| Clone Name | bags25c19 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_475225.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1416 Score = 466 bits (235), Expect = e-128 Identities = 328/359 (91%) Strand = Plus / Plus Query: 31 tatgacactgggcattatccggtgtgggacgagcagaacccggtgcacttcgtggggcac 90 |||||||| || ||||| ||||| ||||||||||| |||||||||||||| || |||||| Sbjct: 469 tatgacacaggacattacccggtctgggacgagcaaaacccggtgcactttgtcgggcac 528 Query: 91 tcggcgggcgcgcaggttgtgagggtgctgcatcagatgctcgctgagaaggctttccct 150 ||||| |||| |||||||||||||||||||||||||||||| || || |||||||||||| Sbjct: 529 tcggccggcgtgcaggttgtgagggtgctgcatcagatgcttgccgataaggctttccct 588 Query: 151 gggcatgatacttctgaagactgggttctgagccttacttccttgtcaggcgcgcttaat 210 || |||||||||||||||||||||||||| ||||||||||||||||| || ||||||||| Sbjct: 589 ggacatgatacttctgaagactgggttcttagccttacttccttgtcgggtgcgcttaat 648 Query: 211 ggaaccacacggacttactacgacggcatgctggctgaagatgggagatccatgaaatca 270 |||||||| | |||||||| || ||||||||||||||||| || ||||||||||||||| Sbjct: 649 ggaaccactagaacttactatgatggcatgctggctgaagacggaagatccatgaaatca 708 Query: 271 atttgtcttcttcagctctgccggcttggagtcattgtctatgattggctggacattcct 330 || ||||||||||||||||||||| ||||||| || |||||||||||||| ||||||||| Sbjct: 709 atctgtcttcttcagctctgccggattggagttatcgtctatgattggctagacattcct 768 Query: 331 tggctgaagaattactacaatttcggttttgatcactttgaaatgtcatggaggaaagt 389 ||||||||||||||||||||||| |||||||| |||||||| ||||||||||||||||| Sbjct: 769 tggctgaagaattactacaattttggttttgaccactttgagatgtcatggaggaaagt 827
>dbj|AK071584.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023104P03, full insert sequence Length = 1797 Score = 466 bits (235), Expect = e-128 Identities = 328/359 (91%) Strand = Plus / Plus Query: 31 tatgacactgggcattatccggtgtgggacgagcagaacccggtgcacttcgtggggcac 90 |||||||| || ||||| ||||| ||||||||||| |||||||||||||| || |||||| Sbjct: 684 tatgacacaggacattacccggtctgggacgagcaaaacccggtgcactttgtcgggcac 743 Query: 91 tcggcgggcgcgcaggttgtgagggtgctgcatcagatgctcgctgagaaggctttccct 150 ||||| |||| |||||||||||||||||||||||||||||| || || |||||||||||| Sbjct: 744 tcggccggcgtgcaggttgtgagggtgctgcatcagatgcttgccgataaggctttccct 803 Query: 151 gggcatgatacttctgaagactgggttctgagccttacttccttgtcaggcgcgcttaat 210 || |||||||||||||||||||||||||| ||||||||||||||||| || ||||||||| Sbjct: 804 ggacatgatacttctgaagactgggttcttagccttacttccttgtcgggtgcgcttaat 863 Query: 211 ggaaccacacggacttactacgacggcatgctggctgaagatgggagatccatgaaatca 270 |||||||| | |||||||| || ||||||||||||||||| || ||||||||||||||| Sbjct: 864 ggaaccactagaacttactatgatggcatgctggctgaagacggaagatccatgaaatca 923 Query: 271 atttgtcttcttcagctctgccggcttggagtcattgtctatgattggctggacattcct 330 || ||||||||||||||||||||| ||||||| || |||||||||||||| ||||||||| Sbjct: 924 atctgtcttcttcagctctgccggattggagttatcgtctatgattggctagacattcct 983 Query: 331 tggctgaagaattactacaatttcggttttgatcactttgaaatgtcatggaggaaagt 389 ||||||||||||||||||||||| |||||||| |||||||| ||||||||||||||||| Sbjct: 984 tggctgaagaattactacaattttggttttgaccactttgagatgtcatggaggaaagt 1042
>dbj|AK068553.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013155K07, full insert sequence Length = 1998 Score = 466 bits (235), Expect = e-128 Identities = 328/359 (91%) Strand = Plus / Plus Query: 31 tatgacactgggcattatccggtgtgggacgagcagaacccggtgcacttcgtggggcac 90 |||||||| || ||||| ||||| ||||||||||| |||||||||||||| || |||||| Sbjct: 885 tatgacacaggacattacccggtctgggacgagcaaaacccggtgcactttgtcgggcac 944 Query: 91 tcggcgggcgcgcaggttgtgagggtgctgcatcagatgctcgctgagaaggctttccct 150 ||||| |||| |||||||||||||||||||||||||||||| || || |||||||||||| Sbjct: 945 tcggccggcgtgcaggttgtgagggtgctgcatcagatgcttgccgataaggctttccct 1004 Query: 151 gggcatgatacttctgaagactgggttctgagccttacttccttgtcaggcgcgcttaat 210 || |||||||||||||||||||||||||| ||||||||||||||||| || ||||||||| Sbjct: 1005 ggacatgatacttctgaagactgggttcttagccttacttccttgtcgggtgcgcttaat 1064 Query: 211 ggaaccacacggacttactacgacggcatgctggctgaagatgggagatccatgaaatca 270 |||||||| | |||||||| || ||||||||||||||||| || ||||||||||||||| Sbjct: 1065 ggaaccactagaacttactatgatggcatgctggctgaagacggaagatccatgaaatca 1124 Query: 271 atttgtcttcttcagctctgccggcttggagtcattgtctatgattggctggacattcct 330 || ||||||||||||||||||||| ||||||| || |||||||||||||| ||||||||| Sbjct: 1125 atctgtcttcttcagctctgccggattggagttatcgtctatgattggctagacattcct 1184 Query: 331 tggctgaagaattactacaatttcggttttgatcactttgaaatgtcatggaggaaagt 389 ||||||||||||||||||||||| |||||||| |||||||| ||||||||||||||||| Sbjct: 1185 tggctgaagaattactacaattttggttttgaccactttgagatgtcatggaggaaagt 1243
>gb|AC137928.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0040B10, complete sequence Length = 150825 Score = 212 bits (107), Expect = 7e-52 Identities = 137/147 (93%) Strand = Plus / Minus Query: 243 ggctgaagatgggagatccatgaaatcaatttgtcttcttcagctctgccggcttggagt 302 ||||||||| || ||||||||||||||||| ||||||||||||||||||||| ||||||| Sbjct: 119778 ggctgaagacggaagatccatgaaatcaatctgtcttcttcagctctgccggattggagt 119719 Query: 303 cattgtctatgattggctggacattccttggctgaagaattactacaatttcggttttga 362 || |||||||||||||| |||||||||||||||||||||||||||||||| |||||||| Sbjct: 119718 tatcgtctatgattggctagacattccttggctgaagaattactacaattttggttttga 119659 Query: 363 tcactttgaaatgtcatggaggaaagt 389 |||||||| ||||||||||||||||| Sbjct: 119658 ccactttgagatgtcatggaggaaagt 119632 Score = 135 bits (68), Expect = 1e-28 Identities = 95/104 (91%) Strand = Plus / Minus Query: 140 aggctttccctgggcatgatacttctgaagactgggttctgagccttacttccttgtcag 199 ||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| | Sbjct: 119976 aggctttccctggacatgatacttctgaagactgggttcttagccttacttccttgtcgg 119917 Query: 200 gcgcgcttaatggaaccacacggacttactacgacggcatgctg 243 | ||||||||||||||||| | |||||||| || ||||||||| Sbjct: 119916 gtgcgcttaatggaaccactagaacttactatgatggcatgctg 119873 Score = 121 bits (61), Expect = 2e-24 Identities = 82/89 (92%) Strand = Plus / Minus Query: 43 cattatccggtgtgggacgagcagaacccggtgcacttcgtggggcactcggcgggcgcg 102 ||||| ||||| ||||||||||| |||||||||||||| || ||||||||||| |||| | Sbjct: 120507 cattacccggtctgggacgagcaaaacccggtgcactttgtcgggcactcggccggcgtg 120448 Query: 103 caggttgtgagggtgctgcatcagatgct 131 ||||||||||||||||||||||||||||| Sbjct: 120447 caggttgtgagggtgctgcatcagatgct 120419
>gb|AC137620.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0014K18, complete sequence Length = 123508 Score = 212 bits (107), Expect = 7e-52 Identities = 137/147 (93%) Strand = Plus / Minus Query: 243 ggctgaagatgggagatccatgaaatcaatttgtcttcttcagctctgccggcttggagt 302 ||||||||| || ||||||||||||||||| ||||||||||||||||||||| ||||||| Sbjct: 44328 ggctgaagacggaagatccatgaaatcaatctgtcttcttcagctctgccggattggagt 44269 Query: 303 cattgtctatgattggctggacattccttggctgaagaattactacaatttcggttttga 362 || |||||||||||||| |||||||||||||||||||||||||||||||| |||||||| Sbjct: 44268 tatcgtctatgattggctagacattccttggctgaagaattactacaattttggttttga 44209 Query: 363 tcactttgaaatgtcatggaggaaagt 389 |||||||| ||||||||||||||||| Sbjct: 44208 ccactttgagatgtcatggaggaaagt 44182 Score = 135 bits (68), Expect = 1e-28 Identities = 95/104 (91%) Strand = Plus / Minus Query: 140 aggctttccctgggcatgatacttctgaagactgggttctgagccttacttccttgtcag 199 ||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| | Sbjct: 44526 aggctttccctggacatgatacttctgaagactgggttcttagccttacttccttgtcgg 44467 Query: 200 gcgcgcttaatggaaccacacggacttactacgacggcatgctg 243 | ||||||||||||||||| | |||||||| || ||||||||| Sbjct: 44466 gtgcgcttaatggaaccactagaacttactatgatggcatgctg 44423 Score = 121 bits (61), Expect = 2e-24 Identities = 82/89 (92%) Strand = Plus / Minus Query: 43 cattatccggtgtgggacgagcagaacccggtgcacttcgtggggcactcggcgggcgcg 102 ||||| ||||| ||||||||||| |||||||||||||| || ||||||||||| |||| | Sbjct: 45057 cattacccggtctgggacgagcaaaacccggtgcactttgtcgggcactcggccggcgtg 44998 Query: 103 caggttgtgagggtgctgcatcagatgct 131 ||||||||||||||||||||||||||||| Sbjct: 44997 caggttgtgagggtgctgcatcagatgct 44969
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 212 bits (107), Expect = 7e-52 Identities = 137/147 (93%) Strand = Plus / Minus Query: 243 ggctgaagatgggagatccatgaaatcaatttgtcttcttcagctctgccggcttggagt 302 ||||||||| || ||||||||||||||||| ||||||||||||||||||||| ||||||| Sbjct: 19791704 ggctgaagacggaagatccatgaaatcaatctgtcttcttcagctctgccggattggagt 19791645 Query: 303 cattgtctatgattggctggacattccttggctgaagaattactacaatttcggttttga 362 || |||||||||||||| |||||||||||||||||||||||||||||||| |||||||| Sbjct: 19791644 tatcgtctatgattggctagacattccttggctgaagaattactacaattttggttttga 19791585 Query: 363 tcactttgaaatgtcatggaggaaagt 389 |||||||| ||||||||||||||||| Sbjct: 19791584 ccactttgagatgtcatggaggaaagt 19791558 Score = 135 bits (68), Expect = 1e-28 Identities = 95/104 (91%) Strand = Plus / Minus Query: 140 aggctttccctgggcatgatacttctgaagactgggttctgagccttacttccttgtcag 199 ||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| | Sbjct: 19791902 aggctttccctggacatgatacttctgaagactgggttcttagccttacttccttgtcgg 19791843 Query: 200 gcgcgcttaatggaaccacacggacttactacgacggcatgctg 243 | ||||||||||||||||| | |||||||| || ||||||||| Sbjct: 19791842 gtgcgcttaatggaaccactagaacttactatgatggcatgctg 19791799 Score = 121 bits (61), Expect = 2e-24 Identities = 82/89 (92%) Strand = Plus / Minus Query: 43 cattatccggtgtgggacgagcagaacccggtgcacttcgtggggcactcggcgggcgcg 102 ||||| ||||| ||||||||||| |||||||||||||| || ||||||||||| |||| | Sbjct: 19792433 cattacccggtctgggacgagcaaaacccggtgcactttgtcgggcactcggccggcgtg 19792374 Query: 103 caggttgtgagggtgctgcatcagatgct 131 ||||||||||||||||||||||||||||| Sbjct: 19792373 caggttgtgagggtgctgcatcagatgct 19792345
>dbj|AP004920.1| Lotus japonicus genomic DNA, chromosome 2, clone:LjT13I21, TM0076c, complete sequence Length = 67145 Score = 83.8 bits (42), Expect = 4e-13 Identities = 66/74 (89%) Strand = Plus / Minus Query: 310 tatgattggctggacattccttggctgaagaattactacaatttcggttttgatcacttt 369 ||||||||| | |||||||| ||||||||||| ||||||||||| || |||||||||||| Sbjct: 9797 tatgattggttcgacattccctggctgaagaactactacaattttgggtttgatcacttt 9738 Query: 370 gaaatgtcatggag 383 | ||||||||||| Sbjct: 9737 aacatgtcatggag 9724
>emb|CR954187.2| Medicago truncatula chromosome 5 clone mth2-181i2, COMPLETE SEQUENCE Length = 128654 Score = 67.9 bits (34), Expect = 2e-08 Identities = 64/74 (86%) Strand = Plus / Minus Query: 310 tatgattggctggacattccttggctgaagaattactacaatttcggttttgatcacttt 369 ||||||||| | |||||| | |||||||| || |||||||||||||| ||||||||||| Sbjct: 690 tatgattggttagacatttcctggctgaaaaactactacaatttcgggtttgatcacttc 631 Query: 370 gaaatgtcatggag 383 | ||||||||||| Sbjct: 630 aacatgtcatggag 617
>ref|NM_202077.1| Arabidopsis thaliana unknown protein AT1G10740 transcript variant AT1G10740.2 mRNA, complete cds Length = 1937 Score = 48.1 bits (24), Expect = 0.023 Identities = 48/56 (85%) Strand = Plus / Plus Query: 313 gattggctggacattccttggctgaagaattactacaatttcggttttgatcactt 368 |||||| |||||||| | ||||| |||| ||| ||||||||||| || |||||||| Sbjct: 1012 gattggttggacatttcatggctaaagacttattacaatttcgggttcgatcactt 1067
>ref|NM_100950.3| Arabidopsis thaliana unknown protein AT1G10740 transcript variant AT1G10740.1 mRNA, complete cds Length = 1889 Score = 48.1 bits (24), Expect = 0.023 Identities = 48/56 (85%) Strand = Plus / Plus Query: 313 gattggctggacattccttggctgaagaattactacaatttcggttttgatcactt 368 |||||| |||||||| | ||||| |||| ||| ||||||||||| || |||||||| Sbjct: 1012 gattggttggacatttcatggctaaagacttattacaatttcgggttcgatcactt 1067
>gb|AY120749.1| Arabidopsis thaliana putative lipase (At1g10740) mRNA, complete cds Length = 1813 Score = 48.1 bits (24), Expect = 0.023 Identities = 48/56 (85%) Strand = Plus / Plus Query: 313 gattggctggacattccttggctgaagaattactacaatttcggttttgatcactt 368 |||||| |||||||| | ||||| |||| ||| ||||||||||| || |||||||| Sbjct: 1011 gattggttggacatttcatggctaaagacttattacaatttcgggttcgatcactt 1066
>gb|AF361099.1| Arabidopsis thaliana clone C00190 (a) putative lipase (At1g10740) mRNA, complete cds Length = 1422 Score = 48.1 bits (24), Expect = 0.023 Identities = 48/56 (85%) Strand = Plus / Plus Query: 313 gattggctggacattccttggctgaagaattactacaatttcggttttgatcactt 368 |||||| |||||||| | ||||| |||| ||| ||||||||||| || |||||||| Sbjct: 718 gattggttggacatttcatggctaaagacttattacaatttcgggttcgatcactt 773
>gb|BT006614.1| Arabidopsis thaliana At1g10740 mRNA, complete cds Length = 1422 Score = 48.1 bits (24), Expect = 0.023 Identities = 48/56 (85%) Strand = Plus / Plus Query: 313 gattggctggacattccttggctgaagaattactacaatttcggttttgatcactt 368 |||||| |||||||| | ||||| |||| ||| ||||||||||| || |||||||| Sbjct: 718 gattggttggacatttcatggctaaagacttattacaatttcgggttcgatcactt 773
>emb|BX814414.1|CNS0AE1W Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB72ZG08 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1797 Score = 48.1 bits (24), Expect = 0.023 Identities = 48/56 (85%) Strand = Plus / Plus Query: 313 gattggctggacattccttggctgaagaattactacaatttcggttttgatcactt 368 |||||| |||||||| | ||||| |||| ||| ||||||||||| || |||||||| Sbjct: 941 gattggttggacatttcatggctaaagacttattacaatttcgggttcgatcactt 996
>emb|BX815538.1|CNS0ACYG Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS70ZC04 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1414 Score = 48.1 bits (24), Expect = 0.023 Identities = 48/56 (85%) Strand = Plus / Plus Query: 313 gattggctggacattccttggctgaagaattactacaatttcggttttgatcactt 368 |||||| |||||||| | ||||| |||| ||| ||||||||||| || |||||||| Sbjct: 479 gattggttggacatttcatggctaaagacttattacaatttcgggttcgatcactt 534
>gb|AC007354.3|T16B5 Arabidopsis thaliana chromosome 1 BAC T16B5 sequence, complete sequence Length = 70116 Score = 48.1 bits (24), Expect = 0.023 Identities = 48/56 (85%) Strand = Plus / Plus Query: 313 gattggctggacattccttggctgaagaattactacaatttcggttttgatcactt 368 |||||| |||||||| | ||||| |||| ||| ||||||||||| || |||||||| Sbjct: 45791 gattggttggacatttcatggctaaagacttattacaatttcgggttcgatcactt 45846
>gb|AC009398.6|AC009398 Genomic sequence for Arabidopsis thaliana BAC F20B24 from chromosome I, complete sequence Length = 99416 Score = 48.1 bits (24), Expect = 0.023 Identities = 48/56 (85%) Strand = Plus / Minus Query: 313 gattggctggacattccttggctgaagaattactacaatttcggttttgatcactt 368 |||||| |||||||| | ||||| |||| ||| ||||||||||| || |||||||| Sbjct: 69400 gattggttggacatttcatggctaaagacttattacaatttcgggttcgatcactt 69345
>gb|AC114820.4| Mus musculus BAC clone RP23-70M6 from 18, complete sequence Length = 174470 Score = 44.1 bits (22), Expect = 0.36 Identities = 25/26 (96%) Strand = Plus / Plus Query: 162 ttctgaagactgggttctgagcctta 187 |||||||||||||||| ||||||||| Sbjct: 53693 ttctgaagactgggttgtgagcctta 53718
>gb|AC157564.11| Mus musculus chromosome 8, clone RP23-363J16, complete sequence Length = 216585 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 386 aagttgggttttctggtttag 406 ||||||||||||||||||||| Sbjct: 4771 aagttgggttttctggtttag 4791
>emb|AL138689.22| Human DNA sequence from clone RP11-272L14 on chromosome 13 Contains the EFNB2 gene for ephrin-B2 (HTKL EPLG5 LERK5)and a CpG island, complete sequence Length = 103616 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 323 acattccttggctgaagaatt 343 ||||||||||||||||||||| Sbjct: 50353 acattccttggctgaagaatt 50333
>emb|AL034424.9|HS257E24 Human DNA sequence from clone RP1-257E24 on chromosome 20q12-13.1 Contains the 3' end of the SLC13A3 gene for member 3 of solute carrier family 13 (sodium-dependent dicarboxylate transporter), the C20orf123 gene for chromosome 20 open reading frame 123, the 5' end of a novel zinc finger protein gene, ESTs, STSs and GSSs, complete sequence Length = 127735 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 177 tctgagccttacttccttgtc 197 ||||||||||||||||||||| Sbjct: 21802 tctgagccttacttccttgtc 21822
>gb|AC116644.4| Homo sapiens BAC clone RP11-678J5 from 4, complete sequence Length = 75455 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 259 tccatgaaatcaatttgtctt 279 ||||||||||||||||||||| Sbjct: 45361 tccatgaaatcaatttgtctt 45341
>gb|AC158564.7| Mus musculus chromosome 8, clone RP24-373M3, complete sequence Length = 144461 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 386 aagttgggttttctggtttag 406 ||||||||||||||||||||| Sbjct: 2923 aagttgggttttctggtttag 2903
>gb|AC150569.2| Bos taurus BAC CH240-223K16 (Children's Hospital Oakland Research Institute Bovine BAC Library (male)) complete sequence Length = 186055 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 365 actttgaaatgtcatggagg 384 |||||||||||||||||||| Sbjct: 127159 actttgaaatgtcatggagg 127140
>gb|AC092494.2| Drosophila melanogaster clone BACR23I18, complete sequence Length = 172029 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 261 catgaaatcaatttgtcttc 280 |||||||||||||||||||| Sbjct: 60446 catgaaatcaatttgtcttc 60427
>gb|AC011251.6| Drosophila melanogaster clone BACR09F10, complete sequence Length = 173988 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 261 catgaaatcaatttgtcttc 280 |||||||||||||||||||| Sbjct: 100558 catgaaatcaatttgtcttc 100539
>gb|AF265215.1| Homo sapiens zinc finger protein 313 short isoform mRNA, complete cds Length = 753 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 ggacattccttggctgaaga 340 |||||||||||||||||||| Sbjct: 412 ggacattccttggctgaaga 393
>gb|CP000359.1| Deinococcus geothermalis DSM 11300, complete genome Length = 2467205 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 82 gtggggcactcggcgggcgc 101 |||||||||||||||||||| Sbjct: 914183 gtggggcactcggcgggcgc 914164
>gb|AC124435.5| Mus musculus BAC clone RP24-252A5 from chromosome 10, complete sequence Length = 160184 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 264 gaaatcaatttgtcttcttc 283 |||||||||||||||||||| Sbjct: 7892 gaaatcaatttgtcttcttc 7911
>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome Length = 5178466 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 234 cggcatgctggctgaagatg 253 |||||||||||||||||||| Sbjct: 1500833 cggcatgctggctgaagatg 1500852
>gb|AC140034.14| Medicago truncatula clone mth2-17g19, complete sequence Length = 83825 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 259 tccatgaaatcaatttgtct 278 |||||||||||||||||||| Sbjct: 13693 tccatgaaatcaatttgtct 13712
>emb|AL138823.14| Human DNA sequence from clone RP11-64J21 on chromosome 13 Contains part of a novel gene similar to tumour-associated hydroquinone (NADH) oxidase TNOX, a ribosomal protein L36 (RPL36) pseudogene and a CpG island, complete sequence Length = 175112 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 386 aagttgggttttctggttta 405 |||||||||||||||||||| Sbjct: 128880 aagttgggttttctggttta 128861
>dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, complete genome Length = 4940217 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 234 cggcatgctggctgaagatg 253 |||||||||||||||||||| Sbjct: 1319163 cggcatgctggctgaagatg 1319182
>gb|AE011759.1| Xanthomonas axonopodis pv. citri str. 306, section 137 of 469 of the complete genome Length = 10210 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 234 cggcatgctggctgaagatg 253 |||||||||||||||||||| Sbjct: 816 cggcatgctggctgaagatg 835
>gb|AC068408.9| Homo sapiens chromosome 18, clone RP11-612A1, complete sequence Length = 183583 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 acattccttggctgaagaat 342 |||||||||||||||||||| Sbjct: 124012 acattccttggctgaagaat 123993
>gb|AC021382.6|AC021382 Homo sapiens, clone RP11-26N15, complete sequence Length = 189806 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 acattccttggctgaagaat 342 |||||||||||||||||||| Sbjct: 158597 acattccttggctgaagaat 158616
>ref|XM_391911.2| PREDICTED: Apis mellifera similar to GA10180-PA (LOC408361), mRNA Length = 1224 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 335 tgaagaattactacaatttc 354 |||||||||||||||||||| Sbjct: 587 tgaagaattactacaatttc 606
>ref|XM_623785.1| PREDICTED: Apis mellifera similar to GA10180-PA (LOC408361), mRNA Length = 1243 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 335 tgaagaattactacaatttc 354 |||||||||||||||||||| Sbjct: 606 tgaagaattactacaatttc 625
>gb|AC154756.2| Mus musculus BAC clone RP23-114J15 from 13, complete sequence Length = 189515 Score = 40.1 bits (20), Expect = 5.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 356 gttttgatcactttgaaatgtcat 379 |||||||||||||||||| ||||| Sbjct: 158214 gttttgatcactttgaaaggtcat 158191
>gb|AE003568.4| Drosophila melanogaster chromosome X, section 71 of 74 of the complete sequence Length = 315815 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 261 catgaaatcaatttgtcttc 280 |||||||||||||||||||| Sbjct: 200538 catgaaatcaatttgtcttc 200519
>gb|AC118750.13| Mus musculus chromosome 10, clone RP24-198J23, complete sequence Length = 174226 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 264 gaaatcaatttgtcttcttc 283 |||||||||||||||||||| Sbjct: 28608 gaaatcaatttgtcttcttc 28589
>gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete genome Length = 4941439 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 234 cggcatgctggctgaagatg 253 |||||||||||||||||||| Sbjct: 1342754 cggcatgctggctgaagatg 1342773 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,339,260 Number of Sequences: 3902068 Number of extensions: 3339260 Number of successful extensions: 61770 Number of sequences better than 10.0: 42 Number of HSP's better than 10.0 without gapping: 42 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 61632 Number of HSP's gapped (non-prelim): 138 length of query: 417 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 395 effective length of database: 17,147,199,772 effective search space: 6773143909940 effective search space used: 6773143909940 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)