ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags26a13
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY104279.1| Zea mays PCO103545 mRNA sequence 613 e-172
2ref|NM_196510.1| Oryza sativa (japonica cultivar-group) putative... 611 e-171
3dbj|AB193582.1| Oryza sativa (japonica cultivar-group) OsGME-1 m... 611 e-171
4dbj|AK104822.1| Oryza sativa (japonica cultivar-group) cDNA clon... 611 e-171
5dbj|AK069385.1| Oryza sativa (japonica cultivar-group) cDNA clon... 611 e-171
6gb|BT016578.1| Zea mays clone Contig411 mRNA sequence 581 e-162
7dbj|AK102348.1| Oryza sativa (japonica cultivar-group) cDNA clon... 398 e-108
8ref|NM_122767.2| Arabidopsis thaliana GDP-mannose 3,5-epimerase/... 254 3e-64
9gb|AY116953.1| Arabidopsis thaliana AT5g28840/F7P1_20 mRNA, comp... 254 3e-64
10gb|AC016780.6| Genomic Sequence For Oryza sativa (japonica culti... 254 3e-64
11gb|AY057694.1| Arabidopsis thaliana AT5g28840/F7P1_20 mRNA, comp... 254 3e-64
12gb|AY057660.1| Arabidopsis thaliana AT5g28840/F7P1_20 mRNA, comp... 254 3e-64
13dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 254 3e-64
14gb|AC027658.1| Oryza sativa (japonica cultivar-group) BAC nbxb00... 254 3e-64
15gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 254 3e-64
16gb|BT013590.1| Lycopersicon esculentum clone 132353F, mRNA sequence 230 5e-57
17gb|AF229187.1|AF229187 Oryza sativa subsp. japonica BAC clone nb... 206 7e-50
18gb|AY106775.1| Zea mays PCO117540 mRNA sequence 206 7e-50
19gb|AC146334.2| Oryza sativa (japonica cultivar-group) chromosome... 198 2e-47
20dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 198 2e-47
21gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 198 2e-47
22gb|DQ268848.1| Solanum tuberosum clone 155B09 NAD-dependent epim... 188 2e-44
23gb|DQ207722.1| Zea mays cultivar B73 IDP512 marker 147 5e-32
24gb|DQ207723.1| Zea mays cultivar inbred line Mo17 IDP512 marker 141 3e-30
25gb|AF272706.1|F7P1 Arabidopsis thaliana BAC F7P1 127 5e-26
26dbj|AK118786.1| Arabidopsis thaliana mRNA, clone: RAFL21-11-O14 127 5e-26
27dbj|AB235855.1| Oryza sativa (japonica cultivar-group) OsGME mRN... 68 4e-08
28dbj|AK109046.1| Oryza sativa (japonica cultivar-group) cDNA clon... 68 4e-08
29ref|XM_848981.1| PREDICTED: Canis familiaris similar to NACHT, L... 44 0.56
30gb|AC125456.4| Mus musculus BAC clone RP24-193M20 from chromosom... 44 0.56
31gb|AC010708.10|AC010708 Drosophila melanogaster, chromosome X, r... 44 0.56
32gb|AC012098.9|AC012098 Drosophila melanogaster, chromosome X, re... 44 0.56
33gb|AE003509.5| Drosophila melanogaster chromosome X, section 61 ... 44 0.56
34gb|AC018489.7| Drosophila melanogaster clone BACR19G19, complete... 42 2.2
35gb|AC022349.3| Drosophila melanogaster clone BACR33D04, complete... 42 2.2
36gb|AY121637.1| Drosophila melanogaster HL04344 full insert cDNA 42 2.2
37ref|NM_206767.1| Drosophila melanogaster CG9132-PB, isoform B (C... 42 2.2
38ref|NM_206768.1| Drosophila melanogaster CG9132-PA, isoform A (C... 42 2.2
39gb|AE003503.4| Drosophila melanogaster chromosome X, section 55 ... 42 2.2
40gb|AE014291.4| Brucella suis 1330 chromosome I, complete sequence 40 8.8
41gb|AC150687.3| Bos taurus BAC CH240-243M2 (Children's Hospital ... 40 8.8
42ref|XM_368123.1| Magnaporthe grisea 70-15 chromosome VI hypothet... 40 8.8
43ref|XM_418410.1| PREDICTED: Gallus gallus similar to RHPN1 prote... 40 8.8
44emb|AL591783.1|SME591783 Sinorhizobium meliloti 1021 complete ch... 40 8.8
45gb|AC134698.10| Homo sapiens chromosome 8, clone RP11-359P18, co... 40 8.8
46emb|BX510937.6| Zebrafish DNA sequence from clone DKEY-90G19 in ... 40 8.8
47emb|BX546446.15| Zebrafish DNA sequence from clone DKEY-7K24 in ... 40 8.8
48gb|AC104119.2| Homo sapiens chromosome 5 clone RP11-34D23, compl... 40 8.8
49emb|CR353063.1| Gallus gallus finished cDNA, clone ChEST419d21 40 8.8
50emb|BX248229.14| Zebrafish DNA sequence from clone CH211-126P4 i... 40 8.8
51gb|AE009631.1| Brucella melitensis 16M chromosome I, section 188... 40 8.8
52gb|AE017223.1| Brucella abortus biovar 1 str. 9-941 chromosome I... 40 8.8
53gb|AC150680.7| Monodelphis domestica, clone XX-28D5, complete se... 40 8.8
54emb|CR774199.4| Zebrafish DNA sequence from clone CH211-42H24 in... 40 8.8
55dbj|AB089266.1| Lethenteron japonicum MASP-like mRNA for mannose... 40 8.8
56gb|AE015924.1| Porphyromonas gingivalis W83, complete genome 40 8.8
57gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, com... 40 8.8
58dbj|AK113577.1| Ciona intestinalis cDNA, clone:ciad076a06, full ... 40 8.8
59gb|AC160645.2| Gallus gallus BAC clone CH261-21L11 from chromoso... 40 8.8
60emb|AM040264.1| Brucella melitensis biovar Abortus chromosome I,... 40 8.8
61gb|DQ079316.1| Drosophila mulleri strain 15081-1371.00 Tes33 (Te... 40 8.8
62gb|DQ079315.1| Drosophila mojavensis strain 15081-1352.02 Tes33 ... 40 8.8
63gb|DQ079314.1| Drosophila mojavensis strain 15081-1352.01 Tes33 ... 40 8.8
64gb|DQ079313.1| Drosophila mojavensis strain 15081-1352.00 Tes33 ... 40 8.8
65gb|DQ079312.1| Drosophila mojavensis strain 15081-1351.09 Tes33 ... 40 8.8
66gb|DQ079311.1| Drosophila mojavensis strain 15081-1351.03 Tes33 ... 40 8.8
67gb|DQ079310.1| Drosophila mojavensis strain 15081-1351.14 Tes33 ... 40 8.8
68gb|DQ079309.1| Drosophila mojavensis strain 15081-1351.12 Tes33 ... 40 8.8
69gb|DQ079307.1| Drosophila arizonae strain 15081-1271.13 Tes33 (T... 40 8.8
70gb|DQ079306.1| Drosophila arizonae strain 15081-1271.12 Tes33 (T... 40 8.8
71gb|DQ079305.1| Drosophila arizonae strain 15081-1271.08 Tes33 (T... 40 8.8
72gb|DQ079304.1| Drosophila arizonae strain 15081-1271.05 Tes33 (T... 40 8.8
73gb|DQ079303.1| Drosophila arizonae strain 15081-1271.04 Tes33 (T... 40 8.8
74gb|DQ079302.1| Drosophila arizonae strain 15081-1271.00 Tes33 (T... 40 8.8
75gb|L37524.1|ASNMETA Aspergillus flavus (isolate 28) metalloprote... 40 8.8

>gb|AY104279.1| Zea mays PCO103545 mRNA sequence
          Length = 1547

 Score =  613 bits (309), Expect = e-172
 Identities = 528/601 (87%)
 Strand = Plus / Plus

                                                                        
Query: 6    gaagctcgcgaccgaggagctgtgcaagcactacaccaaggactttgacattgagtgccg 65
            |||||| || ||||||||||||||||||||||||||||||||||||| ||| ||||||||
Sbjct: 653  gaagcttgcaaccgaggagctgtgcaagcactacaccaaggactttggcatcgagtgccg 712

                                                                        
Query: 66   tattggccgttttcacaacatttatggtccctttggaacatggaaaggcggtcgcgagaa 125
              | ||||| || |||||||| || || || || |||||||||||||| || ||||||||
Sbjct: 713  cgtcggccgcttccacaacatctacggccctttcggaacatggaaaggtggccgcgagaa 772

                                                                        
Query: 126  ggcaccagctgccttctgtagaaaggctcagacctccaccgaacggtttgagatgtgggg 185
            |||||| ||||||||||| |||||||||||||| ||||| ||  ||||||||||||||||
Sbjct: 773  ggcaccggctgccttctgcagaaaggctcagacatccacggagaggtttgagatgtgggg 832

                                                                        
Query: 186  tgatggtctacagactcgatcgttcacttttatcgacgagtgcgtcgagggtgttctgag 245
             |||||||| |||||  | || ||||| || |||||||||||||| ||||||||||||||
Sbjct: 833  cgatggtctccagaccaggtccttcaccttcatcgacgagtgcgtggagggtgttctgag 892

                                                                        
Query: 246  attgacaaagtcagacttctgcgagcccgtgaacattggaagtgatgaaatggtgagcat 305
            |||||| |||||||||||| ||||||| |||||||| ||||| ||||| |||||||||||
Sbjct: 893  attgaccaagtcagacttccgcgagccagtgaacatcggaagcgatgagatggtgagcat 952

                                                                        
Query: 306  gaacgagatggctgagattgttctcggcttcgaggacaagaagctacccatccaccacat 365
            |||||||||||||||||| || || ||||| ||||| | |||||| ||||||||||||||
Sbjct: 953  gaacgagatggctgagatcgtgctgggctttgaggataggaagctgcccatccaccacat 1012

                                                                        
Query: 366  ccctggtccagagggtgtccgcggccgcaactctgacaacaccctcatcaaggagaagct 425
            |||||| || || || |||||||| |||||||||||||||||||| ||||||||||||||
Sbjct: 1013 ccctggcccggaaggggtccgcgggcgcaactctgacaacacccttatcaaggagaagct 1072

                                                                        
Query: 426  tggctgggcccccacaatgaagctcaaggatggcctaaggttcacctacttctggatcaa 485
            |||||||||||| || ||||||||||||||||| ||  ||||||||||||||||||||||
Sbjct: 1073 tggctgggccccgacgatgaagctcaaggatgggctgcggttcacctacttctggatcaa 1132

                                                                        
Query: 486  ggagcagatcgagaaggagaggaccgaggggaaggacgtcgcccggtacggatcatccaa 545
             ||||||||||||||||||| |||  |||||   ||| ||||   |||||| || |||||
Sbjct: 1133 agagcagatcgagaaggagaagacgcagggggtcgacatcgcggcgtacgggtcgtccaa 1192

                                                                        
Query: 546  ggtggtgtccacacaggcaccggtgcagctgggctccctccgcgcggctgacggcaagga 605
            |||||||||||| ||||| || ||||||||||||||||||||||| || |||||||||||
Sbjct: 1193 ggtggtgtccacccaggcgcccgtgcagctgggctccctccgcgccgccgacggcaagga 1252

             
Query: 606  g 606
            |
Sbjct: 1253 g 1253



to top

>ref|NM_196510.1| Oryza sativa (japonica cultivar-group) putative epimerase/dehydratase
            (OSJNBa0061K21.15), mRNA
          Length = 1137

 Score =  611 bits (308), Expect = e-171
 Identities = 530/604 (87%)
 Strand = Plus / Plus

                                                                        
Query: 6    gaagctcgcgaccgaggagctgtgcaagcactacaccaaggactttgacattgagtgccg 65
            |||||| || || |||||||| ||||||||||||||||||||||||| ||||||||||||
Sbjct: 534  gaagcttgcaactgaggagctctgcaagcactacaccaaggactttggcattgagtgccg 593

                                                                        
Query: 66   tattggccgttttcacaacatttatggtccctttggaacatggaaaggcggtcgcgagaa 125
            | ||||||| || |||||||| ||||| |||||||||||||||||||| || || |||||
Sbjct: 594  tgttggccgcttccacaacatatatggcccctttggaacatggaaaggtggccgtgagaa 653

                                                                        
Query: 126  ggcaccagctgccttctgtagaaaggctcagacctccaccgaacggtttgagatgtgggg 185
            |||||||||||| ||||| || ||||||||||| ||||| ||  ||||||||||||||||
Sbjct: 654  ggcaccagctgcattctgcaggaaggctcagacttccactgacaggtttgagatgtgggg 713

                                                                        
Query: 186  tgatggtctacagactcgatcgttcacttttatcgacgagtgcgtcgagggtgttctgag 245
            |||||| || ||||| || || ||||| || || || ||||| || ||||||||||||||
Sbjct: 714  tgatggcctccagacccggtccttcacattcatagatgagtgtgttgagggtgttctgag 773

                                                                        
Query: 246  attgacaaagtcagacttctgcgagcccgtgaacattggaagtgatgaaatggtgagcat 305
             ||||||||||| |||||| | ||||| |||||||||||||| ||||||||||| |||||
Sbjct: 774  gttgacaaagtcggacttccgtgagccagtgaacattggaagcgatgaaatggtaagcat 833

                                                                        
Query: 306  gaacgagatggctgagattgttctcggcttcgaggacaagaagctacccatccaccacat 365
            ||||||||||||||| ||  ||||| |||||||||| | | |||| ||||||||||||||
Sbjct: 834  gaacgagatggctgaaatcattctcagcttcgaggatagggagctgcccatccaccacat 893

                                                                        
Query: 366  ccctggtccagagggtgtccgcggccgcaactctgacaacaccctcatcaaggagaagct 425
            |||||| || ||||||||||| ||||| ||||| ||||||||||||||||||||||||||
Sbjct: 894  ccctggacccgagggtgtccgtggccgtaactccgacaacaccctcatcaaggagaagct 953

                                                                        
Query: 426  tggctgggcccccacaatgaagctcaaggatggcctaaggttcacctacttctggatcaa 485
            ||||||||| |||||||||||||||||||| || || |||||||||||||||||||||||
Sbjct: 954  tggctgggcacccacaatgaagctcaaggacgggctgaggttcacctacttctggatcaa 1013

                                                                        
Query: 486  ggagcagatcgagaaggagaggaccgaggggaaggacgtcgcccggtacggatcatccaa 545
            ||||||||| |||||||||| |||| ||||    ||| ||||  | ||||| ||||||||
Sbjct: 1014 ggagcagatagagaaggagaagacccagggcgtcgacatcgcgggttacggctcatccaa 1073

                                                                        
Query: 546  ggtggtgtccacacaggcaccggtgcagctgggctccctccgcgcggctgacggcaagga 605
            |||||||||||| ||||| ||||| ||||||||||||||||| || || || ||||||||
Sbjct: 1074 ggtggtgtccacccaggccccggttcagctgggctccctccgtgctgccgatggcaagga 1133

                
Query: 606  gtaa 609
            ||||
Sbjct: 1134 gtaa 1137



to top

>dbj|AB193582.1| Oryza sativa (japonica cultivar-group) OsGME-1 mRNA for
            GDP-mannose-3'',5''-epimerase, complete cds
          Length = 1212

 Score =  611 bits (308), Expect = e-171
 Identities = 530/604 (87%)
 Strand = Plus / Plus

                                                                        
Query: 6    gaagctcgcgaccgaggagctgtgcaagcactacaccaaggactttgacattgagtgccg 65
            |||||| || || |||||||| ||||||||||||||||||||||||| ||||||||||||
Sbjct: 570  gaagcttgcaactgaggagctctgcaagcactacaccaaggactttggcattgagtgccg 629

                                                                        
Query: 66   tattggccgttttcacaacatttatggtccctttggaacatggaaaggcggtcgcgagaa 125
            | ||||||| || |||||||| ||||| |||||||||||||||||||| || || |||||
Sbjct: 630  tgttggccgcttccacaacatatatggcccctttggaacatggaaaggtggccgtgagaa 689

                                                                        
Query: 126  ggcaccagctgccttctgtagaaaggctcagacctccaccgaacggtttgagatgtgggg 185
            |||||||||||| ||||| || ||||||||||| ||||| ||  ||||||||||||||||
Sbjct: 690  ggcaccagctgcattctgcaggaaggctcagacttccactgacaggtttgagatgtgggg 749

                                                                        
Query: 186  tgatggtctacagactcgatcgttcacttttatcgacgagtgcgtcgagggtgttctgag 245
            |||||| || ||||| || || ||||| || || || ||||| || ||||||||||||||
Sbjct: 750  tgatggcctccagacccggtccttcacattcatagatgagtgtgttgagggtgttctgag 809

                                                                        
Query: 246  attgacaaagtcagacttctgcgagcccgtgaacattggaagtgatgaaatggtgagcat 305
             ||||||||||| |||||| | ||||| |||||||||||||| ||||||||||| |||||
Sbjct: 810  gttgacaaagtcggacttccgtgagccagtgaacattggaagcgatgaaatggtaagcat 869

                                                                        
Query: 306  gaacgagatggctgagattgttctcggcttcgaggacaagaagctacccatccaccacat 365
            ||||||||||||||| ||  ||||| |||||||||| | | |||| ||||||||||||||
Sbjct: 870  gaacgagatggctgaaatcattctcagcttcgaggatagggagctgcccatccaccacat 929

                                                                        
Query: 366  ccctggtccagagggtgtccgcggccgcaactctgacaacaccctcatcaaggagaagct 425
            |||||| || ||||||||||| ||||| ||||| ||||||||||||||||||||||||||
Sbjct: 930  ccctggacccgagggtgtccgtggccgtaactccgacaacaccctcatcaaggagaagct 989

                                                                        
Query: 426  tggctgggcccccacaatgaagctcaaggatggcctaaggttcacctacttctggatcaa 485
            ||||||||| |||||||||||||||||||| || || |||||||||||||||||||||||
Sbjct: 990  tggctgggcacccacaatgaagctcaaggacgggctgaggttcacctacttctggatcaa 1049

                                                                        
Query: 486  ggagcagatcgagaaggagaggaccgaggggaaggacgtcgcccggtacggatcatccaa 545
            ||||||||| |||||||||| |||| ||||    ||| ||||  | ||||| ||||||||
Sbjct: 1050 ggagcagatagagaaggagaagacccagggcgtcgacatcgcgggttacggctcatccaa 1109

                                                                        
Query: 546  ggtggtgtccacacaggcaccggtgcagctgggctccctccgcgcggctgacggcaagga 605
            |||||||||||| ||||| ||||| ||||||||||||||||| || || || ||||||||
Sbjct: 1110 ggtggtgtccacccaggccccggttcagctgggctccctccgtgctgccgatggcaagga 1169

                
Query: 606  gtaa 609
            ||||
Sbjct: 1170 gtaa 1173



to top

>dbj|AK104822.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-041-B04, full
            insert sequence
          Length = 1587

 Score =  611 bits (308), Expect = e-171
 Identities = 530/604 (87%)
 Strand = Plus / Plus

                                                                        
Query: 6    gaagctcgcgaccgaggagctgtgcaagcactacaccaaggactttgacattgagtgccg 65
            |||||| || || |||||||| ||||||||||||||||||||||||| ||||||||||||
Sbjct: 655  gaagcttgcaactgaggagctctgcaagcactacaccaaggactttggcattgagtgccg 714

                                                                        
Query: 66   tattggccgttttcacaacatttatggtccctttggaacatggaaaggcggtcgcgagaa 125
            | ||||||| || |||||||| ||||| |||||||||||||||||||| || || |||||
Sbjct: 715  tgttggccgcttccacaacatatatggcccctttggaacatggaaaggtggccgtgagaa 774

                                                                        
Query: 126  ggcaccagctgccttctgtagaaaggctcagacctccaccgaacggtttgagatgtgggg 185
            |||||||||||| ||||| || ||||||||||| ||||| ||  ||||||||||||||||
Sbjct: 775  ggcaccagctgcattctgcaggaaggctcagacttccactgacaggtttgagatgtgggg 834

                                                                        
Query: 186  tgatggtctacagactcgatcgttcacttttatcgacgagtgcgtcgagggtgttctgag 245
            |||||| || ||||| || || ||||| || || || ||||| || ||||||||||||||
Sbjct: 835  tgatggcctccagacccggtccttcacattcatagatgagtgtgttgagggtgttctgag 894

                                                                        
Query: 246  attgacaaagtcagacttctgcgagcccgtgaacattggaagtgatgaaatggtgagcat 305
             ||||||||||| |||||| | ||||| |||||||||||||| ||||||||||| |||||
Sbjct: 895  gttgacaaagtcggacttccgtgagccagtgaacattggaagcgatgaaatggtaagcat 954

                                                                        
Query: 306  gaacgagatggctgagattgttctcggcttcgaggacaagaagctacccatccaccacat 365
            ||||||||||||||| ||  ||||| |||||||||| | | |||| ||||||||||||||
Sbjct: 955  gaacgagatggctgaaatcattctcagcttcgaggatagggagctgcccatccaccacat 1014

                                                                        
Query: 366  ccctggtccagagggtgtccgcggccgcaactctgacaacaccctcatcaaggagaagct 425
            |||||| || ||||||||||| ||||| ||||| ||||||||||||||||||||||||||
Sbjct: 1015 ccctggacccgagggtgtccgtggccgtaactccgacaacaccctcatcaaggagaagct 1074

                                                                        
Query: 426  tggctgggcccccacaatgaagctcaaggatggcctaaggttcacctacttctggatcaa 485
            ||||||||| |||||||||||||||||||| || || |||||||||||||||||||||||
Sbjct: 1075 tggctgggcacccacaatgaagctcaaggacgggctgaggttcacctacttctggatcaa 1134

                                                                        
Query: 486  ggagcagatcgagaaggagaggaccgaggggaaggacgtcgcccggtacggatcatccaa 545
            ||||||||| |||||||||| |||| ||||    ||| ||||  | ||||| ||||||||
Sbjct: 1135 ggagcagatagagaaggagaagacccagggcgtcgacatcgcgggttacggctcatccaa 1194

                                                                        
Query: 546  ggtggtgtccacacaggcaccggtgcagctgggctccctccgcgcggctgacggcaagga 605
            |||||||||||| ||||| ||||| ||||||||||||||||| || || || ||||||||
Sbjct: 1195 ggtggtgtccacccaggccccggttcagctgggctccctccgtgctgccgatggcaagga 1254

                
Query: 606  gtaa 609
            ||||
Sbjct: 1255 gtaa 1258



to top

>dbj|AK069385.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023012D14, full
            insert sequence
          Length = 1592

 Score =  611 bits (308), Expect = e-171
 Identities = 530/604 (87%)
 Strand = Plus / Plus

                                                                        
Query: 6    gaagctcgcgaccgaggagctgtgcaagcactacaccaaggactttgacattgagtgccg 65
            |||||| || || |||||||| ||||||||||||||||||||||||| ||||||||||||
Sbjct: 660  gaagcttgcaactgaggagctctgcaagcactacaccaaggactttggcattgagtgccg 719

                                                                        
Query: 66   tattggccgttttcacaacatttatggtccctttggaacatggaaaggcggtcgcgagaa 125
            | ||||||| || |||||||| ||||| |||||||||||||||||||| || || |||||
Sbjct: 720  tgttggccgcttccacaacatatatggcccctttggaacatggaaaggtggccgtgagaa 779

                                                                        
Query: 126  ggcaccagctgccttctgtagaaaggctcagacctccaccgaacggtttgagatgtgggg 185
            |||||||||||| ||||| || ||||||||||| ||||| ||  ||||||||||||||||
Sbjct: 780  ggcaccagctgcattctgcaggaaggctcagacttccactgacaggtttgagatgtgggg 839

                                                                        
Query: 186  tgatggtctacagactcgatcgttcacttttatcgacgagtgcgtcgagggtgttctgag 245
            |||||| || ||||| || || ||||| || || || ||||| || ||||||||||||||
Sbjct: 840  tgatggcctccagacccggtccttcacattcatagatgagtgtgttgagggtgttctgag 899

                                                                        
Query: 246  attgacaaagtcagacttctgcgagcccgtgaacattggaagtgatgaaatggtgagcat 305
             ||||||||||| |||||| | ||||| |||||||||||||| ||||||||||| |||||
Sbjct: 900  gttgacaaagtcggacttccgtgagccagtgaacattggaagcgatgaaatggtaagcat 959

                                                                        
Query: 306  gaacgagatggctgagattgttctcggcttcgaggacaagaagctacccatccaccacat 365
            ||||||||||||||| ||  ||||| |||||||||| | | |||| ||||||||||||||
Sbjct: 960  gaacgagatggctgaaatcattctcagcttcgaggatagggagctgcccatccaccacat 1019

                                                                        
Query: 366  ccctggtccagagggtgtccgcggccgcaactctgacaacaccctcatcaaggagaagct 425
            |||||| || ||||||||||| ||||| ||||| ||||||||||||||||||||||||||
Sbjct: 1020 ccctggacccgagggtgtccgtggccgtaactccgacaacaccctcatcaaggagaagct 1079

                                                                        
Query: 426  tggctgggcccccacaatgaagctcaaggatggcctaaggttcacctacttctggatcaa 485
            ||||||||| |||||||||||||||||||| || || |||||||||||||||||||||||
Sbjct: 1080 tggctgggcacccacaatgaagctcaaggacgggctgaggttcacctacttctggatcaa 1139

                                                                        
Query: 486  ggagcagatcgagaaggagaggaccgaggggaaggacgtcgcccggtacggatcatccaa 545
            ||||||||| |||||||||| |||| ||||    ||| ||||  | ||||| ||||||||
Sbjct: 1140 ggagcagatagagaaggagaagacccagggcgtcgacatcgcgggttacggctcatccaa 1199

                                                                        
Query: 546  ggtggtgtccacacaggcaccggtgcagctgggctccctccgcgcggctgacggcaagga 605
            |||||||||||| ||||| ||||| ||||||||||||||||| || || || ||||||||
Sbjct: 1200 ggtggtgtccacccaggccccggttcagctgggctccctccgtgctgccgatggcaagga 1259

                
Query: 606  gtaa 609
            ||||
Sbjct: 1260 gtaa 1263



to top

>gb|BT016578.1| Zea mays clone Contig411 mRNA sequence
          Length = 1538

 Score =  581 bits (293), Expect = e-162
 Identities = 524/601 (87%)
 Strand = Plus / Plus

                                                                        
Query: 6    gaagctcgcgaccgaggagctgtgcaagcactacaccaaggactttgacattgagtgccg 65
            |||||| || ||||||||||||||||||||||||||||||||||||| ||| ||||||||
Sbjct: 651  gaagcttgcaaccgaggagctgtgcaagcactacaccaaggactttggcatcgagtgccg 710

                                                                        
Query: 66   tattggccgttttcacaacatttatggtccctttggaacatggaaaggcggtcgcgagaa 125
              | ||||| || |||||||| || || || || |||||||||||||| || ||||||||
Sbjct: 711  cgtcggccgcttccacaacatctacggccctttcggaacatggaaaggtggccgcgagaa 770

                                                                        
Query: 126  ggcaccagctgccttctgtagaaaggctcagacctccaccgaacggtttgagatgtgggg 185
            |||||| ||||||||||| |||||||||||||| ||||| ||  ||||||||||||||||
Sbjct: 771  ggcaccggctgccttctgcagaaaggctcagacatccacggagaggtttgagatgtgggg 830

                                                                        
Query: 186  tgatggtctacagactcgatcgttcacttttatcgacgagtgcgtcgagggtgttctgag 245
             |||||||| |||||  | || ||||| || |||||||||||||| ||||||||||||||
Sbjct: 831  cgatggtctccagaccaggtccttcaccttcatcgacgagtgcgtggagggtgttctgag 890

                                                                        
Query: 246  attgacaaagtcagacttctgcgagcccgtgaacattggaagtgatgaaatggtgagcat 305
            |||||| |||||||||||| ||||||| |||||||| ||||| ||||| |||||||||||
Sbjct: 891  attgaccaagtcagacttccgcgagccagtgaacatcggaagcgatgagatggtgagcat 950

                                                                        
Query: 306  gaacgagatggctgagattgttctcggcttcgaggacaagaagctacccatccaccacat 365
            |||||||||||||||||| || || ||||| ||||| | |||||| ||||||||||||||
Sbjct: 951  gaacgagatggctgagatcgtgctgggctttgaggataggaagctgcccatccaccacat 1010

                                                                        
Query: 366  ccctggtccagagggtgtccgcggccgcaactctgacaacaccctcatcaaggagaagct 425
            |||||| || || || |||||||| |||||||||||||||||||| ||||||||||||||
Sbjct: 1011 ccctggcccggaaggggtccgcgggcgcaactctgacaacacccttatcaaggagaagct 1070

                                                                        
Query: 426  tggctgggcccccacaatgaagctcaaggatggcctaaggttcacctacttctggatcaa 485
            |||||||||||| || ||||||||||||||||| ||  ||||||||||||||||||||||
Sbjct: 1071 tggctgggccccgacgatgaagctcaaggatgggctgcggttcacctacttctggatcaa 1130

                                                                        
Query: 486  ggagcagatcgagaaggagaggaccgaggggaaggacgtcgcccggtacggatcatccaa 545
             || |||||||| |||||||  ||  |||||   ||| ||||   |||||| || |||||
Sbjct: 1131 agaccagatcgacaaggagaacacgcagggggtcgacatcgcggcgtacgggtcgtccaa 1190

                                                                        
Query: 546  ggtggtgtccacacaggcaccggtgcagctgggctccctccgcgcggctgacggcaagga 605
            |||||||||||| ||||| || ||||||||||||||||||||| | || |||||||||||
Sbjct: 1191 ggtggtgtccacccaggcgcccgtgcagctgggctccctccgccccgccgacggcaagga 1250

             
Query: 606  g 606
            |
Sbjct: 1251 g 1251



to top

>dbj|AK102348.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033091C16, full
            insert sequence
          Length = 1533

 Score =  398 bits (201), Expect = e-108
 Identities = 495/591 (83%), Gaps = 4/591 (0%)
 Strand = Plus / Plus

                                                                        
Query: 19   gaggagctgtgcaagcactacaccaaggactttgacattgagtgccgtattggccgtttt 78
            ||||| ||||||||||| ||||| ||||| |||| |||||| || ||  ||||||| |||
Sbjct: 601  gaggaactgtgcaagcattacacaaaggattttggcattgaatgtcgggttggccgcttt 660

                                                                        
Query: 79   cacaacatttatggtccctttggaacatggaaaggcggtcgcgagaaggcaccagctgcc 138
            || || || ||||||||||||||||||||||| || ||  | |||||||| || ||||| 
Sbjct: 661  cataatatctatggtccctttggaacatggaagggtggaagggagaaggcgcctgctgct 720

                                                                        
Query: 139  ttctgtagaaaggctcagacctccaccgaacggtttgagatgtggggtgatggtctacag 198
            ||||| ||||| ||||  |||||||| || || |||||||||||||| |||||||| |||
Sbjct: 721  ttctgcagaaaagctctaacctccactgaccgttttgagatgtggggagatggtcttcag 780

                                                                        
Query: 199  actcgatcgttcacttttatcgacgagtgcgtcgagggtgttctgagattgacaaagtca 258
            ||| |||| ||||| ||||| || || || || |||||||| || || ||||||||||| 
Sbjct: 781  actagatccttcacgtttattgatgaatgtgtggagggtgtcctcaggttgacaaagtcc 840

                                                                        
Query: 259  gacttctgcgagcccgtgaacattggaagtgatgaaatggtgagcatgaacgagatggct 318
            || ||| | ||||| || ||||||||||||||||||||||| |||||||| |||||||||
Sbjct: 841  gatttccgtgagcctgtaaacattggaagtgatgaaatggtcagcatgaatgagatggct 900

                                                                        
Query: 319  gagattgttctcggcttcgaggacaagaagctacccatccaccacatccctggtccagag 378
            ||||| || ||| |||| ||| ||||| |||| ||||||||||||||||| || ||||||
Sbjct: 901  gagatagtcctcagctttgagaacaagcagctgcccatccaccacatccccgggccagag 960

                                                                        
Query: 379  ggtgtccgcggccgcaactctgacaacaccctcatcaaggagaagcttggctgggccccc 438
            |||||||| || |||||||| |||||||| |||||||| ||||||||||||||||| || 
Sbjct: 961  ggtgtccgtggtcgcaactccgacaacacgctcatcaaagagaagcttggctgggctcca 1020

                                                                        
Query: 439  acaatgaagctcaaggatggcctaaggttcacctacttctggatcaaggagcagatcgag 498
            || |||| ||| |||||||| || ||| |||| ||||||||||||||||||||| |||||
Sbjct: 1021 accatgaggctgaaggatggtctgaggatcacatacttctggatcaaggagcagctcgag 1080

                                                                        
Query: 499  aaggagaggaccgaggggaaggac--gtcgcccggtacggatcatccaaggtggtgtcca 556
            ||||||| | |||||||    |||  |||| ||  ||||| ||||||||||| |||   |
Sbjct: 1081 aaggagaaggccgagggcgtcgacttgtcggcc--tacgggtcatccaaggtagtgcaga 1138

                                                               
Query: 557  cacaggcaccggtgcagctgggctccctccgcgcggctgacggcaaggagt 607
            | ||||| ||||||||||| ||||||||||| || ||||| || |||||||
Sbjct: 1139 ctcaggcgccggtgcagcttggctccctccgtgctgctgatggaaaggagt 1189



to top

>ref|NM_122767.2| Arabidopsis thaliana GDP-mannose 3,5-epimerase/ catalytic AT5G28840
            mRNA, complete cds
          Length = 1611

 Score =  254 bits (128), Expect = 3e-64
 Identities = 407/500 (81%)
 Strand = Plus / Plus

                                                                        
Query: 6    gaagctcgcgaccgaggagctgtgcaagcactacaccaaggactttgacattgagtgccg 65
            |||||| || || |||||| |||| ||||| |||| ||| || ||||  |||||||| ||
Sbjct: 709  gaagcttgctacggaggagttgtgtaagcattacaacaaagattttggtattgagtgtcg 768

                                                                        
Query: 66   tattggccgttttcacaacatttatggtccctttggaacatggaaaggcggtcgcgagaa 125
             |||||  | || || |||||||||||||| ||||||||||||||||| ||  | |||||
Sbjct: 769  aattggaaggttccataacatttatggtccttttggaacatggaaaggtggaagggagaa 828

                                                                        
Query: 126  ggcaccagctgccttctgtagaaaggctcagacctccaccgaacggtttgagatgtgggg 185
            ||| |||||||| |||||||| ||||||||||| ||||| ||  ||||||||||||||||
Sbjct: 829  ggctccagctgctttctgtaggaaggctcagacttccactgataggtttgagatgtgggg 888

                                                                        
Query: 186  tgatggtctacagactcgatcgttcacttttatcgacgagtgcgtcgagggtgttctgag 245
             ||||| || ||||| || || || || |||||||| ||||| || || ||||| || ||
Sbjct: 889  agatgggcttcagacccgttcttttacctttatcgatgagtgtgttgaaggtgtactcag 948

                                                                        
Query: 246  attgacaaagtcagacttctgcgagcccgtgaacattggaagtgatgaaatggtgagcat 305
             |||||||| ||||| ||| | ||||| |||||||| ||||| ||||| |||||||||||
Sbjct: 949  gttgacaaaatcagatttccgtgagccggtgaacatcggaagcgatgagatggtgagcat 1008

                                                                        
Query: 306  gaacgagatggctgagattgttctcggcttcgaggacaagaagctacccatccaccacat 365
            ||| |||||||||||||| |||||| |||| ||||| |||||||| || || ||||||||
Sbjct: 1009 gaatgagatggctgagatggttctcagctttgaggaaaagaagcttccaattcaccacat 1068

                                                                        
Query: 366  ccctggtccagagggtgtccgcggccgcaactctgacaacaccctcatcaaggagaagct 425
             ||||| || || ||||| || || || ||||| |||||||  || ||||| || |||||
Sbjct: 1069 tcctggcccggaaggtgttcgtggtcgtaactcagacaacaatctgatcaaagaaaagct 1128

                                                                        
Query: 426  tggctgggcccccacaatgaagctcaaggatggcctaaggttcacctacttctggatcaa 485
            ||| ||||| || |  ||||   | ||||| || || ||  | |||||||||||||| ||
Sbjct: 1129 tggttgggctcctaatatgagattgaaggaggggcttagaataacctacttctggataaa 1188

                                
Query: 486  ggagcagatcgagaaggaga 505
            ||| ||||||||||| ||||
Sbjct: 1189 ggaacagatcgagaaagaga 1208



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                               
Query: 562  gcaccggtgcagctgggctccctccgcgcggctga 596
            |||||||| ||||| ||||| ||||||||||||||
Sbjct: 1265 gcaccggttcagctaggctcactccgcgcggctga 1299



to top

>gb|AY116953.1| Arabidopsis thaliana AT5g28840/F7P1_20 mRNA, complete cds
          Length = 1134

 Score =  254 bits (128), Expect = 3e-64
 Identities = 407/500 (81%)
 Strand = Plus / Plus

                                                                        
Query: 6    gaagctcgcgaccgaggagctgtgcaagcactacaccaaggactttgacattgagtgccg 65
            |||||| || || |||||| |||| ||||| |||| ||| || ||||  |||||||| ||
Sbjct: 531  gaagcttgctacggaggagttgtgtaagcattacaacaaagattttggtattgagtgtcg 590

                                                                        
Query: 66   tattggccgttttcacaacatttatggtccctttggaacatggaaaggcggtcgcgagaa 125
             |||||  | || || |||||||||||||| ||||||||||||||||| ||  | |||||
Sbjct: 591  aattggaaggttccataacatttatggtccttttggaacatggaaaggtggaagggagaa 650

                                                                        
Query: 126  ggcaccagctgccttctgtagaaaggctcagacctccaccgaacggtttgagatgtgggg 185
            ||| |||||||| |||||||| ||||||||||| ||||| ||  ||||||||||||||||
Sbjct: 651  ggctccagctgctttctgtaggaaggctcagacttccactgataggtttgagatgtgggg 710

                                                                        
Query: 186  tgatggtctacagactcgatcgttcacttttatcgacgagtgcgtcgagggtgttctgag 245
             ||||| || ||||| || || || || |||||||| ||||| || || ||||| || ||
Sbjct: 711  agatgggcttcagacccgttcttttacctttatcgatgagtgtgttgaaggtgtactcag 770

                                                                        
Query: 246  attgacaaagtcagacttctgcgagcccgtgaacattggaagtgatgaaatggtgagcat 305
             |||||||| ||||| ||| | ||||| |||||||| ||||| ||||| |||||||||||
Sbjct: 771  gttgacaaaatcagatttccgtgagccggtgaacatcggaagcgatgagatggtgagcat 830

                                                                        
Query: 306  gaacgagatggctgagattgttctcggcttcgaggacaagaagctacccatccaccacat 365
            ||| |||||||||||||| |||||| |||| ||||| |||||||| || || ||||||||
Sbjct: 831  gaatgagatggctgagatggttctcagctttgaggaaaagaagcttccaattcaccacat 890

                                                                        
Query: 366  ccctggtccagagggtgtccgcggccgcaactctgacaacaccctcatcaaggagaagct 425
             ||||| || || ||||| || || || ||||| |||||||  || ||||| || |||||
Sbjct: 891  tcctggcccggaaggtgttcgtggtcgtaactcagacaacaatctgatcaaagaaaagct 950

                                                                        
Query: 426  tggctgggcccccacaatgaagctcaaggatggcctaaggttcacctacttctggatcaa 485
            ||| ||||| || |  ||||   | ||||| || || ||  | |||||||||||||| ||
Sbjct: 951  tggttgggctcctaatatgagattgaaggaggggcttagaataacctacttctggataaa 1010

                                
Query: 486  ggagcagatcgagaaggaga 505
            ||| ||||||||||| ||||
Sbjct: 1011 ggaacagatcgagaaagaga 1030



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                               
Query: 562  gcaccggtgcagctgggctccctccgcgcggctga 596
            |||||||| ||||| ||||| ||||||||||||||
Sbjct: 1087 gcaccggttcagctaggctcactccgcgcggctga 1121



to top

>gb|AC016780.6| Genomic Sequence For Oryza sativa (japonica cultivar-group) cultivar
             Nipponbare Clone OSJNBa0061K21 From Chromosome 10,
             complete sequence
          Length = 112721

 Score =  254 bits (128), Expect = 3e-64
 Identities = 188/208 (90%)
 Strand = Plus / Plus

                                                                         
Query: 247   ttgacaaagtcagacttctgcgagcccgtgaacattggaagtgatgaaatggtgagcatg 306
             ||||||||||| |||||| | ||||| |||||||||||||| ||||||||||| ||||||
Sbjct: 67981 ttgacaaagtcggacttccgtgagccagtgaacattggaagcgatgaaatggtaagcatg 68040

                                                                         
Query: 307   aacgagatggctgagattgttctcggcttcgaggacaagaagctacccatccaccacatc 366
             |||||||||||||| ||  ||||| |||||||||| | | |||| |||||||||||||||
Sbjct: 68041 aacgagatggctgaaatcattctcagcttcgaggatagggagctgcccatccaccacatc 68100

                                                                         
Query: 367   cctggtccagagggtgtccgcggccgcaactctgacaacaccctcatcaaggagaagctt 426
             ||||| || ||||||||||| ||||| ||||| |||||||||||||||||||||||||||
Sbjct: 68101 cctggacccgagggtgtccgtggccgtaactccgacaacaccctcatcaaggagaagctt 68160

                                         
Query: 427   ggctgggcccccacaatgaagctcaagg 454
             |||||||| |||||||||||||||||||
Sbjct: 68161 ggctgggcacccacaatgaagctcaagg 68188



 Score =  141 bits (71), Expect = 3e-30
 Identities = 128/147 (87%)
 Strand = Plus / Plus

                                                                         
Query: 463   aggttcacctacttctggatcaaggagcagatcgagaaggagaggaccgaggggaaggac 522
             |||||||||||||||||||||||||||||||| |||||||||| |||| ||||    |||
Sbjct: 68330 aggttcacctacttctggatcaaggagcagatagagaaggagaagacccagggcgtcgac 68389

                                                                         
Query: 523   gtcgcccggtacggatcatccaaggtggtgtccacacaggcaccggtgcagctgggctcc 582
              ||||  | ||||| |||||||||||||||||||| ||||| ||||| ||||||||||||
Sbjct: 68390 atcgcgggttacggctcatccaaggtggtgtccacccaggccccggttcagctgggctcc 68449

                                        
Query: 583   ctccgcgcggctgacggcaaggagtaa 609
             ||||| || || || ||||||||||||
Sbjct: 68450 ctccgtgctgccgatggcaaggagtaa 68476



 Score =  135 bits (68), Expect = 2e-28
 Identities = 98/108 (90%)
 Strand = Plus / Plus

                                                                         
Query: 6     gaagctcgcgaccgaggagctgtgcaagcactacaccaaggactttgacattgagtgccg 65
             |||||| || || |||||||| ||||||||||||||||||||||||| ||||||||||||
Sbjct: 67565 gaagcttgcaactgaggagctctgcaagcactacaccaaggactttggcattgagtgccg 67624

                                                             
Query: 66    tattggccgttttcacaacatttatggtccctttggaacatggaaagg 113
             | ||||||| || |||||||| ||||| ||||||||||||||||||||
Sbjct: 67625 tgttggccgcttccacaacatatatggcccctttggaacatggaaagg 67672



 Score =  105 bits (53), Expect = 2e-19
 Identities = 107/125 (85%)
 Strand = Plus / Plus

                                                                         
Query: 121   gagaaggcaccagctgccttctgtagaaaggctcagacctccaccgaacggtttgagatg 180
             ||||||||||||||||| ||||| || ||||||||||| ||||| ||  |||||||||||
Sbjct: 67759 gagaaggcaccagctgcattctgcaggaaggctcagacttccactgacaggtttgagatg 67818

                                                                         
Query: 181   tggggtgatggtctacagactcgatcgttcacttttatcgacgagtgcgtcgagggtgtt 240
             ||||||||||| || ||||| || || ||||| || || || ||||| || |||||||||
Sbjct: 67819 tggggtgatggcctccagacccggtccttcacattcatagatgagtgtgttgagggtgtt 67878

                  
Query: 241   ctgag 245
             |||||
Sbjct: 67879 ctgag 67883



to top

>gb|AY057694.1| Arabidopsis thaliana AT5g28840/F7P1_20 mRNA, complete cds
          Length = 1404

 Score =  254 bits (128), Expect = 3e-64
 Identities = 407/500 (81%)
 Strand = Plus / Plus

                                                                        
Query: 6    gaagctcgcgaccgaggagctgtgcaagcactacaccaaggactttgacattgagtgccg 65
            |||||| || || |||||| |||| ||||| |||| ||| || ||||  |||||||| ||
Sbjct: 594  gaagcttgctacggaggagttgtgtaagcattacaacaaagattttggtattgagtgtcg 653

                                                                        
Query: 66   tattggccgttttcacaacatttatggtccctttggaacatggaaaggcggtcgcgagaa 125
             |||||  | || || |||||||||||||| ||||||||||||||||| ||  | |||||
Sbjct: 654  aattggaaggttccataacatttatggtccttttggaacatggaaaggtggaagggagaa 713

                                                                        
Query: 126  ggcaccagctgccttctgtagaaaggctcagacctccaccgaacggtttgagatgtgggg 185
            ||| |||||||| |||||||| ||||||||||| ||||| ||  ||||||||||||||||
Sbjct: 714  ggctccagctgctttctgtaggaaggctcagacttccactgataggtttgagatgtgggg 773

                                                                        
Query: 186  tgatggtctacagactcgatcgttcacttttatcgacgagtgcgtcgagggtgttctgag 245
             ||||| || ||||| || || || || |||||||| ||||| || || ||||| || ||
Sbjct: 774  agatgggcttcagacccgttcttttacctttatcgatgagtgtgttgaaggtgtactcag 833

                                                                        
Query: 246  attgacaaagtcagacttctgcgagcccgtgaacattggaagtgatgaaatggtgagcat 305
             |||||||| ||||| ||| | ||||| |||||||| ||||| ||||| |||||||||||
Sbjct: 834  gttgacaaaatcagatttccgtgagccggtgaacatcggaagcgatgagatggtgagcat 893

                                                                        
Query: 306  gaacgagatggctgagattgttctcggcttcgaggacaagaagctacccatccaccacat 365
            ||| |||||||||||||| |||||| |||| ||||| |||||||| || || ||||||||
Sbjct: 894  gaatgagatggctgagatggttctcagctttgaggaaaagaagcttccaattcaccacat 953

                                                                        
Query: 366  ccctggtccagagggtgtccgcggccgcaactctgacaacaccctcatcaaggagaagct 425
             ||||| || || ||||| || || || ||||| |||||||  || ||||| || |||||
Sbjct: 954  tcctggcccggaaggtgttcgtggtcgtaactcagacaacaatctgatcaaagaaaagct 1013

                                                                        
Query: 426  tggctgggcccccacaatgaagctcaaggatggcctaaggttcacctacttctggatcaa 485
            ||| ||||| || |  ||||   | ||||| || || ||  | |||||||||||||| ||
Sbjct: 1014 tggttgggctcctaatatgagattgaaggaggggcttagaataacctacttctggataaa 1073

                                
Query: 486  ggagcagatcgagaaggaga 505
            ||| ||||||||||| ||||
Sbjct: 1074 ggaacagatcgagaaagaga 1093



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                               
Query: 562  gcaccggtgcagctgggctccctccgcgcggctga 596
            |||||||| ||||| ||||| ||||||||||||||
Sbjct: 1150 gcaccggttcagctaggctcactccgcgcggctga 1184



to top

>gb|AY057660.1| Arabidopsis thaliana AT5g28840/F7P1_20 mRNA, complete cds
          Length = 1452

 Score =  254 bits (128), Expect = 3e-64
 Identities = 407/500 (81%)
 Strand = Plus / Plus

                                                                        
Query: 6    gaagctcgcgaccgaggagctgtgcaagcactacaccaaggactttgacattgagtgccg 65
            |||||| || || |||||| |||| ||||| |||| ||| || ||||  |||||||| ||
Sbjct: 594  gaagcttgctacggaggagttgtgtaagcattacaacaaagattttggtattgagtgtcg 653

                                                                        
Query: 66   tattggccgttttcacaacatttatggtccctttggaacatggaaaggcggtcgcgagaa 125
             |||||  | || || |||||||||||||| ||||||||||||||||| ||  | |||||
Sbjct: 654  aattggaaggttccataacatttatggtccttttggaacatggaaaggtggaagggagaa 713

                                                                        
Query: 126  ggcaccagctgccttctgtagaaaggctcagacctccaccgaacggtttgagatgtgggg 185
            ||| |||||||| |||||||| ||||||||||| ||||| ||  ||||||||||||||||
Sbjct: 714  ggctccagctgctttctgtaggaaggctcagacttccactgataggtttgagatgtgggg 773

                                                                        
Query: 186  tgatggtctacagactcgatcgttcacttttatcgacgagtgcgtcgagggtgttctgag 245
             ||||| || ||||| || || || || |||||||| ||||| || || ||||| || ||
Sbjct: 774  agatgggcttcagacccgttcttttacctttatcgatgagtgtgttgaaggtgtactcag 833

                                                                        
Query: 246  attgacaaagtcagacttctgcgagcccgtgaacattggaagtgatgaaatggtgagcat 305
             |||||||| ||||| ||| | ||||| |||||||| ||||| ||||| |||||||||||
Sbjct: 834  gttgacaaaatcagatttccgtgagccggtgaacatcggaagcgatgagatggtgagcat 893

                                                                        
Query: 306  gaacgagatggctgagattgttctcggcttcgaggacaagaagctacccatccaccacat 365
            ||| |||||||||||||| |||||| |||| ||||| |||||||| || || ||||||||
Sbjct: 894  gaatgagatggctgagatggttctcagctttgaggaaaagaagcttccaattcaccacat 953

                                                                        
Query: 366  ccctggtccagagggtgtccgcggccgcaactctgacaacaccctcatcaaggagaagct 425
             ||||| || || ||||| || || || ||||| |||||||  || ||||| || |||||
Sbjct: 954  tcctggcccggaaggtgttcgtggtcgtaactcagacaacaatctgatcaaagaaaagct 1013

                                                                        
Query: 426  tggctgggcccccacaatgaagctcaaggatggcctaaggttcacctacttctggatcaa 485
            ||| ||||| || |  ||||   | ||||| || || ||  | |||||||||||||| ||
Sbjct: 1014 tggttgggctcctaatatgagattgaaggaggggcttagaataacctacttctggataaa 1073

                                
Query: 486  ggagcagatcgagaaggaga 505
            ||| ||||||||||| ||||
Sbjct: 1074 ggaacagatcgagaaagaga 1093



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                               
Query: 562  gcaccggtgcagctgggctccctccgcgcggctga 596
            |||||||| ||||| ||||| ||||||||||||||
Sbjct: 1150 gcaccggttcagctaggctcactccgcgcggctga 1184



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score =  254 bits (128), Expect = 3e-64
 Identities = 188/208 (90%)
 Strand = Plus / Plus

                                                                            
Query: 247      ttgacaaagtcagacttctgcgagcccgtgaacattggaagtgatgaaatggtgagcatg 306
                ||||||||||| |||||| | ||||| |||||||||||||| ||||||||||| ||||||
Sbjct: 14128343 ttgacaaagtcggacttccgtgagccagtgaacattggaagcgatgaaatggtaagcatg 14128402

                                                                            
Query: 307      aacgagatggctgagattgttctcggcttcgaggacaagaagctacccatccaccacatc 366
                |||||||||||||| ||  ||||| |||||||||| | | |||| |||||||||||||||
Sbjct: 14128403 aacgagatggctgaaatcattctcagcttcgaggatagggagctgcccatccaccacatc 14128462

                                                                            
Query: 367      cctggtccagagggtgtccgcggccgcaactctgacaacaccctcatcaaggagaagctt 426
                ||||| || ||||||||||| ||||| ||||| |||||||||||||||||||||||||||
Sbjct: 14128463 cctggacccgagggtgtccgtggccgtaactccgacaacaccctcatcaaggagaagctt 14128522

                                            
Query: 427      ggctgggcccccacaatgaagctcaagg 454
                |||||||| |||||||||||||||||||
Sbjct: 14128523 ggctgggcacccacaatgaagctcaagg 14128550



 Score =  141 bits (71), Expect = 3e-30
 Identities = 128/147 (87%)
 Strand = Plus / Plus

                                                                            
Query: 463      aggttcacctacttctggatcaaggagcagatcgagaaggagaggaccgaggggaaggac 522
                |||||||||||||||||||||||||||||||| |||||||||| |||| ||||    |||
Sbjct: 14128692 aggttcacctacttctggatcaaggagcagatagagaaggagaagacccagggcgtcgac 14128751

                                                                            
Query: 523      gtcgcccggtacggatcatccaaggtggtgtccacacaggcaccggtgcagctgggctcc 582
                 ||||  | ||||| |||||||||||||||||||| ||||| ||||| ||||||||||||
Sbjct: 14128752 atcgcgggttacggctcatccaaggtggtgtccacccaggccccggttcagctgggctcc 14128811

                                           
Query: 583      ctccgcgcggctgacggcaaggagtaa 609
                ||||| || || || ||||||||||||
Sbjct: 14128812 ctccgtgctgccgatggcaaggagtaa 14128838



 Score =  135 bits (68), Expect = 2e-28
 Identities = 98/108 (90%)
 Strand = Plus / Plus

                                                                            
Query: 6        gaagctcgcgaccgaggagctgtgcaagcactacaccaaggactttgacattgagtgccg 65
                |||||| || || |||||||| ||||||||||||||||||||||||| ||||||||||||
Sbjct: 14127927 gaagcttgcaactgaggagctctgcaagcactacaccaaggactttggcattgagtgccg 14127986

                                                                
Query: 66       tattggccgttttcacaacatttatggtccctttggaacatggaaagg 113
                | ||||||| || |||||||| ||||| ||||||||||||||||||||
Sbjct: 14127987 tgttggccgcttccacaacatatatggcccctttggaacatggaaagg 14128034



 Score =  105 bits (53), Expect = 2e-19
 Identities = 107/125 (85%)
 Strand = Plus / Plus

                                                                            
Query: 121      gagaaggcaccagctgccttctgtagaaaggctcagacctccaccgaacggtttgagatg 180
                ||||||||||||||||| ||||| || ||||||||||| ||||| ||  |||||||||||
Sbjct: 14128121 gagaaggcaccagctgcattctgcaggaaggctcagacttccactgacaggtttgagatg 14128180

                                                                            
Query: 181      tggggtgatggtctacagactcgatcgttcacttttatcgacgagtgcgtcgagggtgtt 240
                ||||||||||| || ||||| || || ||||| || || || ||||| || |||||||||
Sbjct: 14128181 tggggtgatggcctccagacccggtccttcacattcatagatgagtgtgttgagggtgtt 14128240

                     
Query: 241      ctgag 245
                |||||
Sbjct: 14128241 ctgag 14128245



to top

>gb|AC027658.1| Oryza sativa (japonica cultivar-group) BAC nbxb0006I13 chromosome
           10, complete sequence
          Length = 142737

 Score =  254 bits (128), Expect = 3e-64
 Identities = 188/208 (90%)
 Strand = Plus / Plus

                                                                       
Query: 247 ttgacaaagtcagacttctgcgagcccgtgaacattggaagtgatgaaatggtgagcatg 306
           ||||||||||| |||||| | ||||| |||||||||||||| ||||||||||| ||||||
Sbjct: 416 ttgacaaagtcggacttccgtgagccagtgaacattggaagcgatgaaatggtaagcatg 475

                                                                       
Query: 307 aacgagatggctgagattgttctcggcttcgaggacaagaagctacccatccaccacatc 366
           |||||||||||||| ||  ||||| |||||||||| | | |||| |||||||||||||||
Sbjct: 476 aacgagatggctgaaatcattctcagcttcgaggatagggagctgcccatccaccacatc 535

                                                                       
Query: 367 cctggtccagagggtgtccgcggccgcaactctgacaacaccctcatcaaggagaagctt 426
           ||||| || ||||||||||| ||||| ||||| |||||||||||||||||||||||||||
Sbjct: 536 cctggacccgagggtgtccgtggccgtaactccgacaacaccctcatcaaggagaagctt 595

                                       
Query: 427 ggctgggcccccacaatgaagctcaagg 454
           |||||||| |||||||||||||||||||
Sbjct: 596 ggctgggcacccacaatgaagctcaagg 623



 Score =  141 bits (71), Expect = 3e-30
 Identities = 128/147 (87%)
 Strand = Plus / Plus

                                                                       
Query: 463 aggttcacctacttctggatcaaggagcagatcgagaaggagaggaccgaggggaaggac 522
           |||||||||||||||||||||||||||||||| |||||||||| |||| ||||    |||
Sbjct: 765 aggttcacctacttctggatcaaggagcagatagagaaggagaagacccagggcgtcgac 824

                                                                       
Query: 523 gtcgcccggtacggatcatccaaggtggtgtccacacaggcaccggtgcagctgggctcc 582
            ||||  | ||||| |||||||||||||||||||| ||||| ||||| ||||||||||||
Sbjct: 825 atcgcgggttacggctcatccaaggtggtgtccacccaggccccggttcagctgggctcc 884

                                      
Query: 583 ctccgcgcggctgacggcaaggagtaa 609
           ||||| || || || ||||||||||||
Sbjct: 885 ctccgtgctgccgatggcaaggagtaa 911



 Score =  133 bits (67), Expect = 8e-28
 Identities = 88/95 (92%)
 Strand = Plus / Plus

                                                                       
Query: 19  gaggagctgtgcaagcactacaccaaggactttgacattgagtgccgtattggccgtttt 78
           |||||||| ||||||||||||||||||||||||| ||||||||||||| ||||||| || 
Sbjct: 13  gaggagctctgcaagcactacaccaaggactttggcattgagtgccgtgttggccgcttc 72

                                              
Query: 79  cacaacatttatggtccctttggaacatggaaagg 113
           |||||||| ||||| ||||||||||||||||||||
Sbjct: 73  cacaacatatatggcccctttggaacatggaaagg 107



 Score =  105 bits (53), Expect = 2e-19
 Identities = 107/125 (85%)
 Strand = Plus / Plus

                                                                       
Query: 121 gagaaggcaccagctgccttctgtagaaaggctcagacctccaccgaacggtttgagatg 180
           ||||||||||||||||| ||||| || ||||||||||| ||||| ||  |||||||||||
Sbjct: 194 gagaaggcaccagctgcattctgcaggaaggctcagacttccactgacaggtttgagatg 253

                                                                       
Query: 181 tggggtgatggtctacagactcgatcgttcacttttatcgacgagtgcgtcgagggtgtt 240
           ||||||||||| || ||||| || || ||||| || || || ||||| || |||||||||
Sbjct: 254 tggggtgatggcctccagacccggtccttcacattcatagatgagtgtgttgagggtgtt 313

                
Query: 241 ctgag 245
           |||||
Sbjct: 314 ctgag 318



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score =  254 bits (128), Expect = 3e-64
 Identities = 188/208 (90%)
 Strand = Plus / Plus

                                                                            
Query: 247      ttgacaaagtcagacttctgcgagcccgtgaacattggaagtgatgaaatggtgagcatg 306
                ||||||||||| |||||| | ||||| |||||||||||||| ||||||||||| ||||||
Sbjct: 14136585 ttgacaaagtcggacttccgtgagccagtgaacattggaagcgatgaaatggtaagcatg 14136644

                                                                            
Query: 307      aacgagatggctgagattgttctcggcttcgaggacaagaagctacccatccaccacatc 366
                |||||||||||||| ||  ||||| |||||||||| | | |||| |||||||||||||||
Sbjct: 14136645 aacgagatggctgaaatcattctcagcttcgaggatagggagctgcccatccaccacatc 14136704

                                                                            
Query: 367      cctggtccagagggtgtccgcggccgcaactctgacaacaccctcatcaaggagaagctt 426
                ||||| || ||||||||||| ||||| ||||| |||||||||||||||||||||||||||
Sbjct: 14136705 cctggacccgagggtgtccgtggccgtaactccgacaacaccctcatcaaggagaagctt 14136764

                                            
Query: 427      ggctgggcccccacaatgaagctcaagg 454
                |||||||| |||||||||||||||||||
Sbjct: 14136765 ggctgggcacccacaatgaagctcaagg 14136792



 Score =  141 bits (71), Expect = 3e-30
 Identities = 128/147 (87%)
 Strand = Plus / Plus

                                                                            
Query: 463      aggttcacctacttctggatcaaggagcagatcgagaaggagaggaccgaggggaaggac 522
                |||||||||||||||||||||||||||||||| |||||||||| |||| ||||    |||
Sbjct: 14136934 aggttcacctacttctggatcaaggagcagatagagaaggagaagacccagggcgtcgac 14136993

                                                                            
Query: 523      gtcgcccggtacggatcatccaaggtggtgtccacacaggcaccggtgcagctgggctcc 582
                 ||||  | ||||| |||||||||||||||||||| ||||| ||||| ||||||||||||
Sbjct: 14136994 atcgcgggttacggctcatccaaggtggtgtccacccaggccccggttcagctgggctcc 14137053

                                           
Query: 583      ctccgcgcggctgacggcaaggagtaa 609
                ||||| || || || ||||||||||||
Sbjct: 14137054 ctccgtgctgccgatggcaaggagtaa 14137080



 Score =  135 bits (68), Expect = 2e-28
 Identities = 98/108 (90%)
 Strand = Plus / Plus

                                                                            
Query: 6        gaagctcgcgaccgaggagctgtgcaagcactacaccaaggactttgacattgagtgccg 65
                |||||| || || |||||||| ||||||||||||||||||||||||| ||||||||||||
Sbjct: 14136169 gaagcttgcaactgaggagctctgcaagcactacaccaaggactttggcattgagtgccg 14136228

                                                                
Query: 66       tattggccgttttcacaacatttatggtccctttggaacatggaaagg 113
                | ||||||| || |||||||| ||||| ||||||||||||||||||||
Sbjct: 14136229 tgttggccgcttccacaacatatatggcccctttggaacatggaaagg 14136276



 Score =  105 bits (53), Expect = 2e-19
 Identities = 107/125 (85%)
 Strand = Plus / Plus

                                                                            
Query: 121      gagaaggcaccagctgccttctgtagaaaggctcagacctccaccgaacggtttgagatg 180
                ||||||||||||||||| ||||| || ||||||||||| ||||| ||  |||||||||||
Sbjct: 14136363 gagaaggcaccagctgcattctgcaggaaggctcagacttccactgacaggtttgagatg 14136422

                                                                            
Query: 181      tggggtgatggtctacagactcgatcgttcacttttatcgacgagtgcgtcgagggtgtt 240
                ||||||||||| || ||||| || || ||||| || || || ||||| || |||||||||
Sbjct: 14136423 tggggtgatggcctccagacccggtccttcacattcatagatgagtgtgttgagggtgtt 14136482

                     
Query: 241      ctgag 245
                |||||
Sbjct: 14136483 ctgag 14136487



to top

>gb|BT013590.1| Lycopersicon esculentum clone 132353F, mRNA sequence
          Length = 1880

 Score =  230 bits (116), Expect = 5e-57
 Identities = 341/416 (81%)
 Strand = Plus / Plus

                                                                        
Query: 19   gaggagctgtgcaagcactacaccaaggactttgacattgagtgccgtattggccgtttt 78
            |||||| |||| |||||||||| |||||||||||  ||||| || || ||||||||||| 
Sbjct: 730  gaggagttgtgtaagcactacaacaaggactttggaattgaatgtcgcattggccgtttc 789

                                                                        
Query: 79   cacaacatttatggtccctttggaacatggaaaggcggtcgcgagaaggcaccagctgcc 138
            || ||||||||||| || |||||||||||||||||||| || ||||| |||||||| || 
Sbjct: 790  cataacatttatggcccatttggaacatggaaaggcggacgtgagaaagcaccagcagct 849

                                                                        
Query: 139  ttctgtagaaaggctcagacctccaccgaacggtttgagatgtggggtgatggtctacag 198
            || |||||||| || |  || ||||| ||    || ||||||||||| |||||    || 
Sbjct: 850  ttttgtagaaaagccctcacttccactgacaaattcgagatgtggggagatggaaagcaa 909

                                                                        
Query: 199  actcgatcgttcacttttatcgacgagtgcgtcgagggtgttctgagattgacaaagtca 258
            |||||||| ||||| || || || ||||| || || ||||| ||||| || ||||| || 
Sbjct: 910  actcgatctttcaccttcattgatgagtgtgttgaaggtgtcctgaggttaacaaaatcc 969

                                                                        
Query: 259  gacttctgcgagcccgtgaacattggaagtgatgaaatggtgagcatgaacgagatggct 318
            |||||| | ||||| |||||||| ||||||||||| ||||| |||||||| |||||||| 
Sbjct: 970  gacttcagagagcctgtgaacatcggaagtgatgagatggtaagcatgaatgagatggca 1029

                                                                        
Query: 319  gagattgttctcggcttcgaggacaagaagctacccatccaccacatccctggtccagag 378
            ||||| || ||| |||| || | |||||| || || ||||| ||||| || || ||||||
Sbjct: 1030 gagatagtcctcagctttgatggcaagaaccttccgatccatcacattccaggaccagag 1089

                                                                    
Query: 379  ggtgtccgcggccgcaactctgacaacaccctcatcaaggagaagcttggctgggc 434
            ||||| || || || |||||||||||||| ||||||||||| ||||||||||||||
Sbjct: 1090 ggtgtgcgtggtcgaaactctgacaacactctcatcaaggaaaagcttggctgggc 1145



to top

>gb|AF229187.1|AF229187 Oryza sativa subsp. japonica BAC clone nbxb0032I20, complete sequence
          Length = 144651

 Score =  206 bits (104), Expect = 7e-50
 Identities = 161/180 (89%)
 Strand = Plus / Plus

                                                                          
Query: 247    ttgacaaagtcagacttctgcgagcccgtgaacattggaagtgatgaaatggtgagcatg 306
              ||||||||||| |||||| | ||||| |||||||||||||| ||||||||||| ||||||
Sbjct: 144472 ttgacaaagtcggacttccgtgagccagtgaacattggaagcgatgaaatggtaagcatg 144531

                                                                          
Query: 307    aacgagatggctgagattgttctcggcttcgaggacaagaagctacccatccaccacatc 366
              |||||||||||||| ||  ||||| |||||||||| | | |||| |||||||||||||||
Sbjct: 144532 aacgagatggctgaaatcattctcagcttcgaggatagggagctgcccatccaccacatc 144591

                                                                          
Query: 367    cctggtccagagggtgtccgcggccgcaactctgacaacaccctcatcaaggagaagctt 426
              ||||| || ||||||||||| ||||| ||||| |||||||||||||||||||||||||||
Sbjct: 144592 cctggacccgagggtgtccgtggccgtaactccgacaacaccctcatcaaggagaagctt 144651



 Score =  135 bits (68), Expect = 2e-28
 Identities = 98/108 (90%)
 Strand = Plus / Plus

                                                                          
Query: 6      gaagctcgcgaccgaggagctgtgcaagcactacaccaaggactttgacattgagtgccg 65
              |||||| || || |||||||| ||||||||||||||||||||||||| ||||||||||||
Sbjct: 144056 gaagcttgcaactgaggagctctgcaagcactacaccaaggactttggcattgagtgccg 144115

                                                              
Query: 66     tattggccgttttcacaacatttatggtccctttggaacatggaaagg 113
              | ||||||| || |||||||| ||||| ||||||||||||||||||||
Sbjct: 144116 tgttggccgcttccacaacatatatggcccctttggaacatggaaagg 144163



 Score =  105 bits (53), Expect = 2e-19
 Identities = 107/125 (85%)
 Strand = Plus / Plus

                                                                          
Query: 121    gagaaggcaccagctgccttctgtagaaaggctcagacctccaccgaacggtttgagatg 180
              ||||||||||||||||| ||||| || ||||||||||| ||||| ||  |||||||||||
Sbjct: 144250 gagaaggcaccagctgcattctgcaggaaggctcagacttccactgacaggtttgagatg 144309

                                                                          
Query: 181    tggggtgatggtctacagactcgatcgttcacttttatcgacgagtgcgtcgagggtgtt 240
              ||||||||||| || ||||| || || ||||| || || || ||||| || |||||||||
Sbjct: 144310 tggggtgatggcctccagacccggtccttcacattcatagatgagtgtgttgagggtgtt 144369

                   
Query: 241    ctgag 245
              |||||
Sbjct: 144370 ctgag 144374



to top

>gb|AY106775.1| Zea mays PCO117540 mRNA sequence
          Length = 541

 Score =  206 bits (104), Expect = 7e-50
 Identities = 263/316 (83%)
 Strand = Plus / Plus

                                                                       
Query: 292 gaaatggtgagcatgaacgagatggctgagattgttctcggcttcgaggacaagaagcta 351
           |||||||||||||||||||||||||| || || || ||  |||| ||| ||||| |||| 
Sbjct: 2   gaaatggtgagcatgaacgagatggcggaaatggtcctgagctttgagaacaagcagctg 61

                                                                       
Query: 352 cccatccaccacatccctggtccagagggtgtccgcggccgcaactctgacaacaccctc 411
           ||||||||||||||||| || || ||||| || || || |||||||| |||||||| |||
Sbjct: 62  cccatccaccacatccccgggccggagggcgtgcgtgggcgcaactcagacaacacgctc 121

                                                                       
Query: 412 atcaaggagaagcttggctgggcccccacaatgaagctcaaggatggcctaaggttcacc 471
           ||||||||||||||||||||||| || || |||| ||| ||||| || || ||| |||| 
Sbjct: 122 atcaaggagaagcttggctgggctccgactatgaggctgaaggacgggctgaggatcacg 181

                                                                       
Query: 472 tacttctggatcaaggagcagatcgagaaggagaggaccgaggggaaggacgtcgcccgg 531
           |||| |||||||||||||||| | |||||||||| | ||||||| | |||  |  |    
Sbjct: 182 tactcctggatcaaggagcagcttgagaaggagaaggccgagggcatggatctgtcggtc 241

                                                                       
Query: 532 tacggatcatccaaggtggtgtccacacaggcaccggtgcagctgggctccctccgcgcg 591
           ||||||||||||||||| |||   |||||||| ||||| ||||| |||||||||||||| 
Sbjct: 242 tacggatcatccaaggtcgtgcagacacaggccccggttcagctcggctccctccgcgcc 301

                           
Query: 592 gctgacggcaaggagt 607
           ||||| ||||||||||
Sbjct: 302 gctgatggcaaggagt 317



to top

>gb|AC146334.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone B1356F10,
              complete sequence
          Length = 170681

 Score =  198 bits (100), Expect = 2e-47
 Identities = 166/188 (88%)
 Strand = Plus / Minus

                                                                          
Query: 247    ttgacaaagtcagacttctgcgagcccgtgaacattggaagtgatgaaatggtgagcatg 306
              ||||||||||| || ||| | ||||| || ||||||||||||||||||||||| ||||||
Sbjct: 130224 ttgacaaagtccgatttccgtgagcctgtaaacattggaagtgatgaaatggtcagcatg 130165

                                                                          
Query: 307    aacgagatggctgagattgttctcggcttcgaggacaagaagctacccatccaccacatc 366
              || |||||||||||||| || ||| |||| ||| ||||| |||| |||||||||||||||
Sbjct: 130164 aatgagatggctgagatagtcctcagctttgagaacaagcagctgcccatccaccacatc 130105

                                                                          
Query: 367    cctggtccagagggtgtccgcggccgcaactctgacaacaccctcatcaaggagaagctt 426
              || || |||||||||||||| || |||||||| |||||||| |||||||| |||||||||
Sbjct: 130104 cccgggccagagggtgtccgtggtcgcaactccgacaacacgctcatcaaagagaagctt 130045

                      
Query: 427    ggctgggc 434
              ||||||||
Sbjct: 130044 ggctgggc 130037



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 79/92 (85%)
 Strand = Plus / Minus

                                                                          
Query: 19     gaggagctgtgcaagcactacaccaaggactttgacattgagtgccgtattggccgtttt 78
              ||||| ||||||||||| ||||| ||||| |||| |||||| || ||  ||||||| |||
Sbjct: 131387 gaggaactgtgcaagcattacacaaaggattttggcattgaatgtcgggttggccgcttt 131328

                                              
Query: 79     cacaacatttatggtccctttggaacatggaa 110
              || || || |||||||||||||||||||||||
Sbjct: 131327 cataatatctatggtccctttggaacatggaa 131296



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 130/158 (82%), Gaps = 4/158 (2%)
 Strand = Plus / Minus

                                                                          
Query: 452    aggatggcctaaggttcacctacttctggatcaaggagcagatcgagaaggagaggaccg 511
              ||||||| || ||| |||| ||||||||||||||||||||| |||||||||||| | |||
Sbjct: 129916 aggatggtctgaggatcacatacttctggatcaaggagcagctcgagaaggagaaggccg 129857

                                                                          
Query: 512    aggggaaggac--gtcgcccggtacggatcatccaaggtggtgtccacacaggcaccggt 569
              ||||    |||  |||| ||  ||||| ||||||||||| |||   || ||||| |||||
Sbjct: 129856 agggcgtcgacttgtcggcc--tacgggtcatccaaggtagtgcagactcaggcgccggt 129799

                                                    
Query: 570    gcagctgggctccctccgcgcggctgacggcaaggagt 607
              |||||| ||||||||||| || ||||| || |||||||
Sbjct: 129798 gcagcttggctccctccgtgctgctgatggaaaggagt 129761



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 99/119 (83%)
 Strand = Plus / Minus

                                                                          
Query: 121    gagaaggcaccagctgccttctgtagaaaggctcagacctccaccgaacggtttgagatg 180
              |||||||| || ||||| ||||| ||||| ||||  |||||||| || || |||||||||
Sbjct: 131208 gagaaggcgcctgctgctttctgcagaaaagctctaacctccactgaccgttttgagatg 131149

                                                                         
Query: 181    tggggtgatggtctacagactcgatcgttcacttttatcgacgagtgcgtcgagggtgt 239
              ||||| |||||||| |||||| |||| ||||| ||||| || || || || ||||||||
Sbjct: 131148 tggggagatggtcttcagactagatccttcacgtttattgatgaatgtgtggagggtgt 131090



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score =  198 bits (100), Expect = 2e-47
 Identities = 166/188 (88%)
 Strand = Plus / Minus

                                                                            
Query: 247      ttgacaaagtcagacttctgcgagcccgtgaacattggaagtgatgaaatggtgagcatg 306
                ||||||||||| || ||| | ||||| || ||||||||||||||||||||||| ||||||
Sbjct: 21606705 ttgacaaagtccgatttccgtgagcctgtaaacattggaagtgatgaaatggtcagcatg 21606646

                                                                            
Query: 307      aacgagatggctgagattgttctcggcttcgaggacaagaagctacccatccaccacatc 366
                || |||||||||||||| || ||| |||| ||| ||||| |||| |||||||||||||||
Sbjct: 21606645 aatgagatggctgagatagtcctcagctttgagaacaagcagctgcccatccaccacatc 21606586

                                                                            
Query: 367      cctggtccagagggtgtccgcggccgcaactctgacaacaccctcatcaaggagaagctt 426
                || || |||||||||||||| || |||||||| |||||||| |||||||| |||||||||
Sbjct: 21606585 cccgggccagagggtgtccgtggtcgcaactccgacaacacgctcatcaaagagaagctt 21606526

                        
Query: 427      ggctgggc 434
                ||||||||
Sbjct: 21606525 ggctgggc 21606518



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 79/92 (85%)
 Strand = Plus / Minus

                                                                            
Query: 19       gaggagctgtgcaagcactacaccaaggactttgacattgagtgccgtattggccgtttt 78
                ||||| ||||||||||| ||||| ||||| |||| |||||| || ||  ||||||| |||
Sbjct: 21607868 gaggaactgtgcaagcattacacaaaggattttggcattgaatgtcgggttggccgcttt 21607809

                                                
Query: 79       cacaacatttatggtccctttggaacatggaa 110
                || || || |||||||||||||||||||||||
Sbjct: 21607808 cataatatctatggtccctttggaacatggaa 21607777



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 130/158 (82%), Gaps = 4/158 (2%)
 Strand = Plus / Minus

                                                                            
Query: 452      aggatggcctaaggttcacctacttctggatcaaggagcagatcgagaaggagaggaccg 511
                ||||||| || ||| |||| ||||||||||||||||||||| |||||||||||| | |||
Sbjct: 21606397 aggatggtctgaggatcacatacttctggatcaaggagcagctcgagaaggagaaggccg 21606338

                                                                            
Query: 512      aggggaaggac--gtcgcccggtacggatcatccaaggtggtgtccacacaggcaccggt 569
                ||||    |||  |||| ||  ||||| ||||||||||| |||   || ||||| |||||
Sbjct: 21606337 agggcgtcgacttgtcggcc--tacgggtcatccaaggtagtgcagactcaggcgccggt 21606280

                                                      
Query: 570      gcagctgggctccctccgcgcggctgacggcaaggagt 607
                |||||| ||||||||||| || ||||| || |||||||
Sbjct: 21606279 gcagcttggctccctccgtgctgctgatggaaaggagt 21606242



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 99/119 (83%)
 Strand = Plus / Minus

                                                                            
Query: 121      gagaaggcaccagctgccttctgtagaaaggctcagacctccaccgaacggtttgagatg 180
                |||||||| || ||||| ||||| ||||| ||||  |||||||| || || |||||||||
Sbjct: 21607689 gagaaggcgcctgctgctttctgcagaaaagctctaacctccactgaccgttttgagatg 21607630

                                                                           
Query: 181      tggggtgatggtctacagactcgatcgttcacttttatcgacgagtgcgtcgagggtgt 239
                ||||| |||||||| |||||| |||| ||||| ||||| || || || || ||||||||
Sbjct: 21607629 tggggagatggtcttcagactagatccttcacgtttattgatgaatgtgtggagggtgt 21607571



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  198 bits (100), Expect = 2e-47
 Identities = 166/188 (88%)
 Strand = Plus / Minus

                                                                            
Query: 247      ttgacaaagtcagacttctgcgagcccgtgaacattggaagtgatgaaatggtgagcatg 306
                ||||||||||| || ||| | ||||| || ||||||||||||||||||||||| ||||||
Sbjct: 21916904 ttgacaaagtccgatttccgtgagcctgtaaacattggaagtgatgaaatggtcagcatg 21916845

                                                                            
Query: 307      aacgagatggctgagattgttctcggcttcgaggacaagaagctacccatccaccacatc 366
                || |||||||||||||| || ||| |||| ||| ||||| |||| |||||||||||||||
Sbjct: 21916844 aatgagatggctgagatagtcctcagctttgagaacaagcagctgcccatccaccacatc 21916785

                                                                            
Query: 367      cctggtccagagggtgtccgcggccgcaactctgacaacaccctcatcaaggagaagctt 426
                || || |||||||||||||| || |||||||| |||||||| |||||||| |||||||||
Sbjct: 21916784 cccgggccagagggtgtccgtggtcgcaactccgacaacacgctcatcaaagagaagctt 21916725

                        
Query: 427      ggctgggc 434
                ||||||||
Sbjct: 21916724 ggctgggc 21916717



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 79/92 (85%)
 Strand = Plus / Minus

                                                                            
Query: 19       gaggagctgtgcaagcactacaccaaggactttgacattgagtgccgtattggccgtttt 78
                ||||| ||||||||||| ||||| ||||| |||| |||||| || ||  ||||||| |||
Sbjct: 21918067 gaggaactgtgcaagcattacacaaaggattttggcattgaatgtcgggttggccgcttt 21918008

                                                
Query: 79       cacaacatttatggtccctttggaacatggaa 110
                || || || |||||||||||||||||||||||
Sbjct: 21918007 cataatatctatggtccctttggaacatggaa 21917976



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 130/158 (82%), Gaps = 4/158 (2%)
 Strand = Plus / Minus

                                                                            
Query: 452      aggatggcctaaggttcacctacttctggatcaaggagcagatcgagaaggagaggaccg 511
                ||||||| || ||| |||| ||||||||||||||||||||| |||||||||||| | |||
Sbjct: 21916596 aggatggtctgaggatcacatacttctggatcaaggagcagctcgagaaggagaaggccg 21916537

                                                                            
Query: 512      aggggaaggac--gtcgcccggtacggatcatccaaggtggtgtccacacaggcaccggt 569
                ||||    |||  |||| ||  ||||| ||||||||||| |||   || ||||| |||||
Sbjct: 21916536 agggcgtcgacttgtcggcc--tacgggtcatccaaggtagtgcagactcaggcgccggt 21916479

                                                      
Query: 570      gcagctgggctccctccgcgcggctgacggcaaggagt 607
                |||||| ||||||||||| || ||||| || |||||||
Sbjct: 21916478 gcagcttggctccctccgtgctgctgatggaaaggagt 21916441



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 99/119 (83%)
 Strand = Plus / Minus

                                                                            
Query: 121      gagaaggcaccagctgccttctgtagaaaggctcagacctccaccgaacggtttgagatg 180
                |||||||| || ||||| ||||| ||||| ||||  |||||||| || || |||||||||
Sbjct: 21917888 gagaaggcgcctgctgctttctgcagaaaagctctaacctccactgaccgttttgagatg 21917829

                                                                           
Query: 181      tggggtgatggtctacagactcgatcgttcacttttatcgacgagtgcgtcgagggtgt 239
                ||||| |||||||| |||||| |||| ||||| ||||| || || || || ||||||||
Sbjct: 21917828 tggggagatggtcttcagactagatccttcacgtttattgatgaatgtgtggagggtgt 21917770



to top

>gb|DQ268848.1| Solanum tuberosum clone 155B09 NAD-dependent epimerase/dehydratase
            family protein-like protein mRNA, complete cds
          Length = 1521

 Score =  188 bits (95), Expect = 2e-44
 Identities = 275/335 (82%)
 Strand = Plus / Plus

                                                                        
Query: 171  gtttgagatgtggggtgatggtctacagactcgatcgttcacttttatcgacgagtgcgt 230
            |||||| |||||||| ||||| || || || || || ||||| || || || ||||| ||
Sbjct: 717  gtttgaaatgtggggagatggacttcaaacacgttcattcaccttcattgatgagtgtgt 776

                                                                        
Query: 231  cgagggtgttctgagattgacaaagtcagacttctgcgagcccgtgaacattggaagtga 290
             || || ||||| ||||||||||| || |||||| | ||||| |||||||| ||||||||
Sbjct: 777  tgaaggggttcttagattgacaaaatccgacttccgagagccagtgaacataggaagtga 836

                                                                        
Query: 291  tgaaatggtgagcatgaacgagatggctgagattgttctcggcttcgaggacaagaagct 350
            ||| ||||| |||||||| |||||||||||||| |||||| |||| ||||||||||||||
Sbjct: 837  tgagatggtcagcatgaatgagatggctgagatggttctcagctttgaggacaagaagct 896

                                                                        
Query: 351  acccatccaccacatccctggtccagagggtgtccgcggccgcaactctgacaacaccct 410
              |  |||| ||||| || || ||||| || ||||| || |||||||| |||||||| ||
Sbjct: 897  tgctgtccaacacattccaggcccagaaggcgtccgtggtcgcaactcagacaacacact 956

                                                                        
Query: 411  catcaaggagaagcttggctgggcccccacaatgaagctcaaggatggcctaaggttcac 470
             || || ||||||||||| ||||| || |||||||   | |||||||| || ||  | ||
Sbjct: 957  gataaaagagaagcttggttgggctccaacaatgagattgaaggatggtctgagaattac 1016

                                               
Query: 471  ctacttctggatcaaggagcagatcgagaaggaga 505
             ||||||||||||||||||||||||||||| ||||
Sbjct: 1017 atacttctggatcaaggagcagatcgagaaagaga 1051



to top

>gb|DQ207722.1| Zea mays cultivar B73 IDP512 marker
          Length = 527

 Score =  147 bits (74), Expect = 5e-32
 Identities = 101/110 (91%)
 Strand = Plus / Minus

                                                                       
Query: 345 gaagctacccatccaccacatccctggtccagagggtgtccgcggccgcaactctgacaa 404
           |||||| |||||||||||||||||||| || || || |||||||| ||||||||||||||
Sbjct: 460 gaagctgcccatccaccacatccctggcccggaaggggtccgcgggcgcaactctgacaa 401

                                                             
Query: 405 caccctcatcaaggagaagcttggctgggcccccacaatgaagctcaagg 454
           |||||| |||||||||||||||||||||||||| || |||||||||||||
Sbjct: 400 cacccttatcaaggagaagcttggctgggccccgacgatgaagctcaagg 351



 Score =  141 bits (71), Expect = 3e-30
 Identities = 125/143 (87%)
 Strand = Plus / Minus

                                                                       
Query: 464 ggttcacctacttctggatcaaggagcagatcgagaaggagaggaccgaggggaaggacg 523
           |||||||||||||||||||||| ||||||||||||||||||| |||  |||||   ||| 
Sbjct: 249 ggttcacctacttctggatcaaagagcagatcgagaaggagaagacgcagggggtcgaca 190

                                                                       
Query: 524 tcgcccggtacggatcatccaaggtggtgtccacacaggcaccggtgcagctgggctccc 583
           ||||   |||||| || ||||||||||||||||| ||||| || ||||||||||||||||
Sbjct: 189 tcgcggcgtacgggtcgtccaaggtggtgtccacccaggcgcccgtgcagctgggctccc 130

                                  
Query: 584 tccgcgcggctgacggcaaggag 606
           ||||||| || ||||||||||||
Sbjct: 129 tccgcgccgccgacggcaaggag 107



to top

>gb|DQ207723.1| Zea mays cultivar inbred line Mo17 IDP512 marker
          Length = 473

 Score =  141 bits (71), Expect = 3e-30
 Identities = 125/143 (87%)
 Strand = Plus / Minus

                                                                       
Query: 464 ggttcacctacttctggatcaaggagcagatcgagaaggagaggaccgaggggaaggacg 523
           |||||||||||||||||||||| ||||||||||||||||||| |||  |||||   ||| 
Sbjct: 257 ggttcacctacttctggatcaaagagcagatcgagaaggagaagacgcagggggtcgaca 198

                                                                       
Query: 524 tcgcccggtacggatcatccaaggtggtgtccacacaggcaccggtgcagctgggctccc 583
           ||||   |||||| || ||||||||||||||||| ||||| || ||||||||||||||||
Sbjct: 197 tcgcggcgtacgggtcgtccaaggtggtgtccacccaggcgcccgtgcagctgggctccc 138

                                  
Query: 584 tccgcgcggctgacggcaaggag 606
           ||||||| || ||||||||||||
Sbjct: 137 tccgcgccgccgacggcaaggag 115



 Score =  139 bits (70), Expect = 1e-29
 Identities = 94/102 (92%)
 Strand = Plus / Minus

                                                                       
Query: 353 ccatccaccacatccctggtccagagggtgtccgcggccgcaactctgacaacaccctca 412
           ||||||||||||||||||| || || || |||||||| |||||||||||||||||||| |
Sbjct: 460 ccatccaccacatccctggcccggaaggggtccgcgggcgcaactctgacaacaccctta 401

                                                     
Query: 413 tcaaggagaagcttggctgggcccccacaatgaagctcaagg 454
           ||||||||||||||||||||||||| || |||||||||||||
Sbjct: 400 tcaaggagaagcttggctgggccccgacgatgaagctcaagg 359



to top

>gb|AF272706.1|F7P1 Arabidopsis thaliana BAC F7P1
          Length = 110714

 Score =  127 bits (64), Expect = 5e-26
 Identities = 157/188 (83%)
 Strand = Plus / Minus

                                                                         
Query: 247   ttgacaaagtcagacttctgcgagcccgtgaacattggaagtgatgaaatggtgagcatg 306
             |||||||| ||||| ||| | ||||| |||||||| ||||| ||||| ||||||||||||
Sbjct: 19112 ttgacaaaatcagatttccgtgagccggtgaacatcggaagcgatgagatggtgagcatg 19053

                                                                         
Query: 307   aacgagatggctgagattgttctcggcttcgaggacaagaagctacccatccaccacatc 366
             || |||||||||||||| |||||| |||| ||||| |||||||| || || |||||||| 
Sbjct: 19052 aatgagatggctgagatggttctcagctttgaggaaaagaagcttccaattcaccacatt 18993

                                                                         
Query: 367   cctggtccagagggtgtccgcggccgcaactctgacaacaccctcatcaaggagaagctt 426
             ||||| || || ||||| || || || ||||| |||||||  || ||||| || ||||||
Sbjct: 18992 cctggcccggaaggtgttcgtggtcgtaactcagacaacaatctgatcaaagaaaagctt 18933

                     
Query: 427   ggctgggc 434
             || |||||
Sbjct: 18932 ggttgggc 18925



 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 91/107 (85%)
 Strand = Plus / Minus

                                                                         
Query: 121   gagaaggcaccagctgccttctgtagaaaggctcagacctccaccgaacggtttgagatg 180
             |||||||| |||||||| |||||||| ||||||||||| ||||| ||  |||||||||||
Sbjct: 19316 gagaaggctccagctgctttctgtaggaaggctcagacttccactgataggtttgagatg 19257

                                                            
Query: 181   tggggtgatggtctacagactcgatcgttcacttttatcgacgagtg 227
             ||||| ||||| || ||||| || || || || |||||||| |||||
Sbjct: 19256 tggggagatgggcttcagacccgttcttttacctttatcgatgagtg 19210



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 89/108 (82%)
 Strand = Plus / Minus

                                                                         
Query: 6     gaagctcgcgaccgaggagctgtgcaagcactacaccaaggactttgacattgagtgccg 65
             |||||| || || |||||| |||| ||||| |||| ||| || ||||  |||||||| ||
Sbjct: 19517 gaagcttgctacggaggagttgtgtaagcattacaacaaagattttggtattgagtgtcg 19458

                                                             
Query: 66    tattggccgttttcacaacatttatggtccctttggaacatggaaagg 113
              |||||  | || || |||||||||||||| |||||||||||||||||
Sbjct: 19457 aattggaaggttccataacatttatggtccttttggaacatggaaagg 19410



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                  
Query: 469   acctacttctggatcaaggagcagatcgagaaggaga 505
             |||||||||||||| ||||| ||||||||||| ||||
Sbjct: 18798 acctacttctggataaaggaacagatcgagaaagaga 18762



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                
Query: 562   gcaccggtgcagctgggctccctccgcgcggctga 596
             |||||||| ||||| ||||| ||||||||||||||
Sbjct: 18705 gcaccggttcagctaggctcactccgcgcggctga 18671



to top

>dbj|AK118786.1| Arabidopsis thaliana mRNA, clone: RAFL21-11-O14
          Length = 550

 Score =  127 bits (64), Expect = 5e-26
 Identities = 157/188 (83%)
 Strand = Plus / Minus

                                                                       
Query: 247 ttgacaaagtcagacttctgcgagcccgtgaacattggaagtgatgaaatggtgagcatg 306
           |||||||| ||||| ||| | ||||| |||||||| ||||| ||||| ||||||||||||
Sbjct: 197 ttgacaaaatcagatttccgtgagccggtgaacatcggaagcgatgagatggtgagcatg 138

                                                                       
Query: 307 aacgagatggctgagattgttctcggcttcgaggacaagaagctacccatccaccacatc 366
           || |||||||||||||| |||||| |||| ||||| |||||||| || || |||||||| 
Sbjct: 137 aatgagatggctgagatggttctcagctttgaggaaaagaagcttccaattcaccacatt 78

                                                                       
Query: 367 cctggtccagagggtgtccgcggccgcaactctgacaacaccctcatcaaggagaagctt 426
           ||||| || || ||||| || || || ||||| |||||||  || ||||| || ||||||
Sbjct: 77  cctggcccggaaggtgttcgtggtcgtaactcagacaacaatctgatcaaagaaaagctt 18

                   
Query: 427 ggctgggc 434
           || |||||
Sbjct: 17  ggttgggc 10



 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 91/107 (85%)
 Strand = Plus / Minus

                                                                       
Query: 121 gagaaggcaccagctgccttctgtagaaaggctcagacctccaccgaacggtttgagatg 180
           |||||||| |||||||| |||||||| ||||||||||| ||||| ||  |||||||||||
Sbjct: 401 gagaaggctccagctgctttctgtaggaaggctcagacttccactgataggtttgagatg 342

                                                          
Query: 181 tggggtgatggtctacagactcgatcgttcacttttatcgacgagtg 227
           ||||| ||||| || ||||| || || || || |||||||| |||||
Sbjct: 341 tggggagatgggcttcagacccgttcttttacctttatcgatgagtg 295



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 82  aacatttatggtccctttggaacatggaaagg 113
           |||||||||||||| |||||||||||||||||
Sbjct: 526 aacatttatggtccttttggaacatggaaagg 495



to top

>dbj|AB235855.1| Oryza sativa (japonica cultivar-group) OsGME mRNA for
           GDP-mannose-3'',5''-epimerase, complete cds
          Length = 1053

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 109/134 (81%)
 Strand = Plus / Plus

                                                                       
Query: 7   aagctcgcgaccgaggagctgtgcaagcactacaccaaggactttgacattgagtgccgt 66
           |||||||  ||||| ||| | |||||| |||||| ||||||||||| |||||||| ||| 
Sbjct: 472 aagctcgttaccgaagagttctgcaagtactacaacaaggactttggcattgagttccgc 531

                                                                       
Query: 67  attggccgttttcacaacatttatggtccctttggaacatggaaaggcggtcgcgagaag 126
           ||||| || || |||||||| || || |||   || || ||||| || ||||||||||||
Sbjct: 532 attggtcgcttccacaacatctacggcccccacggcacttggaagggtggtcgcgagaag 591

                         
Query: 127 gcaccagctgcctt 140
           || || ||||||||
Sbjct: 592 gcccccgctgcctt 605



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 277 aacattggaagtgatgaaatggtgagcatgaacgagatggc 317
           |||||||| || || || ||||||||||||||||| |||||
Sbjct: 742 aacattggcagcgaggagatggtgagcatgaacgacatggc 782



to top

>dbj|AK109046.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-154-D11, full
           insert sequence
          Length = 1134

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 109/134 (81%)
 Strand = Plus / Plus

                                                                       
Query: 7   aagctcgcgaccgaggagctgtgcaagcactacaccaaggactttgacattgagtgccgt 66
           |||||||  ||||| ||| | |||||| |||||| ||||||||||| |||||||| ||| 
Sbjct: 492 aagctcgttaccgaagagttctgcaagtactacaacaaggactttggcattgagttccgc 551

                                                                       
Query: 67  attggccgttttcacaacatttatggtccctttggaacatggaaaggcggtcgcgagaag 126
           ||||| || || |||||||| || || |||   || || ||||| || ||||||||||||
Sbjct: 552 attggtcgcttccacaacatctacggcccccacggcacttggaagggtggtcgcgagaag 611

                         
Query: 127 gcaccagctgcctt 140
           || || ||||||||
Sbjct: 612 gcccccgctgcctt 625



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 277 aacattggaagtgatgaaatggtgagcatgaacgagatggc 317
           |||||||| || || || ||||||||||||||||| |||||
Sbjct: 762 aacattggcagcgaggagatggtgagcatgaacgacatggc 802



to top

>ref|XM_848981.1| PREDICTED: Canis familiaris similar to NACHT, LRR and PYD containing
            protein 10 (LOC611323), mRNA
          Length = 2061

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 477  ctggatcaaggagcagatcgagaagg 502
            |||||||||||||||||| |||||||
Sbjct: 1083 ctggatcaaggagcagatggagaagg 1108



to top

>gb|AC125456.4| Mus musculus BAC clone RP24-193M20 from chromosome 18, complete
             sequence
          Length = 142347

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 401   acaacaccctcatcaaggagaa 422
             ||||||||||||||||||||||
Sbjct: 51885 acaacaccctcatcaaggagaa 51864



to top

>gb|AC010708.10|AC010708 Drosophila melanogaster, chromosome X, region 17A-17B, BAC clone
              BACR10E05, complete sequence
          Length = 188766

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 480    gatcaaggagcagatcgagaaggaga 505
              |||||||||| |||||||||||||||
Sbjct: 176997 gatcaaggaggagatcgagaaggaga 176972



to top

>gb|AC012098.9|AC012098 Drosophila melanogaster, chromosome X, region 17A-17B, BAC clone
             BACR03K10, complete sequence
          Length = 188489

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 480   gatcaaggagcagatcgagaaggaga 505
             |||||||||| |||||||||||||||
Sbjct: 92374 gatcaaggaggagatcgagaaggaga 92349



to top

>gb|AE003509.5| Drosophila melanogaster chromosome X, section 61 of 74 of the complete
             sequence
          Length = 315109

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 480   gatcaaggagcagatcgagaaggaga 505
             |||||||||| |||||||||||||||
Sbjct: 16386 gatcaaggaggagatcgagaaggaga 16361



to top

>gb|AC018489.7| Drosophila melanogaster clone BACR19G19, complete sequence
          Length = 179077

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 485    aggagcagatcgagaaggaga 505
              |||||||||||||||||||||
Sbjct: 170208 aggagcagatcgagaaggaga 170228



to top

>gb|AC022349.3| Drosophila melanogaster clone BACR33D04, complete sequence
          Length = 177576

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 485   aggagcagatcgagaaggaga 505
             |||||||||||||||||||||
Sbjct: 96572 aggagcagatcgagaaggaga 96592



to top

>gb|AY121637.1| Drosophila melanogaster HL04344 full insert cDNA
          Length = 1953

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 485 aggagcagatcgagaaggaga 505
           |||||||||||||||||||||
Sbjct: 463 aggagcagatcgagaaggaga 483



to top

>ref|NM_206767.1| Drosophila melanogaster CG9132-PB, isoform B (CG9132) mRNA,
           complete cds
          Length = 1934

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 485 aggagcagatcgagaaggaga 505
           |||||||||||||||||||||
Sbjct: 462 aggagcagatcgagaaggaga 482



to top

>ref|NM_206768.1| Drosophila melanogaster CG9132-PA, isoform A (CG9132) mRNA,
           complete cds
          Length = 1837

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 485 aggagcagatcgagaaggaga 505
           |||||||||||||||||||||
Sbjct: 365 aggagcagatcgagaaggaga 385



to top

>gb|AE003503.4| Drosophila melanogaster chromosome X, section 55 of 74 of the complete
              sequence
          Length = 300468

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 485    aggagcagatcgagaaggaga 505
              |||||||||||||||||||||
Sbjct: 161817 aggagcagatcgagaaggaga 161797



to top

>gb|AE014291.4| Brucella suis 1330 chromosome I, complete sequence
          Length = 2107794

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 586     cgcgcggctgacggcaagga 605
               ||||||||||||||||||||
Sbjct: 2074181 cgcgcggctgacggcaagga 2074200



to top

>gb|AC150687.3| Bos taurus  BAC CH240-243M2 (Children's Hospital Oakland Research
             Institute Bovine BAC Library (male)) complete sequence
          Length = 144223

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 547   gtggtgtccacacaggcacc 566
             ||||||||||||||||||||
Sbjct: 63866 gtggtgtccacacaggcacc 63885



to top

>ref|XM_368123.1| Magnaporthe grisea 70-15 chromosome VI hypothetical protein
           (MG01121.4) partial mRNA
          Length = 879

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 479 ggatcaaggagcagatcgag 498
           ||||||||||||||||||||
Sbjct: 836 ggatcaaggagcagatcgag 855



to top

>ref|XM_418410.1| PREDICTED: Gallus gallus similar to RHPN1 protein (LOC420299), mRNA
          Length = 3132

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 124 aaggcaccagctgccttctg 143
           ||||||||||||||||||||
Sbjct: 725 aaggcaccagctgccttctg 706



to top

>emb|AL591783.1|SME591783 Sinorhizobium meliloti 1021 complete chromosome; segment 2/12
          Length = 306650

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 479   ggatcaaggagcagatcgag 498
             ||||||||||||||||||||
Sbjct: 44997 ggatcaaggagcagatcgag 44978



to top

>gb|AC134698.10| Homo sapiens chromosome 8, clone RP11-359P18, complete sequence
          Length = 173305

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 352    cccatccaccacatccctgg 371
              ||||||||||||||||||||
Sbjct: 131632 cccatccaccacatccctgg 131613



to top

>emb|BX510937.6| Zebrafish DNA sequence from clone DKEY-90G19 in linkage group 6,
             complete sequence
          Length = 92200

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 76    tttcacaacatttatggtcc 95
             ||||||||||||||||||||
Sbjct: 21987 tttcacaacatttatggtcc 22006



to top

>emb|BX546446.15| Zebrafish DNA sequence from clone DKEY-7K24 in linkage group 6,
             complete sequence
          Length = 196818

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 76    tttcacaacatttatggtcc 95
             ||||||||||||||||||||
Sbjct: 81157 tttcacaacatttatggtcc 81176



to top

>gb|AC104119.2| Homo sapiens chromosome 5 clone RP11-34D23, complete sequence
          Length = 168108

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 486   ggagcagatcgagaaggaga 505
             ||||||||||||||||||||
Sbjct: 92166 ggagcagatcgagaaggaga 92147



to top

>emb|CR353063.1| Gallus gallus finished cDNA, clone ChEST419d21
          Length = 872

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 124 aaggcaccagctgccttctg 143
           ||||||||||||||||||||
Sbjct: 118 aaggcaccagctgccttctg 99



to top

>emb|BX248229.14| Zebrafish DNA sequence from clone CH211-126P4 in linkage group 2,
             complete sequence
          Length = 180233

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 170   ggtttgagatgtggggtgat 189
             ||||||||||||||||||||
Sbjct: 96741 ggtttgagatgtggggtgat 96722



to top

>gb|AE009631.1| Brucella melitensis 16M chromosome I, section 188 of 195 of the
            complete sequence
          Length = 14375

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 586  cgcgcggctgacggcaagga 605
            ||||||||||||||||||||
Sbjct: 2450 cgcgcggctgacggcaagga 2431



to top

>gb|AE017223.1| Brucella abortus biovar 1 str. 9-941 chromosome I, complete sequence
          Length = 2124241

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 586     cgcgcggctgacggcaagga 605
               ||||||||||||||||||||
Sbjct: 2090650 cgcgcggctgacggcaagga 2090669



to top

>gb|AC150680.7| Monodelphis domestica, clone XX-28D5, complete sequence
          Length = 154058

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 544    aaggtggtgtccacacaggc 563
              ||||||||||||||||||||
Sbjct: 141361 aaggtggtgtccacacaggc 141342



to top

>emb|CR774199.4| Zebrafish DNA sequence from clone CH211-42H24 in linkage group 14,
             complete sequence
          Length = 162722

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 72    ccgttttcacaacatttatggtcc 95
             ||||||||||| ||||||||||||
Sbjct: 84381 ccgttttcacaccatttatggtcc 84358



to top

>dbj|AB089266.1| Lethenteron japonicum MASP-like mRNA for mannose-binding lectin
           associated serine protease-like, complete cds
          Length = 3170

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 217 atcgacgagtgcgtcgaggg 236
           ||||||||||||||||||||
Sbjct: 581 atcgacgagtgcgtcgaggg 600



to top

>gb|AE015924.1| Porphyromonas gingivalis W83, complete genome
          Length = 2343476

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 526     gcccggtacggatcatccaa 545
               ||||||||||||||||||||
Sbjct: 1701215 gcccggtacggatcatccaa 1701234



to top

>gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, complete sequence
          Length = 3809201

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 480     gatcaaggagcagatcgaga 499
               ||||||||||||||||||||
Sbjct: 3780788 gatcaaggagcagatcgaga 3780769



to top

>dbj|AK113577.1| Ciona intestinalis cDNA, clone:ciad076a06, full insert sequence
          Length = 1443

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 477 ctggatcaaggagcagatcg 496
           ||||||||||||||||||||
Sbjct: 817 ctggatcaaggagcagatcg 798



to top

>gb|AC160645.2| Gallus gallus BAC clone CH261-21L11 from chromosome unknown, complete
              sequence
          Length = 223748

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 124    aaggcaccagctgccttctg 143
              ||||||||||||||||||||
Sbjct: 169751 aaggcaccagctgccttctg 169770



to top

>emb|AM040264.1| Brucella melitensis biovar Abortus chromosome I, complete sequence, strain
               2308
          Length = 2121359

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 586     cgcgcggctgacggcaagga 605
               ||||||||||||||||||||
Sbjct: 2087769 cgcgcggctgacggcaagga 2087788



to top

>gb|DQ079316.1| Drosophila mulleri strain 15081-1371.00 Tes33 (Tes33) gene, partial
           cds
          Length = 524

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 481 atcaaggagcagatcgagaa 500
           ||||||||||||||||||||
Sbjct: 392 atcaaggagcagatcgagaa 411



to top

>gb|DQ079315.1| Drosophila mojavensis strain 15081-1352.02 Tes33 (Tes33) gene,
           partial cds
          Length = 536

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 481 atcaaggagcagatcgagaa 500
           ||||||||||||||||||||
Sbjct: 404 atcaaggagcagatcgagaa 423



to top

>gb|DQ079314.1| Drosophila mojavensis strain 15081-1352.01 Tes33 (Tes33) gene,
           partial cds
          Length = 536

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 481 atcaaggagcagatcgagaa 500
           ||||||||||||||||||||
Sbjct: 404 atcaaggagcagatcgagaa 423



to top

>gb|DQ079313.1| Drosophila mojavensis strain 15081-1352.00 Tes33 (Tes33) gene,
           partial cds
          Length = 524

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 481 atcaaggagcagatcgagaa 500
           ||||||||||||||||||||
Sbjct: 392 atcaaggagcagatcgagaa 411



to top

>gb|DQ079312.1| Drosophila mojavensis strain 15081-1351.09 Tes33 (Tes33) gene,
           partial cds
          Length = 536

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 481 atcaaggagcagatcgagaa 500
           ||||||||||||||||||||
Sbjct: 404 atcaaggagcagatcgagaa 423



to top

>gb|DQ079311.1| Drosophila mojavensis strain 15081-1351.03 Tes33 (Tes33) gene,
           partial cds
          Length = 536

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 481 atcaaggagcagatcgagaa 500
           ||||||||||||||||||||
Sbjct: 404 atcaaggagcagatcgagaa 423



to top

>gb|DQ079310.1| Drosophila mojavensis strain 15081-1351.14 Tes33 (Tes33) gene,
           partial cds
          Length = 536

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 481 atcaaggagcagatcgagaa 500
           ||||||||||||||||||||
Sbjct: 404 atcaaggagcagatcgagaa 423



to top

>gb|DQ079309.1| Drosophila mojavensis strain 15081-1351.12 Tes33 (Tes33) gene,
           partial cds
          Length = 536

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 481 atcaaggagcagatcgagaa 500
           ||||||||||||||||||||
Sbjct: 404 atcaaggagcagatcgagaa 423



to top

>gb|DQ079307.1| Drosophila arizonae strain 15081-1271.13 Tes33 (Tes33) gene,
           partial cds
          Length = 536

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 481 atcaaggagcagatcgagaa 500
           ||||||||||||||||||||
Sbjct: 404 atcaaggagcagatcgagaa 423



to top

>gb|DQ079306.1| Drosophila arizonae strain 15081-1271.12 Tes33 (Tes33) gene,
           partial cds
          Length = 536

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 481 atcaaggagcagatcgagaa 500
           ||||||||||||||||||||
Sbjct: 404 atcaaggagcagatcgagaa 423



to top

>gb|DQ079305.1| Drosophila arizonae strain 15081-1271.08 Tes33 (Tes33) gene,
           partial cds
          Length = 524

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 481 atcaaggagcagatcgagaa 500
           ||||||||||||||||||||
Sbjct: 392 atcaaggagcagatcgagaa 411



to top

>gb|DQ079304.1| Drosophila arizonae strain 15081-1271.05 Tes33 (Tes33) gene,
           partial cds
          Length = 524

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 481 atcaaggagcagatcgagaa 500
           ||||||||||||||||||||
Sbjct: 392 atcaaggagcagatcgagaa 411



to top

>gb|DQ079303.1| Drosophila arizonae strain 15081-1271.04 Tes33 (Tes33) gene,
           partial cds
          Length = 524

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 481 atcaaggagcagatcgagaa 500
           ||||||||||||||||||||
Sbjct: 392 atcaaggagcagatcgagaa 411



to top

>gb|DQ079302.1| Drosophila arizonae strain 15081-1271.00 Tes33 (Tes33) gene,
           partial cds
          Length = 524

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 481 atcaaggagcagatcgagaa 500
           ||||||||||||||||||||
Sbjct: 392 atcaaggagcagatcgagaa 411



to top

>gb|L37524.1|ASNMETA Aspergillus flavus (isolate 28) metalloproteinase gene, complete
           cds
          Length = 1508

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 399 tgacaacaccctcatcaagg 418
           ||||||||||||||||||||
Sbjct: 283 tgacaacaccctcatcaagg 302


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,825,657
Number of Sequences: 3902068
Number of extensions: 4825657
Number of successful extensions: 89444
Number of sequences better than 10.0: 75
Number of HSP's better than 10.0 without gapping: 75
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 89089
Number of HSP's gapped (non-prelim): 349
length of query: 644
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 621
effective length of database: 17,143,297,704
effective search space: 10645987874184
effective search space used: 10645987874184
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top