| Clone Name | bags25p01 |
|---|---|
| Clone Library Name | barley_pub |
>ref|NM_194876.1| Oryza sativa (japonica cultivar-group) putative RNA-binding protein (OSJNBa0028C16.8), mRNA Length = 1419 Score = 250 bits (126), Expect = 2e-63 Identities = 225/260 (86%) Strand = Plus / Plus Query: 33 ggctcancatgccattgaagaactgcatgacaaggaccacaaggggagaacactgcgang 92 |||||| | ||| ||||| || ||||||||||| || ||||||||||| |||||||| | Sbjct: 486 ggctcagcgtgctattgaggatctgcatgacaaagaacacaaggggaggacactgcggtg 545 Query: 93 ntnattgtcccaggccaagcacaggttatttgttggcaatgtacccaaagggttgagtga 152 | |||||| ||||| ||||||||| |||||||||||||||||||||| ||||||||||| Sbjct: 546 ctcattgtcacaggcaaagcacaggctatttgttggcaatgtacccaaggggttgagtga 605 Query: 153 ggaggagctgacgagcataatcaaagggaaggggccaggtgtcgtcaatattgagatgtt 212 ||| ||||||| | ||||||| | |||||||| |||||||| || || ||||||||||| Sbjct: 606 ggacgagctgagaaacataatccaggggaagggcccaggtgttgtgaacattgagatgtt 665 Query: 213 taaggatttgcataacccaagccgtaatcgtgggttcctctttgttgagtactataacca 272 |||||||| ||| | ||||||||||| ||||||||||||||||||||||| |||||||| Sbjct: 666 caaggatttacatgatccaagccgtaaccgtgggttcctctttgttgagtattataacca 725 Query: 273 tgctngntcagactatgcca 292 |||| | |||||||||||| Sbjct: 726 tgcttgtgcagactatgcca 745
>dbj|AK066347.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013065B13, full insert sequence Length = 3637 Score = 250 bits (126), Expect = 2e-63 Identities = 225/260 (86%) Strand = Plus / Plus Query: 33 ggctcancatgccattgaagaactgcatgacaaggaccacaaggggagaacactgcgang 92 |||||| | ||| ||||| || ||||||||||| || ||||||||||| |||||||| | Sbjct: 751 ggctcagcgtgctattgaggatctgcatgacaaagaacacaaggggaggacactgcggtg 810 Query: 93 ntnattgtcccaggccaagcacaggttatttgttggcaatgtacccaaagggttgagtga 152 | |||||| ||||| ||||||||| |||||||||||||||||||||| ||||||||||| Sbjct: 811 ctcattgtcacaggcaaagcacaggctatttgttggcaatgtacccaaggggttgagtga 870 Query: 153 ggaggagctgacgagcataatcaaagggaaggggccaggtgtcgtcaatattgagatgtt 212 ||| ||||||| | ||||||| | |||||||| |||||||| || || ||||||||||| Sbjct: 871 ggacgagctgagaaacataatccaggggaagggcccaggtgttgtgaacattgagatgtt 930 Query: 213 taaggatttgcataacccaagccgtaatcgtgggttcctctttgttgagtactataacca 272 |||||||| ||| | ||||||||||| ||||||||||||||||||||||| |||||||| Sbjct: 931 caaggatttacatgatccaagccgtaaccgtgggttcctctttgttgagtattataacca 990 Query: 273 tgctngntcagactatgcca 292 |||| | |||||||||||| Sbjct: 991 tgcttgtgcagactatgcca 1010
>gb|AY104865.1| Zea mays PCO099871 mRNA sequence Length = 1968 Score = 147 bits (74), Expect = 2e-32 Identities = 165/196 (84%) Strand = Plus / Plus Query: 98 tgtcccaggccaagcacaggttatttgttggcaatgtacccaaagggttgagtgaggagg 157 |||| ||||| ||||||||| | |||||||| ||||| ||||| ||| |||| ||||||| Sbjct: 769 tgtcgcaggcaaagcacaggctgtttgttgggaatgtgcccaaggggctgagcgaggagg 828 Query: 158 agctgacgagcataatcaaagggaaggggccaggtgtcgtcaatattgagatgtttaagg 217 |||| || | || ||||| |||||||| |||||||| |||| |||||||||||||||| Sbjct: 829 agcttaccaacactatcaaggggaagggtccaggtgttatcaacattgagatgtttaagg 888 Query: 218 atttgcataacccaagccgtaatcgtgggttcctctttgttgagtactataaccatgctn 277 || |||| |||||| |||||| ||||| ||||||||||||||||| || |||||||| Sbjct: 889 atcagcatgacccaaaccgtaaccgtggcttcctctttgttgagtattacaaccatgcct 948 Query: 278 gntcagactatgccag 293 | ||||||||||||| Sbjct: 949 gcgcagactatgccag 964
>gb|AC098565.3| Oryza sativa chromosome 10 clone OSJNBa0028C16, complete sequence Length = 166757 Score = 133 bits (67), Expect = 3e-28 Identities = 124/144 (86%) Strand = Plus / Minus Query: 74 aggggagaacactgcgangntnattgtcccaggccaagcacaggttatttgttggcaatg 133 ||||||| |||||||| | | |||||| ||||| ||||||||| ||||||||||||||| Sbjct: 66390 aggggaggacactgcggtgctcattgtcacaggcaaagcacaggctatttgttggcaatg 66331 Query: 134 tacccaaagggttgagtgaggaggagctgacgagcataatcaaagggaaggggccaggtg 193 ||||||| |||||||||||||| ||||||| | ||||||| | |||||||| ||||||| Sbjct: 66330 tacccaaggggttgagtgaggacgagctgagaaacataatccaggggaagggcccaggtg 66271 Query: 194 tcgtcaatattgagatgtttaagg 217 | || || ||||||||||| |||| Sbjct: 66270 ttgtgaacattgagatgttcaagg 66247 Score = 95.6 bits (48), Expect = 8e-17 Identities = 70/78 (89%) Strand = Plus / Minus Query: 215 aggatttgcataacccaagccgtaatcgtgggttcctctttgttgagtactataaccatg 274 ||||||| ||| | ||||||||||| ||||||||||||||||||||||| |||||||||| Sbjct: 66168 aggatttacatgatccaagccgtaaccgtgggttcctctttgttgagtattataaccatg 66109 Query: 275 ctngntcagactatgcca 292 || | |||||||||||| Sbjct: 66108 cttgtgcagactatgcca 66091
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 133 bits (67), Expect = 3e-28 Identities = 124/144 (86%) Strand = Plus / Minus Query: 74 aggggagaacactgcgangntnattgtcccaggccaagcacaggttatttgttggcaatg 133 ||||||| |||||||| | | |||||| ||||| ||||||||| ||||||||||||||| Sbjct: 3096758 aggggaggacactgcggtgctcattgtcacaggcaaagcacaggctatttgttggcaatg 3096699 Query: 134 tacccaaagggttgagtgaggaggagctgacgagcataatcaaagggaaggggccaggtg 193 ||||||| |||||||||||||| ||||||| | ||||||| | |||||||| ||||||| Sbjct: 3096698 tacccaaggggttgagtgaggacgagctgagaaacataatccaggggaagggcccaggtg 3096639 Query: 194 tcgtcaatattgagatgtttaagg 217 | || || ||||||||||| |||| Sbjct: 3096638 ttgtgaacattgagatgttcaagg 3096615 Score = 95.6 bits (48), Expect = 8e-17 Identities = 70/78 (89%) Strand = Plus / Minus Query: 215 aggatttgcataacccaagccgtaatcgtgggttcctctttgttgagtactataaccatg 274 ||||||| ||| | ||||||||||| ||||||||||||||||||||||| |||||||||| Sbjct: 3096536 aggatttacatgatccaagccgtaaccgtgggttcctctttgttgagtattataaccatg 3096477 Query: 275 ctngntcagactatgcca 292 || | |||||||||||| Sbjct: 3096476 cttgtgcagactatgcca 3096459
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 133 bits (67), Expect = 3e-28 Identities = 124/144 (86%) Strand = Plus / Minus Query: 74 aggggagaacactgcgangntnattgtcccaggccaagcacaggttatttgttggcaatg 133 ||||||| |||||||| | | |||||| ||||| ||||||||| ||||||||||||||| Sbjct: 3096679 aggggaggacactgcggtgctcattgtcacaggcaaagcacaggctatttgttggcaatg 3096620 Query: 134 tacccaaagggttgagtgaggaggagctgacgagcataatcaaagggaaggggccaggtg 193 ||||||| |||||||||||||| ||||||| | ||||||| | |||||||| ||||||| Sbjct: 3096619 tacccaaggggttgagtgaggacgagctgagaaacataatccaggggaagggcccaggtg 3096560 Query: 194 tcgtcaatattgagatgtttaagg 217 | || || ||||||||||| |||| Sbjct: 3096559 ttgtgaacattgagatgttcaagg 3096536 Score = 95.6 bits (48), Expect = 8e-17 Identities = 70/78 (89%) Strand = Plus / Minus Query: 215 aggatttgcataacccaagccgtaatcgtgggttcctctttgttgagtactataaccatg 274 ||||||| ||| | ||||||||||| ||||||||||||||||||||||| |||||||||| Sbjct: 3096457 aggatttacatgatccaagccgtaaccgtgggttcctctttgttgagtattataaccatg 3096398 Query: 275 ctngntcagactatgcca 292 || | |||||||||||| Sbjct: 3096397 cttgtgcagactatgcca 3096380
>gb|AC146948.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone P0782F03 map near S2137, complete sequence Length = 197516 Score = 125 bits (63), Expect = 8e-26 Identities = 123/144 (85%) Strand = Plus / Minus Query: 74 aggggagaacactgcgangntnattgtcccaggccaagcacaggttatttgttggcaatg 133 ||||||| |||||||| | | | |||| ||||| ||||||||| |||| ||||| |||| Sbjct: 104495 aggggaggacactgcggtgctcactgtcgcaggcaaagcacaggctattcgttggtaatg 104436 Query: 134 tacccaaagggttgagtgaggaggagctgacgagcataatcaaagggaaggggccaggtg 193 ||||||| |||||| ||||||||||||||| | |||||| |||||||||||||||||| Sbjct: 104435 tacccaaggggttgggtgaggaggagctgagaaagataatccaagggaaggggccaggtg 104376 Query: 194 tcgtcaatattgagatgtttaagg 217 | ||||| ||||||||||| |||| Sbjct: 104375 ttgtcaacattgagatgttcaagg 104352 Score = 97.6 bits (49), Expect = 2e-17 Identities = 71/79 (89%) Strand = Plus / Minus Query: 215 aggatttgcataacccaagccgtaatcgtgggttcctctttgttgagtactataaccatg 274 ||||||| ||| ||||||||||||| ||||||||||||||||||||||| |||||||| | Sbjct: 104272 aggatttacatgacccaagccgtaaccgtgggttcctctttgttgagtattataaccacg 104213 Query: 275 ctngntcagactatgccag 293 || | ||||||||||||| Sbjct: 104212 cttgtgcagactatgccag 104194
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 125 bits (63), Expect = 8e-26 Identities = 123/144 (85%) Strand = Plus / Minus Query: 74 aggggagaacactgcgangntnattgtcccaggccaagcacaggttatttgttggcaatg 133 ||||||| |||||||| | | | |||| ||||| ||||||||| |||| ||||| |||| Sbjct: 8023767 aggggaggacactgcggtgctcactgtcgcaggcaaagcacaggctattcgttggtaatg 8023708 Query: 134 tacccaaagggttgagtgaggaggagctgacgagcataatcaaagggaaggggccaggtg 193 ||||||| |||||| ||||||||||||||| | |||||| |||||||||||||||||| Sbjct: 8023707 tacccaaggggttgggtgaggaggagctgagaaagataatccaagggaaggggccaggtg 8023648 Query: 194 tcgtcaatattgagatgtttaagg 217 | ||||| ||||||||||| |||| Sbjct: 8023647 ttgtcaacattgagatgttcaagg 8023624 Score = 97.6 bits (49), Expect = 2e-17 Identities = 71/79 (89%) Strand = Plus / Minus Query: 215 aggatttgcataacccaagccgtaatcgtgggttcctctttgttgagtactataaccatg 274 ||||||| ||| ||||||||||||| ||||||||||||||||||||||| |||||||| | Sbjct: 8023544 aggatttacatgacccaagccgtaaccgtgggttcctctttgttgagtattataaccacg 8023485 Query: 275 ctngntcagactatgccag 293 || | ||||||||||||| Sbjct: 8023484 cttgtgcagactatgccag 8023466
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 125 bits (63), Expect = 8e-26 Identities = 123/144 (85%) Strand = Plus / Minus Query: 74 aggggagaacactgcgangntnattgtcccaggccaagcacaggttatttgttggcaatg 133 ||||||| |||||||| | | | |||| ||||| ||||||||| |||| ||||| |||| Sbjct: 8093706 aggggaggacactgcggtgctcactgtcgcaggcaaagcacaggctattcgttggtaatg 8093647 Query: 134 tacccaaagggttgagtgaggaggagctgacgagcataatcaaagggaaggggccaggtg 193 ||||||| |||||| ||||||||||||||| | |||||| |||||||||||||||||| Sbjct: 8093646 tacccaaggggttgggtgaggaggagctgagaaagataatccaagggaaggggccaggtg 8093587 Query: 194 tcgtcaatattgagatgtttaagg 217 | ||||| ||||||||||| |||| Sbjct: 8093586 ttgtcaacattgagatgttcaagg 8093563 Score = 97.6 bits (49), Expect = 2e-17 Identities = 71/79 (89%) Strand = Plus / Minus Query: 215 aggatttgcataacccaagccgtaatcgtgggttcctctttgttgagtactataaccatg 274 ||||||| ||| ||||||||||||| ||||||||||||||||||||||| |||||||| | Sbjct: 8093483 aggatttacatgacccaagccgtaaccgtgggttcctctttgttgagtattataaccacg 8093424 Query: 275 ctngntcagactatgccag 293 || | ||||||||||||| Sbjct: 8093423 cttgtgcagactatgccag 8093405
>gb|BT018606.1| Zea mays clone EL01N0450E05.d mRNA sequence Length = 1806 Score = 99.6 bits (50), Expect = 5e-18 Identities = 139/166 (83%), Gaps = 2/166 (1%) Strand = Plus / Plus Query: 98 tgtcccaggccaagcacaggttatttgttggcaatgtacccaaagggttgagtgaggagg 157 |||| ||||| ||||||||| | |||||||| ||||| ||||| ||| |||| ||||||| Sbjct: 608 tgtcgcaggcaaagcacaggctgtttgttgggaatgtgcccaaggggctgagcgaggagg 667 Query: 158 agctg-acgagcataatcaaagggaaggggccaggtgtcgtcaatattgagatgtttaag 216 |||| || | || ||||| |||||||| |||||||| |||| ||||||||||||| | Sbjct: 668 agctttacca-cactatcaaggggaagggtccaggtgttatcaacattgagatgtttagg 726 Query: 217 gatttgcataacccaagccgtaatcgtgggttcctctttgttgagt 262 ||| |||| |||||| |||||| ||||| |||||||||||||||| Sbjct: 727 gatcagcatgacccaaaccgtaaccgtggcttcctctttgttgagt 772
>gb|AC175380.2| Mus musculus BAC clone RP24-333L5 from chromosome 13, complete sequence Length = 164055 Score = 40.1 bits (20), Expect = 3.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 199 aatattgagatgtttaaggatttg 222 ||||||||||| |||||||||||| Sbjct: 73960 aatattgagatatttaaggatttg 73983
>gb|AC016884.10| Homo sapiens chromosome , clone RP11-350M7, complete sequence Length = 209320 Score = 40.1 bits (20), Expect = 3.9 Identities = 25/27 (92%) Strand = Plus / Plus Query: 35 ctcancatgccattgaagaactgcatg 61 |||| || ||||||||||||||||||| Sbjct: 186269 ctcaacaagccattgaagaactgcatg 186295
>gb|AC121108.12| Mus musculus chromosome 3, clone RP24-417H10, complete sequence Length = 184753 Score = 40.1 bits (20), Expect = 3.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 150 tgaggaggagctgacgagca 169 |||||||||||||||||||| Sbjct: 96823 tgaggaggagctgacgagca 96842
>gb|AE015925.1| Chlamydophila caviae GPIC, complete genome Length = 1173390 Score = 40.1 bits (20), Expect = 3.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 122 ttgttggcaatgtacccaaa 141 |||||||||||||||||||| Sbjct: 249801 ttgttggcaatgtacccaaa 249782 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,223,233 Number of Sequences: 3902068 Number of extensions: 2223233 Number of successful extensions: 40143 Number of sequences better than 10.0: 14 Number of HSP's better than 10.0 without gapping: 14 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 40075 Number of HSP's gapped (non-prelim): 68 length of query: 295 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 273 effective length of database: 17,147,199,772 effective search space: 4681185537756 effective search space used: 4681185537756 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)