>gb|AY108613.1| Zea mays PCO091786 mRNA sequence
          Length = 597

 Score = 71.9 bits (36), Expect = 9e-10
 Identities = 95/115 (82%)
 Strand = Plus / Plus

                                                                       
Query: 71  gtgcgacatcaagtgccaacatcataaagttccggcgaggaagaaacagtgcgtcgacga 130
           |||||||||||||||||| ||||| |  |  ||||| |||| | | |||||||| || ||
Sbjct: 144 gtgcgacatcaagtgccagcatcacagcgacccggccaggaggcagcagtgcgtggatga 203

                                                                  
Query: 131 gtgccacagccgggagcatcatcacccaagcagggcgtcttgcgagaggaantgt 185
           |||||| ||||||||||| |||||||| ||||| | || |||||||| ||| |||
Sbjct: 204 gtgccatagccgggagcaccatcaccctagcagagagttttgcgagatgaagtgt 258

>gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence
          Length = 3694126

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 36     gtcggccggcccgtcgatga 55
              ||||||||||||||||||||
Sbjct: 232442 gtcggccggcccgtcgatga 232423

>gb|AC002553.2| Homo sapiens chromosome , clone CTC-529I10, complete sequence
          Length = 158314

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 75    gacatcaagtgccaacatca 94
             ||||||||||||||||||||
Sbjct: 60849 gacatcaagtgccaacatca 60868

>gb|AE004725.1| Pseudomonas aeruginosa PAO1, section 286 of 529 of the complete
            genome
          Length = 10218

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 38   cggccggcccgtcgatgatc 57
            ||||||||||||||||||||
Sbjct: 1442 cggccggcccgtcgatgatc 1423


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,401,497
Number of Sequences: 3902068
Number of extensions: 1401497
Number of successful extensions: 26532
Number of sequences better than 10.0: 4
Number of HSP's better than 10.0 without gapping: 4
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 26503
Number of HSP's gapped (non-prelim): 28
length of query: 248
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 226
effective length of database: 17,147,199,772
effective search space: 3875267148472
effective search space used: 3875267148472
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)