 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 350 tccttcatgtcagccacgct 331
>emb|BX069964.1|CNS09Q5C Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6DD02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 426 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 332 tccttcatgtcagccacgct 313
>emb|BX069838.1|CNS09Q1U Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6CF06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 704 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 572 tccttcatgtcagccacgct 591
>emb|BX069837.1|CNS09Q1T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6CF06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 711 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 333 tccttcatgtcagccacgct 314
>emb|BX069816.1|CNS09Q18 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6CE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 965 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 589 tccttcatgtcagccacgct 608
>emb|BX069815.1|CNS09Q17 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6CE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 707 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 354 tccttcatgtcagccacgct 335
>emb|BX061095.1|CNS09JAZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC41CH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 911 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 568 tccttcatgtcagccacgct 587
>emb|BX061094.1|CNS09JAY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41CH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 953 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 333 tccttcatgtcagccacgct 314
>emb|BX060930.1|CNS09J6E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC41CA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 649 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 564 tccttcatgtcagccacgct 583
>emb|BX060929.1|CNS09J6D Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41CA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 509 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 291 tccttcatgtcagccacgct 272
>emb|BX069521.1|CNS09PT1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6AH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 923 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 593 tccttcatgtcagccacgct 612
>emb|BX069520.1|CNS09PT0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6AH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 958 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 372 tccttcatgtcagccacgct 353
>emb|BX069417.1|CNS09PQ5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6AC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 860 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 576 tccttcatgtcagccacgct 595
>emb|BX069416.1|CNS09PQ4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6AC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 839 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 303 tccttcatgtcagccacgct 284
>emb|BX069166.1|CNS09PJ6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53CH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 684 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 286 tccttcatgtcagccacgct 267
>emb|BX069144.1|CNS09PIK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53CG04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 948 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 313 tccttcatgtcagccacgct 294
>emb|BX069128.1|CNS09PI4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53CF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 990 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 351 tccttcatgtcagccacgct 332
>emb|BX069125.1|CNS09PI1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53CF06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 602 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 557 tccttcatgtcagccacgct 576
>emb|BX069124.1|CNS09PI0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53CF06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 710 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 347 tccttcatgtcagccacgct 328
>emb|BX069070.1|CNS09PGI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53CD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 994 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 354 tccttcatgtcagccacgct 335
>emb|BX069043.1|CNS09PFR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53CC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 937 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 597 tccttcatgtcagccacgct 616
>emb|BX069042.1|CNS09PFQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53CC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1008 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 356 tccttcatgtcagccacgct 337
>emb|BX069033.1|CNS09PFH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53CB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 819 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 590 tccttcatgtcagccacgct 609
>emb|BX069032.1|CNS09PFG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53CB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 954 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 335 tccttcatgtcagccacgct 316
>emb|BX069017.1|CNS09PF1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53CA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 665 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 593 tccttcatgtcagccacgct 612
>emb|BX069016.1|CNS09PF0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53CA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 684 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 349 tccttcatgtcagccacgct 330
>emb|BX068852.1|CNS09PAG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53BB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 963 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 605 tccttcatgtcagccacgct 624
>emb|BX068851.1|CNS09PAF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53BB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 994 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 368 tccttcatgtcagccacgct 349
>emb|BX068818.1|CNS09P9I Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53BA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 848 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 588 tccttcatgtcagccacgct 607
>emb|BX068817.1|CNS09P9H Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53BA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 848 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 343 tccttcatgtcagccacgct 324
>emb|BX068776.1|CNS09P8C Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53AG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 952 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 318 tccttcatgtcagccacgct 299
>emb|BX068622.1|CNS09P42 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52DH05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 387 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 334 tccttcatgtcagccacgct 315
>emb|BX068497.1|CNS09P0L Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52DB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 915 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 345 tccttcatgtcagccacgct 326
>emb|BX068480.1|CNS09P04 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52DA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 637 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 565 tccttcatgtcagccacgct 584
>emb|BX068479.1|CNS09P03 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52DA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 872 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 304 tccttcatgtcagccacgct 285
>emb|BX068124.1|CNS09OQ8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52AG06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 901 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 603 tccttcatgtcagccacgct 622
>emb|BX068123.1|CNS09OQ7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52AG06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 996 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 365 tccttcatgtcagccacgct 346
>emb|BX068046.1|CNS09OO2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52AC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 796 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 587 tccttcatgtcagccacgct 606
>emb|BX068045.1|CNS09OO1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52AC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 674 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 355 tccttcatgtcagccacgct 336
>emb|BX067898.1|CNS09OJY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51DB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1007 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 591 tccttcatgtcagccacgct 610
>emb|BX067672.1|CNS09ODO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51BH03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 901 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 325 tccttcatgtcagccacgct 306
>emb|BX067486.1|CNS09O8I Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51AG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 939 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 567 tccttcatgtcagccacgct 586
>emb|BX067485.1|CNS09O8H Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51AG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 944 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 342 tccttcatgtcagccacgct 323
>emb|BX067448.1|CNS09O7G Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51AE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 632 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 336 tccttcatgtcagccacgct 355
>emb|BX067447.1|CNS09O7F Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51AE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 991 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 350 tccttcatgtcagccacgct 331
>emb|BX067015.1|CNS09NVF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50CB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 839 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 572 tccttcatgtcagccacgct 591
>emb|BX067014.1|CNS09NVE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50CB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 942 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 343 tccttcatgtcagccacgct 324
>emb|BX066921.1|CNS09NST Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50BF02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 474 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 355 tccttcatgtcagccacgct 336
>emb|BX067271.1|CNS09O2J Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50DE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 976 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 338 tccttcatgtcagccacgct 319
>emb|BX067265.1|CNS09O2D Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50DE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 825 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 356 tccttcatgtcagccacgct 337
>emb|BX067249.1|CNS09O1X Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50DD09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 958 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 571 tccttcatgtcagccacgct 590
>emb|BX067248.1|CNS09O1W Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50DD09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 962 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 325 tccttcatgtcagccacgct 306
>emb|BX067222.1|CNS09O16 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50DC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 988 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 576 tccttcatgtcagccacgct 595
>emb|BX067221.1|CNS09O15 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50DC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 981 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 351 tccttcatgtcagccacgct 332
>emb|BX067182.1|CNS09O02 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50DA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 946 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 575 tccttcatgtcagccacgct 594
>emb|BX067181.1|CNS09O01 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50DA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 969 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 359 tccttcatgtcagccacgct 340
>emb|BX066729.1|CNS09NNH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50AE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 802 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 370 tccttcatgtcagccacgct 351
>emb|BX066570.1|CNS09NJ2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC5DG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 554 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 201 tccttcatgtcagccacgct 220
>emb|BX066569.1|CNS09NJ1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5DG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 986 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 350 tccttcatgtcagccacgct 331
>emb|BX066542.1|CNS09NIA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC5DE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 956 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 581 tccttcatgtcagccacgct 600
>emb|BX066541.1|CNS09NI9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5DE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 976 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 351 tccttcatgtcagccacgct 332
>emb|BX066194.1|CNS09N8M Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5BF04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 805 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 329 tccttcatgtcagccacgct 310
>emb|BX066150.1|CNS09N7E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5BD06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 947 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 354 tccttcatgtcagccacgct 335
>emb|BX066095.1|CNS09N5V Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5BB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 961 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 331 tccttcatgtcagccacgct 312
>emb|BX065974.1|CNS09N2I Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC5AD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 643 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 581 tccttcatgtcagccacgct 600
>emb|BX065973.1|CNS09N2H Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5AD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 735 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 289 tccttcatgtcagccacgct 270
>emb|BX065830.1|CNS09MYI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49DE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 699 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 344 tccttcatgtcagccacgct 325
>emb|BX065805.1|CNS09MXT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49DD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 713 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 588 tccttcatgtcagccacgct 607
>emb|BX065804.1|CNS09MXS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49DD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 607 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 360 tccttcatgtcagccacgct 341
>emb|BX065733.1|CNS09MVT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49DA03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 748 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 286 tccttcatgtcagccacgct 267
>emb|BX065586.1|CNS09MRQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49CB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 973 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 339 tccttcatgtcagccacgct 320
>emb|BX065527.1|CNS09MQ3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49BH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 965 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 588 tccttcatgtcagccacgct 607
>emb|BX065526.1|CNS09MQ2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49BH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 990 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 351 tccttcatgtcagccacgct 332
>emb|BX065395.1|CNS09MMF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49BB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 918 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 558 tccttcatgtcagccacgct 577
>emb|BX065394.1|CNS09MME Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49BB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 961 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 331 tccttcatgtcagccacgct 312
>emb|BX065268.1|CNS09MIW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49AD01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 932 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 569 tccttcatgtcagccacgct 588
>emb|BX065267.1|CNS09MIV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49AD01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 960 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 340 tccttcatgtcagccacgct 321
>emb|BX064786.1|CNS09M5I Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48BE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 793 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 325 tccttcatgtcagccacgct 306
>emb|BX064593.1|CNS09M05 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46DG04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 944 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 360 tccttcatgtcagccacgct 341
>emb|BX064578.1|CNS09LZQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46DF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 652 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 305 tccttcatgtcagccacgct 286
>emb|BX064559.1|CNS09LZ7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46DE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 680 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 570 tccttcatgtcagccacgct 589
>emb|BX064558.1|CNS09LZ6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46DE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 834 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 358 tccttcatgtcagccacgct 339
>emb|BX064318.1|CNS09LSI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46CB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 919 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 587 tccttcatgtcagccacgct 606
>emb|BX064317.1|CNS09LSH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46CB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 937 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 365 tccttcatgtcagccacgct 346
>emb|BX064256.1|CNS09LQS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46BH03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 908 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 347 tccttcatgtcagccacgct 328
>emb|BX064193.1|CNS09LP1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46BE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 889 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 559 tccttcatgtcagccacgct 578
>emb|BX064192.1|CNS09LP0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46BE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 976 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 349 tccttcatgtcagccacgct 330
>emb|BX064097.1|CNS09LMD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46BA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1000 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 586 tccttcatgtcagccacgct 605
>emb|BX064096.1|CNS09LMC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46BA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 997 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 356 tccttcatgtcagccacgct 337
>emb|BX064002.1|CNS09LJQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46AE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 735 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 566 tccttcatgtcagccacgct 585
>emb|BX064001.1|CNS09LJP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46AE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 967 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 350 tccttcatgtcagccacgct 331
>emb|BX063585.1|CNS09L85 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45CA06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 132 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 126 tccttcatgtcagccacgct 107
>emb|BX063528.1|CNS09L6K Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45BF02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 465 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 333 tccttcatgtcagccacgct 314
>emb|BX063517.1|CNS09L69 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC45BE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 720 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 416 tccttcatgtcagccacgct 435
>emb|BX063516.1|CNS09L68 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45BE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 910 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 335 tccttcatgtcagccacgct 316
>emb|BX063197.1|CNS09KXD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44DF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 959 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 575 tccttcatgtcagccacgct 594
>emb|BX063196.1|CNS09KXC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44DF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 976 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 361 tccttcatgtcagccacgct 342
>emb|BX063195.1|CNS09KXB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44DE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 911 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 568 tccttcatgtcagccacgct 587
>emb|BX063194.1|CNS09KXA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44DE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 964 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 360 tccttcatgtcagccacgct 341
>emb|BX063139.1|CNS09KVR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44DC05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 917 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 355 tccttcatgtcagccacgct 336
>emb|BX063130.1|CNS09KVI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44DB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 928 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 598 tccttcatgtcagccacgct 617
>emb|BX063129.1|CNS09KVH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44DB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 918 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 285 tccttcatgtcagccacgct 266
>emb|BX063083.1|CNS09KU7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44CH09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1044 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 399 tccttcatgtcagccacgct 380
>emb|BX062737.1|CNS09KKL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44AF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 346 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 346 tccttcatgtcagccacgct 327
>emb|BX062398.1|CNS09KB6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43CG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 985 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 582 tccttcatgtcagccacgct 601
>emb|BX062397.1|CNS09KB5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43CG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 989 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 349 tccttcatgtcagccacgct 330
>emb|BX062345.1|CNS09K9P Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43CD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 956 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 570 tccttcatgtcagccacgct 589
>emb|BX062344.1|CNS09K9O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43CD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 934 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 302 tccttcatgtcagccacgct 283
>emb|BX062249.1|CNS09K71 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43BG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 945 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 577 tccttcatgtcagccacgct 596
>emb|BX062248.1|CNS09K70 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43BG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 974 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 341 tccttcatgtcagccacgct 322
>emb|BX062217.1|CNS09K65 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43BF02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 982 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 575 tccttcatgtcagccacgct 594
>emb|BX061945.1|CNS09JYL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43AA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 538 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 314 tccttcatgtcagccacgct 295
>emb|BX061917.1|CNS09JXT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42DG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 971 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 567 tccttcatgtcagccacgct 586
>emb|BX061916.1|CNS09JXS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42DG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 947 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 329 tccttcatgtcagccacgct 310
>emb|BX061583.1|CNS09JOJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42CA04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 727 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 338 tccttcatgtcagccacgct 319
>emb|BX061299.1|CNS09JGN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42AB05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 939 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 583 tccttcatgtcagccacgct 602
>emb|BX061298.1|CNS09JGM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42AB05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 957 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 329 tccttcatgtcagccacgct 310
>emb|BX060631.1|CNS09IY3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC41AD04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 570 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 434 tccttcatgtcagccacgct 453
>emb|BX060522.1|CNS09IV2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40DG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 965 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 561 tccttcatgtcagccacgct 580
>emb|BX060521.1|CNS09IV1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40DG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 966 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 343 tccttcatgtcagccacgct 324
>emb|BX060463.1|CNS09ITF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40DD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 663 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 571 tccttcatgtcagccacgct 590
>emb|BX060462.1|CNS09ITE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40DD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 831 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 344 tccttcatgtcagccacgct 325
>emb|BX060432.1|CNS09ISK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40DC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 649 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 577 tccttcatgtcagccacgct 596
>emb|BX060431.1|CNS09ISJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40DC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 925 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 344 tccttcatgtcagccacgct 325
>emb|BX060386.1|CNS09IRA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40CH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 790 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 584 tccttcatgtcagccacgct 603
>emb|BX060385.1|CNS09IR9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40CH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 737 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 365 tccttcatgtcagccacgct 346
>emb|BX060142.1|CNS09IKI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40BF03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 934 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 540 tccttcatgtcagccacgct 559
>emb|BX060141.1|CNS09IKH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40BF03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 948 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 328 tccttcatgtcagccacgct 309
>emb|BX059767.1|CNS09IA3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC4DC08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 852 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 587 tccttcatgtcagccacgct 606
>emb|BX059766.1|CNS09IA2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4DC08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 983 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 349 tccttcatgtcagccacgct 330
>emb|BX059737.1|CNS09I99 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4DA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 907 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 334 tccttcatgtcagccacgct 315
>emb|BX059721.1|CNS09I8T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4CH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 966 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 337 tccttcatgtcagccacgct 318
>emb|BX059691.1|CNS09I7Z Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4CG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 500 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 329 tccttcatgtcagccacgct 310
>emb|BX059325.1|CNS09HXT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC4AE03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 953 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 594 tccttcatgtcagccacgct 613
>emb|BX059252.1|CNS09HVS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC4AA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 946 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 609 tccttcatgtcagccacgct 628
>emb|BX059251.1|CNS09HVR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4AA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 978 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 343 tccttcatgtcagccacgct 324
>emb|BX059147.1|CNS09HSV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39DD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 992 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 588 tccttcatgtcagccacgct 607
>emb|BX059146.1|CNS09HSU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39DD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 991 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 362 tccttcatgtcagccacgct 343
>emb|BX059121.1|CNS09HS5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39DC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 989 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 343 tccttcatgtcagccacgct 324
>emb|BX059021.1|CNS09HPD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39CG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 798 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 560 tccttcatgtcagccacgct 579
>emb|BX059020.1|CNS09HPC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39CG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 856 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 337 tccttcatgtcagccacgct 318
>emb|BX058945.1|CNS09HN9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39CC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1002 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 602 tccttcatgtcagccacgct 621
>emb|BX058944.1|CNS09HN8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39CC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 983 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 369 tccttcatgtcagccacgct 350
>emb|BX058923.1|CNS09HMN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39CC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 952 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 558 tccttcatgtcagccacgct 577
>emb|BX058922.1|CNS09HMM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39CC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 966 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 328 tccttcatgtcagccacgct 309
>emb|BX058853.1|CNS09HKP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39BG12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 954 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 327 tccttcatgtcagccacgct 308
>emb|BX058608.1|CNS09HDW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39AD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 449 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 334 tccttcatgtcagccacgct 315
>emb|BX058465.1|CNS09H9X Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38DE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 855 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 362 tccttcatgtcagccacgct 343
>emb|BX056668.1|CNS09FW0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36AE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 975 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 346 tccttcatgtcagccacgct 327
>emb|BX057945.1|CNS09GVH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC38AE02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 741 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 572 tccttcatgtcagccacgct 591
>emb|BX057944.1|CNS09GVG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38AE02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 975 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 348 tccttcatgtcagccacgct 329
>emb|BX057829.1|CNS09GS9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37DH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 876 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 338 tccttcatgtcagccacgct 319
>emb|BX057649.1|CNS09GN9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC37CG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 732 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 602 tccttcatgtcagccacgct 621
>emb|BX057648.1|CNS09GN8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37CG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 991 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 370 tccttcatgtcagccacgct 351
>emb|BX057637.1|CNS09GMX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC37CG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 847 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 602 tccttcatgtcagccacgct 621
>emb|BX057636.1|CNS09GMW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37CG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 952 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 336 tccttcatgtcagccacgct 317
>emb|BX057621.1|CNS09GMH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37CF09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 381 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 348 tccttcatgtcagccacgct 329
>emb|BX057549.1|CNS09GKH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC37CC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 904 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 591 tccttcatgtcagccacgct 610
>emb|BX057548.1|CNS09GKG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37CC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 910 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 339 tccttcatgtcagccacgct 320
>emb|BX057427.1|CNS09GH3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37BE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 668 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 345 tccttcatgtcagccacgct 326
>emb|BX057217.1|CNS09GB9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37AC08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 583 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 344 tccttcatgtcagccacgct 325
>emb|BX057112.1|CNS09G8C Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC36DF09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 557 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 421 tccttcatgtcagccacgct 440
>emb|BX057111.1|CNS09G8B Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36DF09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 835 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 347 tccttcatgtcagccacgct 328
>emb|BX057064.1|CNS09G70 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36DD08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 654 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 367 tccttcatgtcagccacgct 348
>emb|BX056980.1|CNS09G4O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36CH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 494 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 335 tccttcatgtcagccacgct 316
>emb|BX056939.1|CNS09G3J Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36CF03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 593 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 448 tccttcatgtcagccacgct 467 |||||||||||||||||||| Sbjct: 291 tccttcatgtcagccacgct 272 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,208,661 Number of Sequences: 3902068 Number of extensions: 5208661 Number of successful extensions: 104305 Number of sequences better than 10.0: 564 Number of HSP's better than 10.0 without gapping: 564 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 103534 Number of HSP's gapped (non-prelim): 768 length of query: 634 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 611 effective length of database: 17,143,297,704 effective search space: 10474554897144 effective search space used: 10474554897144 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
