ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags27g13
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_479931.1| Oryza sativa (japonica cultivar-group), mRNA 676 0.0
2dbj|D21130.1|RICYK704 Oryza sativa (japonica cultivar-group) YK7... 676 0.0
3dbj|AK064857.1| Oryza sativa (japonica cultivar-group) cDNA clon... 676 0.0
4emb|Y07959.1|ZMRPP0 Z.mays mRNA for acidic ribosomal protein P0 406 e-110
5gb|BT016531.1| Zea mays clone Contig364 mRNA sequence 398 e-108
6dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 317 2e-83
7dbj|AP004591.3| Oryza sativa (japonica cultivar-group) genomic D... 317 2e-83
8gb|AC123528.2| Oryza sativa chromosome 11 clone OSJNBa0078E03, ... 293 3e-76
9dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 293 3e-76
10dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 293 3e-76
11gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 293 3e-76
12gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 293 3e-76
13emb|BX000508.1|CNS08CDY Oryza sativa chromosome 12, . BAC OJ1575... 293 3e-76
14emb|BX000498.1|CNS08CDO Oryza sativa chromosome 12, . BAC OSJNBa... 293 3e-76
15dbj|AB091076.1| Zinnia elegans ZeRPP0 mRNA for putative 60S acid... 234 2e-58
16ref|NM_111960.2| Arabidopsis thaliana structural constituent of ... 230 4e-57
17gb|AY091201.1| Arabidopsis thaliana putative 60S acidic ribosoma... 230 4e-57
18gb|AY056150.1| Arabidopsis thaliana putative 60S acidic ribosoma... 230 4e-57
19gb|AY087728.1| Arabidopsis thaliana clone 38036 mRNA, complete s... 230 4e-57
20gb|DQ235176.1| Solanum tuberosum clone 156H10 P0 ribosomal prote... 226 6e-56
21gb|BT018921.1| Zea mays clone Contig30.F mRNA sequence 226 6e-56
22gb|DQ241840.1| Solanum tuberosum clone 181G12 P0 ribosomal prote... 226 6e-56
23ref|NM_111754.2| Arabidopsis thaliana structural constituent of ... 212 9e-52
24gb|AY059117.1| Arabidopsis thaliana putative 60S acidic ribosoma... 212 9e-52
25gb|AF370225.1| Arabidopsis thaliana putative 60S acidic ribosoma... 212 9e-52
26emb|BX824039.1|CNS0A6RI Arabidopsis thaliana Full-length cDNA Co... 212 9e-52
27emb|BX823923.1|CNS0A6KD Arabidopsis thaliana Full-length cDNA Co... 212 9e-52
28gb|L46848.1|SOYARPP Glycine max acidic ribosomal protein P0 mRNA... 210 3e-51
29gb|AY086582.1| Arabidopsis thaliana clone 2595 mRNA, complete se... 204 2e-49
30gb|AF227622.1|AF227622 Euphorbia esula 60S acidic ribosomal prot... 198 1e-47
31emb|X93587.1|LLP0 L.luteus mRNA for P0 ribosomal protein 186 5e-44
32dbj|AB236824.1| Trifolium pratense RNA for putative 60S acidic r... 176 5e-41
33dbj|AB236811.1| Trifolium pratense RNA for putative 60S acidic r... 176 5e-41
34emb|X15206.1|CRCRE2 C.rubrum mRNA for light-induced 34kD protein 170 3e-39
35ref|NM_129559.2| Arabidopsis thaliana structural constituent of ... 137 4e-29
36gb|AY070448.1| Arabidopsis thaliana At2g40010 mRNA sequence 137 4e-29
37emb|BX819391.1|CNS0A9W8 Arabidopsis thaliana Full-length cDNA Co... 137 4e-29
38gb|BT001919.1| Arabidopsis thaliana clone C105444 putative 60S a... 137 4e-29
39gb|AC011436.7|ATAC011436 Arabidopsis thaliana chromosome III BAC... 127 4e-26
40gb|AC009326.8|ATAC009326 Arabidopsis thaliana chromosome III P1 ... 127 4e-26
41gb|AC073395.6|AC073395 Arabidopsis thaliana chromosome 3 BAC F11... 121 2e-24
42gb|AF002109.3| Arabidopsis thaliana chromosome 2 clone T28M21 ma... 113 6e-22
43gb|AC130799.19| Medicago truncatula clone mth2-34b13, complete s... 109 9e-21
44emb|BX816288.1|CNS0AE9F Arabidopsis thaliana Full-length cDNA Co... 103 6e-19
45gb|CP000079.1| Leishmania major strain Friedlin chromosome 27, c... 52 0.002
46gb|AY702006.1| Leishmania donovani strain MHOM/IN/1983/AG83 60S ... 52 0.002
47ref|XM_843003.1| Leishmania major strain Friedlin 60S acidic rib... 52 0.002
48ref|XM_843004.1| Leishmania major strain Friedlin 60S acidic rib... 52 0.002
49emb|X72714.1|LILIPOA L. infantum LiPO-A and LiPO-B gene 52 0.002
50gb|AY180912.1| Leishmania donovani ribosomal protein P0-like mRN... 52 0.002
51gb|L29300.1|LEIRIBPP Leishmania chagasi (clone C1) ribosomal pro... 52 0.002
52emb|AJ783861.1| Carabus granulatus partial mRNA for acidic p0 ri... 50 0.007
53gb|AF401551.1| Ictalurus punctatus ribosomal protein P0 mRNA, co... 50 0.007
54ref|XM_787003.1| PREDICTED: Strongylocentrotus purpuratus simila... 48 0.029
55emb|BX032675.1|CNS08XDJ Single read from an extremity of a full-... 48 0.029
56emb|BX019003.1|CNS08MTR Single read from an extremity of a full-... 48 0.029
57emb|BX018793.1|CNS08MNX Single read from an extremity of a full-... 48 0.029
58emb|BX013777.1|CNS08ISL Single read from an extremity of a full-... 48 0.029
59emb|BX006032.1|CNS08CTG Single read from an extremity of a full-... 48 0.029
60emb|BX005998.1|CNS08CSI Single read from an extremity of a full-... 48 0.029
61ref|XM_789716.1| PREDICTED: Strongylocentrotus purpuratus simila... 48 0.029
62ref|XM_655246.1| Aspergillus nidulans FGSC A4 60S acidic ribosom... 46 0.11
63emb|BX053469.1|CNS09DF5 Single read from an extremity of a full-... 46 0.11
64emb|BX072148.1|CNS09RU0 Single read from an extremity of a full-... 46 0.11
65emb|BX072146.1|CNS09RTY Single read from an extremity of a full-... 46 0.11
66emb|BX072055.1|CNS09RRF Single read from an extremity of a full-... 46 0.11
67emb|BX072031.1|CNS09RQR Single read from an extremity of a full-... 46 0.11
68emb|BX071993.1|CNS09RPP Single read from an extremity of a full-... 46 0.11
69emb|BX071847.1|CNS09RLN Single read from an extremity of a full-... 46 0.11
70emb|BX071747.1|CNS09RIV Single read from an extremity of a full-... 46 0.11
71emb|BX071518.1|CNS09RCI Single read from an extremity of a full-... 46 0.11
72emb|BX071226.1|CNS09R4E Single read from an extremity of a full-... 46 0.11
73emb|BX071175.1|CNS09R2Z Single read from an extremity of a full-... 46 0.11
74emb|BX071445.1|CNS09RAH Single read from an extremity of a full-... 46 0.11
75emb|BX071386.1|CNS09R8U Single read from an extremity of a full-... 46 0.11
76emb|BX071318.1|CNS09R6Y Single read from an extremity of a full-... 46 0.11
77emb|BX071251.1|CNS09R53 Single read from an extremity of a full-... 46 0.11
78emb|BX071039.1|CNS09QZ7 Single read from an extremity of a full-... 46 0.11
79emb|BX070973.1|CNS09QXD Single read from an extremity of a full-... 46 0.11
80emb|BX070930.1|CNS09QW6 Single read from an extremity of a full-... 46 0.11
81emb|BX070900.1|CNS09QVC Single read from an extremity of a full-... 46 0.11
82emb|BX070894.1|CNS09QV6 Single read from an extremity of a full-... 46 0.11
83emb|BX070751.1|CNS09QR7 Single read from an extremity of a full-... 46 0.11
84emb|BX070745.1|CNS09QR1 Single read from an extremity of a full-... 46 0.11
85emb|BX070622.1|CNS09QNM Single read from an extremity of a full-... 46 0.11
86emb|BX070589.1|CNS09QMP Single read from an extremity of a full-... 46 0.11
87emb|BX070541.1|CNS09QLD Single read from an extremity of a full-... 46 0.11
88emb|BX070099.1|CNS09Q93 Single read from an extremity of a full-... 46 0.11
89emb|BX069823.1|CNS09Q1F Single read from an extremity of a full-... 46 0.11
90emb|BX069791.1|CNS09Q0J Single read from an extremity of a full-... 46 0.11
91emb|BX061098.1|CNS09JB2 Single read from an extremity of a full-... 46 0.11
92emb|BX061090.1|CNS09JAU Single read from an extremity of a full-... 46 0.11
93emb|BX061061.1|CNS09JA1 Single read from an extremity of a full-... 46 0.11
94emb|BX061042.1|CNS09J9I Single read from an extremity of a full-... 46 0.11
95emb|BX069588.1|CNS09PUW Single read from an extremity of a full-... 46 0.11
96emb|BX069403.1|CNS09PPR Single read from an extremity of a full-... 46 0.11
97emb|BX069336.1|CNS09PNW Single read from an extremity of a full-... 46 0.11
98emb|BX069235.1|CNS09PL3 Single read from an extremity of a full-... 46 0.11
99emb|BX069142.1|CNS09PII Single read from an extremity of a full-... 46 0.11
100emb|BX069126.1|CNS09PI2 Single read from an extremity of a full-... 46 0.11
101emb|BX068988.1|CNS09PE8 Single read from an extremity of a full-... 46 0.11
102emb|BX068833.1|CNS09P9X Single read from an extremity of a full-... 46 0.11
103emb|BX068815.1|CNS09P9F Single read from an extremity of a full-... 46 0.11
104emb|BX068760.1|CNS09P7W Single read from an extremity of a full-... 46 0.11
105emb|BX068607.1|CNS09P3N Single read from an extremity of a full-... 46 0.11
106emb|BX068471.1|CNS09OZV Single read from an extremity of a full-... 46 0.11
107emb|BX068229.1|CNS09OT5 Single read from an extremity of a full-... 46 0.11
108emb|BX068019.1|CNS09ONB Single read from an extremity of a full-... 46 0.11
109emb|BX067891.1|CNS09OJR Single read from an extremity of a full-... 46 0.11
110emb|BX067841.1|CNS09OID Single read from an extremity of a full-... 46 0.11
111emb|BX067819.1|CNS09OHR Single read from an extremity of a full-... 46 0.11
112emb|BX067775.1|CNS09OGJ Single read from an extremity of a full-... 46 0.11
113emb|BX067752.1|CNS09OFW Single read from an extremity of a full-... 46 0.11
114emb|BX067707.1|CNS09OEN Single read from an extremity of a full-... 46 0.11
115emb|BX067564.1|CNS09OAO Single read from an extremity of a full-... 46 0.11
116emb|BX067487.1|CNS09O8J Single read from an extremity of a full-... 46 0.11
117emb|BX067429.1|CNS09O6X Single read from an extremity of a full-... 46 0.11
118emb|BX066992.1|CNS09NUS Single read from an extremity of a full-... 46 0.11
119emb|BX067216.1|CNS09O10 Single read from an extremity of a full-... 46 0.11
120emb|BX067179.1|CNS09NZZ Single read from an extremity of a full-... 46 0.11
121emb|BX066854.1|CNS09NQY Single read from an extremity of a full-... 46 0.11
122emb|BX066645.1|CNS09NL5 Single read from an extremity of a full-... 46 0.11
123emb|BX066623.1|CNS09NKJ Single read from an extremity of a full-... 46 0.11
124emb|BX066597.1|CNS09NJT Single read from an extremity of a full-... 46 0.11
125emb|BX066426.1|CNS09NF2 Single read from an extremity of a full-... 46 0.11
126emb|BX066412.1|CNS09NEO Single read from an extremity of a full-... 46 0.11
127emb|BX066390.1|CNS09NE2 Single read from an extremity of a full-... 46 0.11
128emb|BX066329.1|CNS09NCD Single read from an extremity of a full-... 46 0.11
129emb|BX065816.1|CNS09MY4 Single read from an extremity of a full-... 46 0.11
130emb|BX065714.1|CNS09MVA Single read from an extremity of a full-... 46 0.11
131emb|BX065713.1|CNS09MV9 Single read from an extremity of a full-... 46 0.11
132emb|BX065465.1|CNS09MOD Single read from an extremity of a full-... 46 0.11
133emb|BX065359.1|CNS09MLF Single read from an extremity of a full-... 46 0.11
134emb|BX065269.1|CNS09MIX Single read from an extremity of a full-... 46 0.11
135emb|BX065249.1|CNS09MID Single read from an extremity of a full-... 46 0.11
136emb|BX065042.1|CNS09MCM Single read from an extremity of a full-... 46 0.11
137emb|BX065015.1|CNS09MBV Single read from an extremity of a full-... 46 0.11
138emb|BX065006.1|CNS09MBM Single read from an extremity of a full-... 46 0.11
139emb|BX065005.1|CNS09MBL Single read from an extremity of a full-... 46 0.11
140emb|BX064952.1|CNS09MA4 Single read from an extremity of a full-... 46 0.11
141emb|BX064796.1|CNS09M5S Single read from an extremity of a full-... 46 0.11
142emb|BX064760.1|CNS09M4S Single read from an extremity of a full-... 46 0.11
143emb|BX064725.1|CNS09M3T Single read from an extremity of a full-... 46 0.11
144emb|BX064530.1|CNS09LYE Single read from an extremity of a full-... 46 0.11
145emb|BX064423.1|CNS09LVF Single read from an extremity of a full-... 46 0.11
146emb|BX064284.1|CNS09LRK Single read from an extremity of a full-... 46 0.11
147emb|BX064164.1|CNS09LO8 Single read from an extremity of a full-... 46 0.11
148emb|BX064121.1|CNS09LN1 Single read from an extremity of a full-... 46 0.11
149emb|BX064120.1|CNS09LN0 Single read from an extremity of a full-... 46 0.11
150emb|BX064068.1|CNS09LLK Single read from an extremity of a full-... 46 0.11
151emb|BX063872.1|CNS09LG4 Single read from an extremity of a full-... 46 0.11
152emb|BX063577.1|CNS09L7X Single read from an extremity of a full-... 46 0.11
153emb|BX063467.1|CNS09L4V Single read from an extremity of a full-... 46 0.11
154emb|BX063466.1|CNS09L4U Single read from an extremity of a full-... 46 0.11
155emb|BX063434.1|CNS09L3Y Single read from an extremity of a full-... 46 0.11
156emb|BX063420.1|CNS09L3K Single read from an extremity of a full-... 46 0.11
157emb|BX063227.1|CNS09KY7 Single read from an extremity of a full-... 46 0.11
158emb|BX062791.1|CNS09KM3 Single read from an extremity of a full-... 46 0.11
159emb|BX062552.1|CNS09KFG Single read from an extremity of a full-... 46 0.11
160emb|BX062546.1|CNS09KFA Single read from an extremity of a full-... 46 0.11
161emb|BX062387.1|CNS09KAV Single read from an extremity of a full-... 46 0.11
162emb|BX062299.1|CNS09K8F Single read from an extremity of a full-... 46 0.11
163emb|BX062297.1|CNS09K8D Single read from an extremity of a full-... 46 0.11
164emb|BX062183.1|CNS09K57 Single read from an extremity of a full-... 46 0.11
165emb|BX062169.1|CNS09K4T Single read from an extremity of a full-... 46 0.11
166emb|BX062048.1|CNS09K1G Single read from an extremity of a full-... 46 0.11
167emb|BX061878.1|CNS09JWQ Single read from an extremity of a full-... 46 0.11
168emb|BX061190.1|CNS09JDM Single read from an extremity of a full-... 46 0.11
169emb|BX061164.1|CNS09JCW Single read from an extremity of a full-... 46 0.11
170emb|BX061163.1|CNS09JCV Single read from an extremity of a full-... 46 0.11
171emb|BX061137.1|CNS09JC5 Single read from an extremity of a full-... 46 0.11
172emb|BX061133.1|CNS09JC1 Single read from an extremity of a full-... 46 0.11
173emb|BX060642.1|CNS09IYE Single read from an extremity of a full-... 46 0.11
174emb|BX060527.1|CNS09IV7 Single read from an extremity of a full-... 46 0.11
175emb|BX060489.1|CNS09IU5 Single read from an extremity of a full-... 46 0.11
176emb|BX060488.1|CNS09IU4 Single read from an extremity of a full-... 46 0.11
177emb|BX060443.1|CNS09ISV Single read from an extremity of a full-... 46 0.11
178emb|BX060185.1|CNS09ILP Single read from an extremity of a full-... 46 0.11
179emb|BX059916.1|CNS09IE8 Single read from an extremity of a full-... 46 0.11
180emb|BX059866.1|CNS09ICU Single read from an extremity of a full-... 46 0.11
181emb|BX059758.1|CNS09I9U Single read from an extremity of a full-... 46 0.11
182emb|BX059741.1|CNS09I9D Single read from an extremity of a full-... 46 0.11
183emb|BX059642.1|CNS09I6M Single read from an extremity of a full-... 46 0.11
184emb|BX059587.1|CNS09I53 Single read from an extremity of a full-... 46 0.11
185emb|BX059585.1|CNS09I51 Single read from an extremity of a full-... 46 0.11
186emb|BX059469.1|CNS09I1T Single read from an extremity of a full-... 46 0.11
187emb|BX059305.1|CNS09HX9 Single read from an extremity of a full-... 46 0.11
188emb|BX059220.1|CNS09HUW Single read from an extremity of a full-... 46 0.11
189emb|BX059184.1|CNS09HTW Single read from an extremity of a full-... 46 0.11
190emb|BX059095.1|CNS09HRF Single read from an extremity of a full-... 46 0.11
191emb|BX058971.1|CNS09HNZ Single read from an extremity of a full-... 46 0.11
192emb|BX058839.1|CNS09HKB Single read from an extremity of a full-... 46 0.11
193emb|BX058760.1|CNS09HI4 Single read from an extremity of a full-... 46 0.11
194emb|BX058740.1|CNS09HHK Single read from an extremity of a full-... 46 0.11
195emb|BX058729.1|CNS09HH9 Single read from an extremity of a full-... 46 0.11
196emb|BX058315.1|CNS09H5R Single read from an extremity of a full-... 46 0.11
197emb|BX058203.1|CNS09H2N Single read from an extremity of a full-... 46 0.11
198emb|BX056754.1|CNS09FYE Single read from an extremity of a full-... 46 0.11
199emb|BX057924.1|CNS09GUW Single read from an extremity of a full-... 46 0.11
200emb|BX057796.1|CNS09GRC Single read from an extremity of a full-... 46 0.11
201emb|BX057631.1|CNS09GMR Single read from an extremity of a full-... 46 0.11
202emb|BX057605.1|CNS09GM1 Single read from an extremity of a full-... 46 0.11
203emb|BX057468.1|CNS09GI8 Single read from an extremity of a full-... 46 0.11
204emb|BX057218.1|CNS09GBA Single read from an extremity of a full-... 46 0.11
205emb|BX057213.1|CNS09GB5 Single read from an extremity of a full-... 46 0.11
206emb|BX057133.1|CNS09G8X Single read from an extremity of a full-... 46 0.11
207emb|BX057094.1|CNS09G7U Single read from an extremity of a full-... 46 0.11
208emb|BX057074.1|CNS09G7A Single read from an extremity of a full-... 46 0.11
209emb|BX056996.1|CNS09G54 Single read from an extremity of a full-... 46 0.11
210emb|BX056958.1|CNS09G42 Single read from an extremity of a full-... 46 0.11
211emb|BX056914.1|CNS09G2U Single read from an extremity of a full-... 46 0.11
212emb|BX056483.1|CNS09FQV Single read from an extremity of a full-... 46 0.11
213emb|BX055960.1|CNS09FCC Single read from an extremity of a full-... 46 0.11
214emb|BX055808.1|CNS09F84 Single read from an extremity of a full-... 46 0.11
215emb|BX056320.1|CNS09FMC Single read from an extremity of a full-... 46 0.11
216emb|BX056288.1|CNS09FLG Single read from an extremity of a full-... 46 0.11
217emb|BX056287.1|CNS09FLF Single read from an extremity of a full-... 46 0.11
218emb|BX056283.1|CNS09FLB Single read from an extremity of a full-... 46 0.11
219emb|BX055999.1|CNS09FDF Single read from an extremity of a full-... 46 0.11
220emb|BX055725.1|CNS09F5T Single read from an extremity of a full-... 46 0.11
221emb|BX055721.1|CNS09F5P Single read from an extremity of a full-... 46 0.11
222emb|BX055621.1|CNS09F2X Single read from an extremity of a full-... 46 0.11
223emb|BX055603.1|CNS09F2F Single read from an extremity of a full-... 46 0.11
224emb|BX055567.1|CNS09F1F Single read from an extremity of a full-... 46 0.11
225emb|BX053214.1|CNS09D82 Single read from an extremity of a full-... 46 0.11
226emb|BX053185.1|CNS09D79 Single read from an extremity of a full-... 46 0.11
227emb|BX053146.1|CNS09D66 Single read from an extremity of a full-... 46 0.11
228emb|BX052948.1|CNS09D0O Single read from an extremity of a full-... 46 0.11
229emb|BX052946.1|CNS09D0M Single read from an extremity of a full-... 46 0.11
230emb|BX054654.1|CNS09EC2 Single read from an extremity of a full-... 46 0.11
231emb|BX054435.1|CNS09E5Z Single read from an extremity of a full-... 46 0.11
232emb|BX054345.1|CNS09E3H Single read from an extremity of a full-... 46 0.11
233emb|BX054246.1|CNS09E0Q Single read from an extremity of a full-... 46 0.11
234emb|BX054186.1|CNS09DZ2 Single read from an extremity of a full-... 46 0.11
235emb|BX054114.1|CNS09DX2 Single read from an extremity of a full-... 46 0.11
236emb|BX054048.1|CNS09DV8 Single read from an extremity of a full-... 46 0.11
237emb|BX053890.1|CNS09DQU Single read from an extremity of a full-... 46 0.11
238emb|BX053889.1|CNS09DQT Single read from an extremity of a full-... 46 0.11
239emb|BX053751.1|CNS09DMZ Single read from an extremity of a full-... 46 0.11
240emb|BX053704.1|CNS09DLO Single read from an extremity of a full-... 46 0.11
241emb|BX053693.1|CNS09DLD Single read from an extremity of a full-... 46 0.11
242emb|BX053532.1|CNS09DGW Single read from an extremity of a full-... 46 0.11
243emb|BX052874.1|CNS09CYM Single read from an extremity of a full-... 46 0.11
244emb|BX052836.1|CNS09CXK Single read from an extremity of a full-... 46 0.11
245emb|BX052835.1|CNS09CXJ Single read from an extremity of a full-... 46 0.11
246emb|BX052777.1|CNS09CVX Single read from an extremity of a full-... 46 0.11
247emb|BX052724.1|CNS09CUG Single read from an extremity of a full-... 46 0.11
248emb|BX052368.1|CNS09CKK Single read from an extremity of a full-... 46 0.11
249emb|BX052263.1|CNS09CHN Single read from an extremity of a full-... 46 0.11
250emb|BX052235.1|CNS09CGV Single read from an extremity of a full-... 46 0.11
251emb|BX052085.1|CNS09CCP Single read from an extremity of a full-... 46 0.11
252emb|BX052064.1|CNS09CC4 Single read from an extremity of a full-... 46 0.11
253emb|BX052006.1|CNS09CAI Single read from an extremity of a full-... 46 0.11
254emb|BX051964.1|CNS09C9C Single read from an extremity of a full-... 46 0.11
255emb|BX051899.1|CNS09C7J Single read from an extremity of a full-... 46 0.11
256emb|BX051866.1|CNS09C6M Single read from an extremity of a full-... 46 0.11
257emb|BX051626.1|CNS09BZY Single read from an extremity of a full-... 46 0.11
258emb|BX051618.1|CNS09BZQ Single read from an extremity of a full-... 46 0.11
259emb|BX051600.1|CNS09BZ8 Single read from an extremity of a full-... 46 0.11
260emb|BX051577.1|CNS09BYL Single read from an extremity of a full-... 46 0.11
261emb|BX051509.1|CNS09BWP Single read from an extremity of a full-... 46 0.11
262emb|BX051472.1|CNS09BVO Single read from an extremity of a full-... 46 0.11
263emb|BX051379.1|CNS09BT3 Single read from an extremity of a full-... 46 0.11
264emb|BX051301.1|CNS09BQX Single read from an extremity of a full-... 46 0.11
265emb|BX050244.1|CNS09AXK Single read from an extremity of a full-... 46 0.11
266emb|BX050212.1|CNS09AWO Single read from an extremity of a full-... 46 0.11
267emb|BX050202.1|CNS09AWE Single read from an extremity of a full-... 46 0.11
268emb|BX050196.1|CNS09AW8 Single read from an extremity of a full-... 46 0.11
269emb|BX050804.1|CNS09BD4 Single read from an extremity of a full-... 46 0.11
270emb|BX050797.1|CNS09BCX Single read from an extremity of a full-... 46 0.11
271emb|BX050762.1|CNS09BBY Single read from an extremity of a full-... 46 0.11
272emb|BX050723.1|CNS09BAV Single read from an extremity of a full-... 46 0.11
273emb|BX050711.1|CNS09BAJ Single read from an extremity of a full-... 46 0.11
274emb|BX050679.1|CNS09B9N Single read from an extremity of a full-... 46 0.11
275emb|BX050552.1|CNS09B64 Single read from an extremity of a full-... 46 0.11
276emb|BX050545.1|CNS09B5X Single read from an extremity of a full-... 46 0.11
277emb|BX050514.1|CNS09B52 Single read from an extremity of a full-... 46 0.11
278emb|BX050479.1|CNS09B43 Single read from an extremity of a full-... 46 0.11
279emb|BX050437.1|CNS09B2X Single read from an extremity of a full-... 46 0.11
280emb|BX050412.1|CNS09B28 Single read from an extremity of a full-... 46 0.11
281emb|BX050290.1|CNS09AYU Single read from an extremity of a full-... 46 0.11
282emb|BX049856.1|CNS09AMS Single read from an extremity of a full-... 46 0.11
283emb|BX049758.1|CNS09AK2 Single read from an extremity of a full-... 46 0.11
284emb|BX049674.1|CNS09AHQ Single read from an extremity of a full-... 46 0.11
285emb|BX030999.1|CNS08W2Z Single read from an extremity of a full-... 46 0.11
286emb|BX030941.1|CNS08W1D Single read from an extremity of a full-... 46 0.11
287emb|BX030929.1|CNS08W11 Single read from an extremity of a full-... 46 0.11
288emb|BX030903.1|CNS08W0B Single read from an extremity of a full-... 46 0.11
289emb|BX049615.1|CNS09AG3 Single read from an extremity of a full-... 46 0.11
290emb|BX049546.1|CNS09AE6 Single read from an extremity of a full-... 46 0.11
291emb|BX049524.1|CNS09ADK Single read from an extremity of a full-... 46 0.11
292emb|BX049466.1|CNS09ABY Single read from an extremity of a full-... 46 0.11
293emb|BX049240.1|CNS09A5O Single read from an extremity of a full-... 46 0.11
294emb|BX049187.1|CNS09A47 Single read from an extremity of a full-... 46 0.11
295emb|BX048525.1|CNS099LT Single read from an extremity of a full-... 46 0.11
296emb|BX048433.1|CNS099J9 Single read from an extremity of a full-... 46 0.11
297emb|BX048234.1|CNS099DQ Single read from an extremity of a full-... 46 0.11
298emb|BX048199.1|CNS099CR Single read from an extremity of a full-... 46 0.11
299emb|BX047999.1|CNS09977 Single read from an extremity of a full-... 46 0.11
300emb|BX047946.1|CNS0995Q Single read from an extremity of a full-... 46 0.11
301emb|BX047843.1|CNS0992V Single read from an extremity of a full-... 46 0.11
302emb|BX047734.1|CNS098ZU Single read from an extremity of a full-... 46 0.11
303emb|BX047732.1|CNS098ZS Single read from an extremity of a full-... 46 0.11
304emb|BX047714.1|CNS098ZA Single read from an extremity of a full-... 46 0.11
305emb|BX047691.1|CNS098YN Single read from an extremity of a full-... 46 0.11
306emb|BX047277.1|CNS098N5 Single read from an extremity of a full-... 46 0.11
307emb|BX047157.1|CNS098JT Single read from an extremity of a full-... 46 0.11
308emb|BX047017.1|CNS098FX Single read from an extremity of a full-... 46 0.11
309emb|BX046849.1|CNS098B9 Single read from an extremity of a full-... 46 0.11
310emb|BX046679.1|CNS0986J Single read from an extremity of a full-... 46 0.11
311emb|BX046353.1|CNS097XH Single read from an extremity of a full-... 46 0.11
312emb|BX046290.1|CNS097VQ Single read from an extremity of a full-... 46 0.11
313emb|BX046163.1|CNS097S7 Single read from an extremity of a full-... 46 0.11
314emb|BX046117.1|CNS097QX Single read from an extremity of a full-... 46 0.11
315emb|BX046099.1|CNS097QF Single read from an extremity of a full-... 46 0.11
316emb|BX046025.1|CNS097OD Single read from an extremity of a full-... 46 0.11
317emb|BX045705.1|CNS097FH Single read from an extremity of a full-... 46 0.11
318emb|BX045497.1|CNS0979P Single read from an extremity of a full-... 46 0.11
319emb|BX045440.1|CNS09784 Single read from an extremity of a full-... 46 0.11
320emb|BX045432.1|CNS0977W Single read from an extremity of a full-... 46 0.11
321emb|BX045074.1|CNS096XY Single read from an extremity of a full-... 46 0.11
322emb|BX045040.1|CNS096X0 Single read from an extremity of a full-... 46 0.11
323emb|BX045257.1|CNS09731 Single read from an extremity of a full-... 46 0.11
324emb|BX044857.1|CNS096RX Single read from an extremity of a full-... 46 0.11
325emb|BX044741.1|CNS096OP Single read from an extremity of a full-... 46 0.11
326emb|BX044735.1|CNS096OJ Single read from an extremity of a full-... 46 0.11
327emb|BX043090.1|CNS095EU Single read from an extremity of a full-... 46 0.11
328emb|BX043059.1|CNS095DZ Single read from an extremity of a full-... 46 0.11
329emb|BX042955.1|CNS095B3 Single read from an extremity of a full-... 46 0.11
330emb|BX044619.1|CNS096LB Single read from an extremity of a full-... 46 0.11
331emb|BX044429.1|CNS096G1 Single read from an extremity of a full-... 46 0.11
332emb|BX044185.1|CNS09699 Single read from an extremity of a full-... 46 0.11
333emb|BX044159.1|CNS0968J Single read from an extremity of a full-... 46 0.11
334emb|BX044153.1|CNS0968D Single read from an extremity of a full-... 46 0.11
335emb|BX044099.1|CNS0966V Single read from an extremity of a full-... 46 0.11
336emb|BX044052.1|CNS0965K Single read from an extremity of a full-... 46 0.11
337emb|BX044026.1|CNS0964U Single read from an extremity of a full-... 46 0.11
338emb|BX043798.1|CNS095YI Single read from an extremity of a full-... 46 0.11
339emb|BX043757.1|CNS095XD Single read from an extremity of a full-... 46 0.11
340emb|BX043472.1|CNS095PG Single read from an extremity of a full-... 46 0.11
341emb|BX043702.1|CNS095VU Single read from an extremity of a full-... 46 0.11
342emb|BX043623.1|CNS095TN Single read from an extremity of a full-... 46 0.11
343emb|BX043251.1|CNS095JB Single read from an extremity of a full-... 46 0.11
344emb|BX043128.1|CNS095FW Single read from an extremity of a full-... 46 0.11
345emb|BX043127.1|CNS095FV Single read from an extremity of a full-... 46 0.11
346emb|BX043118.1|CNS095FM Single read from an extremity of a full-... 46 0.11
347emb|BX042609.1|CNS0951H Single read from an extremity of a full-... 46 0.11
348emb|BX042524.1|CNS094Z4 Single read from an extremity of a full-... 46 0.11
349emb|BX042434.1|CNS094WM Single read from an extremity of a full-... 46 0.11
350emb|BX042404.1|CNS094VS Single read from an extremity of a full-... 46 0.11
351emb|BX042353.1|CNS094UD Single read from an extremity of a full-... 46 0.11
352emb|BX041748.1|CNS094DK Single read from an extremity of a full-... 46 0.11
353emb|BX041651.1|CNS094AV Single read from an extremity of a full-... 46 0.11
354emb|BX041602.1|CNS0949I Single read from an extremity of a full-... 46 0.11
355emb|BX041467.1|CNS0945R Single read from an extremity of a full-... 46 0.11
356emb|BX041389.1|CNS0943L Single read from an extremity of a full-... 46 0.11
357emb|BX041365.1|CNS0942X Single read from an extremity of a full-... 46 0.11
358emb|BX041135.1|CNS093WJ Single read from an extremity of a full-... 46 0.11
359emb|BX041109.1|CNS093VT Single read from an extremity of a full-... 46 0.11
360emb|BX041108.1|CNS093VS Single read from an extremity of a full-... 46 0.11
361emb|BX040887.1|CNS093PN Single read from an extremity of a full-... 46 0.11
362emb|BX040837.1|CNS093O9 Single read from an extremity of a full-... 46 0.11
363emb|BX040799.1|CNS093N7 Single read from an extremity of a full-... 46 0.11
364emb|BX040616.1|CNS093I4 Single read from an extremity of a full-... 46 0.11
365emb|BX040351.1|CNS093AR Single read from an extremity of a full-... 46 0.11
366emb|BX040297.1|CNS09399 Single read from an extremity of a full-... 46 0.11
367emb|BX040236.1|CNS0937K Single read from an extremity of a full-... 46 0.11
368emb|BX040137.1|CNS0934T Single read from an extremity of a full-... 46 0.11
369emb|BX040069.1|CNS0932X Single read from an extremity of a full-... 46 0.11
370emb|BX039907.1|CNS092YF Single read from an extremity of a full-... 46 0.11
371emb|BX039734.1|CNS092TM Single read from an extremity of a full-... 46 0.11
372emb|BX039373.1|CNS092JL Single read from an extremity of a full-... 46 0.11
373emb|BX039309.1|CNS092HT Single read from an extremity of a full-... 46 0.11
374emb|BX039262.1|CNS092GI Single read from an extremity of a full-... 46 0.11
375emb|BX037386.1|CNS0910E Single read from an extremity of a full-... 46 0.11
376emb|BX037345.1|CNS090Z9 Single read from an extremity of a full-... 46 0.11
377emb|BX037247.1|CNS090WJ Single read from an extremity of a full-... 46 0.11
378emb|BX037215.1|CNS090VN Single read from an extremity of a full-... 46 0.11
379emb|BX036759.1|CNS090IZ Single read from an extremity of a full-... 46 0.11
380emb|BX036700.1|CNS090HC Single read from an extremity of a full-... 46 0.11
381emb|BX036670.1|CNS090GI Single read from an extremity of a full-... 46 0.11
382emb|BX037189.1|CNS090UX Single read from an extremity of a full-... 46 0.11
383emb|BX037187.1|CNS090UV Single read from an extremity of a full-... 46 0.11
384emb|BX037165.1|CNS090U9 Single read from an extremity of a full-... 46 0.11
385emb|BX037106.1|CNS090SM Single read from an extremity of a full-... 46 0.11
386emb|BX037012.1|CNS090Q0 Single read from an extremity of a full-... 46 0.11
387emb|BX036831.1|CNS090KZ Single read from an extremity of a full-... 46 0.11
388emb|BX036518.1|CNS090CA Single read from an extremity of a full-... 46 0.11
389emb|BX036428.1|CNS0909S Single read from an extremity of a full-... 46 0.11
390emb|BX036405.1|CNS09095 Single read from an extremity of a full-... 46 0.11
391emb|BX036358.1|CNS0907U Single read from an extremity of a full-... 46 0.11
392emb|BX036158.1|CNS0902A Single read from an extremity of a full-... 46 0.11
393emb|BX036109.1|CNS0900X Single read from an extremity of a full-... 46 0.11
394emb|BX035782.1|CNS08ZRU Single read from an extremity of a full-... 46 0.11
395emb|BX035671.1|CNS08ZOR Single read from an extremity of a full-... 46 0.11
396emb|BX035626.1|CNS08ZNI Single read from an extremity of a full-... 46 0.11
397emb|BX035617.1|CNS08ZN9 Single read from an extremity of a full-... 46 0.11
398emb|BX035548.1|CNS08ZLC Single read from an extremity of a full-... 46 0.11
399emb|BX035515.1|CNS08ZKF Single read from an extremity of a full-... 46 0.11
400emb|BX035485.1|CNS08ZJL Single read from an extremity of a full-... 46 0.11
401emb|BX035372.1|CNS08ZGG Single read from an extremity of a full-... 46 0.11
402emb|BX035343.1|CNS08ZFN Single read from an extremity of a full-... 46 0.11
403emb|BX035328.1|CNS08ZF8 Single read from an extremity of a full-... 46 0.11
404emb|BX035267.1|CNS08ZDJ Single read from an extremity of a full-... 46 0.11
405emb|BX035228.1|CNS08ZCG Single read from an extremity of a full-... 46 0.11
406emb|BX035165.1|CNS08ZAP Single read from an extremity of a full-... 46 0.11
407emb|BX034803.1|CNS08Z0N Single read from an extremity of a full-... 46 0.11
408emb|BX034670.1|CNS08YWY Single read from an extremity of a full-... 46 0.11
409emb|BX035008.1|CNS08Z6C Single read from an extremity of a full-... 46 0.11
410emb|BX034906.1|CNS08Z3I Single read from an extremity of a full-... 46 0.11
411emb|BX034904.1|CNS08Z3G Single read from an extremity of a full-... 46 0.11
412emb|BX034886.1|CNS08Z2Y Single read from an extremity of a full-... 46 0.11
413emb|BX034882.1|CNS08Z2U Single read from an extremity of a full-... 46 0.11
414emb|BX034881.1|CNS08Z2T Single read from an extremity of a full-... 46 0.11
415emb|BX034538.1|CNS08YTA Single read from an extremity of a full-... 46 0.11
416emb|BX034506.1|CNS08YSE Single read from an extremity of a full-... 46 0.11
417emb|BX034480.1|CNS08YRO Single read from an extremity of a full-... 46 0.11
418emb|BX034370.1|CNS08YOM Single read from an extremity of a full-... 46 0.11
419emb|BX034264.1|CNS08YLO Single read from an extremity of a full-... 46 0.11
420emb|BX034229.1|CNS08YKP Single read from an extremity of a full-... 46 0.11
421emb|BX034221.1|CNS08YKH Single read from an extremity of a full-... 46 0.11
422emb|BX034196.1|CNS08YJS Single read from an extremity of a full-... 46 0.11
423emb|BX034144.1|CNS08YIC Single read from an extremity of a full-... 46 0.11
424emb|BX034142.1|CNS08YIA Single read from an extremity of a full-... 46 0.11
425emb|BX034126.1|CNS08YHU Single read from an extremity of a full-... 46 0.11
426emb|BX034110.1|CNS08YHE Single read from an extremity of a full-... 46 0.11
427emb|BX034108.1|CNS08YHC Single read from an extremity of a full-... 46 0.11
428emb|BX034106.1|CNS08YHA Single read from an extremity of a full-... 46 0.11
429emb|BX034010.1|CNS08YEM Single read from an extremity of a full-... 46 0.11
430emb|BX034008.1|CNS08YEK Single read from an extremity of a full-... 46 0.11
431emb|BX033976.1|CNS08YDO Single read from an extremity of a full-... 46 0.11
432emb|BX033938.1|CNS08YCM Single read from an extremity of a full-... 46 0.11
433emb|BX033860.1|CNS08YAG Single read from an extremity of a full-... 46 0.11
434emb|BX033846.1|CNS08YA2 Single read from an extremity of a full-... 46 0.11
435emb|BX033821.1|CNS08Y9D Single read from an extremity of a full-... 46 0.11
436emb|BX033820.1|CNS08Y9C Single read from an extremity of a full-... 46 0.11
437emb|BX033818.1|CNS08Y9A Single read from an extremity of a full-... 46 0.11
438emb|BX033673.1|CNS08Y59 Single read from an extremity of a full-... 46 0.11
439emb|BX033647.1|CNS08Y4J Single read from an extremity of a full-... 46 0.11
440emb|BX033618.1|CNS08Y3Q Single read from an extremity of a full-... 46 0.11
441emb|BX033569.1|CNS08Y2D Single read from an extremity of a full-... 46 0.11
442emb|BX033479.1|CNS08XZV Single read from an extremity of a full-... 46 0.11
443emb|BX033311.1|CNS08XV7 Single read from an extremity of a full-... 46 0.11
444emb|BX033238.1|CNS08XT6 Single read from an extremity of a full-... 46 0.11
445emb|BX033237.1|CNS08XT5 Single read from an extremity of a full-... 46 0.11
446emb|BX033218.1|CNS08XSM Single read from an extremity of a full-... 46 0.11
447emb|BX033076.1|CNS08XOO Single read from an extremity of a full-... 46 0.11
448emb|BX033023.1|CNS08XN7 Single read from an extremity of a full-... 46 0.11
449emb|BX032861.1|CNS08XIP Single read from an extremity of a full-... 46 0.11
450emb|BX032848.1|CNS08XIC Single read from an extremity of a full-... 46 0.11
451emb|BX032759.1|CNS08XFV Single read from an extremity of a full-... 46 0.11
452emb|BX032572.1|CNS08XAO Single read from an extremity of a full-... 46 0.11
453emb|BX032456.1|CNS08X7G Single read from an extremity of a full-... 46 0.11
454emb|BX032454.1|CNS08X7E Single read from an extremity of a full-... 46 0.11
455emb|BX032379.1|CNS08X5B Single read from an extremity of a full-... 46 0.11
456emb|BX032309.1|CNS08X3D Single read from an extremity of a full-... 46 0.11
457emb|BX032149.1|CNS08WYX Single read from an extremity of a full-... 46 0.11
458emb|BX032101.1|CNS08WXL Single read from an extremity of a full-... 46 0.11
459emb|BX032100.1|CNS08WXK Single read from an extremity of a full-... 46 0.11
460emb|BX031868.1|CNS08WR4 Single read from an extremity of a full-... 46 0.11
461emb|BX031826.1|CNS08WPY Single read from an extremity of a full-... 46 0.11
462emb|BX031749.1|CNS08WNT Single read from an extremity of a full-... 46 0.11
463emb|BX031528.1|CNS08WHO Single read from an extremity of a full-... 46 0.11
464emb|BX031481.1|CNS08WGD Single read from an extremity of a full-... 46 0.11
465emb|BX031424.1|CNS08WES Single read from an extremity of a full-... 46 0.11
466emb|BX031365.1|CNS08WD5 Single read from an extremity of a full-... 46 0.11
467emb|BX031330.1|CNS08WC6 Single read from an extremity of a full-... 46 0.11
468emb|BX030842.1|CNS08VYM Single read from an extremity of a full-... 46 0.11
469emb|BX030693.1|CNS08VUH Single read from an extremity of a full-... 46 0.11
470emb|BX031290.1|CNS08WB2 Single read from an extremity of a full-... 46 0.11
471emb|BX031264.1|CNS08WAC Single read from an extremity of a full-... 46 0.11
472emb|BX031187.1|CNS08W87 Single read from an extremity of a full-... 46 0.11
473emb|BX031162.1|CNS08W7I Single read from an extremity of a full-... 46 0.11
474emb|BX031150.1|CNS08W76 Single read from an extremity of a full-... 46 0.11
475emb|BX030510.1|CNS08VPE Single read from an extremity of a full-... 46 0.11
476emb|BX030498.1|CNS08VP2 Single read from an extremity of a full-... 46 0.11
477emb|BX030436.1|CNS08VNC Single read from an extremity of a full-... 46 0.11
478emb|BX030414.1|CNS08VMQ Single read from an extremity of a full-... 46 0.11
479emb|BX030353.1|CNS08VL1 Single read from an extremity of a full-... 46 0.11
480emb|BX030216.1|CNS08VH8 Single read from an extremity of a full-... 46 0.11
481emb|BX030189.1|CNS08VGH Single read from an extremity of a full-... 46 0.11
482emb|BX030043.1|CNS08VCF Single read from an extremity of a full-... 46 0.11
483emb|BX030039.1|CNS08VCB Single read from an extremity of a full-... 46 0.11
484emb|BX029932.1|CNS08V9C Single read from an extremity of a full-... 46 0.11
485emb|BX029856.1|CNS08V78 Single read from an extremity of a full-... 46 0.11
486emb|BX029781.1|CNS08V55 Single read from an extremity of a full-... 46 0.11
487emb|BX029776.1|CNS08V50 Single read from an extremity of a full-... 46 0.11
488emb|BX029391.1|CNS08UUB Single read from an extremity of a full-... 46 0.11
489emb|BX029322.1|CNS08USE Single read from an extremity of a full-... 46 0.11
490emb|BX029190.1|CNS08UOQ Single read from an extremity of a full-... 46 0.11
491emb|BX029189.1|CNS08UOP Single read from an extremity of a full-... 46 0.11
492emb|BX029177.1|CNS08UOD Single read from an extremity of a full-... 46 0.11
493emb|BX029754.1|CNS08V4E Single read from an extremity of a full-... 46 0.11
494emb|BX029752.1|CNS08V4C Single read from an extremity of a full-... 46 0.11
495emb|BX029599.1|CNS08V03 Single read from an extremity of a full-... 46 0.11
496emb|BX029095.1|CNS08UM3 Single read from an extremity of a full-... 46 0.11
497emb|BX028997.1|CNS08UJD Single read from an extremity of a full-... 46 0.11
498emb|BX028987.1|CNS08UJ3 Single read from an extremity of a full-... 46 0.11
499emb|BX028918.1|CNS08UH6 Single read from an extremity of a full-... 46 0.11
500emb|BX028886.1|CNS08UGA Single read from an extremity of a full-... 46 0.11

>ref|XM_479931.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1236

 Score =  676 bits (341), Expect = 0.0
 Identities = 464/505 (91%)
 Strand = Plus / Plus

                                                                       
Query: 16  gactccatcgtgctcatgggcaagaacaccctgatccgccgctgcatcaaggtgcactcg 75
           ||||||||||| |||||||| ||||||||||| |||||||||||||||||||||||| | 
Sbjct: 280 gactccatcgtcctcatggggaagaacaccctcatccgccgctgcatcaaggtgcacgcc 339

                                                                       
Query: 76  gagaagactggcaacaaggacttcctcgagctcagcaacctcctcgtcggtaacgttggc 135
           || || || ||||||||||| |||||||||||||    |||||||||||| |||||||||
Sbjct: 340 gacaacaccggcaacaaggagttcctcgagctcatgcccctcctcgtcggaaacgttggc 399

                                                                       
Query: 136 ctcatcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggtt 195
           |||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||
Sbjct: 400 ctcatcttcaccaagggtgacctcaaggaggtccgcgaggaggttgccaagtacaaggtt 459

                                                                       
Query: 196 ggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaac 255
           || ||||||||||||||||| || ||||| ||||||||||||||||||||||||||||||
Sbjct: 460 ggagctcctgctcgtgttggtcttgttgctcctgttgatgtggtggttccccctggcaac 519

                                                                       
Query: 256 actggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagatt 315
           |||||||||||||| |||||||| || |||||||||||||||||||| ||||||||||||
Sbjct: 520 actggtctggatccatcccagacctctttcttccaggtgcttaacatccccaccaagatt 579

                                                                       
Query: 316 aacaagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtg 375
           |||||||||||||||||||||| || ||| |||||||| || ||||||||||||||||||
Sbjct: 580 aacaagggtactgtggaaattatcacccctgtggagctcattaagaagggtgacaaggtg 639

                                                                       
Query: 376 ggctcctctgagtctgccctgcttgccaagcttggtatccgccccttctcatatggactg 435
           |||||||| |||||||| |||||||||||||||||||||||||||||||||||||| |||
Sbjct: 640 ggctcctccgagtctgctctgcttgccaagcttggtatccgccccttctcatatgggctg 699

                                                                       
Query: 436 gtcatctgcaatgtctatgacagtgggtcagtcttcagccccgaggttcttgacctcact 495
           || ||   ||||||||||||||||||||||||||||||||| ||||| ||||||||||||
Sbjct: 700 gttattaccaatgtctatgacagtgggtcagtcttcagccctgaggtgcttgacctcact 759

                                    
Query: 496 gaggaagatctgatggacaagtttg 520
           ||||| || |||||||| |||||||
Sbjct: 760 gaggatgacctgatggagaagtttg 784



to top

>dbj|D21130.1|RICYK704 Oryza sativa (japonica cultivar-group) YK704 mRNA for acidic
           ribosomal protein P0, complete cds
          Length = 1220

 Score =  676 bits (341), Expect = 0.0
 Identities = 464/505 (91%)
 Strand = Plus / Plus

                                                                       
Query: 16  gactccatcgtgctcatgggcaagaacaccctgatccgccgctgcatcaaggtgcactcg 75
           ||||||||||| |||||||| ||||||||||| |||||||||||||||||||||||| | 
Sbjct: 262 gactccatcgtcctcatggggaagaacaccctcatccgccgctgcatcaaggtgcacgcc 321

                                                                       
Query: 76  gagaagactggcaacaaggacttcctcgagctcagcaacctcctcgtcggtaacgttggc 135
           || || || ||||||||||| |||||||||||||    |||||||||||| |||||||||
Sbjct: 322 gacaacaccggcaacaaggagttcctcgagctcatgcccctcctcgtcggaaacgttggc 381

                                                                       
Query: 136 ctcatcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggtt 195
           |||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||
Sbjct: 382 ctcatcttcaccaagggtgacctcaaggaggtccgcgaggaggttgccaagtacaaggtt 441

                                                                       
Query: 196 ggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaac 255
           || ||||||||||||||||| || ||||| ||||||||||||||||||||||||||||||
Sbjct: 442 ggagctcctgctcgtgttggtcttgttgctcctgttgatgtggtggttccccctggcaac 501

                                                                       
Query: 256 actggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagatt 315
           |||||||||||||| |||||||| || |||||||||||||||||||| ||||||||||||
Sbjct: 502 actggtctggatccatcccagacctctttcttccaggtgcttaacatccccaccaagatt 561

                                                                       
Query: 316 aacaagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtg 375
           |||||||||||||||||||||| || ||| |||||||| || ||||||||||||||||||
Sbjct: 562 aacaagggtactgtggaaattatcacccctgtggagctcattaagaagggtgacaaggtg 621

                                                                       
Query: 376 ggctcctctgagtctgccctgcttgccaagcttggtatccgccccttctcatatggactg 435
           |||||||| |||||||| |||||||||||||||||||||||||||||||||||||| |||
Sbjct: 622 ggctcctccgagtctgctctgcttgccaagcttggtatccgccccttctcatatgggctg 681

                                                                       
Query: 436 gtcatctgcaatgtctatgacagtgggtcagtcttcagccccgaggttcttgacctcact 495
           || ||   ||||||||||||||||||||||||||||||||| ||||| ||||||||||||
Sbjct: 682 gttattaccaatgtctatgacagtgggtcagtcttcagccctgaggtgcttgacctcact 741

                                    
Query: 496 gaggaagatctgatggacaagtttg 520
           ||||| || |||||||| |||||||
Sbjct: 742 gaggatgacctgatggagaagtttg 766



to top

>dbj|AK064857.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000H12, full
           insert sequence
          Length = 1236

 Score =  676 bits (341), Expect = 0.0
 Identities = 464/505 (91%)
 Strand = Plus / Plus

                                                                       
Query: 16  gactccatcgtgctcatgggcaagaacaccctgatccgccgctgcatcaaggtgcactcg 75
           ||||||||||| |||||||| ||||||||||| |||||||||||||||||||||||| | 
Sbjct: 280 gactccatcgtcctcatggggaagaacaccctcatccgccgctgcatcaaggtgcacgcc 339

                                                                       
Query: 76  gagaagactggcaacaaggacttcctcgagctcagcaacctcctcgtcggtaacgttggc 135
           || || || ||||||||||| |||||||||||||    |||||||||||| |||||||||
Sbjct: 340 gacaacaccggcaacaaggagttcctcgagctcatgcccctcctcgtcggaaacgttggc 399

                                                                       
Query: 136 ctcatcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggtt 195
           |||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||
Sbjct: 400 ctcatcttcaccaagggtgacctcaaggaggtccgcgaggaggttgccaagtacaaggtt 459

                                                                       
Query: 196 ggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaac 255
           || ||||||||||||||||| || ||||| ||||||||||||||||||||||||||||||
Sbjct: 460 ggagctcctgctcgtgttggtcttgttgctcctgttgatgtggtggttccccctggcaac 519

                                                                       
Query: 256 actggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagatt 315
           |||||||||||||| |||||||| || |||||||||||||||||||| ||||||||||||
Sbjct: 520 actggtctggatccatcccagacctctttcttccaggtgcttaacatccccaccaagatt 579

                                                                       
Query: 316 aacaagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtg 375
           |||||||||||||||||||||| || ||| |||||||| || ||||||||||||||||||
Sbjct: 580 aacaagggtactgtggaaattatcacccctgtggagctcattaagaagggtgacaaggtg 639

                                                                       
Query: 376 ggctcctctgagtctgccctgcttgccaagcttggtatccgccccttctcatatggactg 435
           |||||||| |||||||| |||||||||||||||||||||||||||||||||||||| |||
Sbjct: 640 ggctcctccgagtctgctctgcttgccaagcttggtatccgccccttctcatatgggctg 699

                                                                       
Query: 436 gtcatctgcaatgtctatgacagtgggtcagtcttcagccccgaggttcttgacctcact 495
           || ||   ||||||||||||||||||||||||||||||||| ||||| ||||||||||||
Sbjct: 700 gttattaccaatgtctatgacagtgggtcagtcttcagccctgaggtgcttgacctcact 759

                                    
Query: 496 gaggaagatctgatggacaagtttg 520
           ||||| || |||||||| |||||||
Sbjct: 760 gaggatgacctgatggagaagtttg 784



to top

>emb|Y07959.1|ZMRPP0 Z.mays mRNA for acidic ribosomal protein P0
          Length = 1253

 Score =  406 bits (205), Expect = e-110
 Identities = 286/313 (91%)
 Strand = Plus / Plus

                                                                       
Query: 113 acctcctcgtcggtaacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcg 172
           ||||||| ||||| ||||| |||||||||||||||||||| |||||||||||||| ||||
Sbjct: 380 acctcctggtcggcaacgtaggcctcatcttcaccaagggagacctcaaggaggtgcgcg 439

                                                                       
Query: 173 aggaggtcgccaagtacaaggttggcgctcctgctcgtgttgggctagttgcacctgttg 232
           |||||||||||||||||||||| || ||||||||||||||||| || ||||| || ||||
Sbjct: 440 aggaggtcgccaagtacaaggtgggggctcctgctcgtgttggtctggttgctccagttg 499

                                                                       
Query: 233 atgtggtggttccccctggcaacactggtctggatccctcccagacgtccttcttccagg 292
           |||| || || ||||||||||||||||| |||||||| |||||||| || ||||||||||
Sbjct: 500 atgttgttgtgccccctggcaacactgggctggatccgtcccagacctctttcttccagg 559

                                                                       
Query: 293 tgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcccagtggagc 352
           |||||||||| ||||||||||||||||||||||| |||||||||| || ||| |||||||
Sbjct: 560 tgcttaacatccccaccaagattaacaagggtaccgtggaaattatcacccctgtggagc 619

                                                                       
Query: 353 tgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgccaagcttggta 412
           |||||||||||||||| ||||||||||| ||||||||||||||||| |||||||| ||||
Sbjct: 620 tgatcaagaagggtgaaaaggtgggctcgtctgagtctgccctgctcgccaagctgggta 679

                        
Query: 413 tccgccccttctc 425
           |||||||||||||
Sbjct: 680 tccgccccttctc 692



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                      
Query: 25  gtgctcatgggcaagaacaccctgatccgccgctgcatcaaggtgcactcggagaagac 83
           ||||||||||| |||||||| || ||| | || |||||||||||| || | ||||||||
Sbjct: 292 gtgctcatggggaagaacacgctcatcaggcgttgcatcaaggtgtacgccgagaagac 350



to top

>gb|BT016531.1| Zea mays clone Contig364 mRNA sequence
          Length = 1230

 Score =  398 bits (201), Expect = e-108
 Identities = 285/313 (91%)
 Strand = Plus / Plus

                                                                       
Query: 113 acctcctcgtcggtaacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcg 172
           ||||||| ||||| ||||| |||||||||||||||||||| |||||||||||||| ||||
Sbjct: 361 acctcctggtcggcaacgtaggcctcatcttcaccaagggagacctcaaggaggtgcgcg 420

                                                                       
Query: 173 aggaggtcgccaagtacaaggttggcgctcctgctcgtgttgggctagttgcacctgttg 232
           |||||||||||||||||||||| || ||||||||||||||||| || ||||| || ||||
Sbjct: 421 aggaggtcgccaagtacaaggtgggggctcctgctcgtgttggtctggttgctccagttg 480

                                                                       
Query: 233 atgtggtggttccccctggcaacactggtctggatccctcccagacgtccttcttccagg 292
           |||| || || ||||||||||||||||| |||||||| |||||||| || ||||||||||
Sbjct: 481 atgttgttgtgccccctggcaacactgggctggatccgtcccagacctctttcttccagg 540

                                                                       
Query: 293 tgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcccagtggagc 352
           |||||||||| ||||||||||||||||||||||| |||||||||| || ||| |||||||
Sbjct: 541 tgcttaacatccccaccaagattaacaagggtaccgtggaaattatcacccctgtggagc 600

                                                                       
Query: 353 tgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgccaagcttggta 412
           |||||||||||||||| ||||||||||| || |||||||||||||| |||||||| ||||
Sbjct: 601 tgatcaagaagggtgaaaaggtgggctcgtccgagtctgccctgctcgccaagctgggta 660

                        
Query: 413 tccgccccttctc 425
           |||||||||||||
Sbjct: 661 tccgccccttctc 673



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 25  gtgctcatgggcaagaacaccctgatccgccgctgcatcaaggtgcactcggagaagac 83
           ||||||||||| |||||||| || ||| | ||||||||||||||| || | ||||||||
Sbjct: 273 gtgctcatggggaagaacacgctcatcaggcgctgcatcaaggtgtacgccgagaagac 331



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
               sequence
          Length = 28434780

 Score =  317 bits (160), Expect = 2e-83
 Identities = 214/232 (92%)
 Strand = Plus / Minus

                                                                           
Query: 289     caggtgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcccagtg 348
               |||||||||||||| |||||||||||||||||||||||||||||||||| || ||| |||
Sbjct: 1715190 caggtgcttaacatccccaccaagattaacaagggtactgtggaaattatcacccctgtg 1715131

                                                                           
Query: 349     gagctgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgccaagctt 408
               ||||| || |||||||||||||||||||||||||| |||||||| |||||||||||||||
Sbjct: 1715130 gagctcattaagaagggtgacaaggtgggctcctccgagtctgctctgcttgccaagctt 1715071

                                                                           
Query: 409     ggtatccgccccttctcatatggactggtcatctgcaatgtctatgacagtgggtcagtc 468
               ||||||||||||||||||||||| ||||| ||   |||||||||||||||||||||||||
Sbjct: 1715070 ggtatccgccccttctcatatgggctggttattaccaatgtctatgacagtgggtcagtc 1715011

                                                                   
Query: 469     ttcagccccgaggttcttgacctcactgaggaagatctgatggacaagtttg 520
               |||||||| ||||| ||||||||||||||||| || |||||||| |||||||
Sbjct: 1715010 ttcagccctgaggtgcttgacctcactgaggatgacctgatggagaagtttg 1714959



 Score =  151 bits (76), Expect = 3e-33
 Identities = 97/104 (93%)
 Strand = Plus / Minus

                                                                           
Query: 191     aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 250
               ||||||| ||||||||||||||||| || ||||| |||||||||||||||||||||||||
Sbjct: 1715379 aggttggagctcctgctcgtgttggtcttgttgctcctgttgatgtggtggttccccctg 1715320

                                                           
Query: 251     gcaacactggtctggatccctcccagacgtccttcttccaggtg 294
               ||||||||||||||||||| |||||||| || ||||||||||||
Sbjct: 1715319 gcaacactggtctggatccatcccagacctctttcttccaggtg 1715276



 Score =  119 bits (60), Expect = 9e-24
 Identities = 66/68 (97%)
 Strand = Plus / Minus

                                                                           
Query: 127     aacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaag 186
               ||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||
Sbjct: 1716313 aacgttggcctcatcttcaccaagggtgacctcaaggaggtccgcgaggaggttgccaag 1716254

                       
Query: 187     tacaaggt 194
               ||||||||
Sbjct: 1716253 tacaaggt 1716246



 Score =  115 bits (58), Expect = 1e-22
 Identities = 85/94 (90%)
 Strand = Plus / Minus

                                                                           
Query: 16      gactccatcgtgctcatgggcaagaacaccctgatccgccgctgcatcaaggtgcactcg 75
               ||||||||||| |||||||| ||||||||||| |||||||||||||||||||||||| | 
Sbjct: 1716515 gactccatcgtcctcatggggaagaacaccctcatccgccgctgcatcaaggtgcacgcc 1716456

                                                 
Query: 76      gagaagactggcaacaaggacttcctcgagctca 109
               || || || ||||||||||| |||||||||||||
Sbjct: 1716455 gacaacaccggcaacaaggagttcctcgagctca 1716422



to top

>dbj|AP004591.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
              clone:P0582D05
          Length = 150483

 Score =  317 bits (160), Expect = 2e-83
 Identities = 214/232 (92%)
 Strand = Plus / Minus

                                                                          
Query: 289    caggtgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcccagtg 348
              |||||||||||||| |||||||||||||||||||||||||||||||||| || ||| |||
Sbjct: 114690 caggtgcttaacatccccaccaagattaacaagggtactgtggaaattatcacccctgtg 114631

                                                                          
Query: 349    gagctgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgccaagctt 408
              ||||| || |||||||||||||||||||||||||| |||||||| |||||||||||||||
Sbjct: 114630 gagctcattaagaagggtgacaaggtgggctcctccgagtctgctctgcttgccaagctt 114571

                                                                          
Query: 409    ggtatccgccccttctcatatggactggtcatctgcaatgtctatgacagtgggtcagtc 468
              ||||||||||||||||||||||| ||||| ||   |||||||||||||||||||||||||
Sbjct: 114570 ggtatccgccccttctcatatgggctggttattaccaatgtctatgacagtgggtcagtc 114511

                                                                  
Query: 469    ttcagccccgaggttcttgacctcactgaggaagatctgatggacaagtttg 520
              |||||||| ||||| ||||||||||||||||| || |||||||| |||||||
Sbjct: 114510 ttcagccctgaggtgcttgacctcactgaggatgacctgatggagaagtttg 114459



 Score =  151 bits (76), Expect = 3e-33
 Identities = 97/104 (93%)
 Strand = Plus / Minus

                                                                          
Query: 191    aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 250
              ||||||| ||||||||||||||||| || ||||| |||||||||||||||||||||||||
Sbjct: 114879 aggttggagctcctgctcgtgttggtcttgttgctcctgttgatgtggtggttccccctg 114820

                                                          
Query: 251    gcaacactggtctggatccctcccagacgtccttcttccaggtg 294
              ||||||||||||||||||| |||||||| || ||||||||||||
Sbjct: 114819 gcaacactggtctggatccatcccagacctctttcttccaggtg 114776



 Score =  119 bits (60), Expect = 9e-24
 Identities = 66/68 (97%)
 Strand = Plus / Minus

                                                                          
Query: 127    aacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaag 186
              ||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||
Sbjct: 115813 aacgttggcctcatcttcaccaagggtgacctcaaggaggtccgcgaggaggttgccaag 115754

                      
Query: 187    tacaaggt 194
              ||||||||
Sbjct: 115753 tacaaggt 115746



 Score =  115 bits (58), Expect = 1e-22
 Identities = 85/94 (90%)
 Strand = Plus / Minus

                                                                          
Query: 16     gactccatcgtgctcatgggcaagaacaccctgatccgccgctgcatcaaggtgcactcg 75
              ||||||||||| |||||||| ||||||||||| |||||||||||||||||||||||| | 
Sbjct: 116015 gactccatcgtcctcatggggaagaacaccctcatccgccgctgcatcaaggtgcacgcc 115956

                                                
Query: 76     gagaagactggcaacaaggacttcctcgagctca 109
              || || || ||||||||||| |||||||||||||
Sbjct: 115955 gacaacaccggcaacaaggagttcctcgagctca 115922



to top

>gb|AC123528.2| Oryza sativa chromosome 11 clone  OSJNBa0078E03, complete sequence
          Length = 149493

 Score =  293 bits (148), Expect = 3e-76
 Identities = 211/232 (90%)
 Strand = Plus / Minus

                                                                        
Query: 289  caggtgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcccagtg 348
            |||||||||||||| ||||||||||||||||||||||| |||||||||| || ||| |||
Sbjct: 4568 caggtgcttaacatccccaccaagattaacaagggtaccgtggaaattatcacccctgtg 4509

                                                                        
Query: 349  gagctgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgccaagctt 408
            ||||| || ||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 4508 gagctcattaagaagggtgacaaggttggctcctctgagtctgccctgcttgccaagctt 4449

                                                                        
Query: 409  ggtatccgccccttctcatatggactggtcatctgcaatgtctatgacagtgggtcagtc 468
            ||||||||||||||||||||||| ||||| |||  |||||| || |||||||||||||||
Sbjct: 4448 ggtatccgccccttctcatatgggctggtgatcaccaatgtgtacgacagtgggtcagtc 4389

                                                                
Query: 469  ttcagccccgaggttcttgacctcactgaggaagatctgatggacaagtttg 520
            |||||||| ||||| || ||||||||||| || || |||||||| |||||||
Sbjct: 4388 ttcagccctgaggtgctcgacctcactgaagaggacctgatggagaagtttg 4337



 Score =  143 bits (72), Expect = 7e-31
 Identities = 96/104 (92%)
 Strand = Plus / Minus

                                                                        
Query: 191  aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 250
            ||||||| ||||||||||||||||| || ||||| |||||||||||||||||||||||||
Sbjct: 4744 aggttggagctcctgctcgtgttggtctggttgctcctgttgatgtggtggttccccctg 4685

                                                        
Query: 251  gcaacactggtctggatccctcccagacgtccttcttccaggtg 294
            | |||||||||||||||||||||||||| || ||||| ||||||
Sbjct: 4684 gaaacactggtctggatccctcccagacttctttctttcaggtg 4641



 Score =  131 bits (66), Expect = 2e-27
 Identities = 87/94 (92%)
 Strand = Plus / Minus

                                                                        
Query: 16   gactccatcgtgctcatgggcaagaacaccctgatccgccgctgcatcaaggtgcactcg 75
            ||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| | 
Sbjct: 5698 gactccatcgtcctcatgggcaagaacaccctcatccgccgctgcatcaaggtgcacgcc 5639

                                              
Query: 76   gagaagactggcaacaaggacttcctcgagctca 109
            || || || |||||||||||||||||||||||||
Sbjct: 5638 gacaacaccggcaacaaggacttcctcgagctca 5605



 Score =  119 bits (60), Expect = 9e-24
 Identities = 69/72 (95%)
 Strand = Plus / Minus

                                                                        
Query: 127  aacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaag 186
            |||||||| |||||||||||||||||||||||||||||||| ||||| ||||||||||||
Sbjct: 5485 aacgttggtctcatcttcaccaagggtgacctcaaggaggtccgcgaagaggtcgccaag 5426

                        
Query: 187  tacaaggttggc 198
            ||||||||||||
Sbjct: 5425 tacaaggttggc 5414



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
               sequence
          Length = 27566993

 Score =  293 bits (148), Expect = 3e-76
 Identities = 211/232 (90%)
 Strand = Plus / Minus

                                                                           
Query: 289     caggtgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcccagtg 348
               |||||||||||||| |||||||||||||||||||||||||||||||||| || ||| || 
Sbjct: 1602065 caggtgcttaacatccccaccaagattaacaagggtactgtggaaattatcacccctgta 1602006

                                                                           
Query: 349     gagctgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgccaagctt 408
               ||||| || ||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 1602005 gagctcattaagaagggtgacaaggttggctcctctgagtctgccctgcttgccaagctt 1601946

                                                                           
Query: 409     ggtatccgccccttctcatatggactggtcatctgcaatgtctatgacagtgggtcagtc 468
               ||||||||||||||||||||||| ||||| |||  |||||| || |||||||||||||||
Sbjct: 1601945 ggtatccgccccttctcatatgggctggtgatcaccaatgtgtacgacagtgggtcagtc 1601886

                                                                   
Query: 469     ttcagccccgaggttcttgacctcactgaggaagatctgatggacaagtttg 520
               |||||||| ||||| || ||||||||||| || || |||||||| |||||||
Sbjct: 1601885 ttcagccctgaggtgctcgacctcactgaagaggacctgatggagaagtttg 1601834



 Score =  135 bits (68), Expect = 2e-28
 Identities = 95/104 (91%)
 Strand = Plus / Minus

                                                                           
Query: 191     aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 250
               ||||||| ||||||||||||||||| || ||||| |||||||||||||| ||||||||||
Sbjct: 1602242 aggttggagctcctgctcgtgttggtctggttgctcctgttgatgtggttgttccccctg 1602183

                                                           
Query: 251     gcaacactggtctggatccctcccagacgtccttcttccaggtg 294
               | ||||||||||| |||||||||||||| || ||||||||||||
Sbjct: 1602182 gaaacactggtctcgatccctcccagacttctttcttccaggtg 1602139



 Score =  125 bits (63), Expect = 2e-25
 Identities = 69/71 (97%)
 Strand = Plus / Minus

                                                                           
Query: 124     ggtaacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgcc 183
               ||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 1602988 ggtaacgttggtctcatcttcaccaagggtgacctcaaggaggtccgcgaggaggtcgcc 1602929

                          
Query: 184     aagtacaaggt 194
               |||||||||||
Sbjct: 1602928 aagtacaaggt 1602918



 Score =  123 bits (62), Expect = 6e-25
 Identities = 86/94 (91%)
 Strand = Plus / Minus

                                                                           
Query: 16      gactccatcgtgctcatgggcaagaacaccctgatccgccgctgcatcaaggtgcactcg 75
               ||||||||||| |||||||| ||||||||||| |||||||||||||||||||||||| | 
Sbjct: 1603178 gactccatcgtcctcatggggaagaacaccctcatccgccgctgcatcaaggtgcacgcc 1603119

                                                 
Query: 76      gagaagactggcaacaaggacttcctcgagctca 109
               || || || |||||||||||||||||||||||||
Sbjct: 1603118 gacaacaccggcaacaaggacttcctcgagctca 1603085



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score =  293 bits (148), Expect = 3e-76
 Identities = 211/232 (90%)
 Strand = Plus / Minus

                                                                           
Query: 289     caggtgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcccagtg 348
               |||||||||||||| ||||||||||||||||||||||| |||||||||| || ||| |||
Sbjct: 1648854 caggtgcttaacatccccaccaagattaacaagggtaccgtggaaattatcacccctgtg 1648795

                                                                           
Query: 349     gagctgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgccaagctt 408
               ||||| || ||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 1648794 gagctcattaagaagggtgacaaggttggctcctctgagtctgccctgcttgccaagctt 1648735

                                                                           
Query: 409     ggtatccgccccttctcatatggactggtcatctgcaatgtctatgacagtgggtcagtc 468
               ||||||||||||||||||||||| ||||| |||  |||||| || |||||||||||||||
Sbjct: 1648734 ggtatccgccccttctcatatgggctggtgatcaccaatgtgtacgacagtgggtcagtc 1648675

                                                                   
Query: 469     ttcagccccgaggttcttgacctcactgaggaagatctgatggacaagtttg 520
               |||||||| ||||| || ||||||||||| || || |||||||| |||||||
Sbjct: 1648674 ttcagccctgaggtgctcgacctcactgaagaggacctgatggagaagtttg 1648623



 Score =  143 bits (72), Expect = 7e-31
 Identities = 96/104 (92%)
 Strand = Plus / Minus

                                                                           
Query: 191     aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 250
               ||||||| ||||||||||||||||| || ||||| |||||||||||||||||||||||||
Sbjct: 1649030 aggttggagctcctgctcgtgttggtctggttgctcctgttgatgtggtggttccccctg 1648971

                                                           
Query: 251     gcaacactggtctggatccctcccagacgtccttcttccaggtg 294
               | |||||||||||||||||||||||||| || ||||| ||||||
Sbjct: 1648970 gaaacactggtctggatccctcccagacttctttctttcaggtg 1648927



 Score =  131 bits (66), Expect = 2e-27
 Identities = 87/94 (92%)
 Strand = Plus / Minus

                                                                           
Query: 16      gactccatcgtgctcatgggcaagaacaccctgatccgccgctgcatcaaggtgcactcg 75
               ||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| | 
Sbjct: 1649984 gactccatcgtcctcatgggcaagaacaccctcatccgccgctgcatcaaggtgcacgcc 1649925

                                                 
Query: 76      gagaagactggcaacaaggacttcctcgagctca 109
               || || || |||||||||||||||||||||||||
Sbjct: 1649924 gacaacaccggcaacaaggacttcctcgagctca 1649891



 Score =  119 bits (60), Expect = 9e-24
 Identities = 69/72 (95%)
 Strand = Plus / Minus

                                                                           
Query: 127     aacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaag 186
               |||||||| |||||||||||||||||||||||||||||||| ||||| ||||||||||||
Sbjct: 1649771 aacgttggtctcatcttcaccaagggtgacctcaaggaggtccgcgaagaggtcgccaag 1649712

                           
Query: 187     tacaaggttggc 198
               ||||||||||||
Sbjct: 1649711 tacaaggttggc 1649700



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  293 bits (148), Expect = 3e-76
 Identities = 211/232 (90%)
 Strand = Plus / Minus

                                                                           
Query: 289     caggtgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcccagtg 348
               |||||||||||||| ||||||||||||||||||||||| |||||||||| || ||| |||
Sbjct: 1646575 caggtgcttaacatccccaccaagattaacaagggtaccgtggaaattatcacccctgtg 1646516

                                                                           
Query: 349     gagctgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgccaagctt 408
               ||||| || ||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 1646515 gagctcattaagaagggtgacaaggttggctcctctgagtctgccctgcttgccaagctt 1646456

                                                                           
Query: 409     ggtatccgccccttctcatatggactggtcatctgcaatgtctatgacagtgggtcagtc 468
               ||||||||||||||||||||||| ||||| |||  |||||| || |||||||||||||||
Sbjct: 1646455 ggtatccgccccttctcatatgggctggtgatcaccaatgtgtacgacagtgggtcagtc 1646396

                                                                   
Query: 469     ttcagccccgaggttcttgacctcactgaggaagatctgatggacaagtttg 520
               |||||||| ||||| || ||||||||||| || || |||||||| |||||||
Sbjct: 1646395 ttcagccctgaggtgctcgacctcactgaagaggacctgatggagaagtttg 1646344



 Score =  143 bits (72), Expect = 7e-31
 Identities = 96/104 (92%)
 Strand = Plus / Minus

                                                                           
Query: 191     aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 250
               ||||||| ||||||||||||||||| || ||||| |||||||||||||||||||||||||
Sbjct: 1646751 aggttggagctcctgctcgtgttggtctggttgctcctgttgatgtggtggttccccctg 1646692

                                                           
Query: 251     gcaacactggtctggatccctcccagacgtccttcttccaggtg 294
               | |||||||||||||||||||||||||| || ||||| ||||||
Sbjct: 1646691 gaaacactggtctggatccctcccagacttctttctttcaggtg 1646648



 Score =  131 bits (66), Expect = 2e-27
 Identities = 87/94 (92%)
 Strand = Plus / Minus

                                                                           
Query: 16      gactccatcgtgctcatgggcaagaacaccctgatccgccgctgcatcaaggtgcactcg 75
               ||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| | 
Sbjct: 1647705 gactccatcgtcctcatgggcaagaacaccctcatccgccgctgcatcaaggtgcacgcc 1647646

                                                 
Query: 76      gagaagactggcaacaaggacttcctcgagctca 109
               || || || |||||||||||||||||||||||||
Sbjct: 1647645 gacaacaccggcaacaaggacttcctcgagctca 1647612



 Score =  119 bits (60), Expect = 9e-24
 Identities = 69/72 (95%)
 Strand = Plus / Minus

                                                                           
Query: 127     aacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaag 186
               |||||||| |||||||||||||||||||||||||||||||| ||||| ||||||||||||
Sbjct: 1647492 aacgttggtctcatcttcaccaagggtgacctcaaggaggtccgcgaagaggtcgccaag 1647433

                           
Query: 187     tacaaggttggc 198
               ||||||||||||
Sbjct: 1647432 tacaaggttggc 1647421



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  293 bits (148), Expect = 3e-76
 Identities = 211/232 (90%)
 Strand = Plus / Minus

                                                                           
Query: 289     caggtgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcccagtg 348
               |||||||||||||| |||||||||||||||||||||||||||||||||| || ||| || 
Sbjct: 1602065 caggtgcttaacatccccaccaagattaacaagggtactgtggaaattatcacccctgta 1602006

                                                                           
Query: 349     gagctgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgccaagctt 408
               ||||| || ||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 1602005 gagctcattaagaagggtgacaaggttggctcctctgagtctgccctgcttgccaagctt 1601946

                                                                           
Query: 409     ggtatccgccccttctcatatggactggtcatctgcaatgtctatgacagtgggtcagtc 468
               ||||||||||||||||||||||| ||||| |||  |||||| || |||||||||||||||
Sbjct: 1601945 ggtatccgccccttctcatatgggctggtgatcaccaatgtgtacgacagtgggtcagtc 1601886

                                                                   
Query: 469     ttcagccccgaggttcttgacctcactgaggaagatctgatggacaagtttg 520
               |||||||| ||||| || ||||||||||| || || |||||||| |||||||
Sbjct: 1601885 ttcagccctgaggtgctcgacctcactgaagaggacctgatggagaagtttg 1601834



 Score =  135 bits (68), Expect = 2e-28
 Identities = 95/104 (91%)
 Strand = Plus / Minus

                                                                           
Query: 191     aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 250
               ||||||| ||||||||||||||||| || ||||| |||||||||||||| ||||||||||
Sbjct: 1602242 aggttggagctcctgctcgtgttggtctggttgctcctgttgatgtggttgttccccctg 1602183

                                                           
Query: 251     gcaacactggtctggatccctcccagacgtccttcttccaggtg 294
               | ||||||||||| |||||||||||||| || ||||||||||||
Sbjct: 1602182 gaaacactggtctcgatccctcccagacttctttcttccaggtg 1602139



 Score =  125 bits (63), Expect = 2e-25
 Identities = 69/71 (97%)
 Strand = Plus / Minus

                                                                           
Query: 124     ggtaacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgcc 183
               ||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 1602988 ggtaacgttggtctcatcttcaccaagggtgacctcaaggaggtccgcgaggaggtcgcc 1602929

                          
Query: 184     aagtacaaggt 194
               |||||||||||
Sbjct: 1602928 aagtacaaggt 1602918



 Score =  123 bits (62), Expect = 6e-25
 Identities = 86/94 (91%)
 Strand = Plus / Minus

                                                                           
Query: 16      gactccatcgtgctcatgggcaagaacaccctgatccgccgctgcatcaaggtgcactcg 75
               ||||||||||| |||||||| ||||||||||| |||||||||||||||||||||||| | 
Sbjct: 1603178 gactccatcgtcctcatggggaagaacaccctcatccgccgctgcatcaaggtgcacgcc 1603119

                                                 
Query: 76      gagaagactggcaacaaggacttcctcgagctca 109
               || || || |||||||||||||||||||||||||
Sbjct: 1603118 gacaacaccggcaacaaggacttcctcgagctca 1603085



to top

>emb|BX000508.1|CNS08CDY Oryza sativa chromosome 12, . BAC OJ1575_G05 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 91883

 Score =  293 bits (148), Expect = 3e-76
 Identities = 211/232 (90%)
 Strand = Plus / Plus

                                                                         
Query: 289   caggtgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcccagtg 348
             |||||||||||||| |||||||||||||||||||||||||||||||||| || ||| || 
Sbjct: 90857 caggtgcttaacatccccaccaagattaacaagggtactgtggaaattatcacccctgta 90916

                                                                         
Query: 349   gagctgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgccaagctt 408
             ||||| || ||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 90917 gagctcattaagaagggtgacaaggttggctcctctgagtctgccctgcttgccaagctt 90976

                                                                         
Query: 409   ggtatccgccccttctcatatggactggtcatctgcaatgtctatgacagtgggtcagtc 468
             ||||||||||||||||||||||| ||||| |||  |||||| || |||||||||||||||
Sbjct: 90977 ggtatccgccccttctcatatgggctggtgatcaccaatgtgtacgacagtgggtcagtc 91036

                                                                 
Query: 469   ttcagccccgaggttcttgacctcactgaggaagatctgatggacaagtttg 520
             |||||||| ||||| || ||||||||||| || || |||||||| |||||||
Sbjct: 91037 ttcagccctgaggtgctcgacctcactgaagaggacctgatggagaagtttg 91088



 Score =  135 bits (68), Expect = 2e-28
 Identities = 95/104 (91%)
 Strand = Plus / Plus

                                                                         
Query: 191   aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 250
             ||||||| ||||||||||||||||| || ||||| |||||||||||||| ||||||||||
Sbjct: 90680 aggttggagctcctgctcgtgttggtctggttgctcctgttgatgtggttgttccccctg 90739

                                                         
Query: 251   gcaacactggtctggatccctcccagacgtccttcttccaggtg 294
             | ||||||||||| |||||||||||||| || ||||||||||||
Sbjct: 90740 gaaacactggtctcgatccctcccagacttctttcttccaggtg 90783



 Score =  125 bits (63), Expect = 2e-25
 Identities = 69/71 (97%)
 Strand = Plus / Plus

                                                                         
Query: 124   ggtaacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgcc 183
             ||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 89934 ggtaacgttggtctcatcttcaccaagggtgacctcaaggaggtccgcgaggaggtcgcc 89993

                        
Query: 184   aagtacaaggt 194
             |||||||||||
Sbjct: 89994 aagtacaaggt 90004



 Score =  123 bits (62), Expect = 6e-25
 Identities = 86/94 (91%)
 Strand = Plus / Plus

                                                                         
Query: 16    gactccatcgtgctcatgggcaagaacaccctgatccgccgctgcatcaaggtgcactcg 75
             ||||||||||| |||||||| ||||||||||| |||||||||||||||||||||||| | 
Sbjct: 89744 gactccatcgtcctcatggggaagaacaccctcatccgccgctgcatcaaggtgcacgcc 89803

                                               
Query: 76    gagaagactggcaacaaggacttcctcgagctca 109
             || || || |||||||||||||||||||||||||
Sbjct: 89804 gacaacaccggcaacaaggacttcctcgagctca 89837



to top

>emb|BX000498.1|CNS08CDO Oryza sativa chromosome 12, . BAC OSJNBa0009F13 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 183385

 Score =  293 bits (148), Expect = 3e-76
 Identities = 211/232 (90%)
 Strand = Plus / Plus

                                                                         
Query: 289   caggtgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcccagtg 348
             |||||||||||||| |||||||||||||||||||||||||||||||||| || ||| || 
Sbjct: 23667 caggtgcttaacatccccaccaagattaacaagggtactgtggaaattatcacccctgta 23726

                                                                         
Query: 349   gagctgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgccaagctt 408
             ||||| || ||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 23727 gagctcattaagaagggtgacaaggttggctcctctgagtctgccctgcttgccaagctt 23786

                                                                         
Query: 409   ggtatccgccccttctcatatggactggtcatctgcaatgtctatgacagtgggtcagtc 468
             ||||||||||||||||||||||| ||||| |||  |||||| || |||||||||||||||
Sbjct: 23787 ggtatccgccccttctcatatgggctggtgatcaccaatgtgtacgacagtgggtcagtc 23846

                                                                 
Query: 469   ttcagccccgaggttcttgacctcactgaggaagatctgatggacaagtttg 520
             |||||||| ||||| || ||||||||||| || || |||||||| |||||||
Sbjct: 23847 ttcagccctgaggtgctcgacctcactgaagaggacctgatggagaagtttg 23898



 Score =  135 bits (68), Expect = 2e-28
 Identities = 95/104 (91%)
 Strand = Plus / Plus

                                                                         
Query: 191   aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 250
             ||||||| ||||||||||||||||| || ||||| |||||||||||||| ||||||||||
Sbjct: 23490 aggttggagctcctgctcgtgttggtctggttgctcctgttgatgtggttgttccccctg 23549

                                                         
Query: 251   gcaacactggtctggatccctcccagacgtccttcttccaggtg 294
             | ||||||||||| |||||||||||||| || ||||||||||||
Sbjct: 23550 gaaacactggtctcgatccctcccagacttctttcttccaggtg 23593



 Score =  125 bits (63), Expect = 2e-25
 Identities = 69/71 (97%)
 Strand = Plus / Plus

                                                                         
Query: 124   ggtaacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgcc 183
             ||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 22744 ggtaacgttggtctcatcttcaccaagggtgacctcaaggaggtccgcgaggaggtcgcc 22803

                        
Query: 184   aagtacaaggt 194
             |||||||||||
Sbjct: 22804 aagtacaaggt 22814



 Score =  123 bits (62), Expect = 6e-25
 Identities = 86/94 (91%)
 Strand = Plus / Plus

                                                                         
Query: 16    gactccatcgtgctcatgggcaagaacaccctgatccgccgctgcatcaaggtgcactcg 75
             ||||||||||| |||||||| ||||||||||| |||||||||||||||||||||||| | 
Sbjct: 22554 gactccatcgtcctcatggggaagaacaccctcatccgccgctgcatcaaggtgcacgcc 22613

                                               
Query: 76    gagaagactggcaacaaggacttcctcgagctca 109
             || || || |||||||||||||||||||||||||
Sbjct: 22614 gacaacaccggcaacaaggacttcctcgagctca 22647



to top

>dbj|AB091076.1| Zinnia elegans ZeRPP0 mRNA for putative 60S acidic ribosomal
           protein P0, partial cds
          Length = 820

 Score =  234 bits (118), Expect = 2e-58
 Identities = 220/254 (86%)
 Strand = Plus / Plus

                                                                       
Query: 139 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 198
           |||||||| ||||||||| | ||||||||||| || ||||| || ||||||||||| || 
Sbjct: 481 atcttcacaaagggtgacttgaaggaggttcgtgaagaggttgctaagtacaaggtcgga 540

                                                                       
Query: 199 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 258
           || ||||||||||| ||  | || || || ||||||||||| || || ||||||||||||
Sbjct: 541 gcacctgctcgtgtcggtttggtggctccagttgatgtggttgtccctcctggcaacact 600

                                                                       
Query: 259 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 318
           ||||| || || || ||||| || ||||||||||||||||||||||||||||||||||||
Sbjct: 601 ggtcttgacccatctcagacctctttcttccaggtgcttaacattcccaccaagattaac 660

                                                                       
Query: 319 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 378
           ||||||||||| ||||||| || |||||||||||| ||||||||||||||||| ||||| 
Sbjct: 661 aagggtactgttgaaattatcaccccagtggagcttatcaagaagggtgacaaagtgggt 720

                         
Query: 379 tcctctgagtctgc 392
           || |||||| ||||
Sbjct: 721 tcatctgaggctgc 734



to top

>ref|NM_111960.2| Arabidopsis thaliana structural constituent of ribosome AT3G11250
           mRNA, complete cds
          Length = 1239

 Score =  230 bits (116), Expect = 4e-57
 Identities = 233/272 (85%)
 Strand = Plus / Plus

                                                                       
Query: 139 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 198
           |||||||| || ||||| |||||||| ||  |||||||||| ||||| ||||||||||| 
Sbjct: 364 atcttcactaaaggtgatctcaaggaagtgagcgaggaggttgccaaatacaaggttggt 423

                                                                       
Query: 199 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 258
           |||||||||||||| ||  ||||||| ||| |||||||||| ||||  ||||||||||||
Sbjct: 424 gctcctgctcgtgtgggtttagttgctcctattgatgtggttgttcaacctggcaacact 483

                                                                       
Query: 259 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 318
           ||||| || || || || || || |||||||||||||||||||||||||| |||||||||
Sbjct: 484 ggtcttgacccatctcaaacatcgttcttccaggtgcttaacattcccactaagattaac 543

                                                                       
Query: 319 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 378
           ||||||||||| ||||||| || ||| |||||||| |||||| | ||||||||||| || 
Sbjct: 544 aagggtactgttgaaattatcacccctgtggagcttatcaagcaaggtgacaaggttggg 603

                                           
Query: 379 tcctctgagtctgccctgcttgccaagcttgg 410
           || |||||| ||||||| || || ||||||||
Sbjct: 604 tcttctgaggctgcccttctagctaagcttgg 635



to top

>gb|AY091201.1| Arabidopsis thaliana putative 60S acidic ribosomal protein
           (At3g11250) mRNA, complete cds
          Length = 1003

 Score =  230 bits (116), Expect = 4e-57
 Identities = 233/272 (85%)
 Strand = Plus / Plus

                                                                       
Query: 139 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 198
           |||||||| || ||||| |||||||| ||  |||||||||| ||||| ||||||||||| 
Sbjct: 271 atcttcactaaaggtgatctcaaggaagtgagcgaggaggttgccaaatacaaggttggt 330

                                                                       
Query: 199 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 258
           |||||||||||||| ||  ||||||| ||| |||||||||| ||||  ||||||||||||
Sbjct: 331 gctcctgctcgtgtgggtttagttgctcctattgatgtggttgttcaacctggcaacact 390

                                                                       
Query: 259 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 318
           ||||| || || || || || || |||||||||||||||||||||||||| |||||||||
Sbjct: 391 ggtcttgacccatctcaaacatcgttcttccaggtgcttaacattcccactaagattaac 450

                                                                       
Query: 319 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 378
           ||||||||||| ||||||| || ||| |||||||| |||||| | ||||||||||| || 
Sbjct: 451 aagggtactgttgaaattatcacccctgtggagcttatcaagcaaggtgacaaggttggg 510

                                           
Query: 379 tcctctgagtctgccctgcttgccaagcttgg 410
           || |||||| ||||||| || || ||||||||
Sbjct: 511 tcttctgaggctgcccttctagctaagcttgg 542



to top

>gb|AY056150.1| Arabidopsis thaliana putative 60S acidic ribosomal protein
           (At3g11250) mRNA, complete cds
          Length = 1174

 Score =  230 bits (116), Expect = 4e-57
 Identities = 233/272 (85%)
 Strand = Plus / Plus

                                                                       
Query: 139 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 198
           |||||||| || ||||| |||||||| ||  |||||||||| ||||| ||||||||||| 
Sbjct: 334 atcttcactaaaggtgatctcaaggaagtgagcgaggaggttgccaaatacaaggttggt 393

                                                                       
Query: 199 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 258
           |||||||||||||| ||  ||||||| ||| |||||||||| ||||  ||||||||||||
Sbjct: 394 gctcctgctcgtgtgggtttagttgctcctattgatgtggttgttcaacctggcaacact 453

                                                                       
Query: 259 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 318
           ||||| || || || || || || |||||||||||||||||||||||||| |||||||||
Sbjct: 454 ggtcttgacccatctcaaacatcgttcttccaggtgcttaacattcccactaagattaac 513

                                                                       
Query: 319 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 378
           ||||||||||| ||||||| || ||| |||||||| |||||| | ||||||||||| || 
Sbjct: 514 aagggtactgttgaaattatcacccctgtggagcttatcaagcaaggtgacaaggttggg 573

                                           
Query: 379 tcctctgagtctgccctgcttgccaagcttgg 410
           || |||||| ||||||| || || ||||||||
Sbjct: 574 tcttctgaggctgcccttctagctaagcttgg 605



to top

>gb|AY087728.1| Arabidopsis thaliana clone 38036 mRNA, complete sequence
          Length = 1185

 Score =  230 bits (116), Expect = 4e-57
 Identities = 233/272 (85%)
 Strand = Plus / Plus

                                                                       
Query: 139 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 198
           |||||||| || ||||| |||||||| ||  |||||||||| ||||| ||||||||||| 
Sbjct: 311 atcttcactaaaggtgatctcaaggaagtgagcgaggaggttgccaaatacaaggttggt 370

                                                                       
Query: 199 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 258
           |||||||||||||| ||  ||||||| ||| |||||||||| ||||  ||||||||||||
Sbjct: 371 gctcctgctcgtgtgggtttagttgctcctattgatgtggttgttcaacctggcaacact 430

                                                                       
Query: 259 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 318
           ||||| || || || || || || |||||||||||||||||||||||||| |||||||||
Sbjct: 431 ggtcttgacccatctcaaacatcgttcttccaggtgcttaacattcccactaagattaac 490

                                                                       
Query: 319 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 378
           ||||||||||| ||||||| || ||| |||||||| |||||| | ||||||||||| || 
Sbjct: 491 aagggtactgttgaaattatcacccctgtggagcttatcaagcaaggtgacaaggttggg 550

                                           
Query: 379 tcctctgagtctgccctgcttgccaagcttgg 410
           || |||||| ||||||| || || ||||||||
Sbjct: 551 tcttctgaggctgcccttctagctaagcttgg 582



to top

>gb|DQ235176.1| Solanum tuberosum clone 156H10 P0 ribosomal protein-like mRNA,
           complete cds
          Length = 1254

 Score =  226 bits (114), Expect = 6e-56
 Identities = 315/382 (82%)
 Strand = Plus / Plus

                                                                       
Query: 139 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 198
           |||||||||||||||||||||||||| ||  | ||||| ||||| |||||||||||||| 
Sbjct: 437 atcttcaccaagggtgacctcaaggaagtgagtgaggaagtcgcaaagtacaaggttgga 496

                                                                       
Query: 199 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 258
           || ||||||||||||||  | || || || |||||||| || || || ||||| ||||||
Sbjct: 497 gcacctgctcgtgttggtttggtggctccagttgatgttgttgtccctcctggtaacact 556

                                                                       
Query: 259 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 318
           ||||| ||||| || ||||| || |||||||||||||| ||||| || || |||||||||
Sbjct: 557 ggtcttgatccatctcagacctctttcttccaggtgctcaacatcccaactaagattaac 616

                                                                       
Query: 319 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 378
           ||||||||||| ||||||| ||  || || || || ||||||||||||||||| || || 
Sbjct: 617 aagggtactgttgaaattatcactcctgttgaactcatcaagaagggtgacaaagttggt 676

                                                                       
Query: 379 tcctctgagtctgccctgcttgccaagcttggtatccgccccttctcatatggactggtc 438
           ||||||||  |||||||||||||||| ||||| ||  | || ||||||||||| || || 
Sbjct: 677 tcctctgaagctgccctgcttgccaaacttggaattaggccattctcatatggtcttgtt 736

                                                                       
Query: 439 atctgcaatgtctatgacagtgggtcagtcttcagccccgaggttcttgacctcactgag 498
            |   |  ||| || |||| ||| || ||||||||||| |||||||||||||| ||||||
Sbjct: 737 gttgtctctgtttacgacaatggatccgtcttcagccctgaggttcttgacctgactgag 796

                                 
Query: 499 gaagatctgatggacaagtttg 520
           || ||||| || || |||||||
Sbjct: 797 gatgatctcattgagaagtttg 818



to top

>gb|BT018921.1| Zea mays clone Contig30.F mRNA sequence
          Length = 820

 Score =  226 bits (114), Expect = 6e-56
 Identities = 167/182 (91%), Gaps = 2/182 (1%)
 Strand = Plus / Plus

                                                                       
Query: 244 ccccctggcaacactggtctggatccctcccagacgtccttcttccaggtgcttaacatt 303
           ||||||||||||||||| ||||||||||||||||| || |||||| ||||||| ||||| 
Sbjct: 14  ccccctggcaacactgggctggatccctcccagacctctttcttc-aggtgct-aacatc 71

                                                                       
Query: 304 cccaccaagattaacaagggtactgtggaaattaccatcccagtggagctgatcaagaag 363
           |||||||||||||||||||||||||||||||||| || ||| ||||||||||||||||||
Sbjct: 72  cccaccaagattaacaagggtactgtggaaattatcacccctgtggagctgatcaagaag 131

                                                                       
Query: 364 ggtgacaaggtgggctcctctgagtctgccctgcttgccaagcttggtatccgccccttc 423
           ||||| ||||||||||| || |||||||||||||| |||||||| || ||||||||||||
Sbjct: 132 ggtgagaaggtgggctcgtccgagtctgccctgctcgccaagctgggcatccgccccttc 191

             
Query: 424 tc 425
           ||
Sbjct: 192 tc 193



to top

>gb|DQ241840.1| Solanum tuberosum clone 181G12 P0 ribosomal protein-like mRNA,
           complete cds
          Length = 1253

 Score =  226 bits (114), Expect = 6e-56
 Identities = 315/382 (82%)
 Strand = Plus / Plus

                                                                       
Query: 139 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 198
           |||||||||||||||||||||||||| ||  | ||||| ||||| |||||||||||||| 
Sbjct: 415 atcttcaccaagggtgacctcaaggaagtgagtgaggaagtcgcaaagtacaaggttgga 474

                                                                       
Query: 199 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 258
           || ||||||||||||||  | || || || |||||||| || || || ||||| ||||||
Sbjct: 475 gcacctgctcgtgttggtttggtggctccagttgatgttgttgtccctcctggtaacact 534

                                                                       
Query: 259 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 318
           ||||| ||||| || ||||| || |||||||||||||| ||||| || || |||||||||
Sbjct: 535 ggtcttgatccatctcagacctctttcttccaggtgctcaacatcccaactaagattaac 594

                                                                       
Query: 319 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 378
           ||||||||||| ||||||| ||  || || || || ||||||||||||||||| || || 
Sbjct: 595 aagggtactgttgaaattatcactcctgttgaactcatcaagaagggtgacaaagttggt 654

                                                                       
Query: 379 tcctctgagtctgccctgcttgccaagcttggtatccgccccttctcatatggactggtc 438
           ||||||||  |||||||||||||||| ||||| ||  | || ||||||||||| || || 
Sbjct: 655 tcctctgaagctgccctgcttgccaaacttggaattaggccattctcatatggtcttgtt 714

                                                                       
Query: 439 atctgcaatgtctatgacagtgggtcagtcttcagccccgaggttcttgacctcactgag 498
            |   |  ||| || |||| ||| || ||||||||||| |||||||||||||| ||||||
Sbjct: 715 gttgtctctgtttacgacaatggatccgtcttcagccctgaggttcttgacctgactgag 774

                                 
Query: 499 gaagatctgatggacaagtttg 520
           || ||||| || || |||||||
Sbjct: 775 gatgatctcattgagaagtttg 796



to top

>ref|NM_111754.2| Arabidopsis thaliana structural constituent of ribosome AT3G09200
           mRNA, complete cds
          Length = 1307

 Score =  212 bits (107), Expect = 9e-52
 Identities = 296/359 (82%)
 Strand = Plus / Plus

                                                                       
Query: 139 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 198
           ||||| ||||| |||||||||||||| ||  |||||||||| || |||||||||||||| 
Sbjct: 341 atctttaccaaaggtgacctcaaggaagtgagcgaggaggttgctaagtacaaggttggt 400

                                                                       
Query: 199 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 258
           || ||||||||||| ||  | || || ||  |||||||||| || |  ||||||||||||
Sbjct: 401 gcccctgctcgtgtgggtttggtggctccaattgatgtggttgtccaacctggcaacact 460

                                                                       
Query: 259 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 318
           ||||| || || ||||| || || |||||||||||||||||||| || ||||||||||||
Sbjct: 461 ggtctcgacccatcccaaacatctttcttccaggtgcttaacatcccaaccaagattaac 520

                                                                       
Query: 319 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 378
           |||||||| || ||||| | || |||||| ||||| |||||| | ||||||||||| || 
Sbjct: 521 aagggtaccgtcgaaatcatcaccccagttgagcttatcaagcaaggtgacaaggtcggg 580

                                                                       
Query: 379 tcctctgagtctgccctgcttgccaagcttggtatccgccccttctcatatggactggtc 438
           || |||||| |||| || || ||||||||||| ||| | || ||||||||||| || || 
Sbjct: 581 tcttctgaggctgcgcttctagccaagcttggcatcaggccgttctcatatggtcttgtt 640

                                                                      
Query: 439 atctgcaatgtctatgacagtgggtcagtcttcagccccgaggttcttgacctcactga 497
            ||     ||||||||||| ||| |||||||||||||| ||||||||||| || |||||
Sbjct: 641 gtccagtctgtctatgacaatggctcagtcttcagcccagaggttcttgatcttactga 699



to top

>gb|AY059117.1| Arabidopsis thaliana putative 60S acidic ribosomal protein P0
           (At3g09200) mRNA, complete cds
          Length = 994

 Score =  212 bits (107), Expect = 9e-52
 Identities = 296/359 (82%)
 Strand = Plus / Plus

                                                                       
Query: 139 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 198
           ||||| ||||| |||||||||||||| ||  |||||||||| || |||||||||||||| 
Sbjct: 271 atctttaccaaaggtgacctcaaggaagtgagcgaggaggttgctaagtacaaggttggt 330

                                                                       
Query: 199 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 258
           || ||||||||||| ||  | || || ||  |||||||||| || |  ||||||||||||
Sbjct: 331 gcccctgctcgtgtgggtttggtggctccaattgatgtggttgtccaacctggcaacact 390

                                                                       
Query: 259 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 318
           ||||| || || ||||| || || |||||||||||||||||||| || ||||||||||||
Sbjct: 391 ggtctcgacccatcccaaacatctttcttccaggtgcttaacatcccaaccaagattaac 450

                                                                       
Query: 319 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 378
           |||||||| || ||||| | || |||||| ||||| |||||| | ||||||||||| || 
Sbjct: 451 aagggtaccgtcgaaatcatcaccccagttgagcttatcaagcaaggtgacaaggtcggg 510

                                                                       
Query: 379 tcctctgagtctgccctgcttgccaagcttggtatccgccccttctcatatggactggtc 438
           || |||||| |||| || || ||||||||||| ||| | || ||||||||||| || || 
Sbjct: 511 tcttctgaggctgcgcttctagccaagcttggcatcaggccgttctcatatggtcttgtt 570

                                                                      
Query: 439 atctgcaatgtctatgacagtgggtcagtcttcagccccgaggttcttgacctcactga 497
            ||     ||||||||||| ||| |||||||||||||| ||||||||||| || |||||
Sbjct: 571 gtccagtctgtctatgacaatggctcagtcttcagcccagaggttcttgatcttactga 629



to top

>gb|AF370225.1| Arabidopsis thaliana putative 60S acidic ribosomal protein P0
           (At3g09200) mRNA, complete cds
          Length = 1160

 Score =  212 bits (107), Expect = 9e-52
 Identities = 296/359 (82%)
 Strand = Plus / Plus

                                                                       
Query: 139 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 198
           ||||| ||||| |||||||||||||| ||  |||||||||| || |||||||||||||| 
Sbjct: 341 atctttaccaaaggtgacctcaaggaagtgagcgaggaggttgctaagtacaaggttggt 400

                                                                       
Query: 199 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 258
           || ||||||||||| ||  | || || ||  |||||||||| || |  ||||||||||||
Sbjct: 401 gcccctgctcgtgtgggtttggtggctccaattgatgtggttgtccaacctggcaacact 460

                                                                       
Query: 259 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 318
           ||||| || || ||||| || || |||||||||||||||||||| || ||||||||||||
Sbjct: 461 ggtctcgacccatcccaaacatctttcttccaggtgcttaacatcccaaccaagattaac 520

                                                                       
Query: 319 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 378
           |||||||| || ||||| | || |||||| ||||| |||||| | ||||||||||| || 
Sbjct: 521 aagggtaccgtcgaaatcatcaccccagttgagcttatcaagcaaggtgacaaggtcggg 580

                                                                       
Query: 379 tcctctgagtctgccctgcttgccaagcttggtatccgccccttctcatatggactggtc 438
           || |||||| |||| || || ||||||||||| ||| | || ||||||||||| || || 
Sbjct: 581 tcttctgaggctgcgcttctagccaagcttggcatcaggccgttctcatatggtcttgtt 640

                                                                      
Query: 439 atctgcaatgtctatgacagtgggtcagtcttcagccccgaggttcttgacctcactga 497
            ||     ||||||||||| ||| |||||||||||||| ||||||||||| || |||||
Sbjct: 641 gtccagtctgtctatgacaatggctcagtcttcagcccagaggttcttgatcttactga 699



to top

>emb|BX824039.1|CNS0A6RI Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH17ZF06 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1185

 Score =  212 bits (107), Expect = 9e-52
 Identities = 296/359 (82%)
 Strand = Plus / Plus

                                                                       
Query: 139 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 198
           ||||| ||||| |||||||||||||| ||| |||||||||| || |||||||||||||| 
Sbjct: 325 atctttaccaaaggtgacctcaaggaagttagcgaggaggttgctaagtacaaggttggt 384

                                                                       
Query: 199 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 258
           || ||||||||||| ||  | || || ||  |||||||||| || |  ||||||||||||
Sbjct: 385 gcccctgctcgtgtgggtttggtggctccaattgatgtggttgtccaacctggcaacact 444

                                                                       
Query: 259 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 318
           ||||| || || ||||| || || |||||||||||||||||||| || ||||||||||||
Sbjct: 445 ggtctcgacccatcccaaacatctttcttccaggtgcttaacatcccaaccaagattaac 504

                                                                       
Query: 319 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 378
           |||||||| || ||||| | || |||||| ||||| |||||| | ||||||||||| || 
Sbjct: 505 aagggtaccgtcgaaatcatcaccccagttgagcttatcaagcaaggtgacaaggtcggg 564

                                                                       
Query: 379 tcctctgagtctgccctgcttgccaagcttggtatccgccccttctcatatggactggtc 438
           || |||||| |||| || || ||||||||||| ||| | || ||||||||||| || || 
Sbjct: 565 tcttctgaggctgcgcttctagccaagcttggcatcaggccgttctcatatggtcttgtt 624

                                                                      
Query: 439 atctgcaatgtctatgacagtgggtcagtcttcagccccgaggttcttgacctcactga 497
            ||     ||||||||| | ||| |||||||||||||| ||||||||||| || |||||
Sbjct: 625 gtccagtctgtctatgaaaatggctcagtcttcagcccagaggttcttgatcttactga 683



to top

>emb|BX823923.1|CNS0A6KD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS92ZG11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1136

 Score =  212 bits (107), Expect = 9e-52
 Identities = 296/359 (82%)
 Strand = Plus / Plus

                                                                       
Query: 139 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 198
           ||||| ||||| |||||||||||||| ||  |||||||||| || |||||||||||||| 
Sbjct: 308 atctttaccaaaggtgacctcaaggaagtgagcgaggaggttgctaagtacaaggttggt 367

                                                                       
Query: 199 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 258
           || ||||||||||| ||  | || || ||  |||||||||| || |  ||||||||||||
Sbjct: 368 gcccctgctcgtgtgggtttggtggctccaattgatgtggttgtccaacctggcaacact 427

                                                                       
Query: 259 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 318
           ||||| || || ||||| || || |||||||||||||||||||| || ||||||||||||
Sbjct: 428 ggtctcgacccatcccaaacatctttcttccaggtgcttaacatcccaaccaagattaac 487

                                                                       
Query: 319 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 378
           |||||||| || ||||| | || |||||| ||||| |||||| | ||||||||||| || 
Sbjct: 488 aagggtaccgtcgaaatcatcaccccagttgagcttatcaagcaaggtgacaaggtcggg 547

                                                                       
Query: 379 tcctctgagtctgccctgcttgccaagcttggtatccgccccttctcatatggactggtc 438
           || |||||| |||| || || ||||||||||| ||| | || ||||||||||| || || 
Sbjct: 548 tcttctgaggctgcgcttctagccaagcttggcatcaggccgttctcatatggtcttgtt 607

                                                                      
Query: 439 atctgcaatgtctatgacagtgggtcagtcttcagccccgaggttcttgacctcactga 497
            ||     ||||||||||| ||| |||||||||||||| ||||||||||| || |||||
Sbjct: 608 gtccagtctgtctatgacaatggctcagtcttcagcccagaggttcttgatcttactga 666



to top

>gb|L46848.1|SOYARPP Glycine max acidic ribosomal protein P0 mRNA, complete cds
          Length = 1247

 Score =  210 bits (106), Expect = 3e-51
 Identities = 244/290 (84%)
 Strand = Plus / Plus

                                                                       
Query: 142 ttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggcgct 201
           ||||||||||||||||| ||||||||  | |||||||| || |||||||||||||| |||
Sbjct: 404 ttcaccaagggtgacctgaaggaggtcagtgaggaggttgctaagtacaaggttggagct 463

                                                                       
Query: 202 cctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacactggt 261
           ||||||||||||||  | ||||| ||  ||||||| || ||||| ||||||||||| || 
Sbjct: 464 cctgctcgtgttggtttggttgctccaattgatgtcgttgttcctcctggcaacacaggg 523

                                                                       
Query: 262 ctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaacaag 321
           || |||||||| ||||| || ||||||||||||||||||||||| |||||||||||||||
Sbjct: 524 ctcgatccctctcagacctctttcttccaggtgcttaacattcctaccaagattaacaag 583

                                                                       
Query: 322 ggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggctcc 381
           |||||||||||||| |  |  || ||||| || || | |||||| |||||||| || || 
Sbjct: 584 ggtactgtggaaatcattacacctgtggaactcattaggaagggagacaaggttggatct 643

                                                             
Query: 382 tctgagtctgccctgcttgccaagcttggtatccgccccttctcatatgg 431
           |||||  ||||  ||||||||||||| || ||  | ||||||||||||||
Sbjct: 644 tctgaagctgcattgcttgccaagctaggcataaggcccttctcatatgg 693



to top

>gb|AY086582.1| Arabidopsis thaliana clone 2595 mRNA, complete sequence
          Length = 1199

 Score =  204 bits (103), Expect = 2e-49
 Identities = 295/359 (82%)
 Strand = Plus / Plus

                                                                       
Query: 139 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 198
           ||||| ||||| |||||||||||||| ||  |||||||||| || ||||||||||| || 
Sbjct: 339 atctttaccaaaggtgacctcaaggaagtgagcgaggaggttgctaagtacaaggtcggt 398

                                                                       
Query: 199 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 258
           || ||||||||||| ||  | || || ||  |||||||||| || |  ||||||||||||
Sbjct: 399 gcccctgctcgtgtgggtttggtggctccaattgatgtggttgtccaacctggcaacact 458

                                                                       
Query: 259 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 318
           ||||| || || ||||| || || |||||||||||||||||||| || ||||||||||||
Sbjct: 459 ggtctcgacccatcccaaacatctttcttccaggtgcttaacatcccaaccaagattaac 518

                                                                       
Query: 319 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 378
           |||||||| || ||||| | || |||||| ||||| |||||| | ||||||||||| || 
Sbjct: 519 aagggtaccgtcgaaatcatcaccccagttgagcttatcaagcaaggtgacaaggtcggg 578

                                                                       
Query: 379 tcctctgagtctgccctgcttgccaagcttggtatccgccccttctcatatggactggtc 438
           || |||||| |||| || || ||||||||||| ||| | || ||||||||||| || || 
Sbjct: 579 tcttctgaggctgcgcttctagccaagcttggcatcaggccgttctcatatggtcttgtt 638

                                                                      
Query: 439 atctgcaatgtctatgacagtgggtcagtcttcagccccgaggttcttgacctcactga 497
            ||     ||||||||||| ||| |||||||||||||| ||||||||||| || |||||
Sbjct: 639 gtccagtctgtctatgacaatggctcagtcttcagcccagaggttcttgatcttactga 697



to top

>gb|AF227622.1|AF227622 Euphorbia esula 60S acidic ribosomal protein PO mRNA, partial cds
          Length = 1127

 Score =  198 bits (100), Expect = 1e-47
 Identities = 220/260 (84%)
 Strand = Plus / Plus

                                                                       
Query: 139 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 198
           ||||||||||||||||| |||||||| ||  | || ||||| ||||||||||||||||| 
Sbjct: 265 atcttcaccaagggtgatctcaaggaagtcagtgaagaggttgccaagtacaaggttgga 324

                                                                       
Query: 199 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 258
           || ||||||||||||||  | ||||| ||  |||||||||| || || ||||||||||| 
Sbjct: 325 gcccctgctcgtgttggtttggttgctccaattgatgtggttgtcccacctggcaacaca 384

                                                                       
Query: 259 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 318
           || || || || |||||||| || ||||||||||| ||||||||||| ||||||||||||
Sbjct: 385 gggctcgacccttcccagacctctttcttccaggtccttaacattcctaccaagattaac 444

                                                                       
Query: 319 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 378
           ||||| || || ||||| | || ||| ||||| || ||||||||||| ||||||||||||
Sbjct: 445 aagggaacagtcgaaatcatcacccctgtggaactaatcaagaagggagacaaggtgggc 504

                               
Query: 379 tcctctgagtctgccctgct 398
           ||||| ||| ||||| ||||
Sbjct: 505 tcctccgaggctgccttgct 524



to top

>emb|X93587.1|LLP0 L.luteus mRNA for P0 ribosomal protein
          Length = 1393

 Score =  186 bits (94), Expect = 5e-44
 Identities = 232/278 (83%)
 Strand = Plus / Plus

                                                                       
Query: 160 aaggaggttcgcgaggaggtcgccaagtacaaggttggcgctcctgctcgtgttgggcta 219
           ||||||||| ||||||| || || ||||||||||| || ||||||||  |||||||  | 
Sbjct: 451 aaggaggttagcgaggaagttgctaagtacaaggtcggagctcctgcctgtgttggtttg 510

                                                                       
Query: 220 gttgcacctgttgatgtggtggttccccctggcaacactggtctggatccctcccagacg 279
           ||||| ||  ||||||| || || || || ||||||||||| || ||||| || ||||| 
Sbjct: 511 gttgctccaattgatgttgttgtccctccaggcaacactgggctcgatccatctcagacc 570

                                                                       
Query: 280 tccttcttccaggtgcttaacattcccaccaagattaacaagggtactgtggaaattacc 339
           || |||||||||||||| |||||||||||||||||||||||||||||||| ||||||| |
Sbjct: 571 tctttcttccaggtgctcaacattcccaccaagattaacaagggtactgttgaaattatc 630

                                                                       
Query: 340 atcccagtggagctgatcaagaagggtgacaaggtgggctcctctgagtctgccctgctt 399
           |  || |||||||| || |||||||| |||||||| ||||| |||||  ||||  |||||
Sbjct: 631 acacccgtggagctcattaagaagggagacaaggttggctcttctgaagctgcattgctt 690

                                                 
Query: 400 gccaagcttggtatccgccccttctcatatggactggt 437
           ||||||||||| ||  | || ||||||||||| |||||
Sbjct: 691 gccaagcttggcataaggccattctcatatggtctggt 728



to top

>dbj|AB236824.1| Trifolium pratense RNA for putative 60S acidic ribosomal protein
           P0, complete cds, clone: C2319
          Length = 1345

 Score =  176 bits (89), Expect = 5e-41
 Identities = 197/233 (84%)
 Strand = Plus / Plus

                                                                       
Query: 142 ttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggcgct 201
           ||||||||||||||| | ||||| ||| | |||||||| || |||||||||||||| |||
Sbjct: 433 ttcaccaagggtgacttgaaggaagttagtgaggaggttgctaagtacaaggttggagct 492

                                                                       
Query: 202 cctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacactggt 261
           ||||||||||||||  | ||||| ||  ||||||| || || || ||||| ||||| || 
Sbjct: 493 cctgctcgtgttggtttggttgctccaattgatgttgttgtgcctcctggtaacacaggg 552

                                                                       
Query: 262 ctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaacaag 321
           || || || |||||||| || |||||||||||||||||||| ||||||||||||||||||
Sbjct: 553 ctcgacccatcccagacctctttcttccaggtgcttaacatccccaccaagattaacaag 612

                                                                
Query: 322 ggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggt 374
           |||||||||||||| |  | ||| || || || ||||||||||| ||||||||
Sbjct: 613 ggtactgtggaaatcattacccctgttgaactcatcaagaagggagacaaggt 665



to top

>dbj|AB236811.1| Trifolium pratense RNA for putative 60S acidic ribosomal protein
           P0, complete cds, clone: C212
          Length = 1326

 Score =  176 bits (89), Expect = 5e-41
 Identities = 197/233 (84%)
 Strand = Plus / Plus

                                                                       
Query: 142 ttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggcgct 201
           ||||||||||||||| | ||||| ||| | |||||||| || |||||||||||||| |||
Sbjct: 440 ttcaccaagggtgacttgaaggaagttagtgaggaggttgctaagtacaaggttggagct 499

                                                                       
Query: 202 cctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacactggt 261
           ||||||||||||||  | ||||| ||  ||||||| || || || ||||| ||||| || 
Sbjct: 500 cctgctcgtgttggtttggttgctccaattgatgttgttgtgcctcctggtaacacaggg 559

                                                                       
Query: 262 ctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaacaag 321
           || || || |||||||| || |||||||||||||||||||| ||||||||||||||||||
Sbjct: 560 ctcgacccatcccagacctctttcttccaggtgcttaacatccccaccaagattaacaag 619

                                                                
Query: 322 ggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggt 374
           |||||||||||||| |  | ||| || || || ||||||||||| ||||||||
Sbjct: 620 ggtactgtggaaatcattacccctgttgaactcatcaagaagggagacaaggt 672



to top

>emb|X15206.1|CRCRE2 C.rubrum mRNA for light-induced 34kD protein
          Length = 1332

 Score =  170 bits (86), Expect = 3e-39
 Identities = 209/250 (83%)
 Strand = Plus / Plus

                                                                       
Query: 182 ccaagtacaaggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtgg 241
           |||||||||||||||| |||||||||||| ||||  | ||||||||  ||||||| || |
Sbjct: 556 ccaagtacaaggttggagctcctgctcgttttggtttggttgcaccaattgatgttgttg 615

                                                                       
Query: 242 ttccccctggcaacactggtctggatccctcccagacgtccttcttccaggtgcttaaca 301
           | || || |||||||||||||| || ||||||||||| || ||||||||||| |||||||
Sbjct: 616 tcccaccaggcaacactggtcttgacccctcccagacatctttcttccaggttcttaaca 675

                                                                       
Query: 302 ttcccaccaagattaacaagggtactgtggaaattaccatcccagtggagctgatcaaga 361
           | ||||| |||||||||||||||||||| ||||||| ||   | || ||||| |||||||
Sbjct: 676 tccccactaagattaacaagggtactgtcgaaattatcactgctgtagagctcatcaaga 735

                                                                       
Query: 362 agggtgacaaggtgggctcctctgagtctgccctgcttgccaagcttggtatccgcccct 421
           |||| || |||||||| || |||||| | || || ||||| |||||||| ||  | || |
Sbjct: 736 agggcgaaaaggtgggttcttctgaggcagctctacttgcaaagcttggaattaggcctt 795

                     
Query: 422 tctcatatgg 431
           ||||||||||
Sbjct: 796 tctcatatgg 805



to top

>ref|NM_129559.2| Arabidopsis thaliana structural constituent of ribosome AT2G40010
           mRNA, complete cds
          Length = 1153

 Score =  137 bits (69), Expect = 4e-29
 Identities = 237/293 (80%)
 Strand = Plus / Plus

                                                                       
Query: 139 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 198
           |||||||| ||||||||| | ||||| ||  | || ||||| || |||||||||||||| 
Sbjct: 274 atcttcactaagggtgacttgaaggaagtcagtgaagaggttgctaagtacaaggttgga 333

                                                                       
Query: 199 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 258
           |||||||||||||| ||  |||| || ||  |||||||||| || |  || |||||||||
Sbjct: 334 gctcctgctcgtgtaggtttagtcgctccaattgatgtggtcgtgcaaccaggcaacact 393

                                                                       
Query: 259 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 318
           ||||| || || || ||||| |||||||||||||||||||||||||| ||||| || |||
Sbjct: 394 ggtcttgacccttcacagacctccttcttccaggtgcttaacattccaaccaaaatcaac 453

                                                                       
Query: 319 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 378
           || ||||| || || || |  | ||| |||||||| |||||||| || ||||| || || 
Sbjct: 454 aaaggtacggttgagatcataacccctgtggagctcatcaagaaaggcgacaaagtcggt 513

                                                                
Query: 379 tcctctgagtctgccctgcttgccaagcttggtatccgccccttctcatatgg 431
           || || ||| |||| || |||||||||||||| ||| | ||||| || |||||
Sbjct: 514 tcatccgaggctgcgcttcttgccaagcttggaatcaggcccttttcgtatgg 566



to top

>gb|AY070448.1| Arabidopsis thaliana At2g40010 mRNA sequence
          Length = 1373

 Score =  137 bits (69), Expect = 4e-29
 Identities = 237/293 (80%)
 Strand = Plus / Plus

                                                                       
Query: 139 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 198
           |||||||| ||||||||| | ||||| ||  | || ||||| || |||||||||||||| 
Sbjct: 478 atcttcactaagggtgacttgaaggaagtcagtgaagaggttgctaagtacaaggttgga 537

                                                                       
Query: 199 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 258
           |||||||||||||| ||  |||| || ||  |||||||||| || |  || |||||||||
Sbjct: 538 gctcctgctcgtgtaggtttagtcgctccaattgatgtggtcgtgcaaccaggcaacact 597

                                                                       
Query: 259 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 318
           ||||| || || || ||||| |||||||||||||||||||||||||| ||||| || |||
Sbjct: 598 ggtcttgacccttcacagacctccttcttccaggtgcttaacattccaaccaaaatcaac 657

                                                                       
Query: 319 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 378
           || ||||| || || || |  | ||| |||||||| |||||||| || ||||| || || 
Sbjct: 658 aaaggtacggttgagatcataacccctgtggagctcatcaagaaaggcgacaaagtcggt 717

                                                                
Query: 379 tcctctgagtctgccctgcttgccaagcttggtatccgccccttctcatatgg 431
           || || ||| |||| || |||||||||||||| ||| | ||||| || |||||
Sbjct: 718 tcatccgaggctgcgcttcttgccaagcttggaatcaggcccttttcgtatgg 770



to top

>emb|BX819391.1|CNS0A9W8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB74ZC11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 961

 Score =  137 bits (69), Expect = 4e-29
 Identities = 237/293 (80%)
 Strand = Plus / Plus

                                                                       
Query: 139 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 198
           |||||||| ||||||||| | ||||| ||  | || ||||| || |||||||||||||| 
Sbjct: 130 atcttcactaagggtgacttgaaggaagtcagtgaagaggttgctaagtacaaggttgga 189

                                                                       
Query: 199 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 258
           |||||||||||||| ||  |||| || ||  |||||||||| || |  || |||||||||
Sbjct: 190 gctcctgctcgtgtaggtttagtcgctccaattgatgtggtcgtgcaaccaggcaacact 249

                                                                       
Query: 259 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 318
           ||||| || || || ||||| |||||||||||||||||||||||||| ||||| || |||
Sbjct: 250 ggtcttgacccttcacagacctccttcttccaggtgcttaacattccaaccaaaatcaac 309

                                                                       
Query: 319 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 378
           || ||||| || || || |  | ||| |||||||| |||||||| || ||||| || || 
Sbjct: 310 aaaggtacggttgagatcataacccctgtggagctcatcaagaaaggcgacaaagtcggt 369

                                                                
Query: 379 tcctctgagtctgccctgcttgccaagcttggtatccgccccttctcatatgg 431
           || || ||| |||| || |||||||||||||| ||| | ||||| || |||||
Sbjct: 370 tcatccgaggctgcgcttcttgccaagcttggaatcaggcccttttcgtatgg 422



to top

>gb|BT001919.1| Arabidopsis thaliana clone C105444 putative 60S acidic ribosomal
           protein P0 (At2g40010) mRNA, complete cds
          Length = 985

 Score =  137 bits (69), Expect = 4e-29
 Identities = 237/293 (80%)
 Strand = Plus / Plus

                                                                       
Query: 139 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 198
           |||||||| ||||||||| | ||||| ||  | || ||||| || |||||||||||||| 
Sbjct: 274 atcttcactaagggtgacttgaaggaagtcagtgaagaggttgctaagtacaaggttgga 333

                                                                       
Query: 199 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 258
           |||||||||||||| ||  |||| || ||  |||||||||| || |  || |||||||||
Sbjct: 334 gctcctgctcgtgtaggtttagtcgctccaattgatgtggtcgtgcaaccaggcaacact 393

                                                                       
Query: 259 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 318
           ||||| || || || ||||| |||||||||||||||||||||||||| ||||| || |||
Sbjct: 394 ggtcttgacccttcacagacctccttcttccaggtgcttaacattccaaccaaaatcaac 453

                                                                       
Query: 319 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 378
           || ||||| || || || |  | ||| |||||||| |||||||| || ||||| || || 
Sbjct: 454 aaaggtacggttgagatcataacccctgtggagctcatcaagaaaggcgacaaagtcggt 513

                                                                
Query: 379 tcctctgagtctgccctgcttgccaagcttggtatccgccccttctcatatgg 431
           || || ||| |||| || |||||||||||||| ||| | ||||| || |||||
Sbjct: 514 tcatccgaggctgcgcttcttgccaagcttggaatcaggcccttttcgtatgg 566



to top

>gb|AC011436.7|ATAC011436 Arabidopsis thaliana chromosome III BAC F3L24 genomic sequence,
             complete sequence
          Length = 106688

 Score =  127 bits (64), Expect = 4e-26
 Identities = 172/208 (82%)
 Strand = Plus / Minus

                                                                         
Query: 290   aggtgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcccagtgg 349
             ||||||||||||| || |||||||||||||||||||| || ||||| | || |||||| |
Sbjct: 20578 aggtgcttaacatcccaaccaagattaacaagggtaccgtcgaaatcatcaccccagttg 20519

                                                                         
Query: 350   agctgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgccaagcttg 409
             |||| |||||| | ||||||||||| || || |||||| |||| || || ||||||||||
Sbjct: 20518 agcttatcaagcaaggtgacaaggtcgggtcttctgaggctgcgcttctagccaagcttg 20459

                                                                         
Query: 410   gtatccgccccttctcatatggactggtcatctgcaatgtctatgacagtgggtcagtct 469
             | ||| | || ||||||||||| || ||  ||     ||||||||||| ||| |||||||
Sbjct: 20458 gcatcaggccgttctcatatggtcttgttgtccagtctgtctatgacaatggctcagtct 20399

                                         
Query: 470   tcagccccgaggttcttgacctcactga 497
             ||||||| ||||||||||| || |||||
Sbjct: 20398 tcagcccagaggttcttgatcttactga 20371



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                      
Query: 139   atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggtt 195
             ||||| ||||| |||||||||||||| ||  |||||||||| || ||||||||||||
Sbjct: 21237 atctttaccaaaggtgacctcaaggaagtgagcgaggaggttgctaagtacaaggtt 21181



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 54/64 (84%)
 Strand = Plus / Minus

                                                                         
Query: 230   ttgatgtggtggttccccctggcaacactggtctggatccctcccagacgtccttcttcc 289
             |||||||||| || |  ||||||||||||||||| || || ||||| || || |||||||
Sbjct: 20730 ttgatgtggttgtccaacctggcaacactggtctcgacccatcccaaacatctttcttcc 20671

                 
Query: 290   aggt 293
             ||||
Sbjct: 20670 aggt 20667



to top

>gb|AC009326.8|ATAC009326 Arabidopsis thaliana chromosome III P1 MZB10 genomic sequence, complete
             sequence
          Length = 85561

 Score =  127 bits (64), Expect = 4e-26
 Identities = 172/208 (82%)
 Strand = Plus / Minus

                                                                         
Query: 290   aggtgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcccagtgg 349
             ||||||||||||| || |||||||||||||||||||| || ||||| | || |||||| |
Sbjct: 84901 aggtgcttaacatcccaaccaagattaacaagggtaccgtcgaaatcatcaccccagttg 84842

                                                                         
Query: 350   agctgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgccaagcttg 409
             |||| |||||| | ||||||||||| || || |||||| |||| || || ||||||||||
Sbjct: 84841 agcttatcaagcaaggtgacaaggtcgggtcttctgaggctgcgcttctagccaagcttg 84782

                                                                         
Query: 410   gtatccgccccttctcatatggactggtcatctgcaatgtctatgacagtgggtcagtct 469
             | ||| | || ||||||||||| || ||  ||     ||||||||||| ||| |||||||
Sbjct: 84781 gcatcaggccgttctcatatggtcttgttgtccagtctgtctatgacaatggctcagtct 84722

                                         
Query: 470   tcagccccgaggttcttgacctcactga 497
             ||||||| ||||||||||| || |||||
Sbjct: 84721 tcagcccagaggttcttgatcttactga 84694



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                      
Query: 139   atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggtt 195
             ||||| ||||| |||||||||||||| ||  |||||||||| || ||||||||||||
Sbjct: 85560 atctttaccaaaggtgacctcaaggaagtgagcgaggaggttgctaagtacaaggtt 85504



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 54/64 (84%)
 Strand = Plus / Minus

                                                                         
Query: 230   ttgatgtggtggttccccctggcaacactggtctggatccctcccagacgtccttcttcc 289
             |||||||||| || |  ||||||||||||||||| || || ||||| || || |||||||
Sbjct: 85053 ttgatgtggttgtccaacctggcaacactggtctcgacccatcccaaacatctttcttcc 84994

                 
Query: 290   aggt 293
             ||||
Sbjct: 84993 aggt 84990



to top

>gb|AC073395.6|AC073395 Arabidopsis thaliana chromosome 3 BAC F11B9 genomic sequence, complete
             sequence
          Length = 103517

 Score =  121 bits (61), Expect = 2e-24
 Identities = 106/121 (87%)
 Strand = Plus / Plus

                                                                         
Query: 290   aggtgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcccagtgg 349
             ||||||||||||||||||| |||||||||||||||||||| ||||||| || ||| ||||
Sbjct: 59343 aggtgcttaacattcccactaagattaacaagggtactgttgaaattatcacccctgtgg 59402

                                                                         
Query: 350   agctgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgccaagcttg 409
             |||| |||||| | ||||||||||| || || |||||| ||||||| || || |||||||
Sbjct: 59403 agcttatcaagcaaggtgacaaggttgggtcttctgaggctgcccttctagctaagcttg 59462

              
Query: 410   g 410
             |
Sbjct: 59463 g 59463



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 87/103 (84%)
 Strand = Plus / Plus

                                                                         
Query: 191   aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 250
             ||||||| |||||||||||||| ||  ||||||| ||| |||||||||| ||||  ||||
Sbjct: 59147 aggttggtgctcctgctcgtgtgggtttagttgctcctattgatgtggttgttcaacctg 59206

                                                        
Query: 251   gcaacactggtctggatccctcccagacgtccttcttccaggt 293
             ||||||||||||| || || || || || || |||||||||||
Sbjct: 59207 gcaacactggtcttgacccatctcaaacatcgttcttccaggt 59249



to top

>gb|AF002109.3| Arabidopsis thaliana chromosome 2 clone T28M21 map CIC10A06, complete
             sequence
          Length = 108847

 Score =  113 bits (57), Expect = 6e-22
 Identities = 195/241 (80%)
 Strand = Plus / Minus

                                                                         
Query: 191   aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 250
             ||||||| |||||||||||||| ||  |||| || ||  |||||||||| || |  || |
Sbjct: 77949 aggttggagctcctgctcgtgtaggtttagtcgctccaattgatgtggtcgtgcaaccag 77890

                                                                         
Query: 251   gcaacactggtctggatccctcccagacgtccttcttccaggtgcttaacattcccacca 310
             ||||||||||||| || || || ||||| |||||||||||||||||||||||||| ||||
Sbjct: 77889 gcaacactggtcttgacccttcacagacctccttcttccaggtgcttaacattccaacca 77830

                                                                         
Query: 311   agattaacaagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgaca 370
             | || ||||| ||||| || || || |  | ||| |||||||| |||||||| || ||||
Sbjct: 77829 aaatcaacaaaggtacggttgagatcataacccctgtggagctcatcaagaaaggcgaca 77770

                                                                         
Query: 371   aggtgggctcctctgagtctgccctgcttgccaagcttggtatccgccccttctcatatg 430
             | || || || || ||| |||| || |||||||||||||| ||| | ||||| || ||||
Sbjct: 77769 aagtcggttcatccgaggctgcgcttcttgccaagcttggaatcaggcccttttcgtatg 77710

              
Query: 431   g 431
             |
Sbjct: 77709 g 77709



to top

>gb|AC130799.19| Medicago truncatula clone mth2-34b13, complete sequence
          Length = 133305

 Score =  109 bits (55), Expect = 9e-21
 Identities = 172/211 (81%)
 Strand = Plus / Minus

                                                                          
Query: 290    aggtgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcccagtgg 349
              ||||||| ||||| || ||||||||||||||||||||||||||||| |  | ||||||||
Sbjct: 104236 aggtgctcaacatcccaaccaagattaacaagggtactgtggaaatcattaccccagtgg 104177

                                                                          
Query: 350    agctgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgccaagcttg 409
              | ||||| ||||| || |||||||| || || |||||  ||||  ||||||||||| | |
Sbjct: 104176 aactgattaagaaaggagacaaggttggatcttctgaagctgcattgcttgccaagttag 104117

                                                                          
Query: 410    gtatccgccccttctcatatggactggtcatctgcaatgtctatgacagtgggtcagtct 469
              ||||  | ||||| |||||||| || ||  ||     ||| ||||||| ||| ||||| |
Sbjct: 104116 gtattaggcccttttcatatgggcttgtggtcctttctgtttatgacaatggttcagtgt 104057

                                             
Query: 470    tcagccccgaggttcttgacctcactgagga 500
              | ||||| |||||||||||||||||||||||
Sbjct: 104056 ttagccctgaggttcttgacctcactgagga 104026



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 83/103 (80%)
 Strand = Plus / Minus

                                                                          
Query: 191    aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 250
              ||||||| |||||||| ||||||||  | ||||| ||  ||||||| || ||||| || |
Sbjct: 104410 aggttggagctcctgcccgtgttggtttggttgctccaattgatgtcgttgttcctccag 104351

                                                         
Query: 251    gcaacactggtctggatccctcccagacgtccttcttccaggt 293
              ||||||| || || || || || ||||| || |||||||||||
Sbjct: 104350 gcaacacagggctcgacccatctcagacctctttcttccaggt 104308



to top

>emb|BX816288.1|CNS0AE9F Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTPGH39ZH02 of Hormone Treated Callus of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1296

 Score =  103 bits (52), Expect = 6e-19
 Identities = 178/220 (80%)
 Strand = Plus / Minus

                                                                        
Query: 191  aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 250
            ||||||| |||||||||||||| ||  |||| || ||  |||||||||| || |  || |
Sbjct: 1148 aggttggagctcctgctcgtgtaggtttagtcgctccaattgatgtggtcgtgcaaccag 1089

                                                                        
Query: 251  gcaacactggtctggatccctcccagacgtccttcttccaggtgcttaacattcccacca 310
            ||||||||||||| || || || ||||| |||||||||||||||||||||||||| ||||
Sbjct: 1088 gcaacactggtcttgacccttcacagacctccttcttccaggtgcttaacattccaacca 1029

                                                                        
Query: 311  agattaacaagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgaca 370
            | || ||||| ||||| || || || |  | ||| || ||||| |||||||| || ||||
Sbjct: 1028 aaatcaacaaaggtacggttgagatcataacccctgtagagctcatcaagaaaggcgaca 969

                                                    
Query: 371  aggtgggctcctctgagtctgccctgcttgccaagcttgg 410
            | || || || || ||| |||| || ||||||||||||||
Sbjct: 968  aagtcggttcatccgaggctgcgcttcttgccaagcttgg 929



to top

>gb|CP000079.1| Leishmania major strain Friedlin chromosome 27, complete sequence
          Length = 1130447

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                    
Query: 272    cccagacgtccttcttccaggtgcttaacattcccaccaagattaacaagggta 325
              ||||||||||||||||||||| ||| |||||| | || ||||||  ||||||||
Sbjct: 580972 cccagacgtccttcttccaggcgctgaacattgcgacgaagattgccaagggta 581025



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                    
Query: 272    cccagacgtccttcttccaggtgcttaacattcccaccaagattaacaagggta 325
              ||||||||||||||||||||| ||| |||||| | || ||||||  ||||||||
Sbjct: 578573 cccagacgtccttcttccaggcgctgaacattgcgacgaagattgccaagggta 578626



to top

>gb|AY702006.1| Leishmania donovani strain MHOM/IN/1983/AG83 60S ribosomal protein
           mRNA, partial cds
          Length = 1147

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 272 cccagacgtccttcttccaggtgcttaacattcccaccaagattaacaagggta 325
           ||||||||||||||||||||| ||| |||||| | || ||||||  ||||||||
Sbjct: 397 cccagacgtccttcttccaggcgctgaacattgcgacgaagattgccaagggta 450



to top

>ref|XM_843003.1| Leishmania major strain Friedlin 60S acidic ribosomal subunit
           protein (LMJ_0399) partial mRNA
          Length = 972

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 272 cccagacgtccttcttccaggtgcttaacattcccaccaagattaacaagggta 325
           ||||||||||||||||||||| ||| |||||| | || ||||||  ||||||||
Sbjct: 419 cccagacgtccttcttccaggcgctgaacattgcgacgaagattgccaagggta 472



to top

>ref|XM_843004.1| Leishmania major strain Friedlin 60S acidic ribosomal subunit
           protein (LMJ_0400) partial mRNA
          Length = 972

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 272 cccagacgtccttcttccaggtgcttaacattcccaccaagattaacaagggta 325
           ||||||||||||||||||||| ||| |||||| | || ||||||  ||||||||
Sbjct: 419 cccagacgtccttcttccaggcgctgaacattgcgacgaagattgccaagggta 472



to top

>emb|X72714.1|LILIPOA L. infantum LiPO-A and LiPO-B gene
          Length = 3790

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                  
Query: 272  cccagacgtccttcttccaggtgcttaacattcccaccaagattaacaagggta 325
            ||||||||||||||||||||| ||| |||||| | || ||||||  ||||||||
Sbjct: 3032 cccagacgtccttcttccaggcgctgaacattgcgacgaagattgccaagggta 3085



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 272 cccagacgtccttcttccaggtgcttaacattcccaccaagattaacaagggta 325
           ||||||||||||||||||||| ||| |||||| | || ||||||  ||||||||
Sbjct: 663 cccagacgtccttcttccaggcgctgaacattgcgacgaagattgccaagggta 716



to top

>gb|AY180912.1| Leishmania donovani ribosomal protein P0-like mRNA, complete
           sequence
          Length = 1664

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 272 cccagacgtccttcttccaggtgcttaacattcccaccaagattaacaagggta 325
           ||||||||||||||||||||| ||| |||||| | || ||||||  ||||||||
Sbjct: 452 cccagacgtccttcttccaggcgctgaacattgcgacgaagattgccaagggta 505



to top

>gb|L29300.1|LEIRIBPP Leishmania chagasi (clone C1) ribosomal protein P0 gene, complete
           cds
          Length = 1373

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 272 cccagacgtccttcttccaggtgcttaacattcccaccaagattaacaagggta 325
           ||||||||||||||||||||| ||| |||||| | || ||||||  ||||||||
Sbjct: 496 cccagacgtccttcttccaggcgctgaacattgcgacgaagattgccaagggta 549



to top

>emb|AJ783861.1| Carabus granulatus partial mRNA for acidic p0 ribosomal protein
           (rpp0 gene)
          Length = 608

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 22  atcgtgctcatgggcaagaacaccctgat 50
           |||||||||||||||||||||||| ||||
Sbjct: 154 atcgtgctcatgggcaagaacaccatgat 182



to top

>gb|AF401551.1| Ictalurus punctatus ribosomal protein P0 mRNA, complete cds
          Length = 1081

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 22  atcgtgctcatgggcaagaacaccctgat 50
           |||||||||||||||||||||||| ||||
Sbjct: 227 atcgtgctcatgggcaagaacaccatgat 255



to top

>ref|XM_787003.1| PREDICTED: Strongylocentrotus purpuratus similar to acidic
           ribosomal phosphoprotein P0 (LOC587264), mRNA
          Length = 533

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 23  tcgtgctcatgggcaagaacaccctgatccgc 54
           |||| |||||||||||||||||| ||||||||
Sbjct: 196 tcgtcctcatgggcaagaacaccatgatccgc 227



to top

>emb|BX032675.1|CNS08XDJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA48CH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 960

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 7   ctccgcggtgactccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||  | |||||||||| ||||||||||||||| ||||
Sbjct: 208 ctccgcggttccgccatcgtgctgatgggcaagaacaccatgat 251



to top

>emb|BX019003.1|CNS08MTR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA28DD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 20  ccatcgtgctcatgggcaagaacaccctgatccgcc 55
           |||||||||| ||||||||||||||| |||| ||||
Sbjct: 236 ccatcgtgctgatgggcaagaacaccatgatgcgcc 271



to top

>emb|BX018793.1|CNS08MNX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA28CB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 941

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 7   ctccgcggtgactccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||  | |||||||||| ||||||||||||||| ||||
Sbjct: 208 ctccgcggttccgccatcgtgctgatgggcaagaacaccatgat 251



to top

>emb|BX013777.1|CNS08ISL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA20CH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 598

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 7   ctccgcggtgactccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||  | |||||||||| ||||||||||||||| ||||
Sbjct: 211 ctccgcggttccgccatcgtgctgatgggcaagaacaccatgat 254



to top

>emb|BX006032.1|CNS08CTG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA10BB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 909

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 7   ctccgcggtgactccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||  | |||||||||| ||||||||||||||| ||||
Sbjct: 200 ctccgcggttccgccatcgtgctgatgggcaagaacaccatgat 243



to top

>emb|BX005998.1|CNS08CSI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA10AH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 994

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 7   ctccgcggtgactccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||  | |||||||||| ||||||||||||||| ||||
Sbjct: 214 ctccgcggttccgccatcgtgctgatgggcaagaacaccatgat 257



to top

>ref|XM_789716.1| PREDICTED: Strongylocentrotus purpuratus similar to acidic
           ribosomal phosphoprotein P0 (LOC590099), mRNA
          Length = 198

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 23  tcgtgctcatgggcaagaacaccctgatccgc 54
           |||| |||||||||||||||||| ||||||||
Sbjct: 119 tcgtcctcatgggcaagaacaccatgatccgc 150



to top

>ref|XM_655246.1| Aspergillus nidulans FGSC A4 60S acidic ribosomal protein P0
           (AN2734.2), mRNA
          Length = 939

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 127 aacgttggcctcatcttcaccaagggtgacctcaaggag 165
           ||||||||  ||||||||||||| || ||||||||||||
Sbjct: 247 aacgttggtttcatcttcaccaacggcgacctcaaggag 285



to top

>emb|BX053469.1|CNS09DF5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 999

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 229 ccatcgtgctgatgggcaagaacaccatgat 259



to top

>emb|BX072148.1|CNS09RU0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 812

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 174 ccatcgtgctgatgggcaagaacaccatgat 204



to top

>emb|BX072146.1|CNS09RTY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 236 ccatcgtgctgatgggcaagaacaccatgat 266



to top

>emb|BX072055.1|CNS09RRF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 228 ccatcgtgctgatgggcaagaacaccatgat 258



to top

>emb|BX072031.1|CNS09RQR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 784

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 211 ccatcgtgctgatgggcaagaacaccatgat 241



to top

>emb|BX071993.1|CNS09RPP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 959

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 246 ccatcgtgctgatgggcaagaacaccatgat 276



to top

>emb|BX071847.1|CNS09RLN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9CB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1068

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 233 ccatcgtgctgatgggcaagaacaccatgat 263



to top

>emb|BX071747.1|CNS09RIV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9BF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 950

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 229 ccatcgtgctgatgggcaagaacaccatgat 259



to top

>emb|BX071518.1|CNS09RCI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9AD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 290

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 91  ccatcgtgctgatgggcaagaacaccatgat 121



to top

>emb|BX071226.1|CNS09R4E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8CF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 899

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 224 ccatcgtgctgatgggcaagaacaccatgat 254



to top

>emb|BX071175.1|CNS09R2Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8CD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 955

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 211 ccatcgtgctgatgggcaagaacaccatgat 241



to top

>emb|BX071445.1|CNS09RAH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9AA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1033

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 237 ccatcgtgctgatgggcaagaacaccatgat 267



to top

>emb|BX071386.1|CNS09R8U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8DF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 809

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 206 ccatcgtgctgatgggcaagaacaccatgat 236



to top

>emb|BX071318.1|CNS09R6Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8DC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 864

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 224 ccatcgtgctgatgggcaagaacaccatgat 254



to top

>emb|BX071251.1|CNS09R53 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8CH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 515

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX071039.1|CNS09QZ7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 221 ccatcgtgctgatgggcaagaacaccatgat 251



to top

>emb|BX070973.1|CNS09QXD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 960

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 235 ccatcgtgctgatgggcaagaacaccatgat 265



to top

>emb|BX070930.1|CNS09QW6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1029

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 228 ccatcgtgctgatgggcaagaacaccatgat 258



to top

>emb|BX070900.1|CNS09QVC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8AH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1014

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 233 ccatcgtgctgatgggcaagaacaccatgat 263



to top

>emb|BX070894.1|CNS09QV6 Single read from an extremity of a full-length cDNA clone made
          from Anopheles gambiae total adult females. 5-PRIME end
          of clone FK0AAC8AH07 of strain 6-9 of Anopheles gambiae
          (African malaria mosquito)
          Length = 538

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                         
Query: 20 ccatcgtgctcatgggcaagaacaccctgat 50
          |||||||||| ||||||||||||||| ||||
Sbjct: 55 ccatcgtgctgatgggcaagaacaccatgat 85



to top

>emb|BX070751.1|CNS09QR7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8AA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 980

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 225 ccatcgtgctgatgggcaagaacaccatgat 255



to top

>emb|BX070745.1|CNS09QR1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 837

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 102 ccatcgtgctgatgggcaagaacaccatgat 132



to top

>emb|BX070622.1|CNS09QNM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7DB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 966

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 223 ccatcgtgctgatgggcaagaacaccatgat 253



to top

>emb|BX070589.1|CNS09QMP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7DA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 215 ccatcgtgctgatgggcaagaacaccatgat 245



to top

>emb|BX070541.1|CNS09QLD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7CG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 898

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 228 ccatcgtgctgatgggcaagaacaccatgat 258



to top

>emb|BX070099.1|CNS09Q93 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7AB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 230 ccatcgtgctgatgggcaagaacaccatgat 260



to top

>emb|BX069823.1|CNS09Q1F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6CE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 916

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 230 ccatcgtgctgatgggcaagaacaccatgat 260



to top

>emb|BX069791.1|CNS09Q0J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6CD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 775

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257



to top

>emb|BX061098.1|CNS09JB2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41DA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 951

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 220 ccatcgtgctgatgggcaagaacaccatgat 250



to top

>emb|BX061090.1|CNS09JAU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41CH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 230 ccatcgtgctgatgggcaagaacaccatgat 260



to top

>emb|BX061061.1|CNS09JA1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41CG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1063

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 247 ccatcgtgctgatgggcaagaacaccatgat 277



to top

>emb|BX061042.1|CNS09J9I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41CF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 377

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 228 ccatcgtgctgatgggcaagaacaccatgat 258



to top

>emb|BX069588.1|CNS09PUW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6BC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 834

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257



to top

>emb|BX069403.1|CNS09PPR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6AC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 224 ccatcgtgctgatgggcaagaacaccatgat 254



to top

>emb|BX069336.1|CNS09PNW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53DH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 219 ccatcgtgctgatgggcaagaacaccatgat 249



to top

>emb|BX069235.1|CNS09PL3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 668

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 241 ccatcgtgctgatgggcaagaacaccatgat 271



to top

>emb|BX069142.1|CNS09PII Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 229 ccatcgtgctgatgggcaagaacaccatgat 259



to top

>emb|BX069126.1|CNS09PI2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 455

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 223 ccatcgtgctgatgggcaagaacaccatgat 253



to top

>emb|BX068988.1|CNS09PE8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53BH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 999

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 233 ccatcgtgctgatgggcaagaacaccatgat 263



to top

>emb|BX068833.1|CNS09P9X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53BA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1037

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 253 ccatcgtgctgatgggcaagaacaccatgat 283



to top

>emb|BX068815.1|CNS09P9F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53AH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 234 ccatcgtgctgatgggcaagaacaccatgat 264



to top

>emb|BX068760.1|CNS09P7W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53AF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 753

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 245 ccatcgtgctgatgggcaagaacaccatgat 275



to top

>emb|BX068607.1|CNS09P3N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52DG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 767

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 224 ccatcgtgctgatgggcaagaacaccatgat 254



to top

>emb|BX068471.1|CNS09OZV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52DA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1059

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 223 ccatcgtgctgatgggcaagaacaccatgat 253



to top

>emb|BX068229.1|CNS09OT5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52BD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 882

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 226 ccatcgtgctgatgggcaagaacaccatgat 256



to top

>emb|BX068019.1|CNS09ONB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52AB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 969

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 231 ccatcgtgctgatgggcaagaacaccatgat 261



to top

>emb|BX067891.1|CNS09OJR Single read from an extremity of a full-length cDNA clone made
          from Anopheles gambiae total adult females. 5-PRIME end
          of clone FK0AAC51DB02 of strain 6-9 of Anopheles
          gambiae (African malaria mosquito)
          Length = 374

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                         
Query: 20 ccatcgtgctcatgggcaagaacaccctgat 50
          |||||||||| ||||||||||||||| ||||
Sbjct: 52 ccatcgtgctgatgggcaagaacaccatgat 82



to top

>emb|BX067841.1|CNS09OID Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 690

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257



to top

>emb|BX067819.1|CNS09OHR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 335

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 206 ccatcgtgctgatgggcaagaacaccatgat 236



to top

>emb|BX067775.1|CNS09OGJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1021

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 235 ccatcgtgctgatgggcaagaacaccatgat 265



to top

>emb|BX067752.1|CNS09OFW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 986

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 234 ccatcgtgctgatgggcaagaacaccatgat 264



to top

>emb|BX067707.1|CNS09OEN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1014

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 233 ccatcgtgctgatgggcaagaacaccatgat 263



to top

>emb|BX067564.1|CNS09OAO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 340

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 149 ccatcgtgctgatgggcaagaacaccatgat 179



to top

>emb|BX067487.1|CNS09O8J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51AG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 722

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 221 ccatcgtgctgatgggcaagaacaccatgat 251



to top

>emb|BX067429.1|CNS09O6X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51AE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 642

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX066992.1|CNS09NUS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50CA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 847

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 204 ccatcgtgctgatgggcaagaacaccatgat 234



to top

>emb|BX067216.1|CNS09O10 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50DC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 947

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 226 ccatcgtgctgatgggcaagaacaccatgat 256



to top

>emb|BX067179.1|CNS09NZZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50DA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1008

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257



to top

>emb|BX066854.1|CNS09NQY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1054

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 240 ccatcgtgctgatgggcaagaacaccatgat 270



to top

>emb|BX066645.1|CNS09NL5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50AB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 349

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 203 ccatcgtgctgatgggcaagaacaccatgat 233



to top

>emb|BX066623.1|CNS09NKJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50AA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 731

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 222 ccatcgtgctgatgggcaagaacaccatgat 252



to top

>emb|BX066597.1|CNS09NJT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5DH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 998

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 238 ccatcgtgctgatgggcaagaacaccatgat 268



to top

>emb|BX066426.1|CNS09NF2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5DA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 999

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 206 ccatcgtgctgatgggcaagaacaccatgat 236



to top

>emb|BX066412.1|CNS09NEO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5CH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 814

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257



to top

>emb|BX066390.1|CNS09NE2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5CG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 540

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 218 ccatcgtgctgatgggcaagaacaccatgat 248



to top

>emb|BX066329.1|CNS09NCD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5CD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 851

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 207 ccatcgtgctgatgggcaagaacaccatgat 237



to top

>emb|BX065816.1|CNS09MY4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49DD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 764

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 235 ccatcgtgctgatgggcaagaacaccatgat 265



to top

>emb|BX065714.1|CNS09MVA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49CH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 884

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 850 ccatcgtgctgatgggcaagaacaccatgat 820



to top

>emb|BX065713.1|CNS09MV9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49CH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 843

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX065465.1|CNS09MOD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49BE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 201 ccatcgtgctgatgggcaagaacaccatgat 231



to top

>emb|BX065359.1|CNS09MLF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49AH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 500

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 220 ccatcgtgctgatgggcaagaacaccatgat 250



to top

>emb|BX065269.1|CNS09MIX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49AD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 693

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 171 ccatcgtgctgatgggcaagaacaccatgat 201



to top

>emb|BX065249.1|CNS09MID Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49AC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 944

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 226 ccatcgtgctgatgggcaagaacaccatgat 256



to top

>emb|BX065042.1|CNS09MCM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48DA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 740

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 104 ccatcgtgctgatgggcaagaacaccatgat 134



to top

>emb|BX065015.1|CNS09MBV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48CH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1057

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 223 ccatcgtgctgatgggcaagaacaccatgat 253



to top

>emb|BX065006.1|CNS09MBM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48CH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1009

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 771 ccatcgtgctgatgggcaagaacaccatgat 741



to top

>emb|BX065005.1|CNS09MBL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48CH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1002

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 311 ccatcgtgctgatgggcaagaacaccatgat 341



to top

>emb|BX064952.1|CNS09MA4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48CE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1073

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 226 ccatcgtgctgatgggcaagaacaccatgat 256



to top

>emb|BX064796.1|CNS09M5S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 304

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX064760.1|CNS09M4S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48BC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1031

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 224 ccatcgtgctgatgggcaagaacaccatgat 254



to top

>emb|BX064725.1|CNS09M3T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48BA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 225 ccatcgtgctgatgggcaagaacaccatgat 255



to top

>emb|BX064530.1|CNS09LYE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46DD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 467

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX064423.1|CNS09LVF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46CG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 380

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 247 ccatcgtgctgatgggcaagaacaccatgat 277



to top

>emb|BX064284.1|CNS09LRK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46CA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 987

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 231 ccatcgtgctgatgggcaagaacaccatgat 261



to top

>emb|BX064164.1|CNS09LO8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46BD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1042

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 224 ccatcgtgctgatgggcaagaacaccatgat 254



to top

>emb|BX064121.1|CNS09LN1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46BB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 790 ccatcgtgctgatgggcaagaacaccatgat 760



to top

>emb|BX064120.1|CNS09LN0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46BB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 989

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257



to top

>emb|BX064068.1|CNS09LLK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46AG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1029

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 247 ccatcgtgctgatgggcaagaacaccatgat 277



to top

>emb|BX063872.1|CNS09LG4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1059

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 223 ccatcgtgctgatgggcaagaacaccatgat 253



to top

>emb|BX063577.1|CNS09L7X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45CA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 439

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 92  ccatcgtgctgatgggcaagaacaccatgat 122



to top

>emb|BX063467.1|CNS09L4V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45BB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 884 ccatcgtgctgatgggcaagaacaccatgat 854



to top

>emb|BX063466.1|CNS09L4U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45BB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 856

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX063434.1|CNS09L3Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45AH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 198

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX063420.1|CNS09L3K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45AH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 881

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 235 ccatcgtgctgatgggcaagaacaccatgat 265



to top

>emb|BX063227.1|CNS09KY7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 980

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 234 ccatcgtgctgatgggcaagaacaccatgat 264



to top

>emb|BX062791.1|CNS09KM3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44BA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 199 ccatcgtgctgatgggcaagaacaccatgat 229



to top

>emb|BX062552.1|CNS09KFG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1039

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 216 ccatcgtgctgatgggcaagaacaccatgat 246



to top

>emb|BX062546.1|CNS09KFA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43DE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 764

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 103 ccatcgtgctgatgggcaagaacaccatgat 133



to top

>emb|BX062387.1|CNS09KAV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43CF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 945

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 174 ccatcgtgctgatgggcaagaacaccatgat 204



to top

>emb|BX062299.1|CNS09K8F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43CB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 982

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 176 ccatcgtgctgatgggcaagaacaccatgat 206



to top

>emb|BX062297.1|CNS09K8D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43CB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1032

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 223 ccatcgtgctgatgggcaagaacaccatgat 253



to top

>emb|BX062183.1|CNS09K57 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1052

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 225 ccatcgtgctgatgggcaagaacaccatgat 255



to top

>emb|BX062169.1|CNS09K4T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 689

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 214 ccatcgtgctgatgggcaagaacaccatgat 244



to top

>emb|BX062048.1|CNS09K1G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43AF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1012

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 205 ccatcgtgctgatgggcaagaacaccatgat 235



to top

>emb|BX061878.1|CNS09JWQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42DF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 209 ccatcgtgctgatgggcaagaacaccatgat 239



to top

>emb|BX061190.1|CNS09JDM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41DE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 993

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 224 ccatcgtgctgatgggcaagaacaccatgat 254



to top

>emb|BX061164.1|CNS09JCW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41DC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 858

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 785 ccatcgtgctgatgggcaagaacaccatgat 755



to top

>emb|BX061163.1|CNS09JCV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41DC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257



to top

>emb|BX061137.1|CNS09JC5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41DB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 226 ccatcgtgctgatgggcaagaacaccatgat 256



to top

>emb|BX061133.1|CNS09JC1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41DB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 221 ccatcgtgctgatgggcaagaacaccatgat 251



to top

>emb|BX060642.1|CNS09IYE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41AD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 947

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 172 ccatcgtgctgatgggcaagaacaccatgat 202



to top

>emb|BX060527.1|CNS09IV7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 997

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 218 ccatcgtgctgatgggcaagaacaccatgat 248



to top

>emb|BX060489.1|CNS09IU5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40DE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1036

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 786 ccatcgtgctgatgggcaagaacaccatgat 756



to top

>emb|BX060488.1|CNS09IU4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40DE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1032

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 326 ccatcgtgctgatgggcaagaacaccatgat 356



to top

>emb|BX060443.1|CNS09ISV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40DC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1047

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 235 ccatcgtgctgatgggcaagaacaccatgat 265



to top

>emb|BX060185.1|CNS09ILP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40BH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1050

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 216 ccatcgtgctgatgggcaagaacaccatgat 246



to top

>emb|BX059916.1|CNS09IE8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40AC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 510

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX059866.1|CNS09ICU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40AA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 705

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 215 ccatcgtgctgatgggcaagaacaccatgat 245



to top

>emb|BX059758.1|CNS09I9U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4DC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 229 ccatcgtgctgatgggcaagaacaccatgat 259



to top

>emb|BX059741.1|CNS09I9D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4DB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 239 ccatcgtgctgatgggcaagaacaccatgat 269



to top

>emb|BX059642.1|CNS09I6M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4CD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 430

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 202 ccatcgtgctgatgggcaagaacaccatgat 232



to top

>emb|BX059587.1|CNS09I53 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4CA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 237 ccatcgtgctgatgggcaagaacaccatgat 267



to top

>emb|BX059585.1|CNS09I51 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4CA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 804

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 152 ccatcgtgctgatgggcaagaacaccatgat 182



to top

>emb|BX059469.1|CNS09I1T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4BC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1020

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 238 ccatcgtgctgatgggcaagaacaccatgat 268



to top

>emb|BX059305.1|CNS09HX9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4AD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 817

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 108 ccatcgtgctgatgggcaagaacaccatgat 138



to top

>emb|BX059220.1|CNS09HUW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1011

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 224 ccatcgtgctgatgggcaagaacaccatgat 254



to top

>emb|BX059184.1|CNS09HTW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1045

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 218 ccatcgtgctgatgggcaagaacaccatgat 248



to top

>emb|BX059095.1|CNS09HRF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1007

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257



to top

>emb|BX058971.1|CNS09HNZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39CE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 678

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 205 ccatcgtgctgatgggcaagaacaccatgat 235



to top

>emb|BX058839.1|CNS09HKB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39BG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1035

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 229 ccatcgtgctgatgggcaagaacaccatgat 259



to top

>emb|BX058760.1|CNS09HI4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39BC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1026

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 206 ccatcgtgctgatgggcaagaacaccatgat 236



to top

>emb|BX058740.1|CNS09HHK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39BC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 817

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 214 ccatcgtgctgatgggcaagaacaccatgat 244



to top

>emb|BX058729.1|CNS09HH9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39BB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 207 ccatcgtgctgatgggcaagaacaccatgat 237



to top

>emb|BX058315.1|CNS09H5R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38CF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 557

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 217 ccatcgtgctgatgggcaagaacaccatgat 247



to top

>emb|BX058203.1|CNS09H2N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 956

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 235 ccatcgtgctgatgggcaagaacaccatgat 265



to top

>emb|BX056754.1|CNS09FYE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36BC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 898

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 171 ccatcgtgctgatgggcaagaacaccatgat 201



to top

>emb|BX057924.1|CNS09GUW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38AD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1054

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 239 ccatcgtgctgatgggcaagaacaccatgat 269



to top

>emb|BX057796.1|CNS09GRC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37DF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 541

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 226 ccatcgtgctgatgggcaagaacaccatgat 256



to top

>emb|BX057631.1|CNS09GMR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37CG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 415

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 88  ccatcgtgctgatgggcaagaacaccatgat 118



to top

>emb|BX057605.1|CNS09GM1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37CF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 480

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX057468.1|CNS09GI8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37BG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 159

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 87  ccatcgtgctgatgggcaagaacaccatgat 117



to top

>emb|BX057218.1|CNS09GBA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37AC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 826

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 243 ccatcgtgctgatgggcaagaacaccatgat 273



to top

>emb|BX057213.1|CNS09GB5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37AC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 455

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 228 ccatcgtgctgatgggcaagaacaccatgat 258



to top

>emb|BX057133.1|CNS09G8X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 780

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 234 ccatcgtgctgatgggcaagaacaccatgat 264



to top

>emb|BX057094.1|CNS09G7U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36DE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 287

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 231 ccatcgtgctgatgggcaagaacaccatgat 261



to top

>emb|BX057074.1|CNS09G7A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36DE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 457

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 202 ccatcgtgctgatgggcaagaacaccatgat 232



to top

>emb|BX056996.1|CNS09G54 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36DA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 699

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 235 ccatcgtgctgatgggcaagaacaccatgat 265



to top

>emb|BX056958.1|CNS09G42 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36CG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 738

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 229 ccatcgtgctgatgggcaagaacaccatgat 259



to top

>emb|BX056914.1|CNS09G2U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36CD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 609

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 236 ccatcgtgctgatgggcaagaacaccatgat 266



to top

>emb|BX056483.1|CNS09FQV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35DC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 671

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 162 ccatcgtgctgatgggcaagaacaccatgat 192



to top

>emb|BX055960.1|CNS09FCC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34DB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 496

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX055808.1|CNS09F84 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34CC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1041

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 246 ccatcgtgctgatgggcaagaacaccatgat 276



to top

>emb|BX056320.1|CNS09FMC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35CC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 694

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 209 ccatcgtgctgatgggcaagaacaccatgat 239



to top

>emb|BX056288.1|CNS09FLG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC35CA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 939

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 889 ccatcgtgctgatgggcaagaacaccatgat 859



to top

>emb|BX056287.1|CNS09FLF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35CA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 982

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 237 ccatcgtgctgatgggcaagaacaccatgat 267



to top

>emb|BX056283.1|CNS09FLB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35CA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 856

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 98  ccatcgtgctgatgggcaagaacaccatgat 128



to top

>emb|BX055999.1|CNS09FDF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34DE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 771

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 190 ccatcgtgctgatgggcaagaacaccatgat 220



to top

>emb|BX055725.1|CNS09F5T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 820

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 225 ccatcgtgctgatgggcaagaacaccatgat 255



to top

>emb|BX055721.1|CNS09F5P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34BH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 984

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 242 ccatcgtgctgatgggcaagaacaccatgat 272



to top

>emb|BX055621.1|CNS09F2X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 450

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 225 ccatcgtgctgatgggcaagaacaccatgat 255



to top

>emb|BX055603.1|CNS09F2F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34BB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 599

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 241 ccatcgtgctgatgggcaagaacaccatgat 271



to top

>emb|BX055567.1|CNS09F1F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34AH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 832

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 242 ccatcgtgctgatgggcaagaacaccatgat 272



to top

>emb|BX053214.1|CNS09D82 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30DB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 850

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 221 ccatcgtgctgatgggcaagaacaccatgat 251



to top

>emb|BX053185.1|CNS09D79 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30DA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 362

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX053146.1|CNS09D66 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30CF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 761

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX052948.1|CNS09D0O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30BD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 813

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 210 ccatcgtgctgatgggcaagaacaccatgat 240



to top

>emb|BX052946.1|CNS09D0M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30BD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 916

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 229 ccatcgtgctgatgggcaagaacaccatgat 259



to top

>emb|BX054654.1|CNS09EC2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32DF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 813

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 216 ccatcgtgctgatgggcaagaacaccatgat 246



to top

>emb|BX054435.1|CNS09E5Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32CD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 915

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257



to top

>emb|BX054345.1|CNS09E3H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32BH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 776

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 188 ccatcgtgctgatgggcaagaacaccatgat 218



to top

>emb|BX054246.1|CNS09E0Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32BC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 803

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 243 ccatcgtgctgatgggcaagaacaccatgat 273



to top

>emb|BX054186.1|CNS09DZ2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32BA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 969

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 236 ccatcgtgctgatgggcaagaacaccatgat 266



to top

>emb|BX054114.1|CNS09DX2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32AF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1020

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 230 ccatcgtgctgatgggcaagaacaccatgat 260



to top

>emb|BX054048.1|CNS09DV8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32AC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 956

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 238 ccatcgtgctgatgggcaagaacaccatgat 268



to top

>emb|BX053890.1|CNS09DQU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31DC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 963

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 800 ccatcgtgctgatgggcaagaacaccatgat 770



to top

>emb|BX053889.1|CNS09DQT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31DC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 800

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 282 ccatcgtgctgatgggcaagaacaccatgat 312



to top

>emb|BX053751.1|CNS09DMZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31CE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 881

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 248 ccatcgtgctgatgggcaagaacaccatgat 278



to top

>emb|BX053704.1|CNS09DLO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31CB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 989

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 241 ccatcgtgctgatgggcaagaacaccatgat 271



to top

>emb|BX053693.1|CNS09DLD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31CB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 861

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 243 ccatcgtgctgatgggcaagaacaccatgat 273



to top

>emb|BX053532.1|CNS09DGW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31BA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 761

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 214 ccatcgtgctgatgggcaagaacaccatgat 244



to top

>emb|BX052874.1|CNS09CYM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30BA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1019

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257



to top

>emb|BX052836.1|CNS09CXK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30AG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 310

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 239 ccatcgtgctgatgggcaagaacaccatgat 209



to top

>emb|BX052835.1|CNS09CXJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30AG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 772

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX052777.1|CNS09CVX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30AD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 912

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 204 ccatcgtgctgatgggcaagaacaccatgat 234



to top

>emb|BX052724.1|CNS09CUG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30AA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 904

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 228 ccatcgtgctgatgggcaagaacaccatgat 258



to top

>emb|BX052368.1|CNS09CKK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 939

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 221 ccatcgtgctgatgggcaagaacaccatgat 251



to top

>emb|BX052263.1|CNS09CHN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3BB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 945

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 229 ccatcgtgctgatgggcaagaacaccatgat 259



to top

>emb|BX052235.1|CNS09CGV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3AH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 289

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 20  ccatcgtgctcatgggcaagaacaccctgat 50
           |||||||||| ||||||||||||||| ||||
Sbjct: 219 ccatcgtgctgatgggcaagaacaccatgat 249


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,737,748
Number of Sequences: 3902068
Number of extensions: 3737748
Number of successful extensions: 70913
Number of sequences better than 10.0: 946
Number of HSP's better than 10.0 without gapping: 946
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 68937
Number of HSP's gapped (non-prelim): 1956
length of query: 520
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 497
effective length of database: 17,143,297,704
effective search space: 8520218958888
effective search space used: 8520218958888
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top