Clone Information

BLAST Search Result

Clone Name	bags24m16
Clone Library Name	barley_pub

No.	Definition	Score (bits)	E Value
1	gb\|AC096707.2\| Oryza sativa (japonica cultivar-group) chromosome...	145	2e-31
2	gb\|AC093955.2\| Oryza sativa (japonica cultivar-group) chromosome...	145	2e-31
3	dbj\|AP008211.1\| Oryza sativa (japonica cultivar-group) genomic D...	145	2e-31
4	ref\|NM_123479.2\| Arabidopsis thaliana unknown protein AT5G41140 ...	46	0.12
5	dbj\|AB010072.1\| Arabidopsis thaliana genomic DNA, chromosome 5, ...	46	0.12
6	ref\|NM_180555.2\| Arabidopsis thaliana unknown protein AT5G26600 ...	44	0.49
7	ref\|NM_203109.1\| Arabidopsis thaliana unknown protein AT5G26600 ...	44	0.49
8	gb\|AF058914.1\|F21E10 Arabidopsis thaliana BAC F21E10, complete s...	44	0.49
9	emb\|BX830606.1\|CNS0A071 Arabidopsis thaliana Full-length cDNA Co...	44	0.49
10	gb\|AE000516.2\| Mycobacterium tuberculosis CDC1551, complete genome	42	1.9
11	emb\|CT010577.7\| Mouse DNA sequence from clone RP23-318D14 on chr...	42	1.9
12	ref\|XM_661169.1\| Cryptosporidium hominis TU502 hypothetical prot...	42	1.9
13	emb\|BX842583.1\| Mycobacterium tuberculosis H37Rv complete genome...	42	1.9
14	emb\|BX248346.1\| Mycobacterium bovis subsp. bovis AF2122/97 compl...	42	1.9
15	ref\|XM_678619.1\| PREDICTED: Danio rerio similar to nuclear prela...	42	1.9
16	ref\|XM_702355.1\| PREDICTED: Danio rerio similar to nuclear prela...	42	1.9
17	ref\|XM_679212.1\| PREDICTED: Danio rerio similar to nuclear prela...	42	1.9
18	ref\|XM_628689.1\| Cryptosporidium parvum Iowa II hypothetical pro...	42	1.9
19	gb\|AY259514.1\| Periplaneta americana major allergen Per a 1.0105...	42	1.9
20	gb\|AC153935.2\| Mus musculus 10 BAC RP24-273A2 (Roswell Park Canc...	42	1.9
21	gb\|AC158607.7\| Mus musculus 10 BAC RP23-183G4 (Roswell Park Canc...	42	1.9
22	emb\|AL772362.8\| Zebrafish DNA sequence from clone CH211-173K16 i...	42	1.9
23	gb\|AD000016.1\|MSGY23 Mycobacterium tuberculosis sequence from cl...	42	1.9
24	gb\|AC153936.3\| Mus musculus 10 BAC RP24-114G19 (Roswell Park Can...	42	1.9
25	ref\|XM_808205.1\| Trypanosoma cruzi strain CL Brener hypothetical...	40	7.6
26	ref\|XM_809159.1\| Trypanosoma cruzi strain CL Brener hypothetical...	40	7.6
27	emb\|CR855994.1\| Wallaby DNA sequence from clone MEKBa-69G12, com...	40	7.6
28	emb\|AL354873.19\| Human DNA sequence from clone RP11-108K1 on chr...	40	7.6
29	ref\|XM_779483.1\| PREDICTED: Strongylocentrotus purpuratus simila...	40	7.6
30	gb\|AC104008.4\| Homo sapiens chromosome 8, clone RP11-192I2, comp...	40	7.6
31	dbj\|AB251575.1\| Oryzias latipes gene for mesp, complete cds	40	7.6
32	gb\|AC115836.5\| Homo sapiens chromosome 8, clone RP11-1069E10, co...	40	7.6
33	ref\|XM_372328.3\| PREDICTED: Homo sapiens similar to peptidylprol...	40	7.6
34	gb\|AC034103.7\|AC034103 Homo sapiens chromosome 15 clone CTD-3231...	40	7.6
35	gb\|AC068711.9\|AC068711 Homo sapiens chromosome 15 clone CTD-2644...	40	7.6
36	ref\|XM_343567.2\| PREDICTED: Rattus norvegicus solute carrier fam...	40	7.6
37	gb\|AC175466.2\| Gallus gallus BAC clone CH261-8A20 from chromosom...	40	7.6
38	emb\|BX276125.6\| Zebrafish DNA sequence from clone CH211-212B14 i...	40	7.6
39	gb\|AC174163.2\| Gallus gallus BAC clone CH261-69O1 from chromosom...	40	7.6
40	emb\|CR318628.8\| Zebrafish DNA sequence from clone DKEY-148N22 in...	40	7.6
41	emb\|CT009604.11\| Mouse DNA sequence from clone RP23-4J22 on chro...	40	7.6
42	emb\|AL844867.3\| Mouse DNA sequence from clone RP23-17B8 on chrom...	40	7.6
43	emb\|AL671993.7\| Mouse DNA sequence from clone RP23-428E5 on chro...	40	7.6

>gb|AC096707.2| Oryza sativa (japonica cultivar-group) chromosome 5 BAC clone
             OJ1583_A05, complete sequence
          Length = 126987

 Score =  145 bits (73), Expect = 2e-31
 Identities = 124/141 (87%)
 Strand = Plus / Minus

                                                                         
Query: 345   cagcacgaatcaatggtgagaatccaagagattttcttgctggtctttctacgaatattg 404
             |||||| ||||| ||| |||||||||||  ||||||||||||||||| |||  |||||||
Sbjct: 24951 cagcacaaatcagtggggagaatccaaggaattttcttgctggtcttgctagcaatattg 24892

                                                                         
Query: 405   ggttggacaagttccgtgctgccacacttgtttgtgcatcagttgctgctcgcactcgtg 464
             | ||||| || |||||||||||||||||||||||||||||||||||||||||||| ||| 
Sbjct: 24891 gattggataaattccgtgctgccacacttgtttgtgcatcagttgctgctcgcacacgtt 24832

                                  
Query: 465   cgtgtgtcttgcaatgctggg 485
             | |   |||||||||||||||
Sbjct: 24831 ctttgttcttgcaatgctggg 24811



 Score =  127 bits (64), Expect = 4e-26
 Identities = 100/112 (89%)
 Strand = Plus / Minus

                                                                         
Query: 218   agctaaggcagctatgcaagatatcaggagtaaaggtctcatttgacacagagaatgcac 277
             ||||||||||  |||||||||||||||| ||||||||||| ||||||||||||||||| |
Sbjct: 25198 agctaaggcaattatgcaagatatcaggtgtaaaggtctcttttgacacagagaatgctc 25139

                                                                 
Query: 278   gcgattctttctacagggcaacaacaggctttgttctggatgattgcagcag 329
             | ||||||||||| |||||  ||| |  ||||||||||||||||||||||||
Sbjct: 25138 gtgattctttctatagggcggcaataaactttgttctggatgattgcagcag 25087



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 54/63 (85%)
 Strand = Plus / Minus

                                                                         
Query: 488   ctagagattcagggaaaacgagcagaggcactagatgagcttgtgaagatttgtagaatt 547
             |||||||| || ||||||||  ||||||| |||||||||||    |||||||||||||||
Sbjct: 24723 ctagagatgcaaggaaaacggtcagaggctctagatgagctctcaaagatttgtagaatt 24664

                
Query: 548   cat 550
             |||
Sbjct: 24663 cat 24661



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 188   gtgggcgatattggccaatagattggtccgag 219
             |||||||| ||| || ||||||||||||||||
Sbjct: 26762 gtgggcgagattagcgaatagattggtccgag 26731

to top

>gb|AC093955.2| Oryza sativa (japonica cultivar-group) chromosome 5 BAC clone
             OJ1240_E09, complete sequence
          Length = 118742

 Score =  145 bits (73), Expect = 2e-31
 Identities = 124/141 (87%)
 Strand = Plus / Minus

                                                                         
Query: 345   cagcacgaatcaatggtgagaatccaagagattttcttgctggtctttctacgaatattg 404
             |||||| ||||| ||| |||||||||||  ||||||||||||||||| |||  |||||||
Sbjct: 80910 cagcacaaatcagtggggagaatccaaggaattttcttgctggtcttgctagcaatattg 80851

                                                                         
Query: 405   ggttggacaagttccgtgctgccacacttgtttgtgcatcagttgctgctcgcactcgtg 464
             | ||||| || |||||||||||||||||||||||||||||||||||||||||||| ||| 
Sbjct: 80850 gattggataaattccgtgctgccacacttgtttgtgcatcagttgctgctcgcacacgtt 80791

                                  
Query: 465   cgtgtgtcttgcaatgctggg 485
             | |   |||||||||||||||
Sbjct: 80790 ctttgttcttgcaatgctggg 80770



 Score =  127 bits (64), Expect = 4e-26
 Identities = 100/112 (89%)
 Strand = Plus / Minus

                                                                         
Query: 218   agctaaggcagctatgcaagatatcaggagtaaaggtctcatttgacacagagaatgcac 277
             ||||||||||  |||||||||||||||| ||||||||||| ||||||||||||||||| |
Sbjct: 81157 agctaaggcaattatgcaagatatcaggtgtaaaggtctcttttgacacagagaatgctc 81098

                                                                 
Query: 278   gcgattctttctacagggcaacaacaggctttgttctggatgattgcagcag 329
             | ||||||||||| |||||  ||| |  ||||||||||||||||||||||||
Sbjct: 81097 gtgattctttctatagggcggcaataaactttgttctggatgattgcagcag 81046



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 54/63 (85%)
 Strand = Plus / Minus

                                                                         
Query: 488   ctagagattcagggaaaacgagcagaggcactagatgagcttgtgaagatttgtagaatt 547
             |||||||| || ||||||||  ||||||| |||||||||||    |||||||||||||||
Sbjct: 80682 ctagagatgcaaggaaaacggtcagaggctctagatgagctctcaaagatttgtagaatt 80623

                
Query: 548   cat 550
             |||
Sbjct: 80622 cat 80620



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 188   gtgggcgatattggccaatagattggtccgag 219
             |||||||| ||| || ||||||||||||||||
Sbjct: 82721 gtgggcgagattagcgaatagattggtccgag 82690

to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  145 bits (73), Expect = 2e-31
 Identities = 124/141 (87%)
 Strand = Plus / Minus

                                                                            
Query: 345      cagcacgaatcaatggtgagaatccaagagattttcttgctggtctttctacgaatattg 404
                |||||| ||||| ||| |||||||||||  ||||||||||||||||| |||  |||||||
Sbjct: 13247335 cagcacaaatcagtggggagaatccaaggaattttcttgctggtcttgctagcaatattg 13247276

                                                                            
Query: 405      ggttggacaagttccgtgctgccacacttgtttgtgcatcagttgctgctcgcactcgtg 464
                | ||||| || |||||||||||||||||||||||||||||||||||||||||||| ||| 
Sbjct: 13247275 gattggataaattccgtgctgccacacttgtttgtgcatcagttgctgctcgcacacgtt 13247216

                                     
Query: 465      cgtgtgtcttgcaatgctggg 485
                | |   |||||||||||||||
Sbjct: 13247215 ctttgttcttgcaatgctggg 13247195



 Score =  127 bits (64), Expect = 4e-26
 Identities = 100/112 (89%)
 Strand = Plus / Minus

                                                                            
Query: 218      agctaaggcagctatgcaagatatcaggagtaaaggtctcatttgacacagagaatgcac 277
                ||||||||||  |||||||||||||||| ||||||||||| ||||||||||||||||| |
Sbjct: 13247582 agctaaggcaattatgcaagatatcaggtgtaaaggtctcttttgacacagagaatgctc 13247523

                                                                    
Query: 278      gcgattctttctacagggcaacaacaggctttgttctggatgattgcagcag 329
                | ||||||||||| |||||  ||| |  ||||||||||||||||||||||||
Sbjct: 13247522 gtgattctttctatagggcggcaataaactttgttctggatgattgcagcag 13247471



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 54/63 (85%)
 Strand = Plus / Minus

                                                                            
Query: 488      ctagagattcagggaaaacgagcagaggcactagatgagcttgtgaagatttgtagaatt 547
                |||||||| || ||||||||  ||||||| |||||||||||    |||||||||||||||
Sbjct: 13247107 ctagagatgcaaggaaaacggtcagaggctctagatgagctctcaaagatttgtagaatt 13247048

                   
Query: 548      cat 550
                |||
Sbjct: 13247047 cat 13247045



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                                
Query: 188      gtgggcgatattggccaatagattggtccgag 219
                |||||||| ||| || ||||||||||||||||
Sbjct: 13249146 gtgggcgagattagcgaatagattggtccgag 13249115

to top

>ref|NM_123479.2| Arabidopsis thaliana unknown protein AT5G41140 mRNA, complete cds
          Length = 3231

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 513  aggcactagatgagcttgtgaag 535
            |||||||||||||||||||||||
Sbjct: 1655 aggcactagatgagcttgtgaag 1677

to top

>dbj|AB010072.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MEE6
          Length = 83698

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 513   aggcactagatgagcttgtgaag 535
             |||||||||||||||||||||||
Sbjct: 60532 aggcactagatgagcttgtgaag 60554

to top

>ref|NM_180555.2| Arabidopsis thaliana unknown protein AT5G26600 transcript variant
           AT5G26600.1 mRNA, complete cds
          Length = 1617

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 524 gagcttgtgaagatttgtagaa 545
           ||||||||||||||||||||||
Sbjct: 777 gagcttgtgaagatttgtagaa 798

to top

>ref|NM_203109.1| Arabidopsis thaliana unknown protein AT5G26600 transcript variant
           AT5G26600.2 mRNA, complete cds
          Length = 2009

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 524 gagcttgtgaagatttgtagaa 545
           ||||||||||||||||||||||
Sbjct: 777 gagcttgtgaagatttgtagaa 798

to top

>gb|AF058914.1|F21E10 Arabidopsis thaliana BAC F21E10, complete sequence
          Length = 111767

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 524   gagcttgtgaagatttgtagaa 545
             ||||||||||||||||||||||
Sbjct: 20395 gagcttgtgaagatttgtagaa 20374

to top

>emb|BX830606.1|CNS0A071 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB93ZF09 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1617

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 524 gagcttgtgaagatttgtagaa 545
           ||||||||||||||||||||||
Sbjct: 777 gagcttgtgaagatttgtagaa 798

to top

>gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome
          Length = 4403837

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 59      gctgcctccggccagccgcgt 79
               |||||||||||||||||||||
Sbjct: 4012364 gctgcctccggccagccgcgt 4012344

to top

>emb|CT010577.7| Mouse DNA sequence from clone RP23-318D14 on chromosome 14, complete
              sequence
          Length = 195351

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 325    agcagcagaagatatggggac 345
              |||||||||||||||||||||
Sbjct: 128441 agcagcagaagatatggggac 128461

to top

>ref|XM_661169.1| Cryptosporidium hominis TU502 hypothetical protein (Chro.70609)
           partial mRNA
          Length = 5061

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 519 tagatgagcttgtgaagattt 539
           |||||||||||||||||||||
Sbjct: 629 tagatgagcttgtgaagattt 649

to top

>emb|BX842583.1| Mycobacterium tuberculosis H37Rv complete genome; segment 12/13
          Length = 349606

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 59     gctgcctccggccagccgcgt 79
              |||||||||||||||||||||
Sbjct: 203048 gctgcctccggccagccgcgt 203028

to top

>emb|BX248346.1| Mycobacterium bovis subsp. bovis AF2122/97 complete genome; segment 13/14
          Length = 316050

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 59     gctgcctccggccagccgcgt 79
              |||||||||||||||||||||
Sbjct: 212439 gctgcctccggccagccgcgt 212419

to top

>ref|XM_678619.1| PREDICTED: Danio rerio similar to nuclear prelamin A recognition
           factor-like (LOC555956), mRNA
          Length = 1434

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 26  gaaggaggtggtggtgtctgtatcg 50
           ||||| |||||||||||||||||||
Sbjct: 327 gaaggtggtggtggtgtctgtatcg 351

to top

>ref|XM_702355.1| PREDICTED: Danio rerio similar to nuclear prelamin A recognition
           factor-like (predicted), transcript variant 2
           (LOC560541), mRNA
          Length = 1842

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 26  gaaggaggtggtggtgtctgtatcg 50
           ||||| |||||||||||||||||||
Sbjct: 254 gaaggtggtggtggtgtctgtatcg 278

to top

>ref|XM_679212.1| PREDICTED: Danio rerio similar to nuclear prelamin A recognition
           factor-like (predicted), transcript variant 1
           (LOC560541), mRNA
          Length = 1927

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 26  gaaggaggtggtggtgtctgtatcg 50
           ||||| |||||||||||||||||||
Sbjct: 324 gaaggtggtggtggtgtctgtatcg 348

to top

>ref|XM_628689.1| Cryptosporidium parvum Iowa II hypothetical protein (cgd7_5480),
            partial mRNA
          Length = 6972

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 519  tagatgagcttgtgaagattt 539
            |||||||||||||||||||||
Sbjct: 2540 tagatgagcttgtgaagattt 2560

to top

>gb|AY259514.1| Periplaneta americana major allergen Per a 1.0105 mRNA, partial
          cds
          Length = 579

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 1  ttcggcacgaggggagcatgg 21
          |||||||||||||||||||||
Sbjct: 4  ttcggcacgaggggagcatgg 24

to top

>gb|AC153935.2| Mus musculus 10 BAC RP24-273A2 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 169237

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 91    caaggaaggtcaggaggaagg 111
             |||||||||||||||||||||
Sbjct: 89698 caaggaaggtcaggaggaagg 89718

to top

>gb|AC158607.7| Mus musculus 10 BAC RP23-183G4 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 205308

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 91    caaggaaggtcaggaggaagg 111
             |||||||||||||||||||||
Sbjct: 30645 caaggaaggtcaggaggaagg 30625

to top

>emb|AL772362.8| Zebrafish DNA sequence from clone CH211-173K16 in linkage group 13,
              complete sequence
          Length = 165993

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 26     gaaggaggtggtggtgtctgtatcg 50
              ||||| |||||||||||||||||||
Sbjct: 115035 gaaggtggtggtggtgtctgtatcg 115011

to top

>gb|AD000016.1|MSGY23 Mycobacterium tuberculosis sequence from clone y23
          Length = 40806

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 59    gctgcctccggccagccgcgt 79
             |||||||||||||||||||||
Sbjct: 17292 gctgcctccggccagccgcgt 17312

to top

>gb|AC153936.3| Mus musculus 10 BAC RP24-114G19 (Roswell Park Cancer Institute
             (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 170723

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 91    caaggaaggtcaggaggaagg 111
             |||||||||||||||||||||
Sbjct: 29777 caaggaaggtcaggaggaagg 29797

to top

>ref|XM_808205.1| Trypanosoma cruzi strain CL Brener hypothetical protein
           (Tc00.1047053508027.80) partial mRNA
          Length = 3666

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 164 ggaactggggcaagaggcgg 183
           ||||||||||||||||||||
Sbjct: 956 ggaactggggcaagaggcgg 937

to top

>ref|XM_809159.1| Trypanosoma cruzi strain CL Brener hypothetical protein
           (Tc00.1047053506635.30) partial mRNA
          Length = 3663

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 164 ggaactggggcaagaggcgg 183
           ||||||||||||||||||||
Sbjct: 956 ggaactggggcaagaggcgg 937

to top

>emb|CR855994.1| Wallaby DNA sequence from clone MEKBa-69G12, complete sequence
          Length = 174698

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 20     gggagggaaggaggtggtgg 39
              ||||||||||||||||||||
Sbjct: 125410 gggagggaaggaggtggtgg 125429

to top

>emb|AL354873.19| Human DNA sequence from clone RP11-108K1 on chromosome 10 Contains a
              peptidylprolyl isomerase A (cyclophilin A) (PPIA)
              pseudogene, the 5' end of the ABLIM1 gene for actin binding
              LIM protein 1 and a CpG island, complete sequence
          Length = 187344

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 374    gattttcttgctggtctttc 393
              ||||||||||||||||||||
Sbjct: 149936 gattttcttgctggtctttc 149955

to top

>ref|XM_779483.1| PREDICTED: Strongylocentrotus purpuratus similar to CG6650-PA
           (LOC579363), mRNA
          Length = 1902

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 33  gtggtggtgtctgtatcgtctcct 56
           |||||||||||||| |||||||||
Sbjct: 722 gtggtggtgtctgtttcgtctcct 699

to top

>gb|AC104008.4| Homo sapiens chromosome 8, clone RP11-192I2, complete sequence
          Length = 129898

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 9      gaggggagcatgggagggaaggag 32
              |||||||| |||||||||||||||
Sbjct: 108838 gaggggagaatgggagggaaggag 108815

to top

>dbj|AB251575.1| Oryzias latipes gene for mesp, complete cds
          Length = 153079

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 305    gctttgttctggatgattgcagca 328
              |||||||||| |||||||||||||
Sbjct: 118134 gctttgttcttgatgattgcagca 118157

to top

>gb|AC115836.5| Homo sapiens chromosome 8, clone RP11-1069E10, complete sequence
          Length = 107374

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 9     gaggggagcatgggagggaaggag 32
             |||||||| |||||||||||||||
Sbjct: 57818 gaggggagaatgggagggaaggag 57795

to top

>ref|XM_372328.3| PREDICTED: Homo sapiens similar to peptidylprolyl isomerase A
           isoform 1 (LOC390006), mRNA
          Length = 822

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 374 gattttcttgctggtctttc 393
           ||||||||||||||||||||
Sbjct: 645 gattttcttgctggtctttc 626

to top

>gb|AC034103.7|AC034103 Homo sapiens chromosome 15 clone CTD-3231F14 map 15q21.2, complete
              sequence
          Length = 165416

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 17     catgggagggaaggaggtgg 36
              ||||||||||||||||||||
Sbjct: 148045 catgggagggaaggaggtgg 148064

to top

>gb|AC068711.9|AC068711 Homo sapiens chromosome 15 clone CTD-2644F13 map 15q21.3, complete
             sequence
          Length = 154883

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 17    catgggagggaaggaggtgg 36
             ||||||||||||||||||||
Sbjct: 31700 catgggagggaaggaggtgg 31719

to top

>ref|XM_343567.2| PREDICTED: Rattus norvegicus solute carrier family 39 (zinc
           transporter), member 10 (predicted)
           (Slc39a10_predicted), mRNA
          Length = 2583

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 94  ggaaggtcaggaggaaggaa 113
           ||||||||||||||||||||
Sbjct: 764 ggaaggtcaggaggaaggaa 783

to top

>gb|AC175466.2| Gallus gallus BAC clone CH261-8A20 from chromosome ul, complete sequence
          Length = 233533

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 17     catgggagggaaggaggtgg 36
              ||||||||||||||||||||
Sbjct: 226668 catgggagggaaggaggtgg 226649

to top

>emb|BX276125.6| Zebrafish DNA sequence from clone CH211-212B14 in linkage group 19,
             complete sequence
          Length = 54430

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 23    agggaaggaggtggtggtgt 42
             ||||||||||||||||||||
Sbjct: 51977 agggaaggaggtggtggtgt 51996

to top

>gb|AC174163.2| Gallus gallus BAC clone CH261-69O1 from chromosome ul, complete sequence
          Length = 178322

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 17     catgggagggaaggaggtgg 36
              ||||||||||||||||||||
Sbjct: 155306 catgggagggaaggaggtgg 155325

to top

>emb|CR318628.8| Zebrafish DNA sequence from clone DKEY-148N22 in linkage group 19,
             complete sequence
          Length = 115655

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 23    agggaaggaggtggtggtgt 42
             ||||||||||||||||||||
Sbjct: 43283 agggaaggaggtggtggtgt 43264

to top

>emb|CT009604.11| Mouse DNA sequence from clone RP23-4J22 on chromosome 13, complete
             sequence
          Length = 209356

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 220   ctaaggcagctatgcaagat 239
             ||||||||||||||||||||
Sbjct: 38639 ctaaggcagctatgcaagat 38620

to top

>emb|AL844867.3| Mouse DNA sequence from clone RP23-17B8 on chromosome X, complete
              sequence
          Length = 175256

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 493    gattcagggaaaacgagcag 512
              ||||||||||||||||||||
Sbjct: 149460 gattcagggaaaacgagcag 149441

to top

>emb|AL671993.7| Mouse DNA sequence from clone RP23-428E5 on chromosome X, complete
             sequence
          Length = 194106

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 105   aggaaggaaccacagggaag 124
             ||||||||||||||||||||
Sbjct: 13155 aggaaggaaccacagggaag 13136


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,928,756
Number of Sequences: 3902068
Number of extensions: 4928756
Number of successful extensions: 109684
Number of sequences better than 10.0: 43
Number of HSP's better than 10.0 without gapping: 43
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 109567
Number of HSP's gapped (non-prelim): 111
length of query: 561
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 538
effective length of database: 17,143,297,704
effective search space: 9223094164752
effective search space used: 9223094164752
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

to top

full-length cDNA and EST

Clone Information

BLAST Search Result