ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags26o06
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BT009299.1| Triticum aestivum clone wlm1.pk0008.c11:fis, full... 1035 0.0
2ref|XM_473964.1| Oryza sativa (japonica cultivar-group), predic... 289 5e-75
3dbj|AK120834.1| Oryza sativa (japonica cultivar-group) cDNA clon... 289 5e-75
4gb|BT018319.1| Zea mays clone EL01T0208A09.c mRNA sequence 260 4e-66
5gb|AF402959.1| Oryza sativa chromosome 4 clones V17 and 214, gen... 258 2e-65
6gb|AY109460.1| Zea mays CL862_1 mRNA sequence 252 1e-63
7emb|AL606669.4|OSJN00106 Oryza sativa genomic DNA, chromosome 4,... 250 4e-63
8dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 250 4e-63
9gb|AY107345.1| Zea mays PCO104090 mRNA sequence 214 2e-52
10ref|XM_480466.1| Oryza sativa (japonica cultivar-group), mRNA 182 8e-43
11dbj|AK072804.1| Oryza sativa (japonica cultivar-group) cDNA clon... 182 8e-43
12dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 125 2e-25
13dbj|AP005531.3| Oryza sativa (japonica cultivar-group) genomic D... 125 2e-25
14dbj|AP005505.3| Oryza sativa (japonica cultivar-group) genomic D... 125 2e-25
15dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 64 5e-07
16dbj|AP003864.4| Oryza sativa (japonica cultivar-group) genomic D... 64 5e-07
17dbj|AP004266.3| Oryza sativa (japonica cultivar-group) genomic D... 64 5e-07
18gb|AY107267.1| Zea mays PCO073795 mRNA sequence 50 0.008
19gb|BT012902.1| Lycopersicon esculentum clone 114011F, mRNA sequence 48 0.032
20ref|NM_101037.2| Arabidopsis thaliana ATRBP45B; RNA binding AT1G... 46 0.13
21ref|NM_179310.1| Arabidopsis thaliana ATRBP45B; RNA binding AT1G... 46 0.13
22gb|BT018995.1| Zea mays clone Contig483.F mRNA sequence 46 0.13
23gb|AC132580.2| Mus musculus BAC clone RP24-388H18 from chromosom... 46 0.13
24gb|AC166078.2| Mus musculus BAC clone RP23-13G1 from chromosome ... 46 0.13
25emb|Z73587.1|SCYPL231W S.cerevisiae chromosome XVI reading frame... 46 0.13
26emb|X94561.1|SCCHXVILA S.cerevisiae chromosome XVI left arm (EU)... 46 0.13
27emb|X76890.1|SCFAS2 S.cerevisiae FAS2 gene 46 0.13
28gb|BT008494.1| Arabidopsis thaliana At1g11650 gene, complete cds 46 0.13
29gb|AY093201.1| Arabidopsis thaliana similar to gb|U90212 DNA bin... 46 0.13
30gb|AE016819.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 46 0.13
31gb|AY086969.1| Arabidopsis thaliana clone 30022 mRNA, complete s... 46 0.13
32dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 46 0.13
33ref|NM_212208.1| Eremothecium gossypii AFR525Cp (AFR525C), mRNA 46 0.13
34gb|AY104980.1| Zea mays PCO111857 mRNA sequence 46 0.13
35gb|AC007296.2|F25C20 Arabidopsis thaliana chromosome 1 BAC F25C2... 46 0.13
36gb|J03936.1|YSCFAS2A S.cerevisiae FAS2 gene encoding alpha-subun... 46 0.13
37gb|AY493286.1| Anas platyrhynchos microsatellite CAUD041 sequence 44 0.50
38ref|XM_960499.1| Neurospora crassa OR74A hypothetical protein (N... 44 0.50
39ref|XM_330097.1| Neurospora crassa OR74A hypothetical protein (N... 44 0.50
40gb|AC122896.4| Mus musculus BAC clone RP23-69N8 from chromosome ... 44 0.50
41ref|XM_754825.1| Ustilago maydis 521 hypothetical protein (UM037... 44 0.50
42dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.50
43emb|AL928985.24| Mouse DNA sequence from clone RP23-477P11 on ch... 44 0.50
44gb|AC104809.5| Homo sapiens BAC clone RP11-637O3 from 2, complet... 44 0.50
45dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 44 0.50
46dbj|AP005387.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.50
47dbj|AK122070.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.50
48dbj|AK064807.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.50
49gb|AC079444.28| Mus musculus strain C57BL/6J chromosome 10 clone... 44 0.50
50gb|AC079681.38| Mus musculus strain C57BL/6J chromosome 10 clone... 44 0.50
51gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete... 44 0.50
52gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome 42 2.0
53ref|NM_103642.2| Arabidopsis thaliana ATRBP47C; RNA binding AT1G... 42 2.0
54ref|NM_202255.1| Arabidopsis thaliana ATRBP47C; RNA binding AT1G... 42 2.0
55ref|NM_103848.2| Arabidopsis thaliana ATRBP47A; RNA binding AT1G... 42 2.0
56ref|XM_478418.1| Oryza sativa (japonica cultivar-group), mRNA 42 2.0
57ref|XM_478419.1| Oryza sativa (japonica cultivar-group), mRNA 42 2.0
58gb|AC146131.4| Pan troglodytes BAC clone RP43-4F15 from 7, compl... 42 2.0
59ref|XM_538486.2| PREDICTED: Canis familiaris luteinizing hormone... 42 2.0
60emb|AL590362.12| Human DNA sequence from clone RP11-214G2 on chr... 42 2.0
61emb|AL160269.14| Human DNA sequence from clone RP11-240L7 on chr... 42 2.0
62gb|BT009238.1| Triticum aestivum clone wlk1.pk0001.f8:fis, full ... 42 2.0
63emb|BX017996.1|CNS08M1S Single read from an extremity of a full-... 42 2.0
64gb|AF344325.1| Arabidopsis thaliana putative DNA binding protein... 42 2.0
65gb|AY062960.1| Arabidopsis thaliana putative DNA binding protein... 42 2.0
66gb|AY035180.1| Arabidopsis thaliana putative DNA binding protein... 42 2.0
67emb|BX640441.1| Bordetella bronchiseptica strain RB50, complete ... 42 2.0
68emb|BX640426.1| Bordetella parapertussis strain 12822, complete ... 42 2.0
69emb|BX640419.1| Bordetella pertussis strain Tohama I, complete g... 42 2.0
70emb|AJ313097.1|BVU313097 Beta vulgaris mRNA for salt tolerance p... 42 2.0
71dbj|AK061900.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.0
72gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome 42 2.0
73ref|NM_137930.2| Drosophila melanogaster CG3124-RA (CG3124), mRNA 42 2.0
74gb|AY089280.1| Drosophila melanogaster AT07821 full insert cDNA 42 2.0
75gb|AF441320.1|AF441320 PAH-contaminated sludge bacterium PB-25 1... 42 2.0
76dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 42 2.0
77gb|AC008304.3|AC008304 Drosophila melanogaster, chromosome 2R, r... 42 2.0
78emb|BX813781.1|CNS0AC3C Arabidopsis thaliana Full-length cDNA Co... 42 2.0
79emb|BX815706.1|CNS0AAGP Arabidopsis thaliana Full-length cDNA Co... 42 2.0
80dbj|BA000026.2| Mycoplasma penetrans HF-2 DNA, complete genome 42 2.0
81dbj|AP005755.2| Oryza sativa (japonica cultivar-group) genomic D... 42 2.0
82dbj|AP006849.2| Oryza sativa (japonica cultivar-group) genomic D... 42 2.0
83dbj|AP005103.5| Oryza sativa (japonica cultivar-group) genomic D... 42 2.0
84dbj|AP005320.3| Oryza sativa (japonica cultivar-group) genomic D... 42 2.0
85ref|XM_315414.2| Anopheles gambiae str. PEST ENSANGP00000014064 ... 42 2.0
86dbj|AK067260.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.0
87dbj|AK062798.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.0
88dbj|AK060597.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.0
89gb|AY110306.1| Zea mays CL773_2 mRNA sequence 42 2.0
90gb|AC007519.2|F16N3 Sequence of BAC F16N3 from Arabidopsis thali... 42 2.0
91emb|AJ718892.1| Nicotiana tabacum cDNA-AFLP-fragment BSTC14-2-27... 42 2.0
92gb|AE003460.2| Drosophila melanogaster chromosome 2R, section 68... 42 2.0
93gb|BC063993.1| Danio rerio tRNA selenocysteine associated protei... 42 2.0
94ref|NM_213251.1| Danio rerio tRNA selenocysteine associated prot... 42 2.0
95gb|U90212.1|NTU90212 Nicotiana tabacum DNA binding protein ACBF ... 42 2.0
96gb|L37336.1|TRBC1PG Trypanosoma congolense phosphoglycerate kina... 42 2.0
97gb|L37337.1|TRB56PG Trypanosoma congolense phosphoglycerate kina... 42 2.0
98gb|AC134623.5| Mus musculus BAC clone RP23-20K21 from 8, complet... 42 2.0
99gb|AF029351.1|AF029351 Nicotiana tabacum putative RNA binding pr... 42 2.0
100emb|AL732564.12| Mouse DNA sequence from clone RP23-442G9 on chr... 42 2.0
101emb|AL592403.6| Mouse DNA sequence from clone RP23-90A8 on chrom... 42 2.0
102dbj|AB052339.1| Lampetra japonica LjTTF-1 mRNA for thyroid trans... 42 2.0
103gb|AY851689.1| Uncultured Microbacterium sp. clone p5 16S riboso... 40 7.7
104ref|NM_118834.2| Arabidopsis thaliana RNA binding AT4G27000 mRNA... 40 7.7
105gb|DQ228730.1| Bacterium ID5-18 16S ribosomal RNA gene, partial ... 40 7.7
106gb|AC164883.5| Mus musculus BAC clone RP23-88A20 from chromosome... 40 7.7
107gb|AY398370.1| Danio rerio clone RK105A4F05 poly(A)-binding prot... 40 7.7
108gb|DQ227343.1| Microbacterium sp. PHD-5 16S ribosomal RNA gene, ... 40 7.7
109gb|BT018852.1| Zea mays clone EL01N0555H08.d mRNA sequence 40 7.7
110gb|AY622232.1| Uncultured actinobacterium clone C-CO51 16S ribos... 40 7.7
111gb|AY730719.1| Microbacterium sp. 130704Ws9 16S ribosomal RNA ge... 40 7.7
112gb|DQ119293.3| Microbacterium sp. SK 18 16S ribosomal RNA gene, ... 40 7.7
113gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete ... 40 7.7
114gb|AF417868.1| Microbacterium sp. YSS/2001-1 16S ribosomal RNA g... 40 7.7
115ref|XM_424078.1| PREDICTED: Gallus gallus similar to Ornithine a... 40 7.7
116gb|DQ490451.1| Microbacteriaceae bacterium KVD-1982-06 16S ribos... 40 7.7
117gb|BC044513.1| Danio rerio zgc:55855, mRNA (cDNA clone MGC:55855... 40 7.7
118ref|XM_716050.1| Candida albicans SC5314 hypothetical protein (C... 40 7.7
119ref|XM_715929.1| Candida albicans SC5314 phosphoglycerate mutase... 40 7.7
120gb|AF047639.1| Uncultured eubacterium TRB50 16S ribosomal RNA ge... 40 7.7
121gb|DQ460219.1| Microbacterium sp. 05-7823 16S ribosomal RNA gene... 40 7.7
122gb|DQ191237.1| Bacterium W5(2005) 16S ribosomal RNA gene, partia... 40 7.7
123ref|NM_199839.1| Danio rerio zgc:55855 (zgc:55855), mRNA 40 7.7
124gb|AY038632.1| Uncultured eubacterium clone GL184.20 16S ribosom... 40 7.7
125gb|AY038631.1| Uncultured eubacterium clone GL182.38 16S ribosom... 40 7.7
126gb|AY038630.1| Uncultured eubacterium clone GL178.9 16S ribosoma... 40 7.7
127gb|AF423215.1| Uncultured soil bacterium clone 1245-2 16S riboso... 40 7.7
128gb|AY350712.1| Arabidopsis arenosa clone BAC Aer6D24, complete s... 40 7.7
129gb|AC145799.2| Xenopus tropicalis clone CH216-55B16, complete se... 40 7.7
130gb|DQ189973.1| Uncultured Microbacterium sp. clone SIMO-2998 16S... 40 7.7
131gb|AY275515.1| Microbacterium sp. MSB2098 16S ribosomal RNA gene... 40 7.7
132gb|AY504445.1| Bacillaceae bacterium C19 16S ribosomal RNA gene,... 40 7.7
133gb|AC165352.2| Mus musculus BAC clone RP23-205C7 from chromosome... 40 7.7
134gb|AY547556.1| Microbacterium sp. CME1 16S ribosomal RNA gene, c... 40 7.7
135gb|BC023950.1| Mus musculus ethanolamine kinase 1, mRNA (cDNA cl... 40 7.7
136gb|BC034743.1| Mus musculus ethanolamine kinase 1, mRNA (cDNA cl... 40 7.7
137gb|AC139759.4| Mus musculus BAC clone RP23-385E10 from chromosom... 40 7.7
138gb|AY395032.1| Uncultured Microbacterium sp. clone NAB25 16S rib... 40 7.7
139gb|AY395021.1| Microbacterium sp. NAB17 16S ribosomal RNA gene, ... 40 7.7
140gb|AF176819.1| Xenopus tropicalis twist transcription factor mRN... 40 7.7
141gb|AC111142.16| Mus musculus chromosome 3, clone RP23-370L24, co... 40 7.7
142ref|XM_991485.1| PREDICTED: Mus musculus ethanolamine kinase 1 (... 40 7.7
143ref|XM_908334.2| PREDICTED: Mus musculus ethanolamine kinase 1 (... 40 7.7
144ref|XM_979562.1| PREDICTED: Mus musculus ethanolamine kinase 1 (... 40 7.7
145gb|AY439239.1| Microbacterium sp. GIC27y 16S ribosomal RNA gene,... 40 7.7
146gb|AY509223.1| Microbacterium oxydans strain S28n 16S ribosomal ... 40 7.7
147gb|AY509222.1| Microbacterium oxydans strain 187 16S ribosomal R... 40 7.7
148gb|AY785738.1| Microbacterium oxydans isolate OUCZ46 16S ribosom... 40 7.7
149gb|AY332192.1| Microbacterium sp. GWS-TZ-H111 16S ribosomal RNA ... 40 7.7
150gb|AY332149.1| Microbacterium sp. GWS-SE-H100 16S ribosomal RNA ... 40 7.7
151emb|AM110940.1| Bacillus subtilis partial 16S rRNA gene, isolate... 40 7.7
152ref|XM_849692.1| PREDICTED: Canis familiaris similar to non-POU ... 40 7.7
153emb|AJ879106.1| Microbacterium sp. R1_3_cr partial 16S rRNA gene... 40 7.7
154emb|AJ879104.1| Microbacterium sp. B2_10_cr partial 16S rRNA gen... 40 7.7
155emb|AJ879101.1| Microbacterium sp. B2_4_cr partial 16S rRNA gene... 40 7.7
156emb|AJ879099.1| Microbacterium sp. B3_13_cr partial 16S rRNA gen... 40 7.7
157emb|AJ879095.1| Microbacterium sp. B3_1_cr partial 16S rRNA gene... 40 7.7
158gb|AC132955.3| Mus musculus BAC clone RP24-266J20 from chromosom... 40 7.7
159gb|AY526712.1| Microbacterium sp. Muzt-I71 16S ribosomal RNA gen... 40 7.7
160gb|AY526705.1| Microbacterium sp. Muzt-G32 16S ribosomal RNA gen... 40 7.7
161emb|AJ863312.1| Uncultured bacterium partial 16S rRNA gene, clon... 40 7.7
162emb|AJ717357.1| Microbacterium oxydans 16S rRNA gene, isolate AC44 40 7.7
163emb|AJ863358.1| Uncultured bacterium partial 16S rRNA gene, clon... 40 7.7
164emb|AJ717358.1| Microbacterium oxydans 16S rRNA gene, isolate CV71a 40 7.7
165emb|AJ717356.1| Microbacterium oxydans 16S rRNA gene, isolate AC94 40 7.7
166gb|AC115123.4| Mus musculus BAC clone RP24-129O20 from 3, comple... 40 7.7
167gb|DQ129728.1| Microbacterium sp. HPC408 16S ribosomal RNA gene,... 40 7.7
168gb|DQ129726.1| Microbacterium sp. HPC405 16S ribosomal RNA gene,... 40 7.7
169gb|DQ448707.1| Microbacterium sp. CNJ743 PL04 16S ribosomal RNA ... 40 7.7
170emb|AJ864858.1| Microbacterium sp. J72 partial 16S rRNA gene, is... 40 7.7
171emb|Z99128.1|HS422H11 Human DNA sequence from clone RP3-422H11 o... 40 7.7
172ref|XM_795604.1| PREDICTED: Strongylocentrotus purpuratus hypoth... 40 7.7
173emb|AJ876731.1| Microbacterium sp. R2_5 cr partial 16S rRNA gene... 40 7.7
174emb|AJ969168.1| Microbacterium sp. R-23195 16S rRNA gene, strain... 40 7.7
175emb|AJ634952.1| Microbacterium sp. B0L3 partial 16S rRNA gene, i... 40 7.7
176gb|AY062999.1| Arabidopsis thaliana putative DNA binding protein... 40 7.7
177gb|AF370339.1| Arabidopsis thaliana putative DNA binding protein... 40 7.7
178emb|X55735.1|DPBCD D.pseudoobscura bcd (bicoid) gene involved in... 40 7.7
179gb|DQ105974.1| Microbacterium oxydans 16S ribosomal RNA gene, pa... 40 7.7
180gb|AY526672.1| Microbacterium sp. Muzt-F72 16S ribosomal RNA gen... 40 7.7
181gb|AY526635.1| Microbacterium sp. Muzt-B35 16S ribosomal RNA gen... 40 7.7
182gb|DQ122280.1| Actinobacterium iEAIC68 16S ribosomal RNA gene ge... 40 7.7
183gb|DQ122234.1| Microbacterium sp. iMCIII8 16S ribosomal RNA gene... 40 7.7
184gb|DQ122233.1| Microbacterium sp. iMCIII16 16S ribosomal RNA gen... 40 7.7
185gb|DQ122216.1| Microbacterium oxydans strain iDLIII10 16S riboso... 40 7.7
186emb|BX569693.1| Synechococcus sp. WH8102 complete genome; segmen... 40 7.7
187gb|DQ395689.1| Uncultured organism clone ctg_CGOF008 16S ribosom... 40 7.7
188emb|AL935253.1| Lactobacillus plantarum strain WCFS1 complete ge... 40 7.7
189emb|AL161566.2|ATCHRIV66 Arabidopsis thaliana DNA chromosome 4, ... 40 7.7
190emb|AL035440.2|ATF10M23 Arabidopsis thaliana DNA chromosome 4, B... 40 7.7
191gb|AY822572.1| Bacterium PSD-1-5 16S ribosomal RNA gene, partial... 40 7.7
192gb|AY822543.1| Bacterium RHA-3-12 16S ribosomal RNA gene, partia... 40 7.7
193gb|AY822510.1| Bacterium RSB-1-14 16S ribosomal RNA gene, partia... 40 7.7
194gb|BC074558.1| Xenopus tropicalis twist transcription factor, mR... 40 7.7
195gb|AY661931.1| Bacterium 005-J small subunit ribosomal RNA gene,... 40 7.7
196gb|DQ298378.1| Uncultured bacterium clone PR66 16S ribosomal RNA... 40 7.7
197gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome 40 7.7
198emb|AJ785984.1| Actinobacterium TH-G25 partial 16S rRNA gene 40 7.7
199gb|DQ417926.1| Microbacterium sp. ZD-M2 16S ribosomal RNA gene, ... 40 7.7
200dbj|AB234881.1| Trifolium pratense mRNA for putative DNA binding... 40 7.7
201dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, c... 40 7.7
202gb|DQ063077.1| Actinobacterium BAL137 16S ribosomal RNA gene, pa... 40 7.7
203gb|DQ412995.1| Bacterium E4B 16S ribosomal RNA gene gene, partia... 40 7.7
204gb|DQ412991.1| Bacterium O1 16S ribosomal RNA gene gene, partial... 40 7.7
205gb|DQ401245.1| Microbacterium sp. iMSN37 16S ribosomal RNA gene,... 40 7.7
206gb|DQ403811.1| Microbacterium oxydans isolate NJ6 16S ribosomal ... 40 7.7
207gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome 40 7.7
208dbj|AB004718.1| Microbacterium luteolum gene for 16S rRNA, parti... 40 7.7
209gb|AY093292.1| Arabidopsis thaliana putative DNA binding protein... 40 7.7
210gb|AF450964.1| Drosophila miranda strain Mather28 bicoid (bcd) g... 40 7.7
211gb|AF450963.1| Drosophila miranda strain MSH38 bicoid (bcd) gene... 40 7.7
212gb|AF450961.1| Drosophila persimilis strain MSH7 bicoid (bcd) ge... 40 7.7
213gb|AF450960.1| Drosophila persimilis strain MSH3 bicoid (bcd) ge... 40 7.7
214gb|AF450959.1| Drosophila persimilis strain MSH1 bicoid (bcd) ge... 40 7.7
215gb|AF450958.1| Drosophila persimilis strain MSH42 bicoid (bcd) g... 40 7.7
216gb|AF450957.1| Drosophila persimilis strain MSH25 bicoid (bcd) g... 40 7.7
217gb|AF450956.1| Drosophila persimilis strain MatherB bicoid (bcd)... 40 7.7
218gb|AF450955.1| Drosophila persimilis strain MatherG bicoid (bcd)... 40 7.7
219gb|AF450954.1| Drosophila persimilis strain Mather39 bicoid (bcd... 40 7.7
220gb|AF450953.1| Drosophila persimilis strain Mather37 bicoid (bcd... 40 7.7
221gb|AF450952.1| Drosophila persimilis strain Mather41 bicoid (bcd... 40 7.7
222gb|AF450951.1| Drosophila persimilis strain Mather27 bicoid (bcd... 40 7.7
223gb|AF450950.1| Drosophila persimilis strain Mather6 bicoid (bcd)... 40 7.7
224gb|AF450949.1| Drosophila persimilis strain Mather40 bicoid (bcd... 40 7.7
225gb|AF450947.1| Drosophila pseudoobscura bogotana strain Potosi2 ... 40 7.7
226gb|AF450946.1| Drosophila pseudoobscura bogotana strain Toro4 bi... 40 7.7
227gb|AF450934.1| Drosophila pseudoobscura strain MSH21 bicoid (bcd... 40 7.7
228gb|AF450933.1| Drosophila pseudoobscura strain MSH24 bicoid (bcd... 40 7.7
229gb|AF450932.1| Drosophila pseudoobscura strain MSH32 bicoid (bcd... 40 7.7
230gb|AF450931.1| Drosophila pseudoobscura strain MSH9 bicoid (bcd)... 40 7.7
231gb|AF450929.1| Drosophila pseudoobscura strain Mather52 bicoid (... 40 7.7
232gb|AF450928.1| Drosophila pseudoobscura strain Mather48 bicoid (... 40 7.7
233gb|AF450926.1| Drosophila pseudoobscura strain Mather17 bicoid (... 40 7.7
234gb|AF450925.1| Drosophila pseudoobscura strain Mather10 bicoid (... 40 7.7
235gb|AF450924.1| Drosophila pseudoobscura strain Flagstaff18 bicoi... 40 7.7
236gb|AF450923.1| Drosophila pseudoobscura strain Flagstaff16 bicoi... 40 7.7
237gb|AF450922.1| Drosophila pseudoobscura strain Flagstaff14 bicoi... 40 7.7
238gb|AF450921.1| Drosophila pseudoobscura strain Flagstaff6 bicoid... 40 7.7
239gb|AF450920.1| Drosophila pseudoobscura strain Flagstaff5 bicoid... 40 7.7
240gb|AF450919.1| Drosophila pseudoobscura strain AFC12 bicoid (bcd... 40 7.7
241gb|AF450918.1| Drosophila pseudoobscura strain AFC7 bicoid (bcd)... 40 7.7
242gb|AF450917.1| Drosophila pseudoobscura strain AFC3 bicoid (bcd)... 40 7.7
243gb|AF450916.1| Drosophila pseudoobscura strain AF2 bicoid (bcd) ... 40 7.7
244gb|AF450915.1| Drosophila pseudoobscura strain Abajo36 bicoid (b... 40 7.7
245gb|AC100822.2| Homo sapiens chromosome 8, clone RP11-654O1, comp... 40 7.7
246gb|AY039502.1| Soil bacterium S86D1 16S ribosomal RNA gene, part... 40 7.7
247gb|AY039447.1| Earthworm burrow bacterium B11D2 16S ribosomal RN... 40 7.7
248gb|DQ417333.1| Microbacterium oxydans strain 15E 16S ribosomal R... 40 7.7
249gb|DQ398000.1| Microbacterium sp. W22B22 16S ribosomal RNA gene,... 40 7.7
250gb|DQ397999.1| Microbacterium sp. W22B21 16S ribosomal RNA gene,... 40 7.7
251gb|DQ397991.1| Microbacterium sp. TRL-2.2 16S ribosomal RNA gene... 40 7.7
252gb|AF441322.1|AF441322 PAH-contaminated sludge bacterium PB-27 1... 40 7.7
253gb|AF441319.1|AF441319 PAH-contaminated sludge bacterium PB-24 1... 40 7.7
254gb|AF441318.1|AF441318 PAH-contaminated sludge bacterium PB-23 1... 40 7.7
255gb|AY960683.1| Microbacterium sp. OVE 16S ribosomal RNA gene, pa... 40 7.7
256gb|AY054487.1| Arabidopsis thaliana putative DNA binding protein... 40 7.7
257gb|DQ377339.1| Microbacterium shrimpcida strain HL010406-1 16S r... 40 7.7
258gb|AF161320.1|AF161320 Pseudomonas aeruginosa NRAMP protein MntH... 40 7.7
259dbj|AK049691.1| Mus musculus 12 days embryo spinal cord cDNA, RI... 40 7.7
260gb|AF360367.1|AF360367 Microbacterium sp. NM005 16S ribosomal RN... 40 7.7
261dbj|AK044502.1| Mus musculus adult retina cDNA, RIKEN full-lengt... 40 7.7
262gb|DQ365578.1| Microbacterium hydrocarbonoxydans strain GS02 16S... 40 7.7
263dbj|AK033268.1| Mus musculus 15 days embryo male testis cDNA, RI... 40 7.7
264gb|AY017057.1|AY017057S1 Microbacterium sp. A8-2 16S ribosomal R... 40 7.7
265gb|AY673282.1| Microbacteriaceae bacterium Ellin7116 16S ribosom... 40 7.7
266gb|AY787762.1| Streptomyces filamentosus strain NRRL 11379 dapto... 40 7.7
267ref|NM_204084.2| Xenopus tropicalis twist transcription factor (... 40 7.7
268dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 40 7.7
269gb|AE004516.1| Pseudomonas aeruginosa PAO1, section 77 of 529 of... 40 7.7
270gb|AC087579.17| Homo sapiens chromosome 8, clone RP11-429B7, com... 40 7.7
271gb|AC011807.4|AC011807 Arabidopsis thaliana chromosome I BAC F14... 40 7.7
272gb|DQ347557.1| Microbacterium sp. B-2033 16S ribosomal RNA gene,... 40 7.7
273gb|DQ347555.1| Microbacterium sp. B-1132 16S ribosomal RNA gene,... 40 7.7
274gb|DQ350817.1| Microbacterium saperdae strain 22 16S ribosomal R... 40 7.7
275gb|AF498687.1| Bacterium Ellin305 16S ribosomal RNA gene, partia... 40 7.7
276gb|AY137200.1| Synthetic construct fiber protein DP1B mRNA, part... 40 7.7
277gb|DQ350882.1| Microbacterium sp. XT11 16S ribosomal RNA gene, p... 40 7.7
278gb|AY368525.1| Microbacterium sp. E920 16S ribosomal RNA gene, p... 40 7.7
279gb|AY368523.1| Microbacterium sp. L806 16S ribosomal RNA gene, p... 40 7.7
280gb|AY561529.1| Microbacterium sp. 4a-3 16S ribosomal RNA gene, p... 40 7.7
281gb|AY754445.1| Drosophila miranda strain MSH38 bicoid (bcd) gene... 40 7.7
282gb|AY754444.1| Drosophila miranda strain MSH22 bicoid (bcd) gene... 40 7.7
283gb|AY754443.1| Drosophila miranda strain SP235 bicoid (bcd) gene... 40 7.7
284gb|AY754442.1| Drosophila miranda strain SP138 bicoid (bcd) gene... 40 7.7
285gb|AY754441.1| Drosophila miranda strain MA32 bicoid (bcd) gene,... 40 7.7
286gb|AY754440.1| Drosophila miranda strain MA28 bicoid (bcd) gene,... 40 7.7
287gb|AY754439.1| Drosophila miranda strain 0101.9 bicoid (bcd) gen... 40 7.7
288gb|AY754438.1| Drosophila miranda strain 0101.7 bicoid (bcd) gen... 40 7.7
289gb|AY754437.1| Drosophila miranda strain 0101.5 bicoid (bcd) gen... 40 7.7
290gb|AY754436.1| Drosophila miranda strain 0101.4 bicoid (bcd) gen... 40 7.7
291gb|AY754435.1| Drosophila miranda strain 0101.3 bicoid (bcd) gen... 40 7.7
292gb|AY754434.1| Drosophila pseudoobscura bicoid (bcd) gene, exons... 40 7.7
293dbj|AB193267.1| Microbacterium oxydans gene for 16S rRNA, partia... 40 7.7
294dbj|AB193263.1| Microbacterium oxydans gene for 16S rRNA, partia... 40 7.7
295dbj|AB008831.1| Acinetobacter sp. YAA genes for aniline dioxygen... 40 7.7
296emb|AJ581908.1|MPA581908 Microbacterium paraoxydans partial 16S ... 40 7.7
297emb|Y17236.1|MSA17236 Microbacterium saperdae 16S rRNA gene 40 7.7
298emb|Y17235.1|MLU17235 Microbacterium luteolum 16S rRNA gene 40 7.7
299emb|Y17227.1|MOX17227 Microbacterium oxydans 16S rRNA gene 40 7.7
300emb|AJ249780.1|MFO249780 Microbacterium foliorum partial 16S rRN... 40 7.7
301emb|AJ491806.1|MIC491806 Microbacterium paraoxydans partial 16S ... 40 7.7
302emb|X93589.1|AS16SRR Aureobacterium sp. 16S ribosomal RNA 40 7.7
303emb|Z21500.1|SLDEHYDLA S.longipes mRNA for dehydrin-like protein 40 7.7
304dbj|AK108973.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 7.7
305gb|AY937056.1| Uncultured marine bacterium clone OMU-3337 16S ri... 40 7.7
306emb|CR936503.1| Lactobacillus sakei strain 23K complete genome 40 7.7
307gb|AY109669.1| Zea mays CL866_1 mRNA sequence 40 7.7
308emb|CR760828.2| Xenopus tropicalis finished cDNA, clone TTpA022n08 40 7.7
309emb|AJ853910.1| Microbacterium maritypicum partial 16S rRNA gene... 40 7.7
310emb|AL118557.5|CNS01DRT Human chromosome 14 DNA sequence BAC R-1... 40 7.7
311gb|AY894723.1| Microbacterium paraoxydans 16S ribosomal RNA gene... 40 7.7
312emb|AM234160.1| Microbacterium sp. S15-M4 partial 16S rRNA gene,... 40 7.7
313emb|AM234159.1| Microbacterium oxydans partial 16S rRNA gene, is... 40 7.7
314emb|AM234158.1| Microbacterium oxydans partial 16S rRNA gene, is... 40 7.7
315emb|AM234157.1| Microbacterium oxydans partial 16S rRNA gene, is... 40 7.7
316gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete... 40 7.7
317emb|AM181506.1| Microbacterium maritypicum partial 16S rRNA gene... 40 7.7
318gb|DQ211417.2| Uncultured actinobacterium clone nsc062 16S ribos... 40 7.7
319emb|AJ698726.1| Microbacterium hydrocarbonoxydans partial 16S rR... 40 7.7
320emb|AJ716148.1| Microbacterium sp. AJ115 partial 16S rRNA gene 40 7.7
321emb|AJ576066.1|MOX576066 Microbacterium oxydans partial 16S rRNA... 40 7.7
322emb|BX284680.6| Mouse DNA sequence from clone RP23-260E20 on chr... 40 7.7
323gb|BC061749.1| Rattus norvegicus tripartite motif protein 25 (ma... 40 7.7
324gb|DQ074757.1| Bacillus cereus strain bnj_dkc_41 16S ribosomal R... 40 7.7
325gb|DQ143988.1| Microbacterium sp. ITRC1 16S ribosomal RNA gene, ... 40 7.7
326emb|AJ404587.1|UBA404587 Uncultured bacterium US7 partial 16S rR... 40 7.7
327emb|AJ295433.1|UBA295433 Rape rhizosphere bacterium tsb033 parti... 40 7.7
328emb|AJ295363.1|UBA295363 Rape rhizosphere bacterium cse042 parti... 40 7.7
329emb|AJ516054.1|ALI516054 Aureobacterium liquefaciens partial 16S... 40 7.7
330emb|AJ509628.1|AME509628 Apis mellifera microsatellite marker Am... 40 7.7
331gb|DQ299207.1| Microbacterium sp. HPC943 16S ribosomal RNA gene,... 40 7.7
332gb|DQ303295.1| Erwinia sp. Xb2 16S ribosomal RNA gene, partial s... 40 7.7
333ref|NM_001009536.1| Rattus norvegicus tripartite motif protein 2... 40 7.7
334gb|DQ294032.1| Microbacterium oxydans strain AE3 16S ribosomal R... 40 7.7
335gb|AC149216.5| Mus musculus BAC clone RP24-194H8 from 18, comple... 40 7.7
336gb|AC151574.2| Mus musculus BAC clone RP23-430A4 from 7, complet... 40 7.7
337emb|Y15325.1|PLY15325 Aureobacterium sp. 16S rRNA gene, isolate ... 40 7.7
338emb|AJ517831.1|MSP517831 Microbacterium sp. E1 partial 16S rRNA ... 40 7.7
339gb|DQ268667.1| Bacterium D07 16S ribosomal RNA gene, partial seq... 40 7.7
340gb|DQ268666.1| Bacterium D16(2005) 16S ribosomal RNA gene, parti... 40 7.7
341gb|DQ270680.1| Microbacterium sp. B-1122 16S ribosomal RNA gene,... 40 7.7
342emb|AJ252737.1|PPL252737 Potato plant root bacterium clone RC-II... 40 7.7
343emb|AJ391205.1|MSP391205 Microbacterium sp. AS-44, partial 16S r... 40 7.7
344emb|X77444.1|AL16SR A.liquefaciens (DSM 20638) 16S rRNA gene 40 7.7
345gb|DQ257424.1| Microbacterium phyllosphaerae strain CAI-101 16S ... 40 7.7
346emb|Z35444.1|BMSHEATH2 B.malayi shp2 gene for microfilarial shea... 40 7.7
347gb|AY509966.1| Microbacterium sp. 4F4 16S ribosomal RNA gene, pa... 40 7.7
348gb|DQ248341.1| Microbacterium sp. B-2032 16S ribosomal RNA gene,... 40 7.7
349dbj|AB042092.1| Curtobacterium sp. VKM Ac-2057 gene for 16S ribo... 40 7.7
350dbj|AB042085.1| Microbacterium sp. VKM Ac-2051 gene for 16S ribo... 40 7.7
351dbj|AB042084.1| Microbacterium sp. VKM Ac-2050 gene for 16S ribo... 40 7.7
352dbj|AB042080.1| Microbacterium sp. VKM Ac-2015 gene for 16S ribo... 40 7.7
353dbj|AB042071.1| Microbacterium sp. VKM Ac-1391 gene for 16S ribo... 40 7.7

>gb|BT009299.1| Triticum aestivum clone wlm1.pk0008.c11:fis, full insert mRNA
           sequence
          Length = 1344

 Score = 1035 bits (522), Expect = 0.0
 Identities = 558/570 (97%)
 Strand = Plus / Plus

                                                                       
Query: 1   attacccttcagtgaagggcgcaaaagttgtgactgacaagatgacaatgcgttcaaagg 60
           ||||||||||||| ||||||||||| ||||| ||||||||||||||||||||||||||||
Sbjct: 242 attacccttcagtaaagggcgcaaaggttgtcactgacaagatgacaatgcgttcaaagg 301

                                                                       
Query: 61  gttatgggtttgtcaagtttggtgatcccacagagcaagctcgtgccatgactgagatga 120
           ||||||||||||| |||||||||||||| |||||||||||||||||||||||||| ||||
Sbjct: 302 gttatgggtttgtgaagtttggtgatcctacagagcaagctcgtgccatgactgaaatga 361

                                                                       
Query: 121 atggaatgccctgttcttccagacctatgcgcattggtccagcagcaaataggaagacaa 180
           ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 362 atggaatgccctgttcttccagacctatgcgcattggcccagcagcaaataggaagacaa 421

                                                                       
Query: 181 caggggttcaggagagagtaccaattccaaatacaaatactcaaggagctcagtctgaca 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 422 caggggttcaggagagagtaccaattccaaatacaaatactcaaggagctcagtctgaca 481

                                                                       
Query: 241 atgatcctaacaataccaccatatttgttggcggccttgaccccaatgtcactgaagatg 300
           ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 482 atgatcctaacaataccaccatatttgttggtggccttgaccccaatgtcactgaagatg 541

                                                                       
Query: 301 ccttgaaacaagtgtttgctccatatggggaagtcgtccatgtcaagatccctgttggga 360
           |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 542 ccttgaaacaagtgtttgctccatatggggaagttgtccatgtcaagatccctgttggga 601

                                                                       
Query: 361 agagatgtggctttgttcagtatgctaacaggccttctgctgagcaagctctgcaattgc 420
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 602 agagatgtggctttgttcagtatgctaacaggccttctgctgagcaagctctgcaattgc 661

                                                                       
Query: 421 tgcaagggaccttggttggtggtcagaacgtgaggctttcatggggacgaagcccttcga 480
           |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
Sbjct: 662 tgcaagggaccttggttggtggtcagaatgtgaggctttcatggggacgaagcccttcaa 721

                                                                       
Query: 481 acaaacaaactcagcctcaggaagccacccagtggggtgcaggtgctgctgccggtgctg 540
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 722 acaaacaaactcagcctcaggaagccacccagtggggtgcaggtgctgctgctggtgctg 781

                                         
Query: 541 ctggtggttactatgctggatatggacaag 570
           ||||||||||||||||||||||||||||||
Sbjct: 782 ctggtggttactatgctggatatggacaag 811



to top

>ref|XM_473964.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1245

 Score =  289 bits (146), Expect = 5e-75
 Identities = 242/274 (88%)
 Strand = Plus / Plus

                                                                        
Query: 214  caaatactcaaggagctcagtctgacaatgatcctaacaataccaccatatttgttggcg 273
            ||||| ||||||||||||||||||| |||||||||||||||||||||||||| ||||| |
Sbjct: 776  caaatgctcaaggagctcagtctgagaatgatcctaacaataccaccatattcgttggtg 835

                                                                        
Query: 274  gccttgaccccaatgtcactgaagatgccttgaaacaagtgtttgctccatatggggaag 333
            | ||||||||||| ||||||||||||| |||||||||||| || ||||| ||||| ||||
Sbjct: 836  gtcttgaccccaacgtcactgaagatgtcttgaaacaagttttcgctccttatggagaag 895

                                                                        
Query: 334  tcgtccatgtcaagatccctgttgggaagagatgtggctttgttcagtatgctaacaggc 393
            | |||||||| ||||| ||||||||||| |||||||| |||||||| |||| ||||||||
Sbjct: 896  ttgtccatgttaagattcctgttgggaaaagatgtggttttgttcaatatgttaacaggc 955

                                                                        
Query: 394  cttctgctgagcaagctctgcaattgctgcaagggaccttggttggtggtcagaacgtga 453
            |||||||||||||||| |||  | |||| |||||||||||| ||||||| ||||| || |
Sbjct: 956  cttctgctgagcaagcactggcagtgctacaagggaccttgattggtgggcagaatgtta 1015

                                              
Query: 454  ggctttcatggggacgaagcccttcgaacaaaca 487
            | ||||| ||||| ||||||| ||| ||||||||
Sbjct: 1016 gactttcgtggggtcgaagcctttcaaacaaaca 1049



 Score =  262 bits (132), Expect = 1e-66
 Identities = 186/204 (91%)
 Strand = Plus / Plus

                                                                       
Query: 1   attacccttcagtgaagggcgcaaaagttgtgactgacaagatgacaatgcgttcaaagg 60
           |||||||||| || ||||| ||||||||||| |||||||| |||||||||||||||||||
Sbjct: 575 attacccttcggttaagggtgcaaaagttgtaactgacaaaatgacaatgcgttcaaagg 634

                                                                       
Query: 61  gttatgggtttgtcaagtttggtgatcccacagagcaagctcgtgccatgactgagatga 120
           ||||||||||||| || ||||||||||| ||||||||||||||||| |||||||| ||||
Sbjct: 635 gttatgggtttgtgaaatttggtgatcctacagagcaagctcgtgcaatgactgaaatga 694

                                                                       
Query: 121 atggaatgccctgttcttccagacctatgcgcattggtccagcagcaaataggaagacaa 180
           |||||||||  || ||||||||||| ||||| ||||||||||| ||||||| ||| ||||
Sbjct: 695 atggaatgctttgctcttccagaccgatgcgtattggtccagcggcaaataagaaaacaa 754

                                   
Query: 181 caggggttcaggagagagtaccaa 204
           ||||||||||||||||||||||||
Sbjct: 755 caggggttcaggagagagtaccaa 778



 Score = 48.1 bits (24), Expect = 0.032
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                            
Query: 539  tgctggtggttactatgctggatatggacaag 570
            ||||||||||||||||| ||| ||||||||||
Sbjct: 1089 tgctggtggttactatggtggctatggacaag 1120



to top

>dbj|AK120834.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023019P13, full
            insert sequence
          Length = 1599

 Score =  289 bits (146), Expect = 5e-75
 Identities = 242/274 (88%)
 Strand = Plus / Plus

                                                                        
Query: 214  caaatactcaaggagctcagtctgacaatgatcctaacaataccaccatatttgttggcg 273
            ||||| ||||||||||||||||||| |||||||||||||||||||||||||| ||||| |
Sbjct: 870  caaatgctcaaggagctcagtctgagaatgatcctaacaataccaccatattcgttggtg 929

                                                                        
Query: 274  gccttgaccccaatgtcactgaagatgccttgaaacaagtgtttgctccatatggggaag 333
            | ||||||||||| ||||||||||||| |||||||||||| || ||||| ||||| ||||
Sbjct: 930  gtcttgaccccaacgtcactgaagatgtcttgaaacaagttttcgctccttatggagaag 989

                                                                        
Query: 334  tcgtccatgtcaagatccctgttgggaagagatgtggctttgttcagtatgctaacaggc 393
            | |||||||| ||||| ||||||||||| |||||||| |||||||| |||| ||||||||
Sbjct: 990  ttgtccatgttaagattcctgttgggaaaagatgtggttttgttcaatatgttaacaggc 1049

                                                                        
Query: 394  cttctgctgagcaagctctgcaattgctgcaagggaccttggttggtggtcagaacgtga 453
            |||||||||||||||| |||  | |||| |||||||||||| ||||||| ||||| || |
Sbjct: 1050 cttctgctgagcaagcactggcagtgctacaagggaccttgattggtgggcagaatgtta 1109

                                              
Query: 454  ggctttcatggggacgaagcccttcgaacaaaca 487
            | ||||| ||||| ||||||| ||| ||||||||
Sbjct: 1110 gactttcgtggggtcgaagcctttcaaacaaaca 1143



 Score =  262 bits (132), Expect = 1e-66
 Identities = 186/204 (91%)
 Strand = Plus / Plus

                                                                       
Query: 1   attacccttcagtgaagggcgcaaaagttgtgactgacaagatgacaatgcgttcaaagg 60
           |||||||||| || ||||| ||||||||||| |||||||| |||||||||||||||||||
Sbjct: 669 attacccttcggttaagggtgcaaaagttgtaactgacaaaatgacaatgcgttcaaagg 728

                                                                       
Query: 61  gttatgggtttgtcaagtttggtgatcccacagagcaagctcgtgccatgactgagatga 120
           ||||||||||||| || ||||||||||| ||||||||||||||||| |||||||| ||||
Sbjct: 729 gttatgggtttgtgaaatttggtgatcctacagagcaagctcgtgcaatgactgaaatga 788

                                                                       
Query: 121 atggaatgccctgttcttccagacctatgcgcattggtccagcagcaaataggaagacaa 180
           |||||||||  || ||||||||||| ||||| ||||||||||| ||||||| ||| ||||
Sbjct: 789 atggaatgctttgctcttccagaccgatgcgtattggtccagcggcaaataagaaaacaa 848

                                   
Query: 181 caggggttcaggagagagtaccaa 204
           ||||||||||||||||||||||||
Sbjct: 849 caggggttcaggagagagtaccaa 872



 Score = 48.1 bits (24), Expect = 0.032
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                            
Query: 539  tgctggtggttactatgctggatatggacaag 570
            ||||||||||||||||| ||| ||||||||||
Sbjct: 1183 tgctggtggttactatggtggctatggacaag 1214



to top

>gb|BT018319.1| Zea mays clone EL01T0208A09.c mRNA sequence
          Length = 1019

 Score =  260 bits (131), Expect = 4e-66
 Identities = 248/287 (86%)
 Strand = Plus / Plus

                                                                       
Query: 214 caaatactcaaggagctcagtctgacaatgatcctaacaataccaccatatttgttggcg 273
           ||||| ||||||||||||||||||| |||||||||||||||||||| ||||||||||| |
Sbjct: 227 caaattctcaaggagctcagtctgagaatgatcctaacaataccactatatttgttggtg 286

                                                                       
Query: 274 gccttgaccccaatgtcactgaagatgccttgaaacaagtgtttgctccatatggggaag 333
           | |||||||||||||||||||||||| || | |||||||| ||| |||| || || ||||
Sbjct: 287 ggcttgaccccaatgtcactgaagataccctaaaacaagttttttctccttacggtgaag 346

                                                                       
Query: 334 tcgtccatgtcaagatccctgttgggaagagatgtggctttgttcagtatgctaacaggc 393
           |||||||||| |||||||||||||||||||||||||| ||||||||||  | || ||| |
Sbjct: 347 tcgtccatgttaagatccctgttgggaagagatgtggttttgttcagttcgttaccagac 406

                                                                       
Query: 394 cttctgctgagcaagctctgcaattgctgcaagggaccttggttggtggtcagaacgtga 453
           |||||||||| ||||| |||| | ||||||||||| ||||| ||||||  ||||| ||  
Sbjct: 407 cttctgctgaacaagcgctgctaatgctgcaaggggccttgattggtgcacagaatgttc 466

                                                          
Query: 454 ggctttcatggggacgaagcccttcgaacaaacaaactcagcctcag 500
           | |||||||||||  ||||||  |||||||| ||  |||||||||||
Sbjct: 467 gactttcatggggtagaagcctgtcgaacaagcaggctcagcctcag 513



 Score =  170 bits (86), Expect = 3e-39
 Identities = 134/150 (89%)
 Strand = Plus / Plus

                                                                       
Query: 26  agttgtgactgacaagatgacaatgcgttcaaagggttatgggtttgtcaagtttggtga 85
           |||||||||||| ||  ||||||||||  ||||||||||||| ||||| || ||||||||
Sbjct: 45  agttgtgactgataaattgacaatgcgcacaaagggttatggatttgtgaaatttggtga 104

                                                                       
Query: 86  tcccacagagcaagctcgtgccatgactgagatgaatggaatgccctgttcttccagacc 145
           ||| ||||||||||||||||| |||||||| |||||||||||||| ||||||||||| ||
Sbjct: 105 tcctacagagcaagctcgtgcaatgactgaaatgaatggaatgccttgttcttccaggcc 164

                                         
Query: 146 tatgcgcattggtccagcagcaaataggaa 175
           |||||| |||||||| ||||||| ||||||
Sbjct: 165 tatgcgtattggtcctgcagcaagtaggaa 194



to top

>gb|AF402959.1| Oryza sativa chromosome 4 clones V17 and 214, genomic sequence
          Length = 64224

 Score =  258 bits (130), Expect = 2e-65
 Identities = 181/198 (91%)
 Strand = Plus / Plus

                                                                         
Query: 1     attacccttcagtgaagggcgcaaaagttgtgactgacaagatgacaatgcgttcaaagg 60
             |||||||||| || ||||| ||||||||||| |||||||| |||||||||||||||||||
Sbjct: 21516 attacccttcggttaagggtgcaaaagttgtaactgacaaaatgacaatgcgttcaaagg 21575

                                                                         
Query: 61    gttatgggtttgtcaagtttggtgatcccacagagcaagctcgtgccatgactgagatga 120
             ||||||||||||| || ||||||||||| ||||||||||||||||| |||||||| ||||
Sbjct: 21576 gttatgggtttgtgaaatttggtgatcctacagagcaagctcgtgcgatgactgaaatga 21635

                                                                         
Query: 121   atggaatgccctgttcttccagacctatgcgcattggtccagcagcaaataggaagacaa 180
             |||||||||  |||||||||||||| ||||| ||||||||||| ||||||| ||| ||||
Sbjct: 21636 atggaatgctttgttcttccagaccgatgcgtattggtccagcggcaaataagaaaacaa 21695

                               
Query: 181   caggggttcaggagagag 198
             ||||||||||||||||||
Sbjct: 21696 caggggttcaggagagag 21713



 Score =  135 bits (68), Expect = 2e-28
 Identities = 116/132 (87%)
 Strand = Plus / Plus

                                                                         
Query: 261   atatttgttggcggccttgaccccaatgtcactgaagatgccttgaaacaagtgtttgct 320
             ||||| ||||| |||||||||||||  ||||||||||||| |||||||||||| || |||
Sbjct: 23208 atattcgttggtggccttgaccccagcgtcactgaagatgtcttgaaacaagttttcgct 23267

                                                                         
Query: 321   ccatatggggaagtcgtccatgtcaagatccctgttgggaagagatgtggctttgttcag 380
             || ||||| ||||| |||||||| ||||| ||||||||||| |||||||| |||||||| 
Sbjct: 23268 ccttatggagaagttgtccatgttaagattcctgttgggaaaagatgtggttttgttcaa 23327

                         
Query: 381   tatgctaacagg 392
             |||| |||||||
Sbjct: 23328 tatgttaacagg 23339



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 86/99 (86%)
 Strand = Plus / Plus

                                                                         
Query: 389   caggccttctgctgagcaagctctgcaattgctgcaagggaccttggttggtggtcagaa 448
             ||||||||||||||||||||| |||  | |||| |||||||||||| ||||||| |||||
Sbjct: 23442 caggccttctgctgagcaagcactggcagtgctacaagggaccttgattggtgggcagaa 23501

                                                    
Query: 449   cgtgaggctttcatggggacgaagcccttcgaacaaaca 487
              || || ||||||||||| ||||||| ||| ||||||||
Sbjct: 23502 tgttagactttcatggggtcgaagcctttcaaacaaaca 23540



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 45/47 (95%)
 Strand = Plus / Plus

                                                            
Query: 214   caaatactcaaggagctcagtctgacaatgatcctaacaataccacc 260
             ||||| ||||||||||||||||||| |||||||||||||||||||||
Sbjct: 23079 caaatgctcaaggagctcagtctgagaatgatcctaacaataccacc 23125



 Score = 48.1 bits (24), Expect = 0.032
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                             
Query: 539   tgctggtggttactatgctggatatggacaag 570
             ||||||||||||||||| ||| ||||||||||
Sbjct: 23672 tgctggtggttactatggtggctatggacaag 23703



to top

>gb|AY109460.1| Zea mays CL862_1 mRNA sequence
          Length = 1796

 Score =  252 bits (127), Expect = 1e-63
 Identities = 247/287 (86%)
 Strand = Plus / Plus

                                                                        
Query: 214  caaatactcaaggagctcagtctgacaatgatcctaacaataccaccatatttgttggcg 273
            ||||| ||||||||||||||||||| |||||||||||||||||||| ||||||||||| |
Sbjct: 967  caaattctcaaggagctcagtctgagaatgatcctaacaataccactatatttgttggtg 1026

                                                                        
Query: 274  gccttgaccccaatgtcactgaagatgccttgaaacaagtgtttgctccatatggggaag 333
            | ||||||||||||||||||||||||| | | |||||||  ||| |||| ||||| ||||
Sbjct: 1027 ggcttgaccccaatgtcactgaagatgtcctaaaacaagcattttctccttatggcgaag 1086

                                                                        
Query: 334  tcgtccatgtcaagatccctgttgggaagagatgtggctttgttcagtatgctaacaggc 393
            || ||||||| |||||||||||||||||||||||||| ||||||||||  | || ||| |
Sbjct: 1087 tcatccatgttaagatccctgttgggaagagatgtggttttgttcagttcgttaccagac 1146

                                                                        
Query: 394  cttctgctgagcaagctctgcaattgctgcaagggaccttggttggtggtcagaacgtga 453
            ||||||||||||| || |||| | || |||||||| ||||| ||||||  ||||| ||  
Sbjct: 1147 cttctgctgagcaggcgctgctaatgttgcaaggggccttgattggtgcacagaatgttc 1206

                                                           
Query: 454  ggctttcatggggacgaagcccttcgaacaaacaaactcagcctcag 500
            ||||||| |||||  ||||||  |||||||| || ||||||||||||
Sbjct: 1207 ggctttcgtggggtagaagcctgtcgaacaagcagactcagcctcag 1253



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 81/92 (88%)
 Strand = Plus / Plus

                                                                       
Query: 12  gtgaagggcgcaaaagttgtgactgacaagatgacaatgcgttcaaagggttatgggttt 71
           |||||||| ||||||||||||||||| ||  ||||||||||  | ||||||||||| |||
Sbjct: 771 gtgaagggtgcaaaagttgtgactgataaattgacaatgcgcaccaagggttatggattt 830

                                           
Query: 72  gtcaagtttggtgatcccacagagcaagctcg 103
           || || ||||||||||| ||||||||||||||
Sbjct: 831 gtgaaatttggtgatcctacagagcaagctcg 862



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 132 tgttcttccagacctatgcgcattggtccagcagcaaatagg 173
           ||||||||||| |||||||| |||||||| ||||||| ||||
Sbjct: 891 tgttcttccaggcctatgcgtattggtcctgcagcaagtagg 932



to top

>emb|AL606669.4|OSJN00106 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0060E08,
             complete sequence
          Length = 166951

 Score =  250 bits (126), Expect = 4e-63
 Identities = 180/198 (90%)
 Strand = Plus / Plus

                                                                         
Query: 1     attacccttcagtgaagggcgcaaaagttgtgactgacaagatgacaatgcgttcaaagg 60
             |||||||||| || ||||| ||||||||||| |||||||| |||||||||||||||||||
Sbjct: 27442 attacccttcggttaagggtgcaaaagttgtaactgacaaaatgacaatgcgttcaaagg 27501

                                                                         
Query: 61    gttatgggtttgtcaagtttggtgatcccacagagcaagctcgtgccatgactgagatga 120
             ||||||||||||| || ||||||||||| ||||||||||||||||| |||||||| ||||
Sbjct: 27502 gttatgggtttgtgaaatttggtgatcctacagagcaagctcgtgcaatgactgaaatga 27561

                                                                         
Query: 121   atggaatgccctgttcttccagacctatgcgcattggtccagcagcaaataggaagacaa 180
             |||||||||  || ||||||||||| ||||| ||||||||||| ||||||| ||| ||||
Sbjct: 27562 atggaatgctttgctcttccagaccgatgcgtattggtccagcggcaaataagaaaacaa 27621

                               
Query: 181   caggggttcaggagagag 198
             ||||||||||||||||||
Sbjct: 27622 caggggttcaggagagag 27639



 Score =  135 bits (68), Expect = 2e-28
 Identities = 116/132 (87%)
 Strand = Plus / Plus

                                                                         
Query: 261   atatttgttggcggccttgaccccaatgtcactgaagatgccttgaaacaagtgtttgct 320
             ||||| ||||| || ||||||||||| ||||||||||||| |||||||||||| || |||
Sbjct: 29199 atattcgttggtggtcttgaccccaacgtcactgaagatgtcttgaaacaagttttcgct 29258

                                                                         
Query: 321   ccatatggggaagtcgtccatgtcaagatccctgttgggaagagatgtggctttgttcag 380
             || ||||| ||||| |||||||| ||||| ||||||||||| |||||||| |||||||| 
Sbjct: 29259 ccttatggagaagttgtccatgttaagattcctgttgggaaaagatgtggttttgttcaa 29318

                         
Query: 381   tatgctaacagg 392
             |||| |||||||
Sbjct: 29319 tatgttaacagg 29330



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 85/99 (85%)
 Strand = Plus / Plus

                                                                         
Query: 389   caggccttctgctgagcaagctctgcaattgctgcaagggaccttggttggtggtcagaa 448
             ||||||||||||||||||||| |||  | |||| |||||||||||| ||||||| |||||
Sbjct: 29432 caggccttctgctgagcaagcactggcagtgctacaagggaccttgattggtgggcagaa 29491

                                                    
Query: 449   cgtgaggctttcatggggacgaagcccttcgaacaaaca 487
              || || ||||| ||||| ||||||| ||| ||||||||
Sbjct: 29492 tgttagactttcgtggggtcgaagcctttcaaacaaaca 29530



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 45/47 (95%)
 Strand = Plus / Plus

                                                            
Query: 214   caaatactcaaggagctcagtctgacaatgatcctaacaataccacc 260
             ||||| ||||||||||||||||||| |||||||||||||||||||||
Sbjct: 29070 caaatgctcaaggagctcagtctgagaatgatcctaacaataccacc 29116



 Score = 48.1 bits (24), Expect = 0.032
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                             
Query: 539   tgctggtggttactatgctggatatggacaag 570
             ||||||||||||||||| ||| ||||||||||
Sbjct: 29663 tgctggtggttactatggtggctatggacaag 29694



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  250 bits (126), Expect = 4e-63
 Identities = 180/198 (90%)
 Strand = Plus / Plus

                                                                            
Query: 1        attacccttcagtgaagggcgcaaaagttgtgactgacaagatgacaatgcgttcaaagg 60
                |||||||||| || ||||| ||||||||||| |||||||| |||||||||||||||||||
Sbjct: 31854576 attacccttcggttaagggtgcaaaagttgtaactgacaaaatgacaatgcgttcaaagg 31854635

                                                                            
Query: 61       gttatgggtttgtcaagtttggtgatcccacagagcaagctcgtgccatgactgagatga 120
                ||||||||||||| || ||||||||||| ||||||||||||||||| |||||||| ||||
Sbjct: 31854636 gttatgggtttgtgaaatttggtgatcctacagagcaagctcgtgcaatgactgaaatga 31854695

                                                                            
Query: 121      atggaatgccctgttcttccagacctatgcgcattggtccagcagcaaataggaagacaa 180
                |||||||||  || ||||||||||| ||||| ||||||||||| ||||||| ||| ||||
Sbjct: 31854696 atggaatgctttgctcttccagaccgatgcgtattggtccagcggcaaataagaaaacaa 31854755

                                  
Query: 181      caggggttcaggagagag 198
                ||||||||||||||||||
Sbjct: 31854756 caggggttcaggagagag 31854773



 Score =  135 bits (68), Expect = 2e-28
 Identities = 116/132 (87%)
 Strand = Plus / Plus

                                                                            
Query: 261      atatttgttggcggccttgaccccaatgtcactgaagatgccttgaaacaagtgtttgct 320
                ||||| ||||| || ||||||||||| ||||||||||||| |||||||||||| || |||
Sbjct: 31856333 atattcgttggtggtcttgaccccaacgtcactgaagatgtcttgaaacaagttttcgct 31856392

                                                                            
Query: 321      ccatatggggaagtcgtccatgtcaagatccctgttgggaagagatgtggctttgttcag 380
                || ||||| ||||| |||||||| ||||| ||||||||||| |||||||| |||||||| 
Sbjct: 31856393 ccttatggagaagttgtccatgttaagattcctgttgggaaaagatgtggttttgttcaa 31856452

                            
Query: 381      tatgctaacagg 392
                |||| |||||||
Sbjct: 31856453 tatgttaacagg 31856464



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 85/99 (85%)
 Strand = Plus / Plus

                                                                            
Query: 389      caggccttctgctgagcaagctctgcaattgctgcaagggaccttggttggtggtcagaa 448
                ||||||||||||||||||||| |||  | |||| |||||||||||| ||||||| |||||
Sbjct: 31856566 caggccttctgctgagcaagcactggcagtgctacaagggaccttgattggtgggcagaa 31856625

                                                       
Query: 449      cgtgaggctttcatggggacgaagcccttcgaacaaaca 487
                 || || ||||| ||||| ||||||| ||| ||||||||
Sbjct: 31856626 tgttagactttcgtggggtcgaagcctttcaaacaaaca 31856664



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 45/47 (95%)
 Strand = Plus / Plus

                                                               
Query: 214      caaatactcaaggagctcagtctgacaatgatcctaacaataccacc 260
                ||||| ||||||||||||||||||| |||||||||||||||||||||
Sbjct: 31856204 caaatgctcaaggagctcagtctgagaatgatcctaacaataccacc 31856250



 Score = 48.1 bits (24), Expect = 0.032
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                                
Query: 539      tgctggtggttactatgctggatatggacaag 570
                ||||||||||||||||| ||| ||||||||||
Sbjct: 31856797 tgctggtggttactatggtggctatggacaag 31856828



to top

>gb|AY107345.1| Zea mays PCO104090 mRNA sequence
          Length = 999

 Score =  214 bits (108), Expect = 2e-52
 Identities = 237/280 (84%)
 Strand = Plus / Plus

                                                                       
Query: 220 ctcaaggagctcagtctgacaatgatcctaacaataccaccatatttgttggcggccttg 279
           |||| |||| ||||||||||||||||||||||||||| ||||| |||||||| || ||||
Sbjct: 252 ctcagggagttcagtctgacaatgatcctaacaatacaaccatttttgttggtggtcttg 311

                                                                       
Query: 280 accccaatgtcactgaagatgccttgaaacaagtgtttgctccatatggggaagtcgtcc 339
           ||||||||||||||||||||   ||||||||||| ||  | || |||||||| || ||||
Sbjct: 312 accccaatgtcactgaagatatgttgaaacaagttttcaccccttatggggacgtagtcc 371

                                                                       
Query: 340 atgtcaagatccctgttgggaagagatgtggctttgttcagtatgctaacaggccttctg 399
           |||| ||||| |||||||| || |||||||| |||||||| |||||||||||  |||| |
Sbjct: 372 atgttaagattcctgttggcaaaagatgtggttttgttcaatatgctaacagatcttcgg 431

                                                                       
Query: 400 ctgagcaagctctgcaattgctgcaagggaccttggttggtggtcagaacgtgaggcttt 459
           | ||| | ||  ||  | | |||||||| ||||||||||| || ||||| ||||||||||
Sbjct: 432 cagaggaggcattggtaattctgcaaggcaccttggttggagggcagaatgtgaggcttt 491

                                                   
Query: 460 catggggacgaagcccttcgaacaaacaaactcagcctca 499
           ||||||| || |||||||| |||||||||  |||||||||
Sbjct: 492 catggggtcgcagcccttcaaacaaacaagttcagcctca 531



 Score =  109 bits (55), Expect = 1e-20
 Identities = 91/103 (88%)
 Strand = Plus / Plus

                                                                       
Query: 55  caaagggttatgggtttgtcaagtttggtgatcccacagagcaagctcgtgccatgactg 114
           ||||||||||||| ||||| |||||||||||||| |  |||||||||||||| |||||||
Sbjct: 28  caaagggttatggttttgtgaagtttggtgatcctaatgagcaagctcgtgcaatgactg 87

                                                      
Query: 115 agatgaatggaatgccctgttcttccagacctatgcgcattgg 157
           |||||||||| ||||  |||||||| || |||||||| |||||
Sbjct: 88  agatgaatggcatgctatgttcttctaggcctatgcgtattgg 130



to top

>ref|XM_480466.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1284

 Score =  182 bits (92), Expect = 8e-43
 Identities = 233/280 (83%)
 Strand = Plus / Plus

                                                                        
Query: 220  ctcaaggagctcagtctgacaatgatcctaacaataccaccatatttgttggcggccttg 279
            ||||||||| ||||||||||| |||||||| ||||||||| ||||||||||| |||||||
Sbjct: 830  ctcaaggagttcagtctgacagtgatcctagcaataccactatatttgttggtggccttg 889

                                                                        
Query: 280  accccaatgtcactgaagatgccttgaaacaagtgtttgctccatatggggaagtcgtcc 339
            | |||| ||||||||| |||   ||||||||||| ||  |||| ||||| || || ||||
Sbjct: 890  atcccagtgtcactgacgatatgttgaaacaagttttcactccctatggagatgtggtcc 949

                                                                        
Query: 340  atgtcaagatccctgttgggaagagatgtggctttgttcagtatgctaacaggccttctg 399
            |||| |||||||| ||||| || |||||||| |||||||| | |||||||||  ||||||
Sbjct: 950  atgttaagatcccagttggaaaaagatgtggttttgttcaatttgctaacagagcttctg 1009

                                                                        
Query: 400  ctgagcaagctctgcaattgctgcaagggaccttggttggtggtcagaacgtgaggcttt 459
            | ||  ||||| ||  | | || ||||| |||||| |||| || ||||| ||||||||||
Sbjct: 1010 cagatgaagctttggtacttctacaaggtaccttgattggaggacagaatgtgaggcttt 1069

                                                    
Query: 460  catggggacgaagcccttcgaacaaacaaactcagcctca 499
            ||||||| || |||||||| || | |||| ||||||||||
Sbjct: 1070 catggggccgcagcccttcaaatagacaagctcagcctca 1109



 Score =  131 bits (66), Expect = 3e-27
 Identities = 168/202 (83%)
 Strand = Plus / Plus

                                                                       
Query: 1   attacccttcagtgaagggcgcaaaagttgtgactgacaagatgacaatgcgttcaaagg 60
           ||||||| || |||||||| ||||| |||||||| || || |||||||||||||||||||
Sbjct: 623 attacccatctgtgaagggtgcaaaggttgtgacagataaaatgacaatgcgttcaaagg 682

                                                                       
Query: 61  gttatgggtttgtcaagtttggtgatcccacagagcaagctcgtgccatgactgagatga 120
           | ||||| || ||||| |||||||||||  | |||||||| ||||| ||||| || ||||
Sbjct: 683 gctatggcttcgtcaaatttggtgatccttccgagcaagcccgtgcaatgacagaaatga 742

                                                                       
Query: 121 atggaatgccctgttcttccagacctatgcgcattggtccagcagcaaataggaagacaa 180
           |||| |||   |||||||| ||||||||||| || || ||||| ||||||| |||  |||
Sbjct: 743 atgggatggtttgttcttcaagacctatgcgtatcggcccagctgcaaataagaaagcaa 802

                                 
Query: 181 caggggttcaggagagagtacc 202
           | || ||||| |||| ||||||
Sbjct: 803 ctggagttcaagagaaagtacc 824



to top

>dbj|AK072804.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023135B10, full
            insert sequence
          Length = 1693

 Score =  182 bits (92), Expect = 8e-43
 Identities = 233/280 (83%)
 Strand = Plus / Plus

                                                                        
Query: 220  ctcaaggagctcagtctgacaatgatcctaacaataccaccatatttgttggcggccttg 279
            ||||||||| ||||||||||| |||||||| ||||||||| ||||||||||| |||||||
Sbjct: 982  ctcaaggagttcagtctgacagtgatcctagcaataccactatatttgttggtggccttg 1041

                                                                        
Query: 280  accccaatgtcactgaagatgccttgaaacaagtgtttgctccatatggggaagtcgtcc 339
            | |||| ||||||||| |||   ||||||||||| ||  |||| ||||| || || ||||
Sbjct: 1042 atcccagtgtcactgacgatatgttgaaacaagttttcactccctatggagatgtggtcc 1101

                                                                        
Query: 340  atgtcaagatccctgttgggaagagatgtggctttgttcagtatgctaacaggccttctg 399
            |||| |||||||| ||||| || |||||||| |||||||| | |||||||||  ||||||
Sbjct: 1102 atgttaagatcccagttggaaaaagatgtggttttgttcaatttgctaacagagcttctg 1161

                                                                        
Query: 400  ctgagcaagctctgcaattgctgcaagggaccttggttggtggtcagaacgtgaggcttt 459
            | ||  ||||| ||  | | || ||||| |||||| |||| || ||||| ||||||||||
Sbjct: 1162 cagatgaagctttggtacttctacaaggtaccttgattggaggacagaatgtgaggcttt 1221

                                                    
Query: 460  catggggacgaagcccttcgaacaaacaaactcagcctca 499
            ||||||| || |||||||| || | |||| ||||||||||
Sbjct: 1222 catggggccgcagcccttcaaatagacaagctcagcctca 1261



 Score =  131 bits (66), Expect = 3e-27
 Identities = 168/202 (83%)
 Strand = Plus / Plus

                                                                       
Query: 1   attacccttcagtgaagggcgcaaaagttgtgactgacaagatgacaatgcgttcaaagg 60
           ||||||| || |||||||| ||||| |||||||| || || |||||||||||||||||||
Sbjct: 775 attacccatctgtgaagggtgcaaaggttgtgacagataaaatgacaatgcgttcaaagg 834

                                                                       
Query: 61  gttatgggtttgtcaagtttggtgatcccacagagcaagctcgtgccatgactgagatga 120
           | ||||| || ||||| |||||||||||  | |||||||| ||||| ||||| || ||||
Sbjct: 835 gctatggcttcgtcaaatttggtgatccttccgagcaagcccgtgcaatgacagaaatga 894

                                                                       
Query: 121 atggaatgccctgttcttccagacctatgcgcattggtccagcagcaaataggaagacaa 180
           |||| |||   |||||||| ||||||||||| || || ||||| ||||||| |||  |||
Sbjct: 895 atgggatggtttgttcttcaagacctatgcgtatcggcccagctgcaaataagaaagcaa 954

                                 
Query: 181 caggggttcaggagagagtacc 202
           | || ||||| |||| ||||||
Sbjct: 955 ctggagttcaagagaaagtacc 976



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
               sequence
          Length = 28434780

 Score =  125 bits (63), Expect = 2e-25
 Identities = 144/171 (84%)
 Strand = Plus / Minus

                                                                           
Query: 1       attacccttcagtgaagggcgcaaaagttgtgactgacaagatgacaatgcgttcaaagg 60
               ||||||| || |||||||| ||||| |||||||| || || |||||||||||||||||||
Sbjct: 5265463 attacccatctgtgaagggtgcaaaggttgtgacagataaaatgacaatgcgttcaaagg 5265404

                                                                           
Query: 61      gttatgggtttgtcaagtttggtgatcccacagagcaagctcgtgccatgactgagatga 120
               | ||||| || ||||| |||||||||||  | |||||||| ||||| ||||| || ||||
Sbjct: 5265403 gctatggcttcgtcaaatttggtgatccttccgagcaagcccgtgcaatgacagaaatga 5265344

                                                                  
Query: 121     atggaatgccctgttcttccagacctatgcgcattggtccagcagcaaata 171
               |||| |||   |||||||| ||||||||||| || || ||||| |||||||
Sbjct: 5265343 atgggatggtttgttcttcaagacctatgcgtatcggcccagctgcaaata 5265293



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 111/132 (84%)
 Strand = Plus / Minus

                                                                           
Query: 261     atatttgttggcggccttgaccccaatgtcactgaagatgccttgaaacaagtgtttgct 320
               ||||||||||| |||||||| |||| ||||||||| |||   ||||||||||| ||  ||
Sbjct: 5263180 atatttgttggtggccttgatcccagtgtcactgacgatatgttgaaacaagttttcact 5263121

                                                                           
Query: 321     ccatatggggaagtcgtccatgtcaagatccctgttgggaagagatgtggctttgttcag 380
               || ||||| || || |||||||| |||||||| ||||| || |||||||| |||||||| 
Sbjct: 5263120 ccctatggagatgtggtccatgttaagatcccagttggaaaaagatgtggttttgttcaa 5263061

                           
Query: 381     tatgctaacagg 392
               | ||||||||||
Sbjct: 5263060 tttgctaacagg 5263049



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                       
Query: 220     ctcaaggagctcagtctgacaatgatcctaacaataccac 259
               ||||||||| ||||||||||| |||||||| |||||||||
Sbjct: 5263303 ctcaaggagttcagtctgacagtgatcctagcaataccac 5263264



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                       
Query: 423     caagggaccttggttggtggtcagaacgtgaggctttcatggggacgaagcccttc 478
               ||||| |||||| |||| || ||||| ||||||||||||||||| || ||||||||
Sbjct: 5262921 caaggtaccttgattggaggacagaatgtgaggctttcatggggccgcagcccttc 5262866



to top

>dbj|AP005531.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
              clone:B1099H05
          Length = 186036

 Score =  125 bits (63), Expect = 2e-25
 Identities = 144/171 (84%)
 Strand = Plus / Minus

                                                                          
Query: 1      attacccttcagtgaagggcgcaaaagttgtgactgacaagatgacaatgcgttcaaagg 60
              ||||||| || |||||||| ||||| |||||||| || || |||||||||||||||||||
Sbjct: 133819 attacccatctgtgaagggtgcaaaggttgtgacagataaaatgacaatgcgttcaaagg 133760

                                                                          
Query: 61     gttatgggtttgtcaagtttggtgatcccacagagcaagctcgtgccatgactgagatga 120
              | ||||| || ||||| |||||||||||  | |||||||| ||||| ||||| || ||||
Sbjct: 133759 gctatggcttcgtcaaatttggtgatccttccgagcaagcccgtgcaatgacagaaatga 133700

                                                                 
Query: 121    atggaatgccctgttcttccagacctatgcgcattggtccagcagcaaata 171
              |||| |||   |||||||| ||||||||||| || || ||||| |||||||
Sbjct: 133699 atgggatggtttgttcttcaagacctatgcgtatcggcccagctgcaaata 133649



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 111/132 (84%)
 Strand = Plus / Minus

                                                                          
Query: 261    atatttgttggcggccttgaccccaatgtcactgaagatgccttgaaacaagtgtttgct 320
              ||||||||||| |||||||| |||| ||||||||| |||   ||||||||||| ||  ||
Sbjct: 131536 atatttgttggtggccttgatcccagtgtcactgacgatatgttgaaacaagttttcact 131477

                                                                          
Query: 321    ccatatggggaagtcgtccatgtcaagatccctgttgggaagagatgtggctttgttcag 380
              || ||||| || || |||||||| |||||||| ||||| || |||||||| |||||||| 
Sbjct: 131476 ccctatggagatgtggtccatgttaagatcccagttggaaaaagatgtggttttgttcaa 131417

                          
Query: 381    tatgctaacagg 392
              | ||||||||||
Sbjct: 131416 tttgctaacagg 131405



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                      
Query: 220    ctcaaggagctcagtctgacaatgatcctaacaataccac 259
              ||||||||| ||||||||||| |||||||| |||||||||
Sbjct: 131659 ctcaaggagttcagtctgacagtgatcctagcaataccac 131620



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                      
Query: 423    caagggaccttggttggtggtcagaacgtgaggctttcatggggacgaagcccttc 478
              ||||| |||||| |||| || ||||| ||||||||||||||||| || ||||||||
Sbjct: 131277 caaggtaccttgattggaggacagaatgtgaggctttcatggggccgcagcccttc 131222



to top

>dbj|AP005505.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0610E02
          Length = 135816

 Score =  125 bits (63), Expect = 2e-25
 Identities = 144/171 (84%)
 Strand = Plus / Minus

                                                                         
Query: 1     attacccttcagtgaagggcgcaaaagttgtgactgacaagatgacaatgcgttcaaagg 60
             ||||||| || |||||||| ||||| |||||||| || || |||||||||||||||||||
Sbjct: 57051 attacccatctgtgaagggtgcaaaggttgtgacagataaaatgacaatgcgttcaaagg 56992

                                                                         
Query: 61    gttatgggtttgtcaagtttggtgatcccacagagcaagctcgtgccatgactgagatga 120
             | ||||| || ||||| |||||||||||  | |||||||| ||||| ||||| || ||||
Sbjct: 56991 gctatggcttcgtcaaatttggtgatccttccgagcaagcccgtgcaatgacagaaatga 56932

                                                                
Query: 121   atggaatgccctgttcttccagacctatgcgcattggtccagcagcaaata 171
             |||| |||   |||||||| ||||||||||| || || ||||| |||||||
Sbjct: 56931 atgggatggtttgttcttcaagacctatgcgtatcggcccagctgcaaata 56881



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 111/132 (84%)
 Strand = Plus / Minus

                                                                         
Query: 261   atatttgttggcggccttgaccccaatgtcactgaagatgccttgaaacaagtgtttgct 320
             ||||||||||| |||||||| |||| ||||||||| |||   ||||||||||| ||  ||
Sbjct: 54768 atatttgttggtggccttgatcccagtgtcactgacgatatgttgaaacaagttttcact 54709

                                                                         
Query: 321   ccatatggggaagtcgtccatgtcaagatccctgttgggaagagatgtggctttgttcag 380
             || ||||| || || |||||||| |||||||| ||||| || |||||||| |||||||| 
Sbjct: 54708 ccctatggagatgtggtccatgttaagatcccagttggaaaaagatgtggttttgttcaa 54649

                         
Query: 381   tatgctaacagg 392
             | ||||||||||
Sbjct: 54648 tttgctaacagg 54637



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                     
Query: 220   ctcaaggagctcagtctgacaatgatcctaacaataccac 259
             ||||||||| ||||||||||| |||||||| |||||||||
Sbjct: 54891 ctcaaggagttcagtctgacagtgatcctagcaataccac 54852



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                     
Query: 423   caagggaccttggttggtggtcagaacgtgaggctttcatggggacgaagcccttc 478
             ||||| |||||| |||| || ||||| ||||||||||||||||| || ||||||||
Sbjct: 54509 caaggtaccttgattggaggacagaatgtgaggctttcatggggccgcagcccttc 54454



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                                
Query: 151      gcattggtccagcagcaaataggaagacaacaggggttcaggagagag 198
                ||||||||||||||||||||| ||  ||||| ||||||||||||||||
Sbjct: 18414602 gcattggtccagcagcaaataagagaacaactggggttcaggagagag 18414555



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                                 
Query: 93       gagcaagctcgtgccatgactgagatgaatgga 125
                |||||| | ||||| ||||||||||||||||||
Sbjct: 19868286 gagcaaacacgtgctatgactgagatgaatgga 19868318



to top

>dbj|AP003864.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
            clone:OJ1058_B11
          Length = 102824

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                            
Query: 151  gcattggtccagcagcaaataggaagacaacaggggttcaggagagag 198
            ||||||||||||||||||||| ||  ||||| ||||||||||||||||
Sbjct: 6450 gcattggtccagcagcaaataagagaacaactggggttcaggagagag 6403



to top

>dbj|AP004266.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
              clone:P0038F10
          Length = 153929

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                              
Query: 151    gcattggtccagcagcaaataggaagacaacaggggttcaggagagag 198
              ||||||||||||||||||||| ||  ||||| ||||||||||||||||
Sbjct: 144097 gcattggtccagcagcaaataagagaacaactggggttcaggagagag 144050



to top

>gb|AY107267.1| Zea mays PCO073795 mRNA sequence
          Length = 1599

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 243 gatcctaacaataccaccatatttgttggcggccttgaccc 283
           ||||| |||||||| ||  ||||||||||||||||||||||
Sbjct: 935 gatccgaacaatactactgtatttgttggcggccttgaccc 975



to top

>gb|BT012902.1| Lycopersicon esculentum clone 114011F, mRNA sequence
          Length = 1635

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                    
Query: 252  aataccaccatatttgttggcggccttgaccccaatgtca 291
            |||||||| || |||||||| || ||||||||||||||||
Sbjct: 975  aataccacaatttttgttggaggtcttgaccccaatgtca 1014



to top

>ref|NM_101037.2| Arabidopsis thaliana ATRBP45B; RNA binding AT1G11650 (ATRBP45B)
            transcript variant AT1G11650.2 mRNA, complete cds
          Length = 1561

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                               
Query: 453  aggctttcatggggacgaagcccttcgaacaaaca 487
            ||||| |||||||| ||||| ||||||||||||||
Sbjct: 1100 aggctctcatggggccgaagtccttcgaacaaaca 1134



to top

>ref|NM_179310.1| Arabidopsis thaliana ATRBP45B; RNA binding AT1G11650 (ATRBP45B)
            transcript variant AT1G11650.1 mRNA, complete cds
          Length = 1562

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                               
Query: 453  aggctttcatggggacgaagcccttcgaacaaaca 487
            ||||| |||||||| ||||| ||||||||||||||
Sbjct: 1101 aggctctcatggggccgaagtccttcgaacaaaca 1135



to top

>gb|BT018995.1| Zea mays clone Contig483.F mRNA sequence
          Length = 1456

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 266 tgttggcggccttgaccccaatgtcactgaagatg 300
           |||||| || |||||||||||||||| ||||||||
Sbjct: 750 tgttggtgggcttgaccccaatgtcagtgaagatg 784



to top

>gb|AC132580.2| Mus musculus BAC clone RP24-388H18 from chromosome 9, complete sequence
          Length = 127200

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 522   ggtgctgctgccggtgctgctggtggt 548
             ||||||||||| |||||||||||||||
Sbjct: 31679 ggtgctgctgctggtgctgctggtggt 31653



to top

>gb|AC166078.2| Mus musculus BAC clone RP23-13G1 from chromosome 9, complete sequence
          Length = 225128

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 522    ggtgctgctgccggtgctgctggtggt 548
              ||||||||||| |||||||||||||||
Sbjct: 149989 ggtgctgctgctggtgctgctggtggt 149963



to top

>emb|Z73587.1|SCYPL231W S.cerevisiae chromosome XVI reading frame ORF YPL231w
          Length = 7164

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 516  ggtgcaggtgctgctgccggtgc 538
            |||||||||||||||||||||||
Sbjct: 1441 ggtgcaggtgctgctgccggtgc 1463



to top

>emb|X94561.1|SCCHXVILA S.cerevisiae chromosome XVI left arm (EU) DNA segment
          Length = 20297

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 516  ggtgcaggtgctgctgccggtgc 538
            |||||||||||||||||||||||
Sbjct: 7044 ggtgcaggtgctgctgccggtgc 7066



to top

>emb|X76890.1|SCFAS2 S.cerevisiae FAS2 gene
          Length = 8989

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 516  ggtgcaggtgctgctgccggtgc 538
            |||||||||||||||||||||||
Sbjct: 3599 ggtgcaggtgctgctgccggtgc 3621



to top

>gb|BT008494.1| Arabidopsis thaliana At1g11650 gene, complete cds
          Length = 1218

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                               
Query: 453  aggctttcatggggacgaagcccttcgaacaaaca 487
            ||||| |||||||| ||||| ||||||||||||||
Sbjct: 979  aggctctcatggggccgaagtccttcgaacaaaca 1013



to top

>gb|AY093201.1| Arabidopsis thaliana similar to gb|U90212 DNA binding protein ACBF
            from Nicotiana tabacum and contains 3 PF|00076 RNA
            recognition motif domains (At1g11650) mRNA, complete cds
          Length = 1511

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                               
Query: 453  aggctttcatggggacgaagcccttcgaacaaaca 487
            ||||| |||||||| ||||| ||||||||||||||
Sbjct: 1071 aggctctcatggggccgaagtccttcgaacaaaca 1105



to top

>gb|AE016819.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome VI,
               complete sequence
          Length = 1813164

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                          
Query: 518     tgcaggtgctgctgccggtgctgctgg 544
               |||||||||||||||||| ||||||||
Sbjct: 1381271 tgcaggtgctgctgccggcgctgctgg 1381245



to top

>gb|AY086969.1| Arabidopsis thaliana clone 30022 mRNA, complete sequence
          Length = 1486

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                               
Query: 453  aggctttcatggggacgaagcccttcgaacaaaca 487
            ||||| |||||||| ||||| ||||||||||||||
Sbjct: 1045 aggctctcatggggccgaagtccttcgaacaaaca 1079



to top

>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 524     tgctgctgccggtgctgctggtg 546
               |||||||||||||||||||||||
Sbjct: 2696361 tgctgctgccggtgctgctggtg 2696383



to top

>ref|NM_212208.1| Eremothecium gossypii AFR525Cp (AFR525C), mRNA
          Length = 1194

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 518 tgcaggtgctgctgccggtgctgctgg 544
           |||||||||||||||||| ||||||||
Sbjct: 269 tgcaggtgctgctgccggcgctgctgg 295



to top

>gb|AY104980.1| Zea mays PCO111857 mRNA sequence
          Length = 1651

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 266 tgttggcggccttgaccccaatgtcactgaagatg 300
           |||||| || |||||||||||||||| ||||||||
Sbjct: 959 tgttggtgggcttgaccccaatgtcagtgaagatg 993



to top

>gb|AC007296.2|F25C20 Arabidopsis thaliana chromosome 1 BAC F25C20 sequence, complete
             sequence
          Length = 91566

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                
Query: 453   aggctttcatggggacgaagcccttcgaacaaaca 487
             ||||| |||||||| ||||| ||||||||||||||
Sbjct: 73960 aggctctcatggggccgaagtccttcgaacaaaca 73926



to top

>gb|J03936.1|YSCFAS2A S.cerevisiae FAS2 gene encoding alpha-subunit of fatty acid synthase,
            complete cds
          Length = 7555

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 516  ggtgcaggtgctgctgccggtgc 538
            |||||||||||||||||||||||
Sbjct: 2305 ggtgcaggtgctgctgccggtgc 2327



to top

>gb|AY493286.1| Anas platyrhynchos microsatellite CAUD041 sequence
          Length = 384

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 515 gggtgcaggtgctgctgccggtgctgctggtggt 548
           |||||| | ||||||||| |||||||||||||||
Sbjct: 334 gggtgctgctgctgctgcgggtgctgctggtggt 301



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 516 ggtgcaggtgctgctgccggtgctgctg 543
           ||||| ||||||||||| ||||||||||
Sbjct: 351 ggtgctggtgctgctgcgggtgctgctg 324



to top

>ref|XM_960499.1| Neurospora crassa OR74A hypothetical protein (NCU02910.1) partial
           mRNA
          Length = 1185

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 522 ggtgctgctgccggtgctgctggtgg 547
           |||||||||| |||||||||||||||
Sbjct: 871 ggtgctgctggcggtgctgctggtgg 896



to top

>ref|XM_330097.1| Neurospora crassa OR74A hypothetical protein (NCU02910.1) partial
           mRNA
          Length = 1185

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 522 ggtgctgctgccggtgctgctggtgg 547
           |||||||||| |||||||||||||||
Sbjct: 871 ggtgctgctggcggtgctgctggtgg 896



to top

>gb|AC122896.4| Mus musculus BAC clone RP23-69N8 from chromosome 10, complete sequence
          Length = 232473

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 522   ggtgctgctgccggtgctgctggtgg 547
             ||||||||||| ||||||||||||||
Sbjct: 30926 ggtgctgctgctggtgctgctggtgg 30951



to top

>ref|XM_754825.1| Ustilago maydis 521 hypothetical protein (UM03771.1) partial mRNA
          Length = 2217

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 521  aggtgctgctgccggtgctgctggtg 546
            ||||| ||||||||||||||||||||
Sbjct: 2110 aggtggtgctgccggtgctgctggtg 2085



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                         
Query: 523     gtgctgctgccggtgctgctggtggt 548
               |||||||||| |||||||||||||||
Sbjct: 8988691 gtgctgctgcaggtgctgctggtggt 8988716



to top

>emb|AL928985.24| Mouse DNA sequence from clone RP23-477P11 on chromosome 2, complete
             sequence
          Length = 83772

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 523   gtgctgctgccggtgctgctggtggt 548
             |||||||||| |||||||||||||||
Sbjct: 54370 gtgctgctgctggtgctgctggtggt 54395



to top

>gb|AC104809.5| Homo sapiens BAC clone RP11-637O3 from 2, complete sequence
          Length = 167196

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 512   gtggggtgcaggtgctgctgcc 533
             ||||||||||||||||||||||
Sbjct: 34302 gtggggtgcaggtgctgctgcc 34323



to top

>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 526     ctgctgccggtgctgctggtgg 547
               ||||||||||||||||||||||
Sbjct: 6199546 ctgctgccggtgctgctggtgg 6199567



to top

>dbj|AP005387.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OSJNBa0084K06
          Length = 177895

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 523   gtgctgctgccggtgctgctggtggt 548
             |||||||||| |||||||||||||||
Sbjct: 36009 gtgctgctgcaggtgctgctggtggt 36034



to top

>dbj|AK122070.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033117I22, full
            insert sequence
          Length = 2126

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 523  gtgctgctgccggtgctgctggtggt 548
            |||||||||| |||||||||||||||
Sbjct: 1599 gtgctgctgcaggtgctgctggtggt 1574



to top

>dbj|AK064807.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000D18, full
            insert sequence
          Length = 1896

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 523  gtgctgctgccggtgctgctggtggt 548
            |||||||||| |||||||||||||||
Sbjct: 1452 gtgctgctgcaggtgctgctggtggt 1427



to top

>gb|AC079444.28| Mus musculus strain C57BL/6J chromosome 10 clone rp23-395k5, complete
             sequence
          Length = 171451

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 522   ggtgctgctgccggtgctgctggtgg 547
             ||||||||||| ||||||||||||||
Sbjct: 80943 ggtgctgctgctggtgctgctggtgg 80918



to top

>gb|AC079681.38| Mus musculus strain C57BL/6J chromosome 10 clone rp23-310n21, complete
             sequence
          Length = 216807

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 522   ggtgctgctgccggtgctgctggtgg 547
             ||||||||||| ||||||||||||||
Sbjct: 26265 ggtgctgctgctggtgctgctggtgg 26240



to top

>gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete sequence
          Length = 2648638

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 521    aggtgctgctgccggtgctgct 542
              ||||||||||||||||||||||
Sbjct: 389817 aggtgctgctgccggtgctgct 389838



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 526     ctgctgccggtgctgctggt 545
               ||||||||||||||||||||
Sbjct: 2528207 ctgctgccggtgctgctggt 2528188



to top

>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome
          Length = 4109442

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 525     gctgctgccggtgctgctggt 545
               |||||||||||||||||||||
Sbjct: 1610687 gctgctgccggtgctgctggt 1610667



to top

>ref|NM_103642.2| Arabidopsis thaliana ATRBP47C; RNA binding AT1G47490 (ATRBP47C)
           transcript variant AT1G47490.1 mRNA, complete cds
          Length = 1724

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 54  tcaaagggttatgggtttgtcaagtttggtgat 86
           |||||||| ||||||||||| | ||||||||||
Sbjct: 844 tcaaaggggtatgggtttgtgaggtttggtgat 876



to top

>ref|NM_202255.1| Arabidopsis thaliana ATRBP47C; RNA binding AT1G47490 (ATRBP47C)
           transcript variant AT1G47490.2 mRNA, complete cds
          Length = 1837

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 54  tcaaagggttatgggtttgtcaagtttggtgat 86
           |||||||| ||||||||||| | ||||||||||
Sbjct: 844 tcaaaggggtatgggtttgtgaggtttggtgat 876



to top

>ref|NM_103848.2| Arabidopsis thaliana ATRBP47A; RNA binding AT1G49600 (ATRBP47A) mRNA,
            complete cds
          Length = 1688

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                             
Query: 345  aagatccctgttgggaagagatgtggctttgttcagtatgctaacaggc 393
            |||||||| || |||||  ||||||||||||| || | |||||||||||
Sbjct: 1069 aagatcccagtagggaaaggatgtggctttgtccaatttgctaacaggc 1117



to top

>ref|XM_478418.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1302

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 93  gagcaagctcgtgccatgactgagatgaatgga 125
           |||||| | ||||| ||||||||||||||||||
Sbjct: 622 gagcaaacacgtgctatgactgagatgaatgga 654



to top

>ref|XM_478419.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1156

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 93  gagcaagctcgtgccatgactgagatgaatgga 125
           |||||| | ||||| ||||||||||||||||||
Sbjct: 722 gagcaaacacgtgctatgactgagatgaatgga 754



to top

>gb|AC146131.4| Pan troglodytes BAC clone RP43-4F15 from 7, complete sequence
          Length = 179576

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                              
Query: 516   ggtgcaggtgctgctgccggtgctgctggtggt 548
             ||||| ||||||| ||| |||||||||||||||
Sbjct: 60642 ggtgctggtgctggtgctggtgctgctggtggt 60674



to top

>ref|XM_538486.2| PREDICTED: Canis familiaris luteinizing hormone receptor (LHR),
           mRNA
          Length = 2272

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 522 ggtgctgctgccggtgctgctggtg 546
           |||||||||||||||||||| ||||
Sbjct: 30  ggtgctgctgccggtgctgccggtg 54



to top

>emb|AL590362.12| Human DNA sequence from clone RP11-214G2 on chromosome 9 Contains a CpG
              island, complete sequence
          Length = 154698

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 518    tgcaggtgctgctgccggtgctgctggtg 546
              ||||| ||||| |||||||||||||||||
Sbjct: 138734 tgcagctgctggtgccggtgctgctggtg 138762



to top

>emb|AL160269.14| Human DNA sequence from clone RP11-240L7 on chromosome 9 Contains the
             3' end of a gene for a novel protein similar to a zinc
             finger protein, the gene for a nucleotide-sugar
             transporter (SQV7L) the HSD17B3 gene for hydroxysteroid
             (17-beta) dehydrogenase 3, 2 novel genes and two CpG
             islands, complete sequence
          Length = 169646

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 507   acccagtggggtgcaggtgct 527
             |||||||||||||||||||||
Sbjct: 38618 acccagtggggtgcaggtgct 38638



to top

>gb|BT009238.1| Triticum aestivum clone wlk1.pk0001.f8:fis, full insert mRNA
           sequence
          Length = 1160

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 102 cgtgccatgactgagatgaatggaatgcc 130
           ||||| |||||||||||||||||| ||||
Sbjct: 312 cgtgctatgactgagatgaatggagtgcc 340



to top

>emb|BX017996.1|CNS08M1S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA27AG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 980

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 522 ggtgctgctgccggtgctgctggtggttactat 554
           ||||||||||| |||||||||||| ||| ||||
Sbjct: 98  ggtgctgctgctggtgctgctggtagttgctat 66



to top

>gb|AF344325.1| Arabidopsis thaliana putative DNA binding protein (At1g47490) mRNA,
           complete cds
          Length = 1299

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 54  tcaaagggttatgggtttgtcaagtttggtgat 86
           |||||||| ||||||||||| | ||||||||||
Sbjct: 712 tcaaaggggtatgggtttgtgaggtttggtgat 744



to top

>gb|AY062960.1| Arabidopsis thaliana putative DNA binding protein (At1g47490) mRNA,
           complete cds
          Length = 1330

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 54  tcaaagggttatgggtttgtcaagtttggtgat 86
           |||||||| ||||||||||| | ||||||||||
Sbjct: 712 tcaaaggggtatgggtttgtgaggtttggtgat 744



to top

>gb|AY035180.1| Arabidopsis thaliana putative DNA binding protein (At1g47490) mRNA,
           complete cds
          Length = 1709

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 54  tcaaagggttatgggtttgtcaagtttggtgat 86
           |||||||| ||||||||||| | ||||||||||
Sbjct: 844 tcaaaggggtatgggtttgtgaggtttggtgat 876



to top

>emb|BX640441.1| Bordetella bronchiseptica strain RB50, complete genome; segment 5/16
          Length = 348624

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 516   ggtgcaggtgctgctgccggtgctg 540
             ||||| |||||||||||||||||||
Sbjct: 34250 ggtgctggtgctgctgccggtgctg 34274



to top

>emb|BX640426.1| Bordetella parapertussis strain 12822, complete genome; segment 4/14
          Length = 348866

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 516    ggtgcaggtgctgctgccggtgctg 540
              ||||| |||||||||||||||||||
Sbjct: 147412 ggtgctggtgctgctgccggtgctg 147436



to top

>emb|BX640419.1| Bordetella pertussis strain Tohama I, complete genome; segment 9/12
          Length = 349672

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 516    ggtgcaggtgctgctgccggtgctg 540
              ||||| |||||||||||||||||||
Sbjct: 101564 ggtgctggtgctgctgccggtgctg 101588



to top

>emb|AJ313097.1|BVU313097 Beta vulgaris mRNA for salt tolerance protein 6 (sato6 gene)
          Length = 969

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 96  caagctcgtgccatgactgagatgaatggaatg 128
           ||||| ||||||||| | |||||||||||||||
Sbjct: 412 caagcacgtgccatgtcagagatgaatggaatg 444



to top

>dbj|AK061900.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-041-H03, full
           insert sequence
          Length = 1152

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 93  gagcaagctcgtgccatgactgagatgaatgga 125
           |||||| | ||||| ||||||||||||||||||
Sbjct: 144 gagcaaacacgtgctatgactgagatgaatgga 176



to top

>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome
          Length = 5513844

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 524     tgctgctgccggtgctgctgg 544
               |||||||||||||||||||||
Sbjct: 1497398 tgctgctgccggtgctgctgg 1497378



to top

>ref|NM_137930.2| Drosophila melanogaster CG3124-RA (CG3124), mRNA
          Length = 1169

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 524 tgctgctgccggtgctgctggtggt 548
           ||||||||| |||||||||||||||
Sbjct: 782 tgctgctgctggtgctgctggtggt 758



to top

>gb|AY089280.1| Drosophila melanogaster AT07821 full insert cDNA
          Length = 1181

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 524 tgctgctgccggtgctgctggtggt 548
           ||||||||| |||||||||||||||
Sbjct: 774 tgctgctgctggtgctgctggtggt 750



to top

>gb|AF441320.1|AF441320 PAH-contaminated sludge bacterium PB-25 16S ribosomal RNA gene,
           partial sequence
          Length = 430

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 82  gtgatcccacagagcaagctc 102
           |||||||||||||||||||||
Sbjct: 28  gtgatcccacagagcaagctc 8



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 104      tgccatgactgagatgaatgg 124
                |||||||||||||||||||||
Sbjct: 17446348 tgccatgactgagatgaatgg 17446368



to top

>gb|AC008304.3|AC008304 Drosophila melanogaster, chromosome 2R, region 59D2-59D3, BAC clone
             BACR04G19, complete sequence
          Length = 181955

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 524   tgctgctgccggtgctgctggtggt 548
             ||||||||| |||||||||||||||
Sbjct: 51247 tgctgctgctggtgctgctggtggt 51271



to top

>emb|BX813781.1|CNS0AC3C Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB39ZG06 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1614

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 54  tcaaagggttatgggtttgtcaagtttggtgat 86
           |||||||| ||||||||||| | ||||||||||
Sbjct: 684 tcaaaggggtatgggtttgtgaggtttggtgat 716



to top

>emb|BX815706.1|CNS0AAGP Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS86ZA12 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1618

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 54  tcaaagggttatgggtttgtcaagtttggtgat 86
           |||||||| ||||||||||| | ||||||||||
Sbjct: 812 tcaaaggggtatgggtttgtgaggtttggtgat 844



to top

>dbj|BA000026.2| Mycoplasma penetrans HF-2 DNA, complete genome
          Length = 1358633

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 201    ccaattccaaatacaaatact 221
              |||||||||||||||||||||
Sbjct: 730356 ccaattccaaatacaaatact 730376



to top

>dbj|AP005755.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:OSJNBb0019B14
          Length = 127570

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 104   tgccatgactgagatgaatgg 124
             |||||||||||||||||||||
Sbjct: 10526 tgccatgactgagatgaatgg 10546



to top

>dbj|AP006849.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:OSJNBa0054F02
          Length = 180651

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 104    tgccatgactgagatgaatgg 124
              |||||||||||||||||||||
Sbjct: 170261 tgccatgactgagatgaatgg 170281



to top

>dbj|AP005103.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OSJNBa0036M16
          Length = 158880

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                              
Query: 93    gagcaagctcgtgccatgactgagatgaatgga 125
             |||||| | ||||| ||||||||||||||||||
Sbjct: 32936 gagcaaacacgtgctatgactgagatgaatgga 32968



to top

>dbj|AP005320.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
              clone:P0650C03
          Length = 144337

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                               
Query: 93     gagcaagctcgtgccatgactgagatgaatgga 125
              |||||| | ||||| ||||||||||||||||||
Sbjct: 108445 gagcaaacacgtgctatgactgagatgaatgga 108477



to top

>ref|XM_315414.2| Anopheles gambiae str. PEST ENSANGP00000014064
           (ENSANGG00000011575), partial mRNA
          Length = 1290

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 520 caggtgctgctgccggtgctgctggtggt 548
           |||||||||||| ||||| ||||||||||
Sbjct: 635 caggtgctgctggcggtggtgctggtggt 663



to top

>dbj|AK067260.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013096N13, full
           insert sequence
          Length = 1615

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 104 tgccatgactgagatgaatgg 124
           |||||||||||||||||||||
Sbjct: 797 tgccatgactgagatgaatgg 817



to top

>dbj|AK062798.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-107-C10, full
           insert sequence
          Length = 1157

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 93  gagcaagctcgtgccatgactgagatgaatgga 125
           |||||| | ||||| ||||||||||||||||||
Sbjct: 723 gagcaaacacgtgctatgactgagatgaatgga 755



to top

>dbj|AK060597.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-024-G08, full
           insert sequence
          Length = 1356

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 104 tgccatgactgagatgaatgg 124
           |||||||||||||||||||||
Sbjct: 541 tgccatgactgagatgaatgg 561



to top

>gb|AY110306.1| Zea mays CL773_2 mRNA sequence
          Length = 1267

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 104 tgccatgactgagatgaatgg 124
           |||||||||||||||||||||
Sbjct: 382 tgccatgactgagatgaatgg 402



to top

>gb|AC007519.2|F16N3 Sequence of BAC F16N3 from Arabidopsis thaliana chromosome 1, complete
              sequence
          Length = 171769

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                               
Query: 54     tcaaagggttatgggtttgtcaagtttggtgat 86
              |||||||| ||||||||||| | ||||||||||
Sbjct: 140510 tcaaaggggtatgggtttgtgaggtttggtgat 140478



to top

>emb|AJ718892.1| Nicotiana tabacum cDNA-AFLP-fragment BSTC14-2-275, cultivar Bright
           Yellow 2
          Length = 210

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 100 ctcgtgccatgactgagatgaatgg 124
           |||| ||||||||||||||||||||
Sbjct: 127 ctcgggccatgactgagatgaatgg 103



to top

>gb|AE003460.2| Drosophila melanogaster chromosome 2R, section 68 of 73 of the complete
              sequence
          Length = 299331

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 524    tgctgctgccggtgctgctggtggt 548
              ||||||||| |||||||||||||||
Sbjct: 103724 tgctgctgctggtgctgctggtggt 103748



to top

>gb|BC063993.1| Danio rerio tRNA selenocysteine associated protein 1, mRNA (cDNA
            clone MGC:77884 IMAGE:6996630), complete cds
          Length = 2232

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 56   aaagggttatgggtttgtcaagttt 80
            |||||||||||| ||||||||||||
Sbjct: 1007 aaagggttatggctttgtcaagttt 1031



to top

>ref|NM_213251.1| Danio rerio tRNA selenocysteine associated protein 1 (trspap1), mRNA
          Length = 2232

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 56   aaagggttatgggtttgtcaagttt 80
            |||||||||||| ||||||||||||
Sbjct: 1007 aaagggttatggctttgtcaagttt 1031



to top

>gb|U90212.1|NTU90212 Nicotiana tabacum DNA binding protein ACBF mRNA, complete cds
          Length = 1556

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 100 ctcgtgccatgactgagatgaatgg 124
           |||| ||||||||||||||||||||
Sbjct: 737 ctcgggccatgactgagatgaatgg 761



to top

>gb|L37336.1|TRBC1PG Trypanosoma congolense phosphoglycerate kinase (c1PGK) gene, 3' end
            of cds, and phosphoglycerate kinase (c2PGK) gene,
            complete cds
          Length = 2207

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 517  gtgcaggtgctgctgccggtg 537
            |||||||||||||||||||||
Sbjct: 1453 gtgcaggtgctgctgccggtg 1473



to top

>gb|L37337.1|TRB56PG Trypanosoma congolense phosphoglycerate kinase (56PGK, c1PGK, c2PGK)
            genes, complete cds
          Length = 4418

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 517  gtgcaggtgctgctgccggtg 537
            |||||||||||||||||||||
Sbjct: 2857 gtgcaggtgctgctgccggtg 2877



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 517  gtgcaggtgctgctgccggtg 537
            |||||||||||||||||||||
Sbjct: 1204 gtgcaggtgctgctgccggtg 1224



to top

>gb|AC134623.5| Mus musculus BAC clone RP23-20K21 from 8, complete sequence
          Length = 234976

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 89    cacagagcaagctcgtgccat 109
             |||||||||||||||||||||
Sbjct: 53098 cacagagcaagctcgtgccat 53078



to top

>gb|AF029351.1|AF029351 Nicotiana tabacum putative RNA binding protein (QRRBP-1) mRNA,
           partial cds
          Length = 1682

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 100 ctcgtgccatgactgagatgaatgg 124
           |||| ||||||||||||||||||||
Sbjct: 862 ctcgggccatgactgagatgaatgg 886



to top

>emb|AL732564.12| Mouse DNA sequence from clone RP23-442G9 on chromosome 2, complete
              sequence
          Length = 211657

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 522    ggtgctgctgccggtgctgctggtg 546
              ||||||||||| |||||||||||||
Sbjct: 206935 ggtgctgctgctggtgctgctggtg 206911



to top

>emb|AL592403.6| Mouse DNA sequence from clone RP23-90A8 on chromosome 1, complete
             sequence
          Length = 165527

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 524   tgctgctgccggtgctgctggtggt 548
             ||||||||| |||||||||||||||
Sbjct: 15452 tgctgctgctggtgctgctggtggt 15428



to top

>dbj|AB052339.1| Lampetra japonica LjTTF-1 mRNA for thyroid transcription factor-1,
            complete cds
          Length = 2110

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 524  tgctgctgccggtgctgctggtggt 548
            ||||||||| |||||||||||||||
Sbjct: 1060 tgctgctgctggtgctgctggtggt 1036



to top

>gb|AY851689.1| Uncultured Microbacterium sp. clone p5 16S ribosomal RNA gene,
            partial sequence
          Length = 1491

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 83   tgatcccacagagcaagctc 102
            ||||||||||||||||||||
Sbjct: 1401 tgatcccacagagcaagctc 1420



to top

>ref|NM_118834.2| Arabidopsis thaliana RNA binding AT4G27000 mRNA, complete cds
          Length = 1696

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 101 tcgtgccatgactgagatgaatgg 124
           ||||||||||||||| ||||||||
Sbjct: 778 tcgtgccatgactgaaatgaatgg 801



to top

>gb|DQ228730.1| Bacterium ID5-18 16S ribosomal RNA gene, partial sequence
          Length = 488

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 70  tgatcccacagagcaagctc 51



to top

>gb|AC164883.5| Mus musculus BAC clone RP23-88A20 from chromosome 15, complete sequence
          Length = 260402

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 346    agatccctgttgggaagaga 365
              ||||||||||||||||||||
Sbjct: 222599 agatccctgttgggaagaga 222580



to top

>gb|AY398370.1| Danio rerio clone RK105A4F05 poly(A)-binding protein, cytoplasmic 1
           (KM0002) mRNA, complete cds
          Length = 2175

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 54  tcaaagggttatgggtttgt 73
           ||||||||||||||||||||
Sbjct: 516 tcaaagggttatgggtttgt 535



to top

>gb|DQ227343.1| Microbacterium sp. PHD-5 16S ribosomal RNA gene, partial sequence
          Length = 1489

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 93  tgatcccacagagcaagctc 74



to top

>gb|BT018852.1| Zea mays clone EL01N0555H08.d mRNA sequence
          Length = 1780

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 93  gagcaagctcgtgccatgactgagatgaatggaatg 128
           ||||| || ||||| ||||| |||||||||||||||
Sbjct: 908 gagcaggcacgtgctatgaccgagatgaatggaatg 943



to top

>gb|AY622232.1| Uncultured actinobacterium clone C-CO51 16S ribosomal RNA gene,
           complete sequence
          Length = 1447

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 70  tgatcccacagagcaagctc 51



to top

>gb|AY730719.1| Microbacterium sp. 130704Ws9 16S ribosomal RNA gene, partial
           sequence
          Length = 1343

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 72  tgatcccacagagcaagctc 53



to top

>gb|DQ119293.3| Microbacterium sp. SK 18 16S ribosomal RNA gene, partial sequence
          Length = 1432

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 93  tgatcccacagagcaagctc 74



to top

>gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete genome
          Length = 2584158

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 527     tgctgccggtgctgctggtg 546
               ||||||||||||||||||||
Sbjct: 2122789 tgctgccggtgctgctggtg 2122770



to top

>gb|AF417868.1| Microbacterium sp. YSS/2001-1 16S ribosomal RNA gene, partial
           sequence
          Length = 1420

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 30  tgatcccacagagcaagctc 11



to top

>ref|XM_424078.1| PREDICTED: Gallus gallus similar to Ornithine aminotransferase,
           mitochondrial precursor (Ornithine--oxo-acid
           aminotransferase) (LOC426431), partial mRNA
          Length = 979

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 524 tgctgctgccggtgctgctg 543
           ||||||||||||||||||||
Sbjct: 46  tgctgctgccggtgctgctg 27



to top

>gb|DQ490451.1| Microbacteriaceae bacterium KVD-1982-06 16S ribosomal RNA gene,
           partial sequence
          Length = 1488

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 90  tgatcccacagagcaagctc 71



to top

>gb|BC044513.1| Danio rerio zgc:55855, mRNA (cDNA clone MGC:55855 IMAGE:3818253),
           complete cds
          Length = 2256

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 54  tcaaagggttatgggtttgt 73
           ||||||||||||||||||||
Sbjct: 505 tcaaagggttatgggtttgt 524



to top

>ref|XM_716050.1| Candida albicans SC5314 hypothetical protein (CaO19_8522), mRNA
          Length = 747

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 524 tgctgctgccggtgctgctg 543
           ||||||||||||||||||||
Sbjct: 699 tgctgctgccggtgctgctg 718



to top

>ref|XM_715929.1| Candida albicans SC5314 phosphoglycerate mutase (CaO19_903), mRNA
          Length = 747

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 524 tgctgctgccggtgctgctg 543
           ||||||||||||||||||||
Sbjct: 699 tgctgctgccggtgctgctg 718



to top

>gb|AF047639.1| Uncultured eubacterium TRB50 16S ribosomal RNA gene, partial
           sequence
          Length = 435

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 70  tgatcccacagagcaagctc 51



to top

>gb|DQ460219.1| Microbacterium sp. 05-7823 16S ribosomal RNA gene, partial sequence
          Length = 426

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 24  tgatcccacagagcaagctc 5



to top

>gb|DQ191237.1| Bacterium W5(2005) 16S ribosomal RNA gene, partial sequence
          Length = 742

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 68  tgatcccacagagcaagctc 49



to top

>ref|NM_199839.1| Danio rerio zgc:55855 (zgc:55855), mRNA
          Length = 2256

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 54  tcaaagggttatgggtttgt 73
           ||||||||||||||||||||
Sbjct: 505 tcaaagggttatgggtttgt 524



to top

>gb|AY038632.1| Uncultured eubacterium clone GL184.20 16S ribosomal RNA gene,
           partial sequence
          Length = 1322

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 57  tgatcccacagagcaagctc 38



to top

>gb|AY038631.1| Uncultured eubacterium clone GL182.38 16S ribosomal RNA gene,
           partial sequence
          Length = 1322

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 57  tgatcccacagagcaagctc 38



to top

>gb|AY038630.1| Uncultured eubacterium clone GL178.9 16S ribosomal RNA gene,
           partial sequence
          Length = 1322

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 57  tgatcccacagagcaagctc 38



to top

>gb|AF423215.1| Uncultured soil bacterium clone 1245-2 16S ribosomal RNA gene,
           partial sequence
          Length = 1448

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 70  tgatcccacagagcaagctc 51



to top

>gb|AY350712.1| Arabidopsis arenosa clone BAC Aer6D24, complete sequence
          Length = 87863

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 516   ggtgcaggtgctgctgccggtgctgctg 543
             ||||||||||||||||| | ||||||||
Sbjct: 36377 ggtgcaggtgctgctgctgctgctgctg 36350



to top

>gb|AC145799.2| Xenopus tropicalis clone CH216-55B16, complete sequence
          Length = 163674

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 525    gctgctgccggtgctgctgg 544
              ||||||||||||||||||||
Sbjct: 135086 gctgctgccggtgctgctgg 135067



to top

>gb|DQ189973.1| Uncultured Microbacterium sp. clone SIMO-2998 16S ribosomal RNA
           gene, partial sequence
          Length = 728

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 38  tgatcccacagagcaagctc 19



to top

>gb|AY275515.1| Microbacterium sp. MSB2098 16S ribosomal RNA gene, partial sequence
          Length = 507

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 90  tgatcccacagagcaagctc 71



to top

>gb|AY504445.1| Bacillaceae bacterium C19 16S ribosomal RNA gene, partial sequence
          Length = 507

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 93  tgatcccacagagcaagctc 74



to top

>gb|AC165352.2| Mus musculus BAC clone RP23-205C7 from chromosome 15, complete sequence
          Length = 202977

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 346   agatccctgttgggaagaga 365
             ||||||||||||||||||||
Sbjct: 89379 agatccctgttgggaagaga 89398



to top

>gb|AY547556.1| Microbacterium sp. CME1 16S ribosomal RNA gene, complete sequence
          Length = 1532

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 83   tgatcccacagagcaagctc 102
            ||||||||||||||||||||
Sbjct: 1435 tgatcccacagagcaagctc 1454



to top

>gb|BC023950.1| Mus musculus ethanolamine kinase 1, mRNA (cDNA clone
           IMAGE:5320201), partial cds
          Length = 3543

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 525 gctgctgccggtgctgctgg 544
           ||||||||||||||||||||
Sbjct: 345 gctgctgccggtgctgctgg 364



to top

>gb|BC034743.1| Mus musculus ethanolamine kinase 1, mRNA (cDNA clone
           IMAGE:4952607), partial cds
          Length = 3475

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 525 gctgctgccggtgctgctgg 544
           ||||||||||||||||||||
Sbjct: 276 gctgctgccggtgctgctgg 295



to top

>gb|AC139759.4| Mus musculus BAC clone RP23-385E10 from chromosome 18, complete
             sequence
          Length = 200426

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 87    cccacagagcaagctcgtgccatg 110
             |||||||||| |||||||||||||
Sbjct: 13731 cccacagagccagctcgtgccatg 13708



to top

>gb|AY395032.1| Uncultured Microbacterium sp. clone NAB25 16S ribosomal RNA gene,
           partial sequence
          Length = 1444

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 48  tgatcccacagagcaagctc 29



to top

>gb|AY395021.1| Microbacterium sp. NAB17 16S ribosomal RNA gene, partial sequence
          Length = 1468

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 69  tgatcccacagagcaagctc 50



to top

>gb|AF176819.1| Xenopus tropicalis twist transcription factor mRNA, complete cds
          Length = 501

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 525 gctgctgccggtgctgctgg 544
           ||||||||||||||||||||
Sbjct: 189 gctgctgccggtgctgctgg 170



to top

>gb|AC111142.16| Mus musculus chromosome 3, clone RP23-370L24, complete sequence
          Length = 171774

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 516    ggtgcaggtgctgctgccggtgctgctg 543
              ||||| ||||||||||| ||||||||||
Sbjct: 137998 ggtgctggtgctgctgctggtgctgctg 137971



to top

>ref|XM_991485.1| PREDICTED: Mus musculus ethanolamine kinase 1 (Etnk1), mRNA
          Length = 6635

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 525  gctgctgccggtgctgctgg 544
            ||||||||||||||||||||
Sbjct: 3424 gctgctgccggtgctgctgg 3443



to top

>ref|XM_908334.2| PREDICTED: Mus musculus ethanolamine kinase 1 (Etnk1), mRNA
          Length = 6857

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 525  gctgctgccggtgctgctgg 544
            ||||||||||||||||||||
Sbjct: 3646 gctgctgccggtgctgctgg 3665



to top

>ref|XM_979562.1| PREDICTED: Mus musculus ethanolamine kinase 1 (Etnk1), mRNA
          Length = 6857

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 525  gctgctgccggtgctgctgg 544
            ||||||||||||||||||||
Sbjct: 3646 gctgctgccggtgctgctgg 3665



to top

>gb|AY439239.1| Microbacterium sp. GIC27y 16S ribosomal RNA gene, partial sequence
          Length = 720

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 32  tgatcccacagagcaagctc 13



to top

>gb|AY509223.1| Microbacterium oxydans strain S28n 16S ribosomal RNA gene, partial
           sequence
          Length = 1445

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 57  tgatcccacagagcaagctc 38



to top

>gb|AY509222.1| Microbacterium oxydans strain 187 16S ribosomal RNA gene, partial
           sequence
          Length = 1450

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 58  tgatcccacagagcaagctc 39



to top

>gb|AY785738.1| Microbacterium oxydans isolate OUCZ46 16S ribosomal RNA gene,
           partial sequence
          Length = 1441

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 42  tgatcccacagagcaagctc 23



to top

>gb|AY332192.1| Microbacterium sp. GWS-TZ-H111 16S ribosomal RNA gene, partial
           sequence
          Length = 695

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 86  tgatcccacagagcaagctc 67



to top

>gb|AY332149.1| Microbacterium sp. GWS-SE-H100 16S ribosomal RNA gene, partial
           sequence
          Length = 830

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 86  tgatcccacagagcaagctc 67



to top

>emb|AM110940.1| Bacillus subtilis partial 16S rRNA gene, isolate B-2032
          Length = 1440

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 58  tgatcccacagagcaagctc 39



to top

>ref|XM_849692.1| PREDICTED: Canis familiaris similar to non-POU domain containing,
           octamer-binding (LOC483074), mRNA
          Length = 1891

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 525 gctgctgccggtgctgctggtggt 548
           |||||||| |||||||||||||||
Sbjct: 178 gctgctgctggtgctgctggtggt 155



to top

>emb|AJ879106.1| Microbacterium sp. R1_3_cr partial 16S rRNA gene, strain R1_3_cr
          Length = 475

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 84  tgatcccacagagcaagctc 65



to top

>emb|AJ879104.1| Microbacterium sp. B2_10_cr partial 16S rRNA gene, strain B2_10_cr
          Length = 609

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 53  tgatcccacagagcaagctc 34



to top

>emb|AJ879101.1| Microbacterium sp. B2_4_cr partial 16S rRNA gene, strain B2_4_cr
          Length = 476

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 84  tgatcccacagagcaagctc 65



to top

>emb|AJ879099.1| Microbacterium sp. B3_13_cr partial 16S rRNA gene, strain B3_13_cr
          Length = 639

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 57  tgatcccacagagcaagctc 38



to top

>emb|AJ879095.1| Microbacterium sp. B3_1_cr partial 16S rRNA gene, strain B3_1_cr
          Length = 470

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 80  tgatcccacagagcaagctc 61



to top

>gb|AC132955.3| Mus musculus BAC clone RP24-266J20 from chromosome 6, complete sequence
          Length = 174507

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 525    gctgctgccggtgctgctgg 544
              ||||||||||||||||||||
Sbjct: 128378 gctgctgccggtgctgctgg 128359



to top

>gb|AY526712.1| Microbacterium sp. Muzt-I71 16S ribosomal RNA gene, partial
           sequence
          Length = 715

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 43  tgatcccacagagcaagctc 24



to top

>gb|AY526705.1| Microbacterium sp. Muzt-G32 16S ribosomal RNA gene, partial
           sequence
          Length = 670

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 56  tgatcccacagagcaagctc 37



to top

>emb|AJ863312.1| Uncultured bacterium partial 16S rRNA gene, clone 27RHU11
          Length = 1010

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 70  tgatcccacagagcaagctc 51



to top

>emb|AJ717357.1| Microbacterium oxydans 16S rRNA gene, isolate AC44
          Length = 1510

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 80  tgatcccacagagcaagctc 61



to top

>emb|AJ863358.1| Uncultured bacterium partial 16S rRNA gene, clone 5RHF39
          Length = 1447

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 70  tgatcccacagagcaagctc 51



to top

>emb|AJ717358.1| Microbacterium oxydans 16S rRNA gene, isolate CV71a
          Length = 1510

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 80  tgatcccacagagcaagctc 61



to top

>emb|AJ717356.1| Microbacterium oxydans 16S rRNA gene, isolate AC94
          Length = 1509

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 84  tgatcccacagagcaagctc 65



to top

>gb|AC115123.4| Mus musculus BAC clone RP24-129O20 from 3, complete sequence
          Length = 181380

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 516  ggtgcaggtgctgctgccggtgctgctg 543
            ||||| ||||||||||| ||||||||||
Sbjct: 1107 ggtgctggtgctgctgctggtgctgctg 1080



to top

>gb|DQ129728.1| Microbacterium sp. HPC408 16S ribosomal RNA gene, partial sequence
          Length = 864

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 76  tgatcccacagagcaagctc 57



to top

>gb|DQ129726.1| Microbacterium sp. HPC405 16S ribosomal RNA gene, partial sequence
          Length = 979

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 68  tgatcccacagagcaagctc 49



to top

>gb|DQ448707.1| Microbacterium sp. CNJ743 PL04 16S ribosomal RNA gene, partial
           sequence
          Length = 1488

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 90  tgatcccacagagcaagctc 71



to top

>emb|AJ864858.1| Microbacterium sp. J72 partial 16S rRNA gene, isolate J72
          Length = 1480

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 70  tgatcccacagagcaagctc 51



to top

>emb|Z99128.1|HS422H11 Human DNA sequence from clone RP3-422H11 on chromosome 6p21.1-22.2
             Contains the 3' end of a novel gene, the SRPK1 gene for
             SFRS protein kinase 1 and two CpG islands, complete
             sequence
          Length = 112984

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 298   atgccttgaaacaagtgttt 317
             ||||||||||||||||||||
Sbjct: 65594 atgccttgaaacaagtgttt 65575



to top

>ref|XM_795604.1| PREDICTED: Strongylocentrotus purpuratus hypothetical protein
           LOC592333 (LOC592333), partial mRNA
          Length = 472

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 524 tgctgctgccggtgctgctg 543
           ||||||||||||||||||||
Sbjct: 205 tgctgctgccggtgctgctg 224



to top

>emb|AJ876731.1| Microbacterium sp. R2_5 cr partial 16S rRNA gene, strain R2_5 cr
          Length = 472

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 80  tgatcccacagagcaagctc 61



to top

>emb|AJ969168.1| Microbacterium sp. R-23195 16S rRNA gene, strain R-23195
          Length = 921

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 70  tgatcccacagagcaagctc 51



to top

>emb|AJ634952.1| Microbacterium sp. B0L3 partial 16S rRNA gene, isolate B0L3
          Length = 427

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 38  tgatcccacagagcaagctc 19



to top

>gb|AY062999.1| Arabidopsis thaliana putative DNA binding protein (At4g27000) mRNA,
           complete cds
          Length = 1279

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 101 tcgtgccatgactgagatgaatgg 124
           ||||||||||||||| ||||||||
Sbjct: 687 tcgtgccatgactgaaatgaatgg 710



to top

>gb|AF370339.1| Arabidopsis thaliana putative DNA binding protein (At4g27000) mRNA,
           complete cds
          Length = 1691

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 101 tcgtgccatgactgagatgaatgg 124
           ||||||||||||||| ||||||||
Sbjct: 778 tcgtgccatgactgaaatgaatgg 801



to top

>emb|X55735.1|DPBCD D.pseudoobscura bcd (bicoid) gene involved in anterior positional
            specification during embryogenesis
          Length = 3476

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 516  ggtgcaggtgctgctgccggtgctgctg 543
            ||||||||||||||||| | ||||||||
Sbjct: 1583 ggtgcaggtgctgctgctgttgctgctg 1556



to top

>gb|DQ105974.1| Microbacterium oxydans 16S ribosomal RNA gene, partial sequence
          Length = 1429

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 44  tgatcccacagagcaagctc 25



to top

>gb|AY526672.1| Microbacterium sp. Muzt-F72 16S ribosomal RNA gene, partial
           sequence
          Length = 588

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 53  tgatcccacagagcaagctc 34



to top

>gb|AY526635.1| Microbacterium sp. Muzt-B35 16S ribosomal RNA gene, partial
           sequence
          Length = 649

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 51  tgatcccacagagcaagctc 32



to top

>gb|DQ122280.1| Actinobacterium iEAIC68 16S ribosomal RNA gene gene, partial
           sequence
          Length = 456

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 90  tgatcccacagagcaagctc 71



to top

>gb|DQ122234.1| Microbacterium sp. iMCIII8 16S ribosomal RNA gene, partial sequence
          Length = 459

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 90  tgatcccacagagcaagctc 71



to top

>gb|DQ122233.1| Microbacterium sp. iMCIII16 16S ribosomal RNA gene, partial
           sequence
          Length = 453

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 90  tgatcccacagagcaagctc 71



to top

>gb|DQ122216.1| Microbacterium oxydans strain iDLIII10 16S ribosomal RNA gene,
           partial sequence
          Length = 466

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 86  tgatcccacagagcaagctc 67



to top

>emb|BX569693.1| Synechococcus sp. WH8102 complete genome; segment 5/7
          Length = 349213

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 524    tgctgctgccggtgctgctg 543
              ||||||||||||||||||||
Sbjct: 193569 tgctgctgccggtgctgctg 193588



to top

>gb|DQ395689.1| Uncultured organism clone ctg_CGOF008 16S ribosomal RNA gene,
           partial sequence
          Length = 1518

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 89  tgatcccacagagcaagctc 70



to top

>emb|AL935253.1| Lactobacillus plantarum strain WCFS1 complete genome; segment 2/11
          Length = 324050

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 524    tgctgctgccggtgctgctggtgg 547
              ||||| ||||||||||||||||||
Sbjct: 246724 tgctgttgccggtgctgctggtgg 246747



to top

>emb|AL161566.2|ATCHRIV66 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 66
          Length = 198372

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 101   tcgtgccatgactgagatgaatgg 124
             ||||||||||||||| ||||||||
Sbjct: 60845 tcgtgccatgactgaaatgaatgg 60822



to top

>emb|AL035440.2|ATF10M23 Arabidopsis thaliana DNA chromosome 4, BAC clone F10M23 (ESSA project)
          Length = 128574

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 101    tcgtgccatgactgagatgaatgg 124
              ||||||||||||||| ||||||||
Sbjct: 105002 tcgtgccatgactgaaatgaatgg 104979



to top

>gb|AY822572.1| Bacterium PSD-1-5 16S ribosomal RNA gene, partial sequence
          Length = 711

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 31  tgatcccacagagcaagctc 12



to top

>gb|AY822543.1| Bacterium RHA-3-12 16S ribosomal RNA gene, partial sequence
          Length = 849

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 68  tgatcccacagagcaagctc 49



to top

>gb|AY822510.1| Bacterium RSB-1-14 16S ribosomal RNA gene, partial sequence
          Length = 857

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 61  tgatcccacagagcaagctc 42



to top

>gb|BC074558.1| Xenopus tropicalis twist transcription factor, mRNA (cDNA clone
           MGC:69439 IMAGE:5335836), complete cds
          Length = 1338

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 525 gctgctgccggtgctgctgg 544
           ||||||||||||||||||||
Sbjct: 327 gctgctgccggtgctgctgg 308



to top

>gb|AY661931.1| Bacterium 005-J small subunit ribosomal RNA gene, partial sequence
          Length = 432

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 82  tgatcccacagagcaagctc 63



to top

>gb|DQ298378.1| Uncultured bacterium clone PR66 16S ribosomal RNA gene, partial
           sequence
          Length = 1380

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 90  tgatcccacagagcaagctc 71



to top

>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome
          Length = 7074893

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 525     gctgctgccggtgctgctgg 544
               ||||||||||||||||||||
Sbjct: 6245460 gctgctgccggtgctgctgg 6245479



to top

>emb|AJ785984.1| Actinobacterium TH-G25 partial 16S rRNA gene
          Length = 636

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 52  tgatcccacagagcaagctc 33



to top

>gb|DQ417926.1| Microbacterium sp. ZD-M2 16S ribosomal RNA gene, partial sequence
          Length = 1464

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 63  tgatcccacagagcaagctc 44



to top

>dbj|AB234881.1| Trifolium pratense mRNA for putative DNA binding protein, complete
            cds
          Length = 3067

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                    
Query: 454  ggctttcatggggacgaagcccttcgaacaaacaaactca 493
            ||||||||||||| ||||||||  | |||||||| |||||
Sbjct: 2630 ggctttcatggggccgaagcccagcaaacaaacagactca 2669



to top

>dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, complete genome
          Length = 4940217

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 525     gctgctgccggtgctgctgg 544
               ||||||||||||||||||||
Sbjct: 4766730 gctgctgccggtgctgctgg 4766749



to top

>gb|DQ063077.1| Actinobacterium BAL137 16S ribosomal RNA gene, partial sequence
          Length = 443

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 66  tgatcccacagagcaagctc 47



to top

>gb|DQ412995.1| Bacterium E4B 16S ribosomal RNA gene gene, partial sequence
          Length = 560

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 27  tgatcccacagagcaagctc 8



to top

>gb|DQ412991.1| Bacterium O1 16S ribosomal RNA gene gene, partial sequence
          Length = 836

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 68  tgatcccacagagcaagctc 49



to top

>gb|DQ401245.1| Microbacterium sp. iMSN37 16S ribosomal RNA gene, partial sequence
          Length = 456

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 90  tgatcccacagagcaagctc 71



to top

>gb|DQ403811.1| Microbacterium oxydans isolate NJ6 16S ribosomal RNA gene, partial
           sequence
          Length = 1387

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 27  tgatcccacagagcaagctc 8



to top

>gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome
          Length = 4712337

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 525    gctgctgccggtgctgctgg 544
              ||||||||||||||||||||
Sbjct: 508879 gctgctgccggtgctgctgg 508860



to top

>dbj|AB004718.1| Microbacterium luteolum gene for 16S rRNA, partial sequence
          Length = 1440

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 55  tgatcccacagagcaagctc 36



to top

>gb|AY093292.1| Arabidopsis thaliana putative DNA binding protein (At4g27000) mRNA,
           complete cds
          Length = 1408

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 101 tcgtgccatgactgagatgaatgg 124
           ||||||||||||||| ||||||||
Sbjct: 687 tcgtgccatgactgaaatgaatgg 710



to top

>gb|AF450964.1| Drosophila miranda strain Mather28 bicoid (bcd) gene, partial cds
          Length = 1369

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 516 ggtgcaggtgctgctgccggtgctgctg 543
           ||||||||||||||||| | ||||||||
Sbjct: 811 ggtgcaggtgctgctgctgttgctgctg 784



to top

>gb|AF450963.1| Drosophila miranda strain MSH38 bicoid (bcd) gene, partial cds
          Length = 1369

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 516 ggtgcaggtgctgctgccggtgctgctg 543
           ||||||||||||||||| | ||||||||
Sbjct: 811 ggtgcaggtgctgctgctgttgctgctg 784



to top

>gb|AF450961.1| Drosophila persimilis strain MSH7 bicoid (bcd) gene, partial cds
          Length = 1387

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 516 ggtgcaggtgctgctgccggtgctgctg 543
           ||||||||||||||||| | ||||||||
Sbjct: 817 ggtgcaggtgctgctgctgttgctgctg 790



to top

>gb|AF450960.1| Drosophila persimilis strain MSH3 bicoid (bcd) gene, partial cds
          Length = 1378

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 516 ggtgcaggtgctgctgccggtgctgctg 543
           ||||||||||||||||| | ||||||||
Sbjct: 808 ggtgcaggtgctgctgctgttgctgctg 781



to top

>gb|AF450959.1| Drosophila persimilis strain MSH1 bicoid (bcd) gene, partial cds
          Length = 1378

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 516 ggtgcaggtgctgctgccggtgctgctg 543
           ||||||||||||||||| | ||||||||
Sbjct: 808 ggtgcaggtgctgctgctgttgctgctg 781



to top

>gb|AF450958.1| Drosophila persimilis strain MSH42 bicoid (bcd) gene, partial cds
          Length = 1378

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 516 ggtgcaggtgctgctgccggtgctgctg 543
           ||||||||||||||||| | ||||||||
Sbjct: 808 ggtgcaggtgctgctgctgttgctgctg 781



to top

>gb|AF450957.1| Drosophila persimilis strain MSH25 bicoid (bcd) gene, partial cds
          Length = 1378

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 516 ggtgcaggtgctgctgccggtgctgctg 543
           ||||||||||||||||| | ||||||||
Sbjct: 808 ggtgcaggtgctgctgctgttgctgctg 781



to top

>gb|AF450956.1| Drosophila persimilis strain MatherB bicoid (bcd) gene, partial cds
          Length = 1378

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 516 ggtgcaggtgctgctgccggtgctgctg 543
           ||||||||||||||||| | ||||||||
Sbjct: 808 ggtgcaggtgctgctgctgttgctgctg 781



to top

>gb|AF450955.1| Drosophila persimilis strain MatherG bicoid (bcd) gene, partial cds
          Length = 1378

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 516 ggtgcaggtgctgctgccggtgctgctg 543
           ||||||||||||||||| | ||||||||
Sbjct: 808 ggtgcaggtgctgctgctgttgctgctg 781



to top

>gb|AF450954.1| Drosophila persimilis strain Mather39 bicoid (bcd) gene, partial
           cds
          Length = 1360

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 516 ggtgcaggtgctgctgccggtgctgctg 543
           ||||||||||||||||| | ||||||||
Sbjct: 790 ggtgcaggtgctgctgctgttgctgctg 763



to top

>gb|AF450953.1| Drosophila persimilis strain Mather37 bicoid (bcd) gene, partial
           cds
          Length = 1378

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 516 ggtgcaggtgctgctgccggtgctgctg 543
           ||||||||||||||||| | ||||||||
Sbjct: 808 ggtgcaggtgctgctgctgttgctgctg 781



to top

>gb|AF450952.1| Drosophila persimilis strain Mather41 bicoid (bcd) gene, partial
           cds
          Length = 1384

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 516 ggtgcaggtgctgctgccggtgctgctg 543
           ||||||||||||||||| | ||||||||
Sbjct: 808 ggtgcaggtgctgctgctgttgctgctg 781



to top

>gb|AF450951.1| Drosophila persimilis strain Mather27 bicoid (bcd) gene, partial
           cds
          Length = 1378

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 516 ggtgcaggtgctgctgccggtgctgctg 543
           ||||||||||||||||| | ||||||||
Sbjct: 808 ggtgcaggtgctgctgctgttgctgctg 781



to top

>gb|AF450950.1| Drosophila persimilis strain Mather6 bicoid (bcd) gene, partial cds
          Length = 1378

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 516 ggtgcaggtgctgctgccggtgctgctg 543
           ||||||||||||||||| | ||||||||
Sbjct: 808 ggtgcaggtgctgctgctgttgctgctg 781



to top

>gb|AF450949.1| Drosophila persimilis strain Mather40 bicoid (bcd) gene, partial
           cds
          Length = 1378

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 516 ggtgcaggtgctgctgccggtgctgctg 543
           ||||||||||||||||| | ||||||||
Sbjct: 808 ggtgcaggtgctgctgctgttgctgctg 781



to top

>gb|AF450947.1| Drosophila pseudoobscura bogotana strain Potosi2 bicoid (bcd) gene,
           partial cds
          Length = 1378

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 516 ggtgcaggtgctgctgccggtgctgctg 543
           ||||||||||||||||| | ||||||||
Sbjct: 808 ggtgcaggtgctgctgctgttgctgctg 781



to top

>gb|AF450946.1| Drosophila pseudoobscura bogotana strain Toro4 bicoid (bcd) gene,
           partial cds
          Length = 1378

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 516 ggtgcaggtgctgctgccggtgctgctg 543
           ||||||||||||||||| | ||||||||
Sbjct: 808 ggtgcaggtgctgctgctgttgctgctg 781



to top

>gb|AF450934.1| Drosophila pseudoobscura strain MSH21 bicoid (bcd) gene, partial
           cds
          Length = 1378

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 516 ggtgcaggtgctgctgccggtgctgctg 543
           ||||||||||||||||| | ||||||||
Sbjct: 808 ggtgcaggtgctgctgctgttgctgctg 781



to top

>gb|AF450933.1| Drosophila pseudoobscura strain MSH24 bicoid (bcd) gene, partial
           cds
          Length = 1378

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 516 ggtgcaggtgctgctgccggtgctgctg 543
           ||||||||||||||||| | ||||||||
Sbjct: 808 ggtgcaggtgctgctgctgttgctgctg 781



to top

>gb|AF450932.1| Drosophila pseudoobscura strain MSH32 bicoid (bcd) gene, partial
           cds
          Length = 1381

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 516 ggtgcaggtgctgctgccggtgctgctg 543
           ||||||||||||||||| | ||||||||
Sbjct: 811 ggtgcaggtgctgctgctgttgctgctg 784



to top

>gb|AF450931.1| Drosophila pseudoobscura strain MSH9 bicoid (bcd) gene, partial cds
          Length = 1378

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 516 ggtgcaggtgctgctgccggtgctgctg 543
           ||||||||||||||||| | ||||||||
Sbjct: 808 ggtgcaggtgctgctgctgttgctgctg 781



to top

>gb|AF450929.1| Drosophila pseudoobscura strain Mather52 bicoid (bcd) gene, partial
           cds
          Length = 1351

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 516 ggtgcaggtgctgctgccggtgctgctg 543
           ||||||||||||||||| | ||||||||
Sbjct: 793 ggtgcaggtgctgctgctgttgctgctg 766



to top

>gb|AF450928.1| Drosophila pseudoobscura strain Mather48 bicoid (bcd) gene, partial
           cds
          Length = 1375

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 516 ggtgcaggtgctgctgccggtgctgctg 543
           ||||||||||||||||| | ||||||||
Sbjct: 808 ggtgcaggtgctgctgctgttgctgctg 781



to top

>gb|AF450926.1| Drosophila pseudoobscura strain Mather17 bicoid (bcd) gene, partial
           cds
          Length = 1378

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 516 ggtgcaggtgctgctgccggtgctgctg 543
           ||||||||||||||||| | ||||||||
Sbjct: 808 ggtgcaggtgctgctgctgttgctgctg 781



to top

>gb|AF450925.1| Drosophila pseudoobscura strain Mather10 bicoid (bcd) gene, partial
           cds
          Length = 1378

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 516 ggtgcaggtgctgctgccggtgctgctg 543
           ||||||||||||||||| | ||||||||
Sbjct: 808 ggtgcaggtgctgctgctgttgctgctg 781



to top

>gb|AF450924.1| Drosophila pseudoobscura strain Flagstaff18 bicoid (bcd) gene,
           partial cds
          Length = 1372

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 516 ggtgcaggtgctgctgccggtgctgctg 543
           ||||||||||||||||| | ||||||||
Sbjct: 808 ggtgcaggtgctgctgctgttgctgctg 781



to top

>gb|AF450923.1| Drosophila pseudoobscura strain Flagstaff16 bicoid (bcd) gene,
           partial cds
          Length = 1372

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 516 ggtgcaggtgctgctgccggtgctgctg 543
           ||||||||||||||||| | ||||||||
Sbjct: 808 ggtgcaggtgctgctgctgttgctgctg 781



to top

>gb|AF450922.1| Drosophila pseudoobscura strain Flagstaff14 bicoid (bcd) gene,
           partial cds
          Length = 1378

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 516 ggtgcaggtgctgctgccggtgctgctg 543
           ||||||||||||||||| | ||||||||
Sbjct: 808 ggtgcaggtgctgctgctgttgctgctg 781



to top

>gb|AF450921.1| Drosophila pseudoobscura strain Flagstaff6 bicoid (bcd) gene,
           partial cds
          Length = 1366

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 516 ggtgcaggtgctgctgccggtgctgctg 543
           ||||||||||||||||| | ||||||||
Sbjct: 808 ggtgcaggtgctgctgctgttgctgctg 781



to top

>gb|AF450920.1| Drosophila pseudoobscura strain Flagstaff5 bicoid (bcd) gene,
           partial cds
          Length = 1351

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 516 ggtgcaggtgctgctgccggtgctgctg 543
           ||||||||||||||||| | ||||||||
Sbjct: 793 ggtgcaggtgctgctgctgttgctgctg 766



to top

>gb|AF450919.1| Drosophila pseudoobscura strain AFC12 bicoid (bcd) gene, partial
           cds
          Length = 1378

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 516 ggtgcaggtgctgctgccggtgctgctg 543
           ||||||||||||||||| | ||||||||
Sbjct: 808 ggtgcaggtgctgctgctgttgctgctg 781



to top

>gb|AF450918.1| Drosophila pseudoobscura strain AFC7 bicoid (bcd) gene, partial cds
          Length = 1372

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 516 ggtgcaggtgctgctgccggtgctgctg 543
           ||||||||||||||||| | ||||||||
Sbjct: 808 ggtgcaggtgctgctgctgttgctgctg 781



to top

>gb|AF450917.1| Drosophila pseudoobscura strain AFC3 bicoid (bcd) gene, partial cds
          Length = 1372

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 516 ggtgcaggtgctgctgccggtgctgctg 543
           ||||||||||||||||| | ||||||||
Sbjct: 808 ggtgcaggtgctgctgctgttgctgctg 781



to top

>gb|AF450916.1| Drosophila pseudoobscura strain AF2 bicoid (bcd) gene, partial cds
          Length = 1369

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 516 ggtgcaggtgctgctgccggtgctgctg 543
           ||||||||||||||||| | ||||||||
Sbjct: 811 ggtgcaggtgctgctgctgttgctgctg 784



to top

>gb|AF450915.1| Drosophila pseudoobscura strain Abajo36 bicoid (bcd) gene, partial
           cds
          Length = 1372

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 516 ggtgcaggtgctgctgccggtgctgctg 543
           ||||||||||||||||| | ||||||||
Sbjct: 808 ggtgcaggtgctgctgctgttgctgctg 781



to top

>gb|AC100822.2| Homo sapiens chromosome 8, clone RP11-654O1, complete sequence
          Length = 186380

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 516   ggtgcaggtgctgctgccggtgctgctg 543
             ||||||||||||||||| | ||||||||
Sbjct: 23580 ggtgcaggtgctgctgctgctgctgctg 23553



to top

>gb|AY039502.1| Soil bacterium S86D1 16S ribosomal RNA gene, partial sequence
          Length = 495

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 49  tgatcccacagagcaagctc 30



to top

>gb|AY039447.1| Earthworm burrow bacterium B11D2 16S ribosomal RNA gene, partial
           sequence
          Length = 501

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 46  tgatcccacagagcaagctc 27



to top

>gb|DQ417333.1| Microbacterium oxydans strain 15E 16S ribosomal RNA gene, partial
           sequence
          Length = 1380

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 90  tgatcccacagagcaagctc 71



to top

>gb|DQ398000.1| Microbacterium sp. W22B22 16S ribosomal RNA gene, partial sequence
          Length = 725

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 66  tgatcccacagagcaagctc 47



to top

>gb|DQ397999.1| Microbacterium sp. W22B21 16S ribosomal RNA gene, partial sequence
          Length = 725

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgatcccacagagcaagctc 102
           ||||||||||||||||||||
Sbjct: 67  tgatcccacagagcaagctc 48


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,161,536
Number of Sequences: 3902068
Number of extensions: 6161536
Number of successful extensions: 115826
Number of sequences better than 10.0: 355
Number of HSP's better than 10.0 without gapping: 355
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 114412
Number of HSP's gapped (non-prelim): 1411
length of query: 570
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 547
effective length of database: 17,143,297,704
effective search space: 9377383844088
effective search space used: 9377383844088
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top