| Clone Name | bags26o04 |
|---|---|
| Clone Library Name | barley_pub |
>gb|BT018466.1| Zea mays clone EL01N0417F11.d mRNA sequence Length = 958 Score = 361 bits (182), Expect = 1e-96 Identities = 306/346 (88%), Gaps = 1/346 (0%) Strand = Plus / Plus Query: 1 ttataccatgnatgaagtttgcgtccttcgaaactattgttgagcttatctacaaacacg 60 |||||||||| ||||||||||| ||||| || || || ||||||||||||||||| || | Sbjct: 267 ttataccatg-atgaagtttgcttcctttgagaccatcgttgagcttatctacaagcatg 325 Query: 61 ctgttcctgttccgaaggccgagtgcagcaagtcttcccagttgggtatcagctttgctg 120 |||| |||||||||||| | |||||||||||| || ||||||||||||| |||||||||| Sbjct: 326 ctgtgcctgttccgaagtctgagtgcagcaagactacccagttgggtattagctttgctg 385 Query: 121 gtggctacattgccggtgttttctgtgctattgtttctcatccggctgacaaccttgtct 180 |||| |||||||||||||| |||||||||||||||||||| ||||||||||||||||| | Sbjct: 386 gtggttacattgccggtgtcttctgtgctattgtttctcacccggctgacaaccttgtgt 445 Query: 181 cgttcctcaacaatgccaagggtgctacagtgggcgatgctgttaagaagattggcatgt 240 | ||||| |||||||||||||| ||||||||||| ||||||||||||||| |||| | | Sbjct: 446 ctttcctgaacaatgccaagggagctacagtgggagatgctgttaagaagcttggtctct 505 Query: 241 tgggccttttcaccagagggctcccccttcgtatcgtcatgattggtactcttactggtg 300 ||| || ||||| ||||| || || ||||||||||||||||||||||| |||||||||| Sbjct: 506 ggggtctcttcactagaggacttcctcttcgtatcgtcatgattggtacccttactggtg 565 Query: 301 ctcagtggggaatctatgatgcgtttaaagttatggtgggactccc 346 ||||||||||||| || ||||| || ||||| ||||| |||||||| Sbjct: 566 ctcagtggggaatttacgatgcattcaaagtgatggttggactccc 611
>gb|AY104226.1| Zea mays PCO060710 mRNA sequence Length = 1639 Score = 361 bits (182), Expect = 1e-96 Identities = 306/346 (88%), Gaps = 1/346 (0%) Strand = Plus / Plus Query: 1 ttataccatgnatgaagtttgcgtccttcgaaactattgttgagcttatctacaaacacg 60 |||||||||| ||||||||||| ||||| || || || ||||||||||||||||| || | Sbjct: 836 ttataccatg-atgaagtttgcttcctttgagaccatcgttgagcttatctacaagcatg 894 Query: 61 ctgttcctgttccgaaggccgagtgcagcaagtcttcccagttgggtatcagctttgctg 120 |||| |||||||||||| | |||||||||||| || ||||||||||||| |||||||||| Sbjct: 895 ctgtgcctgttccgaagtctgagtgcagcaagactacccagttgggtattagctttgctg 954 Query: 121 gtggctacattgccggtgttttctgtgctattgtttctcatccggctgacaaccttgtct 180 |||| |||||||||||||| |||||||||||||||||||| ||||||||||||||||| | Sbjct: 955 gtggttacattgccggtgtcttctgtgctattgtttctcacccggctgacaaccttgtgt 1014 Query: 181 cgttcctcaacaatgccaagggtgctacagtgggcgatgctgttaagaagattggcatgt 240 | ||||| |||||||||||||| ||||||||||| ||||||||||||||| |||| | | Sbjct: 1015 ctttcctgaacaatgccaagggagctacagtgggagatgctgttaagaagcttggtctct 1074 Query: 241 tgggccttttcaccagagggctcccccttcgtatcgtcatgattggtactcttactggtg 300 ||| || ||||| ||||| || || ||||||||||||||||||||||| |||||||||| Sbjct: 1075 ggggtctcttcactagaggacttcctcttcgtatcgtcatgattggtacccttactggtg 1134 Query: 301 ctcagtggggaatctatgatgcgtttaaagttatggtgggactccc 346 ||||||||||||| || ||||| || ||||| ||||| |||||||| Sbjct: 1135 ctcagtggggaatttacgatgcattcaaagtgatggttggactccc 1180
>dbj|AB016064.1| Zea mays mRNA for mitochondrial phosphate transporter, complete cds Length = 1444 Score = 361 bits (182), Expect = 1e-96 Identities = 306/346 (88%), Gaps = 1/346 (0%) Strand = Plus / Plus Query: 1 ttataccatgnatgaagtttgcgtccttcgaaactattgttgagcttatctacaaacacg 60 |||||||||| ||||||||||| ||||| || || || ||||||||||||||||| || | Sbjct: 744 ttataccatg-atgaagtttgcttcctttgagaccatcgttgagcttatctacaagcatg 802 Query: 61 ctgttcctgttccgaaggccgagtgcagcaagtcttcccagttgggtatcagctttgctg 120 |||| |||||||||||| | |||||||||||| || ||||||||||||| |||||||||| Sbjct: 803 ctgtgcctgttccgaagtctgagtgcagcaagactacccagttgggtattagctttgctg 862 Query: 121 gtggctacattgccggtgttttctgtgctattgtttctcatccggctgacaaccttgtct 180 |||| |||||||||||||| |||||||||||||||||||| ||||||||||||||||| | Sbjct: 863 gtggttacattgccggtgtgttctgtgctattgtttctcacccggctgacaaccttgtgt 922 Query: 181 cgttcctcaacaatgccaagggtgctacagtgggcgatgctgttaagaagattggcatgt 240 | ||||| |||||||||||||| ||||||||||| ||||||||||||||| |||| | | Sbjct: 923 ctttcctgaacaatgccaagggagctacagtgggagatgctgttaagaagcttggtctct 982 Query: 241 tgggccttttcaccagagggctcccccttcgtatcgtcatgattggtactcttactggtg 300 ||| || ||||| ||||| || || ||||||||||||||||||||||| |||||||||| Sbjct: 983 ggggtctcttcactagaggacttcctcttcgtatcgtcatgattggtacccttactggtg 1042 Query: 301 ctcagtggggaatctatgatgcgtttaaagttatggtgggactccc 346 ||||||||||||| || ||||| || ||||| ||||| |||||||| Sbjct: 1043 ctcagtggggaatttacgatgcattcaaagtgatggttggactccc 1088
>ref|XM_467970.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1612 Score = 287 bits (145), Expect = 2e-74 Identities = 298/349 (85%) Strand = Plus / Plus Query: 12 atgaagtttgcgtccttcgaaactattgttgagcttatctacaaacacgctgttcctgtt 71 ||||||||||| ||||| || || |||||||| | |||||||| ||||||||||||||| Sbjct: 885 atgaagtttgcctcctttgagaccattgttgaaatgatctacaagcacgctgttcctgtt 944 Query: 72 ccgaaggccgagtgcagcaagtcttcccagttgggtatcagctttgctggtggctacatt 131 |||||| | |||||||||||||||| ||| ||||||||||| || |||||||| |||||| Sbjct: 945 ccgaagtctgagtgcagcaagtctttccaattgggtatcagtttcgctggtggttacatt 1004 Query: 132 gccggtgttttctgtgctattgtttctcatccggctgacaaccttgtctcgttcctcaac 191 || || || |||||||| ||||| |||||||| ||||||||| | ||||| ||| | ||| Sbjct: 1005 gctggagtcttctgtgccattgtctctcatccagctgacaacttggtctctttcttgaac 1064 Query: 192 aatgccaagggtgctacagtgggcgatgctgttaagaagattggcatgttgggccttttc 251 || |||||||| ||||||||||| ||||||||||| ||| |||| | | |||||||||| Sbjct: 1065 aacgccaagggagctacagtgggtgatgctgttaaaaagcttggtctttggggccttttc 1124 Query: 252 accagagggctcccccttcgtatcgtcatgattggtactcttactggtgctcagtgggga 311 || ||||| || ||||||||||| || |||||||| ||||||||||||||||| ||||| Sbjct: 1125 actagaggactgccccttcgtattgttatgattggaactcttactggtgctcaatggggt 1184 Query: 312 atctatgatgcgtttaaagttatggtgggactcccgaccaccggcggtg 360 || |||||||| |||||||| ||||| ||||| || || ||||| |||| Sbjct: 1185 atttatgatgcttttaaagtcatggttggacttccaacaaccggtggtg 1233
>dbj|AB016065.1| Oryza sativa (japonica cultivar-group) mRNA for mitochondrial phosphate transporter, complete cds Length = 1552 Score = 287 bits (145), Expect = 2e-74 Identities = 298/349 (85%) Strand = Plus / Plus Query: 12 atgaagtttgcgtccttcgaaactattgttgagcttatctacaaacacgctgttcctgtt 71 ||||||||||| ||||| || || |||||||| | |||||||| ||||||||||||||| Sbjct: 850 atgaagtttgcctcctttgagaccattgttgaaatgatctacaagcacgctgttcctgtt 909 Query: 72 ccgaaggccgagtgcagcaagtcttcccagttgggtatcagctttgctggtggctacatt 131 |||||| | |||||||||||||||| ||| ||||||||||| || |||||||| |||||| Sbjct: 910 ccgaagtctgagtgcagcaagtctttccaattgggtatcagtttcgctggtggttacatt 969 Query: 132 gccggtgttttctgtgctattgtttctcatccggctgacaaccttgtctcgttcctcaac 191 || || || |||||||| ||||| |||||||| ||||||||| | ||||| ||| | ||| Sbjct: 970 gctggagtcttctgtgccattgtctctcatccagctgacaacttggtctctttcttgaac 1029 Query: 192 aatgccaagggtgctacagtgggcgatgctgttaagaagattggcatgttgggccttttc 251 || |||||||| ||||||||||| ||||||||||| ||| |||| | | |||||||||| Sbjct: 1030 aacgccaagggagctacagtgggtgatgctgttaaaaagcttggtctttggggccttttc 1089 Query: 252 accagagggctcccccttcgtatcgtcatgattggtactcttactggtgctcagtgggga 311 || ||||| || ||||||||||| || |||||||| ||||||||||||||||| ||||| Sbjct: 1090 actagaggactgccccttcgtattgttatgattggaactcttactggtgctcaatggggt 1149 Query: 312 atctatgatgcgtttaaagttatggtgggactcccgaccaccggcggtg 360 || |||||||| |||||||| ||||| ||||| || || ||||| |||| Sbjct: 1150 atttatgatgcttttaaagtcatggttggacttccaacaaccggtggtg 1198
>dbj|AK069611.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023022H13, full insert sequence Length = 1612 Score = 280 bits (141), Expect = 4e-72 Identities = 297/349 (85%) Strand = Plus / Plus Query: 12 atgaagtttgcgtccttcgaaactattgttgagcttatctacaaacacgctgttcctgtt 71 ||||||||||| ||||| || || |||||||| | |||||||| ||||||||||||||| Sbjct: 885 atgaagtttgcctcctttgagaccattgttgaaatgatctacaagcacgctgttcctgtt 944 Query: 72 ccgaaggccgagtgcagcaagtcttcccagttgggtatcagctttgctggtggctacatt 131 |||||| | |||||||||||||||| ||| ||||||||||| || |||||||| |||||| Sbjct: 945 ccgaagtctgagtgcagcaagtctttccaattgggtatcagtttcgctggtggttacatt 1004 Query: 132 gccggtgttttctgtgctattgtttctcatccggctgacaaccttgtctcgttcctcaac 191 || || || |||||||| ||||| |||||||| ||||||||| | ||||| ||| | ||| Sbjct: 1005 gctggagtcttctgtgccattgtctctcatccagctgacaacttggtctctttcttgaac 1064 Query: 192 aatgccaagggtgctacagtgggcgatgctgttaagaagattggcatgttgggccttttc 251 || |||||||| ||||||||||| ||||||||||| ||| |||| | | |||||||||| Sbjct: 1065 aacgccaagggagctacagtgggtgatgctgttaaaaagcttggtctttggggccttttc 1124 Query: 252 accagagggctcccccttcgtatcgtcatgattggtactcttactggtgctcagtgggga 311 | ||||| || ||||||||||| || |||||||| ||||||||||||||||| ||||| Sbjct: 1125 tctagaggactgccccttcgtattgttatgattggaactcttactggtgctcaatggggt 1184 Query: 312 atctatgatgcgtttaaagttatggtgggactcccgaccaccggcggtg 360 || |||||||| |||||||| ||||| ||||| || || ||||| |||| Sbjct: 1185 atttatgatgcttttaaagtcatggttggacttccaacaaccggtggtg 1233
>dbj|AK066979.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013090N24, full insert sequence Length = 1410 Score = 266 bits (134), Expect = 6e-68 Identities = 278/326 (85%) Strand = Plus / Plus Query: 12 atgaagtttgcgtccttcgaaactattgttgagcttatctacaaacacgctgttcctgtt 71 ||||||||||| ||||| || || |||||||| | |||||||| || ||||||||||| Sbjct: 792 atgaagtttgcatcctttgagaccattgttgaacaaatctacaagcatgctgttcctgtc 851 Query: 72 ccgaaggccgagtgcagcaagtcttcccagttgggtatcagctttgctggtggctacatt 131 |||||| | ||||| ||||| || | ||||||||||||||||||||||||||| |||||| Sbjct: 852 ccgaagtcagagtgtagcaaatcattccagttgggtatcagctttgctggtggttacatt 911 Query: 132 gccggtgttttctgtgctattgtttctcatccggctgacaaccttgtctcgttcctcaac 191 |||||||| |||||||||||||||||||| ||||| || || || ||||| ||||| ||| Sbjct: 912 gccggtgtcttctgtgctattgtttctcacccggcagataatctagtctctttcctgaac 971 Query: 192 aatgccaagggtgctacagtgggcgatgctgttaagaagattggcatgttgggccttttc 251 ||||||||||||||||||||||| ||||||||||||||| |||| | | ||| || ||| Sbjct: 972 aatgccaagggtgctacagtgggtgatgctgttaagaagcttggtctctggggtctattc 1031 Query: 252 accagagggctcccccttcgtatcgtcatgattggtactcttactggtgctcagtgggga 311 || | || || ||||| ||||| |||||||| ||||| |||||||| ||||| |||||| Sbjct: 1032 actcgtggactgcccctacgtattgtcatgatcggtacccttactggagctcaatgggga 1091 Query: 312 atctatgatgcgtttaaagttatggt 337 || |||||||| || ||||| ||||| Sbjct: 1092 atttatgatgcattcaaagtcatggt 1117
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 206 bits (104), Expect = 5e-50 Identities = 182/208 (87%) Strand = Plus / Plus Query: 12 atgaagtttgcgtccttcgaaactattgttgagcttatctacaaacacgctgttcctgtt 71 ||||||||||| ||||| || || |||||||| | |||||||| || ||||||||||| Sbjct: 5651332 atgaagtttgcatcctttgagaccattgttgaacaaatctacaagcatgctgttcctgtc 5651391 Query: 72 ccgaaggccgagtgcagcaagtcttcccagttgggtatcagctttgctggtggctacatt 131 |||||| | ||||| ||||| || | ||||||||||||||||||||||||||| |||||| Sbjct: 5651392 ccgaagtcagagtgtagcaaatcattccagttgggtatcagctttgctggtggttacatt 5651451 Query: 132 gccggtgttttctgtgctattgtttctcatccggctgacaaccttgtctcgttcctcaac 191 |||||||| |||||||||||||||||||| ||||| || || || ||||| ||||| ||| Sbjct: 5651452 gccggtgtcttctgtgctattgtttctcacccggcagataatctagtctctttcctgaac 5651511 Query: 192 aatgccaagggtgctacagtgggcgatg 219 ||||||||||||||||||||||| |||| Sbjct: 5651512 aatgccaagggtgctacagtgggtgatg 5651539
>dbj|AP004687.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0021C04 Length = 162115 Score = 206 bits (104), Expect = 5e-50 Identities = 182/208 (87%) Strand = Plus / Plus Query: 12 atgaagtttgcgtccttcgaaactattgttgagcttatctacaaacacgctgttcctgtt 71 ||||||||||| ||||| || || |||||||| | |||||||| || ||||||||||| Sbjct: 43479 atgaagtttgcatcctttgagaccattgttgaacaaatctacaagcatgctgttcctgtc 43538 Query: 72 ccgaaggccgagtgcagcaagtcttcccagttgggtatcagctttgctggtggctacatt 131 |||||| | ||||| ||||| || | ||||||||||||||||||||||||||| |||||| Sbjct: 43539 ccgaagtcagagtgtagcaaatcattccagttgggtatcagctttgctggtggttacatt 43598 Query: 132 gccggtgttttctgtgctattgtttctcatccggctgacaaccttgtctcgttcctcaac 191 |||||||| |||||||||||||||||||| ||||| || || || ||||| ||||| ||| Sbjct: 43599 gccggtgtcttctgtgctattgtttctcacccggcagataatctagtctctttcctgaac 43658 Query: 192 aatgccaagggtgctacagtgggcgatg 219 ||||||||||||||||||||||| |||| Sbjct: 43659 aatgccaagggtgctacagtgggtgatg 43686
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 182 bits (92), Expect = 7e-43 Identities = 179/208 (86%) Strand = Plus / Minus Query: 12 atgaagtttgcgtccttcgaaactattgttgagcttatctacaaacacgctgttcctgtt 71 ||||||||||| ||||| || || |||||||| | |||||||| ||||||||||||||| Sbjct: 32339178 atgaagtttgcctcctttgagaccattgttgaaatgatctacaagcacgctgttcctgtt 32339119 Query: 72 ccgaaggccgagtgcagcaagtcttcccagttgggtatcagctttgctggtggctacatt 131 |||||| | |||||||||||||||| ||| ||||||||||| || |||||||| |||||| Sbjct: 32339118 ccgaagtctgagtgcagcaagtctttccaattgggtatcagtttcgctggtggttacatt 32339059 Query: 132 gccggtgttttctgtgctattgtttctcatccggctgacaaccttgtctcgttcctcaac 191 || || || |||||||| ||||| |||||||| ||||||||| | ||||| ||| | ||| Sbjct: 32339058 gctggagtcttctgtgccattgtctctcatccagctgacaacttggtctctttcttgaac 32338999 Query: 192 aatgccaagggtgctacagtgggcgatg 219 || |||||||| ||||||||||| |||| Sbjct: 32338998 aacgccaagggagctacagtgggtgatg 32338971 Score = 107 bits (54), Expect = 3e-20 Identities = 90/102 (88%) Strand = Plus / Minus Query: 242 gggccttttcaccagagggctcccccttcgtatcgtcatgattggtactcttactggtgc 301 |||||||||||| ||||| || ||||||||||| || |||||||| |||||||||||||| Sbjct: 32338473 gggccttttcactagaggactgccccttcgtattgttatgattggaactcttactggtgc 32338414 Query: 302 tcagtggggaatctatgatgcgtttaaagttatggtgggact 343 ||| ||||| || |||||||| |||||||| ||||| ||||| Sbjct: 32338413 tcaatggggtatttatgatgcttttaaagtcatggttggact 32338372
>dbj|AP005287.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1004_A11 Length = 132352 Score = 182 bits (92), Expect = 7e-43 Identities = 179/208 (86%) Strand = Plus / Minus Query: 12 atgaagtttgcgtccttcgaaactattgttgagcttatctacaaacacgctgttcctgtt 71 ||||||||||| ||||| || || |||||||| | |||||||| ||||||||||||||| Sbjct: 115010 atgaagtttgcctcctttgagaccattgttgaaatgatctacaagcacgctgttcctgtt 114951 Query: 72 ccgaaggccgagtgcagcaagtcttcccagttgggtatcagctttgctggtggctacatt 131 |||||| | |||||||||||||||| ||| ||||||||||| || |||||||| |||||| Sbjct: 114950 ccgaagtctgagtgcagcaagtctttccaattgggtatcagtttcgctggtggttacatt 114891 Query: 132 gccggtgttttctgtgctattgtttctcatccggctgacaaccttgtctcgttcctcaac 191 || || || |||||||| ||||| |||||||| ||||||||| | ||||| ||| | ||| Sbjct: 114890 gctggagtcttctgtgccattgtctctcatccagctgacaacttggtctctttcttgaac 114831 Query: 192 aatgccaagggtgctacagtgggcgatg 219 || |||||||| ||||||||||| |||| Sbjct: 114830 aacgccaagggagctacagtgggtgatg 114803 Score = 107 bits (54), Expect = 3e-20 Identities = 90/102 (88%) Strand = Plus / Minus Query: 242 gggccttttcaccagagggctcccccttcgtatcgtcatgattggtactcttactggtgc 301 |||||||||||| ||||| || ||||||||||| || |||||||| |||||||||||||| Sbjct: 114305 gggccttttcactagaggactgccccttcgtattgttatgattggaactcttactggtgc 114246 Query: 302 tcagtggggaatctatgatgcgtttaaagttatggtgggact 343 ||| ||||| || |||||||| |||||||| ||||| ||||| Sbjct: 114245 tcaatggggtatttatgatgcttttaaagtcatggttggact 114204
>dbj|AP004125.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1767_D02 Length = 139145 Score = 182 bits (92), Expect = 7e-43 Identities = 179/208 (86%) Strand = Plus / Minus Query: 12 atgaagtttgcgtccttcgaaactattgttgagcttatctacaaacacgctgttcctgtt 71 ||||||||||| ||||| || || |||||||| | |||||||| ||||||||||||||| Sbjct: 691 atgaagtttgcctcctttgagaccattgttgaaatgatctacaagcacgctgttcctgtt 632 Query: 72 ccgaaggccgagtgcagcaagtcttcccagttgggtatcagctttgctggtggctacatt 131 |||||| | |||||||||||||||| ||| ||||||||||| || |||||||| |||||| Sbjct: 631 ccgaagtctgagtgcagcaagtctttccaattgggtatcagtttcgctggtggttacatt 572 Query: 132 gccggtgttttctgtgctattgtttctcatccggctgacaaccttgtctcgttcctcaac 191 || || || |||||||| ||||| |||||||| ||||||||| | ||||| ||| | ||| Sbjct: 571 gctggagtcttctgtgccattgtctctcatccagctgacaacttggtctctttcttgaac 512 Query: 192 aatgccaagggtgctacagtgggcgatg 219 || |||||||| ||||||||||| |||| Sbjct: 511 aacgccaagggagctacagtgggtgatg 484
>gb|BT014277.1| Lycopersicon esculentum clone 133507F, mRNA sequence Length = 1482 Score = 163 bits (82), Expect = 7e-37 Identities = 184/218 (84%) Strand = Plus / Plus Query: 105 ggtatcagctttgctggtggctacattgccggtgttttctgtgctattgtttctcatccg 164 ||||| || ||||||||||| || || || ||||| |||||||| ||||| || ||||| Sbjct: 915 ggtattagttttgctggtggatatatagctggtgtcttctgtgccattgtatcccatcct 974 Query: 165 gctgacaaccttgtctcgttcctcaacaatgccaagggtgctacagtgggcgatgctgtt 224 |||||||| ||||||||||||||||||||||| |||||||| || || || ||||| || Sbjct: 975 gctgacaatcttgtctcgttcctcaacaatgcgaagggtgcaactgttggtgatgccgta 1034 Query: 225 aagaagattggcatgttgggccttttcaccagagggctcccccttcgtatcgtcatgatt 284 |||||||| || | |||||||| || ||| | || || || || ||||| ||||||||| Sbjct: 1035 aagaagataggagtattgggcctctttacccgtggtctacctctacgtattgtcatgatt 1094 Query: 285 ggtactcttactggtgctcagtggggaatctatgatgc 322 || ||||||||||||||||| ||||||||||||||||| Sbjct: 1095 ggaactcttactggtgctcaatggggaatctatgatgc 1132 Score = 48.1 bits (24), Expect = 0.027 Identities = 39/44 (88%) Strand = Plus / Plus Query: 12 atgaagtttgcgtccttcgaaactattgttgagcttatctacaa 55 ||||||||||||||||| || |||||||| ||| | |||||||| Sbjct: 822 atgaagtttgcgtcctttgagactattgtggagatgatctacaa 865
>emb|AJ275306.1|CAR275306 Cicer arietinum partial mRNA for mitochondrial phosphate transporter Length = 1228 Score = 143 bits (72), Expect = 6e-31 Identities = 187/224 (83%), Gaps = 1/224 (0%) Strand = Plus / Plus Query: 109 tcagctttgctggtggctacattgccggtgttttctgtgcta-ttgtttctcatccggct 167 |||| ||||||||||| |||||||| |||||| | ||||| | |||| |||||||| ||| Sbjct: 583 tcagttttgctggtggatacattgctggtgttctttgtgcaaattgtgtctcatcctgct 642 Query: 168 gacaaccttgtctcgttcctcaacaatgccaagggtgctacagtgggcgatgctgttaag 227 || || | |||||| ||||| ||||||||||| ||||| ||||| || |||||||||||| Sbjct: 643 gataatcctgtctctttcctgaacaatgccaaaggtgcaacagttggtgatgctgttaag 702 Query: 228 aagattggcatgttgggccttttcaccagagggctcccccttcgtatcgtcatgattggt 287 ||| |||| || |||| ||||||||| |||| ||||| || ||||| || |||||||| Sbjct: 703 aagtttggtgtggtggggcttttcacccgaggtctccctctacgtattgttatgattgga 762 Query: 288 actcttactggtgctcagtggggaatctatgatgcgtttaaagt 331 || ||||| ||||| || |||||||| |||||||| || ||||| Sbjct: 763 acacttaccggtgcccaatggggaatatatgatgctttcaaagt 806
>ref|XM_462662.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1083 Score = 121 bits (61), Expect = 2e-24 Identities = 190/233 (81%) Strand = Plus / Plus Query: 111 agctttgctggtggctacattgccggtgttttctgtgctattgtttctcatccggctgac 170 |||||||| ||||| |||||||| || || |||||||| || ||||| || || || ||| Sbjct: 811 agctttgcaggtggttacattgcaggggtgttctgtgcaatagtttcacaccctgcggac 870 Query: 171 aaccttgtctcgttcctcaacaatgccaagggtgctacagtgggcgatgctgttaagaag 230 || ||||| || |||||||||||||||||||| || ||||| ||||||||||| || ||| Sbjct: 871 aatcttgtgtctttcctcaacaatgccaagggcgcaacagttggcgatgctgtgaataag 930 Query: 231 attggcatgttgggccttttcaccagagggctcccccttcgtatcgtcatgattggtact 290 |||| |||| ||| || || || | || ||||| | |||||||| ||||| |||||| Sbjct: 931 cttggtatgtggggtctatttacgcgtggactccctttgcgtatcgtgatgatcggtact 990 Query: 291 cttactggtgctcagtggggaatctatgatgcgtttaaagttatggtgggact 343 || ||||| || ||||||||| ||||||| || || ||||| ||||| ||||| Sbjct: 991 ctcactggagcgcagtggggactctatgacgctttcaaagtgatggttggact 1043
>dbj|AK105021.2| Oryza sativa (japonica cultivar-group) cDNA clone:001-010-E02, full insert sequence Length = 1772 Score = 121 bits (61), Expect = 2e-24 Identities = 190/233 (81%) Strand = Plus / Plus Query: 111 agctttgctggtggctacattgccggtgttttctgtgctattgtttctcatccggctgac 170 |||||||| ||||| |||||||| || || |||||||| || ||||| || || || ||| Sbjct: 1009 agctttgcaggtggttacattgcaggggtgttctgtgcaatagtttcacaccctgcggac 1068 Query: 171 aaccttgtctcgttcctcaacaatgccaagggtgctacagtgggcgatgctgttaagaag 230 || ||||| || |||||||||||||||||||| || ||||| ||||||||||| || ||| Sbjct: 1069 aatcttgtgtctttcctcaacaatgccaagggcgcaacagttggcgatgctgtgaataag 1128 Query: 231 attggcatgttgggccttttcaccagagggctcccccttcgtatcgtcatgattggtact 290 |||| |||| ||| || || || | || ||||| | |||||||| ||||| |||||| Sbjct: 1129 cttggtatgtggggtctatttacgcgtggactccctttgcgtatcgtgatgatcggtact 1188 Query: 291 cttactggtgctcagtggggaatctatgatgcgtttaaagttatggtgggact 343 || ||||| || ||||||||| ||||||| || || ||||| ||||| ||||| Sbjct: 1189 ctcactggagcgcagtggggactctatgacgctttcaaagtgatggttggact 1241
>dbj|AK069397.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023012A09, full insert sequence Length = 1703 Score = 121 bits (61), Expect = 2e-24 Identities = 190/233 (81%) Strand = Plus / Plus Query: 111 agctttgctggtggctacattgccggtgttttctgtgctattgtttctcatccggctgac 170 |||||||| ||||| |||||||| || || |||||||| || ||||| || || || ||| Sbjct: 872 agctttgcaggtggttacattgcaggggtgttctgtgcaatagtttcacaccctgcggac 931 Query: 171 aaccttgtctcgttcctcaacaatgccaagggtgctacagtgggcgatgctgttaagaag 230 || ||||| || |||||||||||||||||||| || ||||| ||||||||||| || ||| Sbjct: 932 aatcttgtgtctttcctcaacaatgccaagggcgcaacagttggcgatgctgtgaataag 991 Query: 231 attggcatgttgggccttttcaccagagggctcccccttcgtatcgtcatgattggtact 290 |||| |||| ||| || || || | || ||||| | |||||||| ||||| |||||| Sbjct: 992 cttggtatgtggggtctatttacgcgtggactccctttgcgtatcgtgatgatcggtact 1051 Query: 291 cttactggtgctcagtggggaatctatgatgcgtttaaagttatggtgggact 343 || ||||| || ||||||||| ||||||| || || ||||| ||||| ||||| Sbjct: 1052 ctcactggagcgcagtggggactctatgacgctttcaaagtgatggttggact 1104
>gb|AF452453.1|AF452453 Glycine max phosphate transporter mRNA, complete cds; nuclear gene for mitochondrial product Length = 1470 Score = 101 bits (51), Expect = 2e-18 Identities = 180/223 (80%) Strand = Plus / Plus Query: 109 tcagctttgctggtggctacattgccggtgttttctgtgctattgtttctcatccggctg 168 |||| ||||||||||| || ||||| ||||| | ||||| ||||| |||||||| |||| Sbjct: 794 tcagttttgctggtggatatattgctggtgtactttgtgcaattgtgtctcatcctgctg 853 Query: 169 acaaccttgtctcgttcctcaacaatgccaagggtgctacagtgggcgatgctgttaaga 228 | || |||||||| || || |||||||| || || || ||||| || ||||| || |||| Sbjct: 854 ataatcttgtctcttttctgaacaatgcaaaaggagcaacagttggtgatgcggtgaaga 913 Query: 229 agattggcatgttgggccttttcaccagagggctcccccttcgtatcgtcatgattggta 288 || ||||| ||| ||| || || ||| | || || ||||| ||||| || |||||||| | Sbjct: 914 agcttggcctgtggggtctctttacccgtggtcttcccctccgtattgttatgattggaa 973 Query: 289 ctcttactggtgctcagtggggaatctatgatgcgtttaaagt 331 |||||||||| || || |||||||| |||||||| || ||||| Sbjct: 974 ctcttactggagcccaatggggaatatatgatgcattcaaagt 1016
>dbj|AB077283.1| Lotus japonicus LjMPT mRNA for mitochondrial phosphate transporter, complete cds Length = 1621 Score = 87.7 bits (44), Expect = 3e-14 Identities = 251/320 (78%) Strand = Plus / Plus Query: 12 atgaagtttgcgtccttcgaaactattgttgagcttatctacaaacacgctgttcctgtt 71 ||||||||||| ||||| || || ||||||||| | ||||| || || || ||||| ||| Sbjct: 818 atgaagtttgcttcctttgagaccattgttgagatgatctataagcatgccgttcccgtt 877 Query: 72 ccgaaggccgagtgcagcaagtcttcccagttgggtatcagctttgctggtggctacatt 131 || ||| |||||||||||| | || | |||||||| || |||||||| || || Sbjct: 878 ccaaagagcgagtgcagcaaaaatctgcaactcggtatcagtttcgctggtggatatgtt 937 Query: 132 gccggtgttttctgtgctattgtttctcatccggctgacaaccttgtctcgttcctcaac 191 || ||||| || ||||| ||||| |||||||| ||||| || |||||||| || |||||| Sbjct: 938 gctggtgtattttgtgcaattgtgtctcatcctgctgataatcttgtctcttttctcaac 997 Query: 192 aatgccaagggtgctacagtgggcgatgctgttaagaagattggcatgttgggccttttc 251 ||||| | || || ||||| || ||||| || |||||| | ||||||| ||| || || Sbjct: 998 aatgctcaaggcgcaacagttggtgatgcggtgaagaagctcggcatgtggggtctcttt 1057 Query: 252 accagagggctcccccttcgtatcgtcatgattggtactcttactggtgctcagtgggga 311 ||| | || || || || ||||| |||||||| || || |||||||| || || |||||| Sbjct: 1058 acccgtggtcttcctctccgtattgtcatgatcggaacacttactggagcccaatgggga 1117 Query: 312 atctatgatgcgtttaaagt 331 ||||| ||||| || ||||| Sbjct: 1118 atctacgatgcattcaaagt 1137
>emb|Y08499.1|BPPT B.pendula mRNA encoding mitochondrial phosphate translocator Length = 1330 Score = 83.8 bits (42), Expect = 5e-13 Identities = 177/222 (79%) Strand = Plus / Plus Query: 111 agctttgctggtggctacattgccggtgttttctgtgctattgtttctcatccggctgac 170 ||||||||||| || || | || ||||| ||||||||||| || || || || |||||| Sbjct: 894 agctttgctggcggatatgtggctggtgtattctgtgctatcgtctcacaccctgctgac 953 Query: 171 aaccttgtctcgttcctcaacaatgccaagggtgctacagtgggcgatgctgttaagaag 230 || || || || ||||||||||||||||||||||| || || || |||||||| |||||| Sbjct: 954 aatctggtgtctttcctcaacaatgccaagggtgcaactgtcggtgatgctgtgaagaag 1013 Query: 231 attggcatgttgggccttttcaccagagggctcccccttcgtatcgtcatgattggtact 290 || || ||||||| |||| ||| | || || || |||||||| ||||| |||| || Sbjct: 1014 atgggattgttgggtctttgtacccgtggccttcctcttcgtatattcatggttggaacc 1073 Query: 291 cttactggtgctcagtggggaatctatgatgcgtttaaagtt 332 || || || | ||||||||||| |||||||| || |||||| Sbjct: 1074 ctcacgggagtccagtggggaatttatgatgctttcaaagtt 1115
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 81.8 bits (41), Expect = 2e-12 Identities = 92/109 (84%) Strand = Plus / Plus Query: 111 agctttgctggtggctacattgccggtgttttctgtgctattgtttctcatccggctgac 170 |||||||| ||||| |||||||| || || |||||||| || ||||| || || || ||| Sbjct: 22340777 agctttgcaggtggttacattgcaggggtgttctgtgcaatagtttcacaccctgcggac 22340836 Query: 171 aaccttgtctcgttcctcaacaatgccaagggtgctacagtgggcgatg 219 || ||||| || |||||||||||||||||||| || ||||| ||||||| Sbjct: 22340837 aatcttgtgtctttcctcaacaatgccaagggcgcaacagttggcgatg 22340885
>emb|AL606448.3|OSJN00013 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0064H22, complete sequence Length = 147214 Score = 81.8 bits (41), Expect = 2e-12 Identities = 92/109 (84%) Strand = Plus / Plus Query: 111 agctttgctggtggctacattgccggtgttttctgtgctattgtttctcatccggctgac 170 |||||||| ||||| |||||||| || || |||||||| || ||||| || || || ||| Sbjct: 91681 agctttgcaggtggttacattgcaggggtgttctgtgcaatagtttcacaccctgcggac 91740 Query: 171 aaccttgtctcgttcctcaacaatgccaagggtgctacagtgggcgatg 219 || ||||| || |||||||||||||||||||| || ||||| ||||||| Sbjct: 91741 aatcttgtgtctttcctcaacaatgccaagggcgcaacagttggcgatg 91789
>ref|NM_121407.2| Arabidopsis thaliana binding / transporter AT5G14040 mRNA, complete cds Length = 1649 Score = 73.8 bits (37), Expect = 5e-10 Identities = 109/133 (81%) Strand = Plus / Plus Query: 130 ttgccggtgttttctgtgctattgtttctcatccggctgacaaccttgtctcgttcctca 189 ||||||| || |||||||| || ||||||||||| || ||||| || || || ||||||| Sbjct: 959 ttgccggagtgttctgtgccatcgtttctcatccagcagacaatctagtgtcattcctca 1018 Query: 190 acaatgccaagggtgctacagtgggcgatgctgttaagaagattggcatgttgggccttt 249 |||| || ||||| || || || || ||||| || ||||||||||| ||| |||| || | Sbjct: 1019 acaacgctaagggagcaaccgttggagatgcggtgaagaagattggtatggtgggactgt 1078 Query: 250 tcaccagagggct 262 |||| |||||||| Sbjct: 1079 tcacaagagggct 1091
>gb|AY143869.1| Arabidopsis thaliana At5g14040/MUA22_4 mRNA, complete cds Length = 1128 Score = 73.8 bits (37), Expect = 5e-10 Identities = 109/133 (81%) Strand = Plus / Plus Query: 130 ttgccggtgttttctgtgctattgtttctcatccggctgacaaccttgtctcgttcctca 189 ||||||| || |||||||| || ||||||||||| || ||||| || || || ||||||| Sbjct: 854 ttgccggagtgttctgtgccatcgtttctcatccagcagacaatctagtgtcattcctca 913 Query: 190 acaatgccaagggtgctacagtgggcgatgctgttaagaagattggcatgttgggccttt 249 |||| || ||||| || || || || ||||| || ||||||||||| ||| |||| || | Sbjct: 914 acaacgctaagggagcaaccgttggagatgcggtgaagaagattggtatggtgggactgt 973 Query: 250 tcaccagagggct 262 |||| |||||||| Sbjct: 974 tcacaagagggct 986
>gb|AY142545.1| Arabidopsis thaliana clone RAFL07-09-K24 (R10865) mRNA sequence Length = 2578 Score = 73.8 bits (37), Expect = 5e-10 Identities = 109/133 (81%) Strand = Plus / Plus Query: 130 ttgccggtgttttctgtgctattgtttctcatccggctgacaaccttgtctcgttcctca 189 ||||||| || |||||||| || ||||||||||| || ||||| || || || ||||||| Sbjct: 959 ttgccggagtgttctgtgccatcgtttctcatccagcagacaatctagtgtcattcctca 1018 Query: 190 acaatgccaagggtgctacagtgggcgatgctgttaagaagattggcatgttgggccttt 249 |||| || ||||| || || || || ||||| || ||||||||||| ||| |||| || | Sbjct: 1019 acaacgctaagggagcaaccgttggagatgcggtgaagaagattggtatggtgggactgt 1078 Query: 250 tcaccagagggct 262 |||| |||||||| Sbjct: 1079 tcacaagagggct 1091
>gb|AY058848.1| Arabidopsis thaliana AT5g14040/MUA22_4 mRNA, complete cds Length = 1649 Score = 73.8 bits (37), Expect = 5e-10 Identities = 109/133 (81%) Strand = Plus / Plus Query: 130 ttgccggtgttttctgtgctattgtttctcatccggctgacaaccttgtctcgttcctca 189 ||||||| || |||||||| || ||||||||||| || ||||| || || || ||||||| Sbjct: 959 ttgccggagtgttctgtgccatcgtttctcatccagcagacaatctagtgtcattcctca 1018 Query: 190 acaatgccaagggtgctacagtgggcgatgctgttaagaagattggcatgttgggccttt 249 |||| || ||||| || || || || ||||| || ||||||||||| ||| |||| || | Sbjct: 1019 acaacgctaagggagcaaccgttggagatgcggtgaagaagattggtatggtgggactgt 1078 Query: 250 tcaccagagggct 262 |||| |||||||| Sbjct: 1079 tcacaagagggct 1091
>dbj|AK222060.1| Arabidopsis thaliana mRNA for mitochondrial phosphate translocator, complete cds, clone: RAFL22-79-L24 Length = 819 Score = 73.8 bits (37), Expect = 5e-10 Identities = 109/133 (81%) Strand = Plus / Plus Query: 130 ttgccggtgttttctgtgctattgtttctcatccggctgacaaccttgtctcgttcctca 189 ||||||| || |||||||| || ||||||||||| || ||||| || || || ||||||| Sbjct: 197 ttgccggagtgttctgtgccatcgtttctcatccagcagacaatctagtgtcattcctca 256 Query: 190 acaatgccaagggtgctacagtgggcgatgctgttaagaagattggcatgttgggccttt 249 |||| || ||||| || || || || ||||| || ||||||||||| ||| |||| || | Sbjct: 257 acaacgctaagggagcaaccgttggagatgcggtgaagaagattggtatggtgggactgt 316 Query: 250 tcaccagagggct 262 |||| |||||||| Sbjct: 317 tcacaagagggct 329
>emb|BX830659.1|CNS0A0U3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS11ZC10 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1463 Score = 73.8 bits (37), Expect = 5e-10 Identities = 109/133 (81%) Strand = Plus / Plus Query: 130 ttgccggtgttttctgtgctattgtttctcatccggctgacaaccttgtctcgttcctca 189 ||||||| || |||||||| || ||||||||||| || ||||| || || || ||||||| Sbjct: 882 ttgccggagtgttctgtgccatcgtttctcatccagcagacaatctagtgtcattcctca 941 Query: 190 acaatgccaagggtgctacagtgggcgatgctgttaagaagattggcatgttgggccttt 249 |||| || ||||| || || || || ||||| || ||||||||||| ||| |||| || | Sbjct: 942 acaacgctaagggagcaaccgttggagatgcggtgaagaagattggtatggtgggactgt 1001 Query: 250 tcaccagagggct 262 |||| |||||||| Sbjct: 1002 tcacaagagggct 1014
>emb|BX831215.1|CNS0A0Q1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS69ZC10 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1513 Score = 73.8 bits (37), Expect = 5e-10 Identities = 109/133 (81%) Strand = Plus / Plus Query: 130 ttgccggtgttttctgtgctattgtttctcatccggctgacaaccttgtctcgttcctca 189 ||||||| || |||||||| || ||||||||||| || ||||| || || || ||||||| Sbjct: 941 ttgccggagtgttctgtgccatcgtttctcatccagcagacaatctagtgtcattcctca 1000 Query: 190 acaatgccaagggtgctacagtgggcgatgctgttaagaagattggcatgttgggccttt 249 |||| || ||||| || || || || ||||| || ||||||||||| ||| |||| || | Sbjct: 1001 acaacgctaagggagcaaccgttggagatgcggtgaagaagattggtatggtgggactgt 1060 Query: 250 tcaccagagggct 262 |||| |||||||| Sbjct: 1061 tcacaagagggct 1073
>emb|BX830971.1|CNS0A0SV Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS44ZA08 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1507 Score = 73.8 bits (37), Expect = 5e-10 Identities = 109/133 (81%) Strand = Plus / Plus Query: 130 ttgccggtgttttctgtgctattgtttctcatccggctgacaaccttgtctcgttcctca 189 ||||||| || |||||||| || ||||||||||| || ||||| || || || ||||||| Sbjct: 941 ttgccggagtgttctgtgccatcgtttctcatccagcagacaatctagtgtcattcctca 1000 Query: 190 acaatgccaagggtgctacagtgggcgatgctgttaagaagattggcatgttgggccttt 249 |||| || ||||| || || || || ||||| || ||||||||||| ||| |||| || | Sbjct: 1001 acaacgctaagggagcaaccgttggagatgcggtgaagaagattggtatggtgggactgt 1060 Query: 250 tcaccagagggct 262 |||| |||||||| Sbjct: 1061 tcacaagagggct 1073
>dbj|AB016066.1| Arabidopsis thaliana mRNA for mitochondrial phosphate transporter, partial cds Length = 1021 Score = 73.8 bits (37), Expect = 5e-10 Identities = 109/133 (81%) Strand = Plus / Plus Query: 130 ttgccggtgttttctgtgctattgtttctcatccggctgacaaccttgtctcgttcctca 189 ||||||| || |||||||| || ||||||||||| || ||||| || || || ||||||| Sbjct: 593 ttgccggagtgttctgtgccatcgtttctcatccagcagacaatctagtgtcattcctca 652 Query: 190 acaatgccaagggtgctacagtgggcgatgctgttaagaagattggcatgttgggccttt 249 |||| || ||||| || || || || ||||| || ||||||||||| ||| |||| || | Sbjct: 653 acaacgctaagggagcaaccgttggagatgcggtgaagaagattggtatggtgggactgt 712 Query: 250 tcaccagagggct 262 |||| |||||||| Sbjct: 713 tcacaagagggct 725
>emb|AJ844468.1| Medicago truncatula mpt gene for mitochondrial phosphate translocator and T-DNA integration region, transgenic line N21-1 Length = 4564 Score = 69.9 bits (35), Expect = 7e-09 Identities = 77/91 (84%) Strand = Plus / Plus Query: 109 tcagctttgctggtggctacattgccggtgttttctgtgctattgtttctcatccggctg 168 |||| ||||||||||| |||||||| ||||| | ||||| ||||| |||||||| |||| Sbjct: 2565 tcagttttgctggtggatacattgctggtgtactttgtgcaattgtgtctcatcctgctg 2624 Query: 169 acaaccttgtctcgttcctcaacaatgccaa 199 | ||||||||||| || || ||||| ||||| Sbjct: 2625 ataaccttgtctcttttctgaacaacgccaa 2655 Score = 61.9 bits (31), Expect = 2e-06 Identities = 70/83 (84%) Strand = Plus / Plus Query: 249 ttcaccagagggctcccccttcgtatcgtcatgattggtactcttactggtgctcagtgg 308 ||||||||||| ||||| || ||||| || |||||||| || ||||| || || |||||| Sbjct: 2800 ttcaccagaggtctccctctccgtattgttatgattggaacacttaccggagcccagtgg 2859 Query: 309 ggaatctatgatgcgtttaaagt 331 ||||| |||||||| || ||||| Sbjct: 2860 ggaatatatgatgctttcaaagt 2882
>gb|AC149131.3| Medicago truncatula chromosome 7 BAC clone mth2-19e15, complete sequence Length = 122492 Score = 69.9 bits (35), Expect = 7e-09 Identities = 77/91 (84%) Strand = Plus / Plus Query: 109 tcagctttgctggtggctacattgccggtgttttctgtgctattgtttctcatccggctg 168 |||| ||||||||||| |||||||| ||||| | ||||| ||||| |||||||| |||| Sbjct: 72067 tcagttttgctggtggatacattgctggtgtactttgtgcaattgtgtctcatcctgctg 72126 Query: 169 acaaccttgtctcgttcctcaacaatgccaa 199 | ||||||||||| || || ||||| ||||| Sbjct: 72127 ataaccttgtctcttttctgaacaacgccaa 72157 Score = 54.0 bits (27), Expect = 4e-04 Identities = 69/83 (83%) Strand = Plus / Plus Query: 249 ttcaccagagggctcccccttcgtatcgtcatgattggtactcttactggtgctcagtgg 308 ||||||||||| ||||| || || || || |||||||| || ||||| || || |||||| Sbjct: 72306 ttcaccagaggtctccctctccggattgttatgattggaacacttaccggagcccagtgg 72365 Query: 309 ggaatctatgatgcgtttaaagt 331 ||||| |||||||| || ||||| Sbjct: 72366 ggaatatatgatgctttcaaagt 72388
>dbj|AB016063.1| Glycine max mRNA for mitochondrial phosphate transporter, complete cds Length = 1640 Score = 69.9 bits (35), Expect = 7e-09 Identities = 176/223 (78%) Strand = Plus / Plus Query: 109 tcagctttgctggtggctacattgccggtgttttctgtgctattgtttctcatccggctg 168 |||| ||||||||||| || |||| ||||| | ||||| ||||| |||||||| |||| Sbjct: 981 tcagttttgctggtggatatgttgctggtgtactttgtgcaattgtgtctcatcctgctg 1040 Query: 169 acaaccttgtctcgttcctcaacaatgccaagggtgctacagtgggcgatgctgttaaga 228 | || |||||||| || || |||||||| || || || ||||| || ||||| || || | Sbjct: 1041 ataatcttgtctcttttctgaacaatgcaaaaggagcaacagttggtgatgcggtgaaaa 1100 Query: 229 agattggcatgttgggccttttcaccagagggctcccccttcgtatcgtcatgattggta 288 || |||| ||| ||| || || || | || |||||||| || || || |||||||| | Sbjct: 1101 agcttggtttgtggggtctctttacgcgtggtctccccctccgaattgttatgattggaa 1160 Query: 289 ctcttactggtgctcagtggggaatctatgatgcgtttaaagt 331 |||||||||| || || |||||||| |||||||| || ||||| Sbjct: 1161 ctcttactggagcccaatggggaatatatgatgcattcaaagt 1203
>emb|BX071401.1|CNS09R99 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8DF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 904 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 123 ggctacattgccggtgttttctgtgctattgtttctcatccggc 166 ||||||||||||||||| ||||| ||||| ||||| |||||||| Sbjct: 802 ggctacattgccggtgtgttctgcgctatcgtttcccatccggc 759
>emb|BX071400.1|CNS09R98 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8DF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 852 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Plus Query: 123 ggctacattgccggtgttttctgtgctattgtttctcatccggc 166 ||||||||||||||||| ||||| ||||| ||||| |||||||| Sbjct: 280 ggctacattgccggtgtgttctgcgctatcgtttcccatccggc 323
>emb|BX063739.1|CNS09LCF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC45DA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 981 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 123 ggctacattgccggtgttttctgtgctattgtttctcatccggc 166 ||||||||||||||||| ||||| ||||| ||||| |||||||| Sbjct: 822 ggctacattgccggtgtgttctgcgctatcgtttcccatccggc 779
>emb|BX063738.1|CNS09LCE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45DA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 644 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Plus Query: 123 ggctacattgccggtgttttctgtgctattgtttctcatccggc 166 ||||||||||||||||| ||||| ||||| ||||| |||||||| Sbjct: 280 ggctacattgccggtgtgttctgcgctatcgtttcccatccggc 323
>emb|BX055792.1|CNS09F7O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC34CC03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 923 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 123 ggctacattgccggtgttttctgtgctattgtttctcatccggc 166 ||||||||||||||||| ||||| ||||| ||||| |||||||| Sbjct: 842 ggctacattgccggtgtgttctgcgctatcgtttcccatccggc 799
>emb|BX055791.1|CNS09F7N Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC34CC03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 896 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Plus Query: 123 ggctacattgccggtgttttctgtgctattgtttctcatccggc 166 ||||||||||||||||| ||||| ||||| ||||| |||||||| Sbjct: 837 ggctacattgccggtgtgttctgcgctatcgtttcccatccggc 880
>emb|BX040566.1|CNS093GQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC11BH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 972 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 123 ggctacattgccggtgttttctgtgctattgtttctcatccggc 166 ||||||||||||||||| ||||| ||||| ||||| |||||||| Sbjct: 795 ggctacattgccggtgtgttctgcgctatcgtttcccatccggc 752
>emb|BX040565.1|CNS093GP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC11BH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 948 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Plus Query: 123 ggctacattgccggtgttttctgtgctattgtttctcatccggc 166 ||||||||||||||||| ||||| ||||| ||||| |||||||| Sbjct: 280 ggctacattgccggtgtgttctgcgctatcgtttcccatccggc 323
>emb|BX036645.1|CNS090FT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA8DA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 875 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 123 ggctacattgccggtgttttctgtgctattgtttctcatccggc 166 |||||||||||||||||||| |||| ||| ||||| |||||||| Sbjct: 833 ggctacattgccggtgttttttgtgttatcgtttcccatccggc 790
>emb|BX036644.1|CNS090FS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA8DA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 770 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Plus Query: 123 ggctacattgccggtgttttctgtgctattgtttctcatccggc 166 ||||||||||||||||| ||||| ||||| ||||| |||||||| Sbjct: 578 ggctacattgccggtgtgttctgcgctatcgtttcccatccggc 621
>emb|AJ719594.1| Gallus gallus mRNA for hypothetical protein, clone 4e21 Length = 1258 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Plus Query: 123 ggctacattgccggtgttttctgtgctattgtttctcatccggctgac 170 ||||| ||||| ||||| |||||||| |||||||||||||| |||||| Sbjct: 788 ggctatattgctggtgtcttctgtgcaattgtttctcatcctgctgac 835
>ref|NM_001006236.1| Gallus gallus solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 3 (SLC25A3), mRNA Length = 1258 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Plus Query: 123 ggctacattgccggtgttttctgtgctattgtttctcatccggctgac 170 ||||| ||||| ||||| |||||||| |||||||||||||| |||||| Sbjct: 788 ggctatattgctggtgtcttctgtgcaattgtttctcatcctgctgac 835
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 56.0 bits (28), Expect = 1e-04 Identities = 79/96 (82%) Strand = Plus / Plus Query: 242 gggccttttcaccagagggctcccccttcgtatcgtcatgattggtactcttactggtgc 301 ||||||||||||| | || || || ||||| ||| ||||||| ||||| || ||||| | Sbjct: 17028428 gggccttttcacccgcggccttcctcttcgcatcctcatgatcggtacactgactggaac 17028487 Query: 302 tcagtggggaatctatgatgcgtttaaagttatggt 337 |||||||| ||||||||| | || ||||||||||| Sbjct: 17028488 tcagtgggtgatctatgattctttcaaagttatggt 17028523
>dbj|AP005655.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0025H07 Length = 145605 Score = 56.0 bits (28), Expect = 1e-04 Identities = 79/96 (82%) Strand = Plus / Plus Query: 242 gggccttttcaccagagggctcccccttcgtatcgtcatgattggtactcttactggtgc 301 ||||||||||||| | || || || ||||| ||| ||||||| ||||| || ||||| | Sbjct: 22087 gggccttttcacccgcggccttcctcttcgcatcctcatgatcggtacactgactggaac 22146 Query: 302 tcagtggggaatctatgatgcgtttaaagttatggt 337 |||||||| ||||||||| | || ||||||||||| Sbjct: 22147 tcagtgggtgatctatgattctttcaaagttatggt 22182
>ref|XM_313341.2| Anopheles gambiae str. PEST ENSANGP00000011905 (ENSANGG00000009354), partial mRNA Length = 936 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Plus Query: 123 ggctacattgccggtgttttctgtgctattgtttctcatccggc 166 ||||||||||||||||| ||||| ||||| ||||| |||||||| Sbjct: 679 ggctacattgccggtgtgttctgcgctatcgtttcccatccggc 722
>ref|XM_562439.1| Anopheles gambiae str. PEST ENSANGP00000029434 (ENSANGG00000009354), partial mRNA Length = 1107 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Plus Query: 123 ggctacattgccggtgttttctgtgctattgtttctcatccggc 166 ||||||||||||||||| ||||| ||||| ||||| |||||||| Sbjct: 835 ggctacattgccggtgtgttctgcgctatcgtttcccatccggc 878
>ref|XM_313339.2| Anopheles gambiae str. PEST ENSANGP00000011843 (ENSANGG00000009354), mRNA Length = 1687 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Plus Query: 123 ggctacattgccggtgttttctgtgctattgtttctcatccggc 166 ||||||||||||||||| ||||| ||||| ||||| |||||||| Sbjct: 873 ggctacattgccggtgtgttctgcgctatcgtttcccatccggc 916
>dbj|AP006392.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT39E03, TM0266, complete sequence Length = 113459 Score = 52.0 bits (26), Expect = 0.002 Identities = 83/102 (81%) Strand = Plus / Minus Query: 219 gctgttaagaagattggcatgttgggccttttcaccagagggctcccccttcgtatcgtc 278 ||||| ||||||||||| || |||| |||||||| | || || || |||||||| || Sbjct: 76595 gctgtgaagaagattggggtggtgggtcttttcactcgcggccttccgcttcgtattgtt 76536 Query: 279 atgattggtactcttactggtgctcagtggggaatctatgat 320 |||||||| || || ||||| |||||||||||| | |||||| Sbjct: 76535 atgattggaacactaactggagctcagtggggactatatgat 76494 Score = 46.1 bits (23), Expect = 0.11 Identities = 74/91 (81%) Strand = Plus / Minus Query: 129 attgccggtgttttctgtgctattgtttctcatccggctgacaaccttgtctcgttcctc 188 ||||| ||||| ||||||| ||||| || || || ||||||||||| || || || || Sbjct: 76809 attgcaggtgtactctgtgcaattgtctcgcacccagctgacaacctcgtttcttttctt 76750 Query: 189 aacaatgccaagggtgctacagtgggcgatg 219 |||||||||||||| || || || ||||||| Sbjct: 76749 aacaatgccaagggagccactgttggcgatg 76719 Score = 40.1 bits (20), Expect = 6.6 Identities = 48/56 (85%), Gaps = 1/56 (1%) Strand = Plus / Minus Query: 3 ataccatgnatgaagtttgcgtccttcgaaactattgttgagcttatctacaaaca 58 |||||||| ||||| ||||| ||||| || |||||||| ||| | ||||||||||| Sbjct: 76934 ataccatg-atgaaatttgcttcctttgagactattgtggagatgatctacaaaca 76880
>dbj|AP006098.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT10G08, TM0175, complete sequence Length = 108582 Score = 52.0 bits (26), Expect = 0.002 Identities = 83/102 (81%) Strand = Plus / Minus Query: 219 gctgttaagaagattggcatgttgggccttttcaccagagggctcccccttcgtatcgtc 278 ||||| ||||||||||| || |||| |||||||| | || || || |||||||| || Sbjct: 27586 gctgtgaagaagattggggtggtgggtcttttcactcgcggccttccgcttcgtattgtt 27527 Query: 279 atgattggtactcttactggtgctcagtggggaatctatgat 320 |||||||| || || ||||| |||||||||||| | |||||| Sbjct: 27526 atgattggaacactaactggagctcagtggggactatatgat 27485 Score = 46.1 bits (23), Expect = 0.11 Identities = 74/91 (81%) Strand = Plus / Minus Query: 129 attgccggtgttttctgtgctattgtttctcatccggctgacaaccttgtctcgttcctc 188 ||||| ||||| ||||||| ||||| || || || ||||||||||| || || || || Sbjct: 27800 attgcaggtgtactctgtgcaattgtctcgcacccagctgacaacctcgtttcttttctt 27741 Query: 189 aacaatgccaagggtgctacagtgggcgatg 219 |||||||||||||| || || || ||||||| Sbjct: 27740 aacaatgccaagggagccactgttggcgatg 27710 Score = 40.1 bits (20), Expect = 6.6 Identities = 48/56 (85%), Gaps = 1/56 (1%) Strand = Plus / Minus Query: 3 ataccatgnatgaagtttgcgtccttcgaaactattgttgagcttatctacaaaca 58 |||||||| ||||| ||||| ||||| || |||||||| ||| | ||||||||||| Sbjct: 27925 ataccatg-atgaaatttgcttcctttgagactattgtggagatgatctacaaaca 27871
>ref|NM_187525.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1137 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Plus Query: 283 ttggtactcttactggtgctcagtggggaatctatgatgcgtttaaagt 331 |||||||||||||||| ||||| |||| || |||||||| |||||||| Sbjct: 1001 ttggtactcttactggagctcaatgggcaacatatgatgcatttaaagt 1049 Score = 46.1 bits (23), Expect = 0.11 Identities = 41/47 (87%) Strand = Plus / Plus Query: 156 tctcatccggctgacaaccttgtctcgttcctcaacaatgccaaggg 202 |||||||| || |||||||| || || |||||||||||||| ||||| Sbjct: 874 tctcatcctgcagacaacctggtgtctttcctcaacaatgcaaaggg 920
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Plus Query: 283 ttggtactcttactggtgctcagtggggaatctatgatgcgtttaaagt 331 |||||||||||||||| ||||| |||| || |||||||| |||||||| Sbjct: 8631697 ttggtactcttactggagctcaatgggcaacatatgatgcatttaaagt 8631745 Score = 46.1 bits (23), Expect = 0.11 Identities = 41/47 (87%) Strand = Plus / Plus Query: 156 tctcatccggctgacaaccttgtctcgttcctcaacaatgccaaggg 202 |||||||| || |||||||| || || |||||||||||||| ||||| Sbjct: 8631453 tctcatcctgcagacaacctggtgtctttcctcaacaatgcaaaggg 8631499
>emb|AL136536.1|SPBC1703 S.pombe chromosome II cosmid c1703 Length = 32799 Score = 50.1 bits (25), Expect = 0.007 Identities = 34/37 (91%) Strand = Plus / Minus Query: 268 ttcgtatcgtcatgattggtactcttactggtgctca 304 ||||||| ||||||||||||||| | ||||||||||| Sbjct: 25251 ttcgtatagtcatgattggtactttgactggtgctca 25215
>ref|NM_001022127.1| Schizosaccharomyces pombe 972h- hypothetical protein (SPBC1703.13c), partial mRNA Length = 936 Score = 50.1 bits (25), Expect = 0.007 Identities = 34/37 (91%) Strand = Plus / Plus Query: 268 ttcgtatcgtcatgattggtactcttactggtgctca 304 ||||||| ||||||||||||||| | ||||||||||| Sbjct: 842 ttcgtatagtcatgattggtactttgactggtgctca 878
>gb|AC135206.3| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1041F02, complete sequence Length = 137327 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Plus Query: 283 ttggtactcttactggtgctcagtggggaatctatgatgcgtttaaagt 331 |||||||||||||||| ||||| |||| || |||||||| |||||||| Sbjct: 112669 ttggtactcttactggagctcaatgggcaacatatgatgcatttaaagt 112717 Score = 46.1 bits (23), Expect = 0.11 Identities = 41/47 (87%) Strand = Plus / Plus Query: 156 tctcatccggctgacaaccttgtctcgttcctcaacaatgccaaggg 202 |||||||| || |||||||| || || |||||||||||||| ||||| Sbjct: 112425 tctcatcctgcagacaacctggtgtctttcctcaacaatgcaaaggg 112471
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Plus Query: 283 ttggtactcttactggtgctcagtggggaatctatgatgcgtttaaagt 331 |||||||||||||||| ||||| |||| || |||||||| |||||||| Sbjct: 8629532 ttggtactcttactggagctcaatgggcaacatatgatgcatttaaagt 8629580 Score = 46.1 bits (23), Expect = 0.11 Identities = 41/47 (87%) Strand = Plus / Plus Query: 156 tctcatccggctgacaaccttgtctcgttcctcaacaatgccaaggg 202 |||||||| || |||||||| || || |||||||||||||| ||||| Sbjct: 8629288 tctcatcctgcagacaacctggtgtctttcctcaacaatgcaaaggg 8629334
>dbj|AB007650.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUA22 Length = 65465 Score = 50.1 bits (25), Expect = 0.007 Identities = 61/73 (83%) Strand = Plus / Minus Query: 130 ttgccggtgttttctgtgctattgtttctcatccggctgacaaccttgtctcgttcctca 189 ||||||| || |||||||| || ||||||||||| || ||||| || || || ||||||| Sbjct: 7406 ttgccggagtgttctgtgccatcgtttctcatccagcagacaatctagtgtcattcctca 7347 Query: 190 acaatgccaaggg 202 |||| || ||||| Sbjct: 7346 acaacgctaaggg 7334
>dbj|AK058971.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-020-D01, full insert sequence Length = 1849 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Plus Query: 283 ttggtactcttactggtgctcagtggggaatctatgatgcgtttaaagt 331 |||||||||||||||| ||||| |||| || |||||||| |||||||| Sbjct: 1344 ttggtactcttactggagctcaatgggcaacatatgatgcatttaaagt 1392 Score = 46.1 bits (23), Expect = 0.11 Identities = 41/47 (87%) Strand = Plus / Plus Query: 156 tctcatccggctgacaaccttgtctcgttcctcaacaatgccaaggg 202 |||||||| || |||||||| || || |||||||||||||| ||||| Sbjct: 1217 tctcatcctgcagacaacctggtgtctttcctcaacaatgcaaaggg 1263
>gb|BC046849.1| Xenopus laevis solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 3, mRNA (cDNA clone MGC:53098 IMAGE:5542314), complete cds Length = 2549 Score = 48.1 bits (24), Expect = 0.027 Identities = 39/44 (88%) Strand = Plus / Plus Query: 126 tacattgccggtgttttctgtgctattgtttctcatccggctga 169 |||||||| ||||| |||||||||||||| || ||||| ||||| Sbjct: 866 tacattgctggtgtcttctgtgctattgtctcacatcctgctga 909
>dbj|AK173681.1| Ciona intestinalis cDNA, clone:cixxx00047, full insert sequence Length = 1359 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Plus Query: 122 tggctacattgccggtgttttctgtgctattgtttc 157 |||||||||||| ||||||||||| || |||||||| Sbjct: 829 tggctacattgctggtgttttctgcgccattgtttc 864
>dbj|AK117004.1| Ciona intestinalis cDNA, clone:cits014l20, full insert sequence Length = 1375 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Plus Query: 122 tggctacattgccggtgttttctgtgctattgtttc 157 |||||||||||| ||||||||||| || |||||||| Sbjct: 837 tggctacattgctggtgttttctgcgccattgtttc 872
>dbj|AK114654.1| Ciona intestinalis cDNA, clone:cieg009n14, full insert sequence Length = 1371 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Plus Query: 122 tggctacattgccggtgttttctgtgctattgtttc 157 |||||||||||| ||||||||||| || |||||||| Sbjct: 839 tggctacattgctggtgttttctgcgccattgtttc 874
>ref|XM_505403.1| Yarrowia lipolytica CLIB122, YALI0F14223g predicted mRNA Length = 1110 Score = 46.1 bits (23), Expect = 0.11 Identities = 32/35 (91%) Strand = Plus / Plus Query: 120 ggtggctacattgccggtgttttctgtgctattgt 154 ||||| |||||||| ||||| |||||||||||||| Sbjct: 835 ggtggttacattgctggtgtcttctgtgctattgt 869
>emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB122 of Yarrowia lipolytica Length = 4003362 Score = 46.1 bits (23), Expect = 0.11 Identities = 32/35 (91%) Strand = Plus / Plus Query: 120 ggtggctacattgccggtgttttctgtgctattgt 154 ||||| |||||||| ||||| |||||||||||||| Sbjct: 1914832 ggtggttacattgctggtgtcttctgtgctattgt 1914866
>emb|Z81586.2|CET05F1 Caenorhabditis elegans Cosmid T05F1, complete sequence Length = 36760 Score = 44.1 bits (22), Expect = 0.42 Identities = 34/38 (89%) Strand = Plus / Plus Query: 126 tacattgccggtgttttctgtgctattgtttctcatcc 163 |||||||| ||||||||||||||| | || |||||||| Sbjct: 23132 tacattgctggtgttttctgtgctgtcgtgtctcatcc 23169
>emb|BX066454.1|CNS09NFU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC5DB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 959 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 123 ggctacattgccggtgttttctgtgc 148 ||||||||||||||||| |||||||| Sbjct: 785 ggctacattgccggtgtgttctgtgc 760
>emb|BX063803.1|CNS09LE7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC45DD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1052 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 123 ggctacattgccggtgttttctgtgc 148 ||||||||||||||||| |||||||| Sbjct: 796 ggctacattgccggtgtgttctgtgc 771
>emb|BX063802.1|CNS09LE6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45DD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1006 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Plus Query: 123 ggctacattgccggtgttttctgtgc 148 ||||||||||||||||| |||||||| Sbjct: 613 ggctacattgccggtgtgttctgtgc 638
>emb|BX060354.1|CNS09IQE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40CG06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 832 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 123 ggctacattgccggtgttttctgtgc 148 ||||||||||||||||| |||||||| Sbjct: 742 ggctacattgccggtgtgttctgtgc 717
>emb|BX060353.1|CNS09IQD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40CG06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 986 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Plus Query: 123 ggctacattgccggtgttttctgtgc 148 ||||||||||||||||| |||||||| Sbjct: 837 ggctacattgccggtgtgttctgtgc 862
>emb|BX057546.1|CNS09GKE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37CC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 624 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Plus Query: 123 ggctacattgccggtgttttctgtgc 148 ||||||||||||||||| |||||||| Sbjct: 524 ggctacattgccggtgtgttctgtgc 549
>emb|BX055395.1|CNS09EWN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC34AA06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 963 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 123 ggctacattgccggtgttttctgtgc 148 ||||||||||||||||| |||||||| Sbjct: 788 ggctacattgccggtgtgttctgtgc 763
>emb|BX055394.1|CNS09EWM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC34AA06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 975 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Plus Query: 123 ggctacattgccggtgttttctgtgc 148 ||||||||||||||||| |||||||| Sbjct: 844 ggctacattgccggtgtgttctgtgc 869
>emb|BX054397.1|CNS09E4X Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC32CB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 889 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 123 ggctacattgccggtgttttctgtgc 148 ||||||||||||||||| |||||||| Sbjct: 788 ggctacattgccggtgtgttctgtgc 763
>emb|BX047293.1|CNS098NL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC21BF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 238 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Plus Query: 123 ggctacattgccggtgttttctgtgc 148 ||||||||||||||||| |||||||| Sbjct: 196 ggctacattgccggtgtgttctgtgc 221
>emb|BX044517.1|CNS096IH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC18BA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 914 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 123 ggctacattgccggtgttttctgtgc 148 ||||||||||||||||| |||||||| Sbjct: 743 ggctacattgccggtgtgttctgtgc 718
>emb|BX044516.1|CNS096IG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC18BA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 962 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Plus Query: 123 ggctacattgccggtgttttctgtgc 148 ||||||||||||||||| |||||||| Sbjct: 810 ggctacattgccggtgtgttctgtgc 835
>emb|BX035414.1|CNS08ZHM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA6DA03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 710 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Plus Query: 123 ggctacattgccggtgttttctgtgc 148 ||||||||||||||||| |||||||| Sbjct: 682 ggctacattgccggtgtgttctgtgc 707
>emb|BX028055.1|CNS08TT7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA41DH07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 479 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 123 ggctacattgccggtgttttctgtgc 148 ||||||||||||||||| |||||||| Sbjct: 360 ggctacattgccggtgtgttctgtgc 335
>emb|BX027492.1|CNS08TDK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA41AF07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 977 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Plus Query: 123 ggctacattgccggtgttttctgtgc 148 ||||||||||||||||| |||||||| Sbjct: 282 ggctacattgccggtgtgttctgtgc 307
>emb|BX025401.1|CNS08RRH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA38DH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 933 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 123 ggctacattgccggtgttttctgtgc 148 ||||||||||||||||| |||||||| Sbjct: 799 ggctacattgccggtgtgttctgtgc 774
>emb|BX025397.1|CNS08RRD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA38DH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 977 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 123 ggctacattgccggtgttttctgtgc 148 ||||||||||||||||| |||||||| Sbjct: 790 ggctacattgccggtgtgttctgtgc 765
>emb|BX025396.1|CNS08RRC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA38DH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 975 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Plus Query: 123 ggctacattgccggtgttttctgtgc 148 ||||||||||||||||| |||||||| Sbjct: 837 ggctacattgccggtgtgttctgtgc 862
>emb|BX023672.1|CNS08QFG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA36AF07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1027 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 123 ggctacattgccggtgttttctgtgc 148 ||||||||||||||||| |||||||| Sbjct: 791 ggctacattgccggtgtgttctgtgc 766
>emb|BX023671.1|CNS08QFF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA36AF07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1003 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Plus Query: 123 ggctacattgccggtgttttctgtgc 148 ||||||||||||||||| |||||||| Sbjct: 838 ggctacattgccggtgtgttctgtgc 863
>emb|BX020121.1|CNS08NOT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA3CE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 968 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 123 ggctacattgccggtgttttctgtgc 148 ||||||||||||||||| |||||||| Sbjct: 799 ggctacattgccggtgtgttctgtgc 774
>emb|BX020120.1|CNS08NOS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA3CE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 973 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Plus Query: 123 ggctacattgccggtgttttctgtgc 148 ||||||||||||||||| |||||||| Sbjct: 863 ggctacattgccggtgtgttctgtgc 888
>emb|BX020103.1|CNS08NOB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA3CE03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 998 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 123 ggctacattgccggtgttttctgtgc 148 ||||||||||||||||| |||||||| Sbjct: 772 ggctacattgccggtgtgttctgtgc 747
>emb|BX020102.1|CNS08NOA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA3CE03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 996 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Plus Query: 123 ggctacattgccggtgttttctgtgc 148 ||||||||||||||||| |||||||| Sbjct: 280 ggctacattgccggtgtgttctgtgc 305
>emb|BX019188.1|CNS08MYW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA29AG10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1043 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 123 ggctacattgccggtgttttctgtgc 148 ||||||||||||||||| |||||||| Sbjct: 767 ggctacattgccggtgtgttctgtgc 742
>emb|BX019187.1|CNS08MYV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA29AG10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 357 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Plus Query: 123 ggctacattgccggtgttttctgtgc 148 ||||||||||||||||| |||||||| Sbjct: 280 ggctacattgccggtgtgttctgtgc 305
>emb|BX017487.1|CNS08LNN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA26BG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 971 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 123 ggctacattgccggtgttttctgtgc 148 ||||||||||||||||| |||||||| Sbjct: 759 ggctacattgccggtgtgttctgtgc 734
>emb|BX017486.1|CNS08LNM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA26BG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1012 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Plus Query: 123 ggctacattgccggtgttttctgtgc 148 ||||||||||||||||| |||||||| Sbjct: 836 ggctacattgccggtgtgttctgtgc 861
>emb|BX015698.1|CNS08K9Y Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA23CC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 946 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 123 ggctacattgccggtgttttctgtgc 148 ||||||||||||||||| |||||||| Sbjct: 365 ggctacattgccggtgtgttctgtgc 340
>emb|BX015697.1|CNS08K9X Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA23CC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1006 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Plus Query: 123 ggctacattgccggtgttttctgtgc 148 ||||||||||||||||| |||||||| Sbjct: 626 ggctacattgccggtgtgttctgtgc 651
>emb|BX015629.1|CNS08K81 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA23BH08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 953 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 123 ggctacattgccggtgttttctgtgc 148 ||||||||||||||||| |||||||| Sbjct: 797 ggctacattgccggtgtgttctgtgc 772
>emb|BX015628.1|CNS08K80 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA23BH08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1036 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Plus Query: 123 ggctacattgccggtgttttctgtgc 148 ||||||||||||||||| |||||||| Sbjct: 829 ggctacattgccggtgtgttctgtgc 854
>emb|BX014351.1|CNS08J8J Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA21CC11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 890 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Plus Query: 123 ggctacattgccggtgttttctgtgc 148 ||||||||||||||||| |||||||| Sbjct: 632 ggctacattgccggtgtgttctgtgc 657
>emb|BX013224.1|CNS08ID8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA2DF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1041 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 123 ggctacattgccggtgttttctgtgc 148 ||||||||||||||||| |||||||| Sbjct: 801 ggctacattgccggtgtgttctgtgc 776
>emb|BX013223.1|CNS08ID7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA2DF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1044 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Plus Query: 123 ggctacattgccggtgttttctgtgc 148 ||||||||||||||||| |||||||| Sbjct: 856 ggctacattgccggtgtgttctgtgc 881
>emb|BX011936.1|CNS08HDG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA19AB06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 126 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Plus Query: 123 ggctacattgccggtgttttctgtgc 148 ||||||||||||||||| |||||||| Sbjct: 9 ggctacattgccggtgtgttctgtgc 34
>emb|BX011827.1|CNS08HAF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA18DE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 967 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 123 ggctacattgccggtgttttctgtgc 148 ||||||||||||||||| |||||||| Sbjct: 801 ggctacattgccggtgtgttctgtgc 776
>emb|BX010818.1|CNS08GIE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA17BD06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 912 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Plus Query: 123 ggctacattgccggtgttttctgtgc 148 ||||||||||||||||| |||||||| Sbjct: 281 ggctacattgccggtgtgttctgtgc 306
>emb|BX008451.1|CNS08EON Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA13DF02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 845 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Plus Query: 123 ggctacattgccggtgttttctgtgc 148 ||||||||||||||||| |||||||| Sbjct: 529 ggctacattgccggtgtgttctgtgc 554
>ref|NM_060160.3| Caenorhabditis elegans T05F1.8 (T05F1.8) mRNA, complete cds Length = 1287 Score = 44.1 bits (22), Expect = 0.42 Identities = 34/38 (89%) Strand = Plus / Plus Query: 126 tacattgccggtgttttctgtgctattgtttctcatcc 163 |||||||| ||||||||||||||| | || |||||||| Sbjct: 839 tacattgctggtgttttctgtgctgtcgtgtctcatcc 876
>ref|XM_532660.2| PREDICTED: Canis familiaris phosphate carrier, transcript variant 1 (SLC25A3), mRNA Length = 1352 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Plus Query: 141 ttctgtgctattgtttctcatccggctga 169 |||||||| |||||||||||||| ||||| Sbjct: 905 ttctgtgcaattgtttctcatcctgctga 933
>ref|XM_861320.1| PREDICTED: Canis familiaris phosphate carrier, transcript variant 6 (SLC25A3), mRNA Length = 1428 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Plus Query: 141 ttctgtgctattgtttctcatccggctga 169 |||||||| |||||||||||||| ||||| Sbjct: 981 ttctgtgcaattgtttctcatcctgctga 1009
>ref|XM_861309.1| PREDICTED: Canis familiaris phosphate carrier, transcript variant 5 (SLC25A3), mRNA Length = 1367 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Plus Query: 141 ttctgtgctattgtttctcatccggctga 169 |||||||| |||||||||||||| ||||| Sbjct: 920 ttctgtgcaattgtttctcatcctgctga 948
>ref|XM_861300.1| PREDICTED: Canis familiaris phosphate carrier, transcript variant 4 (SLC25A3), mRNA Length = 1418 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Plus Query: 141 ttctgtgctattgtttctcatccggctga 169 |||||||| |||||||||||||| ||||| Sbjct: 971 ttctgtgcaattgtttctcatcctgctga 999
>ref|XM_861287.1| PREDICTED: Canis familiaris phosphate carrier, transcript variant 3 (SLC25A3), mRNA Length = 1011 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Plus Query: 141 ttctgtgctattgtttctcatccggctga 169 |||||||| |||||||||||||| ||||| Sbjct: 564 ttctgtgcaattgtttctcatcctgctga 592
>ref|XM_861273.1| PREDICTED: Canis familiaris phosphate carrier, transcript variant 2 (SLC25A3), mRNA Length = 718 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Plus Query: 141 ttctgtgctattgtttctcatccggctga 169 |||||||| |||||||||||||| ||||| Sbjct: 271 ttctgtgcaattgtttctcatcctgctga 299
>emb|AL592144.5| Human DNA sequence from clone RP11-476B1 on chromosome 1 Contains a novel gene, complete sequence Length = 197322 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 394 gattgatttttgctgctatga 414 ||||||||||||||||||||| Sbjct: 120447 gattgatttttgctgctatga 120427
>emb|AL139097.16| Human DNA sequence from clone RP1-125E8 on chromosome 6, complete sequence Length = 112533 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 388 cagcttgattgatttttgctg 408 ||||||||||||||||||||| Sbjct: 95774 cagcttgattgatttttgctg 95794
>gb|AC092290.3| Homo sapiens chromosome 5 clone CTD-2376K3, complete sequence Length = 80527 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 420 tattcctggttgtggttattg 440 ||||||||||||||||||||| Sbjct: 20058 tattcctggttgtggttattg 20038
>gb|AC008610.7| Homo sapiens chromosome 5 clone CTB-129O4, complete sequence Length = 145242 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 420 tattcctggttgtggttattg 440 ||||||||||||||||||||| Sbjct: 19780 tattcctggttgtggttattg 19800
>gb|AC160337.2| Mus musculus BAC clone RP23-193N1 from chromosome 9, complete sequence Length = 204712 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 244 gccttttcaccagagggctcc 264 ||||||||||||||||||||| Sbjct: 146869 gccttttcaccagagggctcc 146849
>gb|DQ066599.1| Homo sapiens mitogen-activated protein kinase 9 (MAPK9) gene, complete cds Length = 48787 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 420 tattcctggttgtggttattg 440 ||||||||||||||||||||| Sbjct: 11297 tattcctggttgtggttattg 11277
>ref|XM_396960.2| PREDICTED: Apis mellifera similar to CG9090-PA (LOC413517), mRNA Length = 1560 Score = 42.1 bits (21), Expect = 1.7 Identities = 36/41 (87%) Strand = Plus / Plus Query: 129 attgccggtgttttctgtgctattgtttctcatccggctga 169 ||||||||||| || ||||| ||||| |||||||| ||||| Sbjct: 948 attgccggtgtattttgtgcaattgtatctcatcctgctga 988
>emb|BX830907.1|CNS0A0R0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS38ZH11 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1490 Score = 42.1 bits (21), Expect = 1.7 Identities = 105/133 (78%) Strand = Plus / Plus Query: 130 ttgccggtgttttctgtgctattgtttctcatccggctgacaaccttgtctcgttcctca 189 ||||||| || |||||||| || ||||||||||| | || || || || || ||||||| Sbjct: 939 ttgccggagtgttctgtgccatcgtttctcatccagaagaaaatctagtgtcattcctca 998 Query: 190 acaatgccaagggtgctacagtgggcgatgctgttaagaagattggcatgttgggccttt 249 |||| || | ||| || || || || ||||| || ||||||||||| ||| |||| || | Sbjct: 999 acaacgctacgggagcaaccgttggagatgcggtgaagaagattggtatggtgggactgt 1058 Query: 250 tcaccagagggct 262 | || |||||||| Sbjct: 1059 taacaagagggct 1071
>gb|AE017352.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 12, complete sequence Length = 906719 Score = 40.1 bits (20), Expect = 6.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 45 cttatctacaaacacgctgttcct 68 ||||| |||||||||||||||||| Sbjct: 435980 cttatttacaaacacgctgttcct 435957
>ref|XM_652740.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN0228.2), mRNA Length = 2748 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 346 cgaccaccggcggtgctcca 365 |||||||||||||||||||| Sbjct: 238 cgaccaccggcggtgctcca 219
>ref|XM_568050.1| Cryptococcus neoformans var. neoformans JEC21 hypothetical protein (CNL05110) partial mRNA Length = 779 Score = 40.1 bits (20), Expect = 6.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 45 cttatctacaaacacgctgttcct 68 ||||| |||||||||||||||||| Sbjct: 315 cttatttacaaacacgctgttcct 338
>gb|AE014305.1| Homo sapiens chromosome 13q34 schizophrenia region contig 1 section 2 of 11 of the complete sequence Length = 613322 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 385 aatcagcttgattgattttt 404 |||||||||||||||||||| Sbjct: 52192 aatcagcttgattgattttt 52211
>gb|AF101312.2| Caenorhabditis elegans cosmid F56E10, complete sequence Length = 41184 Score = 40.1 bits (20), Expect = 6.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 50 ctacaaacacgctgttcctgttcc 73 |||||||||||||| ||||||||| Sbjct: 28798 ctacaaacacgctggtcctgttcc 28821
>gb|AC120124.9| Mus musculus chromosome 7, clone RP23-21A23, complete sequence Length = 237001 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 170 caaccttgtctcgttcctca 189 |||||||||||||||||||| Sbjct: 85590 caaccttgtctcgttcctca 85609
>emb|BX901957.4| Zebrafish DNA sequence from clone CH211-150G5 in linkage group 15, complete sequence Length = 175019 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 379 tagaggaatcagcttgattg 398 |||||||||||||||||||| Sbjct: 137183 tagaggaatcagcttgattg 137202
>emb|AL662896.9| Human DNA sequence from clone RP13-218H24 on chromosome X Contains the gene for a novel protein, complete sequence Length = 86097 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 ttgtttagcacccaaaatct 483 |||||||||||||||||||| Sbjct: 22634 ttgtttagcacccaaaatct 22615
>emb|AL512655.17| Human DNA sequence from clone RP11-536C2 on chromosome 13, complete sequence Length = 146002 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 389 agcttgattgatttttgctg 408 |||||||||||||||||||| Sbjct: 78104 agcttgattgatttttgctg 78085
>emb|AL391883.17| Human DNA sequence from clone RP11-91K11 on chromosome 1 Contains the 5' end of the gene for a novel protein (LOC255104), the gene for a novel protein (FLJ20225), a novel gene and the 5' end of the gene for a novel protein (KIAA0459), complete sequence Length = 126371 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 451 ctgtatcagttacttgttta 470 |||||||||||||||||||| Sbjct: 12151 ctgtatcagttacttgttta 12170
>emb|AL445188.5| Human DNA sequence from clone RP11-260E14 on chromosome 13, complete sequence Length = 164061 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 385 aatcagcttgattgattttt 404 |||||||||||||||||||| Sbjct: 112301 aatcagcttgattgattttt 112320
>ref|XM_781562.1| PREDICTED: Strongylocentrotus purpuratus similar to kidney predominant protein NCU-G1 (LOC581573), mRNA Length = 1236 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 134 cggtgttttctgtgctattg 153 |||||||||||||||||||| Sbjct: 481 cggtgttttctgtgctattg 462
>dbj|AB200900.1| Danio rerio TAS1R2a mRNA for taste receptor, type 1, member 2a, complete cds Length = 2478 Score = 40.1 bits (20), Expect = 6.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 231 attggcatgttgggccttttcacc 254 |||||||| ||||||||||||||| Sbjct: 1696 attggcatattgggccttttcacc 1719
>ref|NM_001039831.1| Danio rerio taste receptor, type 1, member 2a (tas1r2a), mRNA Length = 2478 Score = 40.1 bits (20), Expect = 6.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 231 attggcatgttgggccttttcacc 254 |||||||| ||||||||||||||| Sbjct: 1696 attggcatattgggccttttcacc 1719
>dbj|AB169487.1| Macaca fascicularis brain cDNA, clone: QccE-10596, similar to human solute carrier family 25 (mitochondrial carrier;phosphate carrier), member 3 (SLC25A3), nuclear geneencoding mitochondrial protein, transcript variant 1b,mRNA, RefSeq: NM_002635.1 Length = 1340 Score = 40.1 bits (20), Expect = 6.6 Identities = 26/28 (92%) Strand = Plus / Plus Query: 270 cgtatcgtcatgattggtactcttactg 297 |||||| |||||||||||||||| |||| Sbjct: 1006 cgtatcatcatgattggtactctgactg 1033
>gb|AC022203.4|AC022203 Homo sapiens BAC clone RP11-490K15 from 13, complete sequence Length = 177088 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 389 agcttgattgatttttgctg 408 |||||||||||||||||||| Sbjct: 13757 agcttgattgatttttgctg 13776
>emb|CT030245.8| M.truncatula DNA sequence from clone MTH2-59B18 on chromosome 3, complete sequence Length = 128436 Score = 40.1 bits (20), Expect = 6.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 155 ttctcatccggctgacaaccttgt 178 ||||||||||| |||||||||||| Sbjct: 60187 ttctcatccggttgacaaccttgt 60210 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,502,321 Number of Sequences: 3902068 Number of extensions: 3502321 Number of successful extensions: 59702 Number of sequences better than 10.0: 139 Number of HSP's better than 10.0 without gapping: 138 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 59393 Number of HSP's gapped (non-prelim): 307 length of query: 486 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 464 effective length of database: 17,147,199,772 effective search space: 7956300694208 effective search space used: 7956300694208 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)