ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | bags22m17 |
|---|---|
| Clone Library Name | barley_pub |
>emb|X75778.1|ASTCPP1A A.sativa (Pewi) ASTCP-K36 mRNA for t complex polypeptide 1 Length = 2022 Score = 852 bits (430), Expect = 0.0 Identities = 523/554 (94%) Strand = Plus / Plus Query: 1 cttgggaaggccggattagtccgagagaagtcatttggaacaacaaaagatcggatgctt 60 ||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct: 1177 cttgggaaggctggattagtcagagagaagtcatttggaacaacaaaagatcggatgcta 1236 Query: 61 tacatcgagaagtgtgccaattccaaagctgtaactattttcatccgcggtggcaacaaa 120 ||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| Sbjct: 1237 tacatcgagaagtgtgccaattccaaagctgtaactattttcatccgtgggggcaacaaa 1296 Query: 121 atgatgattgaggagaccaagcgaagtattcatgatgctctatgtgttgcaaggaatctg 180 |||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| Sbjct: 1297 atgatgattgaggagaccaagcgaagtattcatgatgcgctttgtgttgcaaggaatctc 1356 Query: 181 atcatcaacaactcaattgtgtatggtggtggctcagcagaaatatcttgctcaattgct 240 ||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| Sbjct: 1357 atcatcaacaactcaattgtgtatggtggtggctcagcagagatatcttgctcgattgct 1416 Query: 241 gttgacgctgcagcagatcggcatcctggagttgagcagtatgcaatcagggcatttgct 300 ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||||||||| Sbjct: 1417 gttgaagctgctgcagatcggcatcctggagttgaacagtatgcaatcagggcatttgct 1476 Query: 301 gatgctttggatgccattccactagctttagctgaaaacagtggtttggcacctattgat 360 |||||||||||||| |||||| | |||||||||||||||||||||||| ||||||||||| Sbjct: 1477 gatgctttggatgctattccattggctttagctgaaaacagtggtttgccacctattgat 1536 Query: 361 actctcaccgtcgtaaaatctcaacacgtcaaggagaacaattcccgctgtggcatcgat 420 ||||| ||||| |||||||||||||| ||||||||||||||||| || || ||||| ||| Sbjct: 1537 actctgaccgtggtaaaatctcaacatgtcaaggagaacaattctcgttgcggcattgat 1596 Query: 421 tgcaatgatgttggtaccaacgacatgaaagagcagaatgttttcgagactctgatcggc 480 ||||||||||| |||||||| |||||||||||||||||||||||||| |||||||| ||| Sbjct: 1597 tgcaatgatgtgggtaccaatgacatgaaagagcagaatgttttcgaaactctgattggc 1656 Query: 481 aagcagcagcagatcttgctggcaacacaggttgtcaagatgatcctcaagatcgatgat 540 |||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| Sbjct: 1657 aagcagcagcagatcttgctggcaacccaggtcgtcaagatgatcctcaagatcgatgat 1716 Query: 541 gttataacgccttc 554 ||||| |||||||| Sbjct: 1717 gttatcacgccttc 1730
>emb|X75777.1|ASTCPP1 A.sativa (Pewi) ASTCP-K19 mRNA for t complex polypeptide 1 Length = 2039 Score = 833 bits (420), Expect = 0.0 Identities = 528/564 (93%) Strand = Plus / Plus Query: 1 cttgggaaggccggattagtccgagagaagtcatttggaacaacaaaagatcggatgctt 60 ||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 1152 cttgggaaggctggattagtcagagagaagtcatttggaacaacaaaagatcggatgctt 1211 Query: 61 tacatcgagaagtgtgccaattccaaagctgtaactattttcatccgcggtggcaacaaa 120 |||||||| |||||||||||||||||||||||||||||||||||||| || || |||||| Sbjct: 1212 tacatcgaaaagtgtgccaattccaaagctgtaactattttcatccgtggaggtaacaaa 1271 Query: 121 atgatgattgaggagaccaagcgaagtattcatgatgctctatgtgttgcaaggaatctg 180 ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 1272 atgatgattgaggagaccaagcgaagtattcatgatgctctttgtgttgcaaggaatctc 1331 Query: 181 atcatcaacaactcaattgtgtatggtggtggctcagcagaaatatcttgctcaattgct 240 ||||||||||||||||| |||||||||||||| |||||||| ||||||||||| |||||| Sbjct: 1332 atcatcaacaactcaatcgtgtatggtggtggttcagcagagatatcttgctcgattgct 1391 Query: 241 gttgacgctgcagcagatcggcatcctggagttgagcagtatgcaatcagggcatttgct 300 ||||| ||||| || ||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1392 gttgaagctgctgctgatcggcatcctggagttgagcagtatgcaatcagggcatttgct 1451 Query: 301 gatgctttggatgccattccactagctttagctgaaaacagtggtttggcacctattgat 360 |||||||||||||| |||||||| |||||||||||||||||||||||| ||||||||||| Sbjct: 1452 gatgctttggatgctattccactggctttagctgaaaacagtggtttgccacctattgat 1511 Query: 361 actctcaccgtcgtaaaatctcaacacgtcaaggagaacaattcccgctgtggcatcgat 420 ||||| || || |||||||| ||||| ||||||||||||||||||||||| ||||| || Sbjct: 1512 actctgacagtggtaaaatcccaacatgtcaaggagaacaattcccgctgcggcattgac 1571 Query: 421 tgcaatgatgttggtaccaacgacatgaaagagcagaatgttttcgagactctgatcggc 480 ||||| ||||| |||||||| ||||||||||||||||||||||| || |||||||| ||| Sbjct: 1572 tgcaacgatgtgggtaccaatgacatgaaagagcagaatgtttttgaaactctgattggc 1631 Query: 481 aagcagcagcagatcttgctggcaacacaggttgtcaagatgatcctcaagatcgatgat 540 |||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| Sbjct: 1632 aagcagcagcagatcttgctggcaacccaggtcgtcaagatgatcctcaagatcgatgat 1691 Query: 541 gttataacgccttccgagtattga 564 ||||| ||||||||||| |||||| Sbjct: 1692 gttatcacgccttccgaatattga 1715
>dbj|AK105701.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-201-D07, full insert sequence Length = 2088 Score = 567 bits (286), Expect = e-158 Identities = 496/566 (87%) Strand = Plus / Plus Query: 1 cttgggaaggccggattagtccgagagaagtcatttggaacaacaaaagatcggatgctt 60 ||||||||||| ||| ||||| ||||||| ||||||||||||||||||||||| |||||| Sbjct: 1138 cttgggaaggctggagtagtcagagagaaatcatttggaacaacaaaagatcgcatgctt 1197 Query: 61 tacatcgagaagtgtgccaattccaaagctgtaactattttcatccgcggtggcaacaaa 120 ||||| || |||||||||| |||| |||||||||||| ||||| || |||||||||||| Sbjct: 1198 tacattgaacagtgtgccaactccagagctgtaactatcttcatacgtggtggcaacaaa 1257 Query: 121 atgatgattgaggagaccaagcgaagtattcatgatgctctatgtgttgcaaggaatctg 180 ||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| Sbjct: 1258 atgatgattgaggagaccaagcgaagtcttcatgatgctctttgtgttgcaaggaatctt 1317 Query: 181 atcatcaacaactcaattgtgtatggtggtggctcagcagaaatatcttgctcaattgct 240 ||| || || |||||||||||||||||||| ||||||||||||||||||||| ||||| Sbjct: 1318 atccgtaataattcaattgtgtatggtggtggttcagcagaaatatcttgctcagttgct 1377 Query: 241 gttgacgctgcagcagatcggcatcctggagttgagcagtatgcaatcagggcatttgct 300 ||||| ||||| ||||||||| | || |||||||| ||||||||||||||| |||||||| Sbjct: 1378 gttgaagctgctgcagatcggtacccaggagttgaacagtatgcaatcaggtcatttgct 1437 Query: 301 gatgctttggatgccattccactagctttagctgaaaacagtggtttggcacctattgat 360 ||||| |||||||| ||||||||||| || || ||||||||||||||| | ||||||||| Sbjct: 1438 gatgcgttggatgctattccactagccttggccgaaaacagtggtttgtctcctattgat 1497 Query: 361 actctcaccgtcgtaaaatctcaacacgtcaaggagaacaattcccgctgtggcatcgat 420 || || || | |||||||||||||| || ||||||| |||| | | ||||||||| || Sbjct: 1498 acactgacagcagtaaaatctcaacaagtaaaggagagcaatcctcactgtggcattgac 1557 Query: 421 tgcaatgatgttggtaccaacgacatgaaagagcagaatgttttcgagactctgatcggc 480 ||||| |||||||| || ||| ||||||| || || |||||||| || || ||||| ||| Sbjct: 1558 tgcaacgatgttgggacaaaccacatgaaggaacaaaatgtttttgaaacactgataggc 1617 Query: 481 aagcagcagcagatcttgctggcaacacaggttgtcaagatgatcctcaagatcgatgat 540 ||||||||||||||||| |||||||| ||||| || |||||||| ||||||||||||||| Sbjct: 1618 aagcagcagcagatcttactggcaacccaggtggtgaagatgattctcaagatcgatgat 1677 Query: 541 gttataacgccttccgagtattgatg 566 ||||| ||||||| || |||||||| Sbjct: 1678 gttatctcgccttctgactattgatg 1703
>dbj|AK067114.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013095K16, full insert sequence Length = 2100 Score = 567 bits (286), Expect = e-158 Identities = 496/566 (87%) Strand = Plus / Plus Query: 1 cttgggaaggccggattagtccgagagaagtcatttggaacaacaaaagatcggatgctt 60 ||||||||||| ||| ||||| ||||||| ||||||||||||||||||||||| |||||| Sbjct: 1152 cttgggaaggctggaatagtcagagagaaatcatttggaacaacaaaagatcgcatgctt 1211 Query: 61 tacatcgagaagtgtgccaattccaaagctgtaactattttcatccgcggtggcaacaaa 120 ||||| || |||||||||| |||| |||||||||||| ||||| || |||||||||||| Sbjct: 1212 tacattgaacagtgtgccaactccagagctgtaactatcttcatacgtggtggcaacaaa 1271 Query: 121 atgatgattgaggagaccaagcgaagtattcatgatgctctatgtgttgcaaggaatctg 180 ||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| Sbjct: 1272 atgatgattgaggagaccaagcgaagtcttcatgatgctctttgtgttgcaaggaatctt 1331 Query: 181 atcatcaacaactcaattgtgtatggtggtggctcagcagaaatatcttgctcaattgct 240 ||| || || |||||||||||||||||||| ||||||||||||||||||||| ||||| Sbjct: 1332 atccgtaataattcaattgtgtatggtggtggttcagcagaaatatcttgctcagttgct 1391 Query: 241 gttgacgctgcagcagatcggcatcctggagttgagcagtatgcaatcagggcatttgct 300 ||||| ||||| ||||||||| | || |||||||| ||||||||||||||| |||||||| Sbjct: 1392 gttgaagctgctgcagatcggtacccaggagttgaacagtatgcaatcaggtcatttgct 1451 Query: 301 gatgctttggatgccattccactagctttagctgaaaacagtggtttggcacctattgat 360 ||||| |||||||| ||||||||||| || || ||||||||||||||| | ||||||||| Sbjct: 1452 gatgcgttggatgctattccactagccttggccgaaaacagtggtttgtctcctattgat 1511 Query: 361 actctcaccgtcgtaaaatctcaacacgtcaaggagaacaattcccgctgtggcatcgat 420 || || || | |||||||||||||| || ||||||| |||| | | ||||||||| || Sbjct: 1512 acactgacagcagtaaaatctcaacaagtaaaggagagcaatcctcactgtggcattgac 1571 Query: 421 tgcaatgatgttggtaccaacgacatgaaagagcagaatgttttcgagactctgatcggc 480 ||||| |||||||| || ||| ||||||| || || |||||||| || || ||||| ||| Sbjct: 1572 tgcaacgatgttgggacaaaccacatgaaggaacaaaatgtttttgaaacactgataggc 1631 Query: 481 aagcagcagcagatcttgctggcaacacaggttgtcaagatgatcctcaagatcgatgat 540 ||||||||||||||||| |||||||| ||||| || |||||||| ||||||||||||||| Sbjct: 1632 aagcagcagcagatcttactggcaacccaggtggtgaagatgattctcaagatcgatgat 1691 Query: 541 gttataacgccttccgagtattgatg 566 ||||| ||||||| || |||||||| Sbjct: 1692 gttatctcgccttctgactattgatg 1717
>gb|AY103729.1| Zea mays PCO099347 mRNA sequence Length = 2083 Score = 464 bits (234), Expect = e-127 Identities = 465/542 (85%) Strand = Plus / Plus Query: 1 cttgggaaggccggattagtccgagagaagtcatttggaacaacaaaagatcggatgctt 60 ||||||||||| ||||||||| ||||||| ||||| ||||||||||| || |||||||| Sbjct: 1165 cttgggaaggctggattagtcagagagaaatcattcggaacaacaaaggacaggatgctt 1224 Query: 61 tacatcgagaagtgtgccaattccaaagctgtaactattttcatccgcggtggcaacaaa 120 ||||| ||| ||||||||||||||| |||||||||||| ||||| || ||||| |||||| Sbjct: 1225 tacattgagcagtgtgccaattccagagctgtaactatcttcattcgtggtggaaacaaa 1284 Query: 121 atgatgattgaggagaccaagcgaagtattcatgatgctctatgtgttgcaaggaatctg 180 ||||||||||||||||||||||| ||| ||||||||||||| || || |||||||||||| Sbjct: 1285 atgatgattgaggagaccaagcgcagtcttcatgatgctctttgcgtggcaaggaatctg 1344 Query: 181 atcatcaacaactcaattgtgtatggtggtggctcagcagaaatatcttgctcaattgct 240 ||| || |||||||||||||| ||||| |||||||| || |||||||||||||||||| Sbjct: 1345 atccggaataactcaattgtgtacggtggcggctcagccgagatatcttgctcaattgct 1404 Query: 241 gttgacgctgcagcagatcggcatcctggagttgagcagtatgcaatcagggcatttgct 300 ||||| |||| |||||| |||| || ||||||||||||||||| |||||| |||| ||| Sbjct: 1405 gttgaaactgctgcagataggcacccgggagttgagcagtatgctatcaggtcattcgct 1464 Query: 301 gatgctttggatgccattccactagctttagctgaaaacagtggtttggcacctattgat 360 ||||| || ||||| |||||||||| || || ||||||||||||||| |||| |||||| Sbjct: 1465 gatgcattagatgctgttccactagcgttggccgaaaacagtggtttgtcaccaattgat 1524 Query: 361 actctcaccgtcgtaaaatctcaacacgtcaaggagaacaattcccgctgtggcatcgat 420 || | || | |||||| ||||||| |||||||||| ||| ||| ||| ||||| || Sbjct: 1525 accttaactgcggtaaaagctcaacaagtcaaggagagcaacccccactgcggcatagac 1584 Query: 421 tgcaatgatgttggtaccaacgacatgaaagagcagaatgttttcgagactctgatcggc 480 ||||| || ||||| |||| |||||||||||| ||||| || |||||||| ||||| ||| Sbjct: 1585 tgcaacgacgttggcaccaccgacatgaaagaacagaacgtcttcgagaccctgattggc 1644 Query: 481 aagcagcagcagatcttgctggcaacacaggttgtcaagatgatcctcaagatcgatgat 540 |||||||| ||||||||||| || || ||||| || ||||||||||| |||||||| ||| Sbjct: 1645 aagcagcaacagatcttgcttgccacccaggtggtgaagatgatcctgaagatcgacgat 1704 Query: 541 gt 542 || Sbjct: 1705 gt 1706
>gb|BT017463.1| Zea mays clone EL01N0407F08.c mRNA sequence Length = 710 Score = 293 bits (148), Expect = 4e-76 Identities = 313/368 (85%) Strand = Plus / Plus Query: 169 gcaaggaatctgatcatcaacaactcaattgtgtatggtggtggctcagcagaaatatct 228 ||||||||||||||| ||||||||||| ||||| || |||||||||||||| |||||| Sbjct: 12 gcaaggaatctgatccggaacaactcaatcgtgtacggcggtggctcagcagagatatct 71 Query: 229 tgctcaattgctgttgacgctgcagcagatcggcatcctggagttgagcagtatgcaatc 288 ||||||||||||||||| |||| ||||||||||| ||||||||||||||||| || ||| Sbjct: 72 tgctcaattgctgttgaaactgctgcagatcggcaccctggagttgagcagtacgctatc 131 Query: 289 agggcatttgctgatgctttggatgccattccactagctttagctgaaaacagtggtttg 348 ||| |||| |||||||| || ||||| |||||||||| || |||||||||||||||||| Sbjct: 132 aggtcattcgctgatgcattagatgctgttccactagccttggctgaaaacagtggtttg 191 Query: 349 gcacctattgatactctcaccgtcgtaaaatctcaacacgtcaaggagaacaattcccgc 408 | || |||||||| | || | |||||| |||| || || ||||||| ||| ||| | Sbjct: 192 tcgccaattgataccttgacggcggtaaaagctcagcaagttaaggagagcaacccccac 251 Query: 409 tgtggcatcgattgcaatgatgttggtaccaacgacatgaaagagcagaatgttttcgag 468 || ||||| || ||||| ||||| || ||||||||||||||||||||||| || || ||| Sbjct: 252 tgcggcatagactgcaacgatgtaggcaccaacgacatgaaagagcagaacgtctttgag 311 Query: 469 actctgatcggcaagcagcagcagatcttgctggcaacacaggttgtcaagatgatcctc 528 || ||||| |||||||||||||||||| |||| ||||| ||||| || ||||||||||| Sbjct: 312 accctgattggcaagcagcagcagatcctgctagcaactcaggtggtgaagatgatcctg 371 Query: 529 aagatcga 536 |||||||| Sbjct: 372 aagatcga 379
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 206 bits (104), Expect = 6e-50 Identities = 149/164 (90%) Strand = Plus / Minus Query: 112 ggcaacaaaatgatgattgaggagaccaagcgaagtattcatgatgctctatgtgttgca 171 |||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||| Sbjct: 21251614 ggcaacaaaatgatgattgaggagaccaagcgaagtcttcatgatgctctttgtgttgca 21251555 Query: 172 aggaatctgatcatcaacaactcaattgtgtatggtggtggctcagcagaaatatcttgc 231 |||||||| ||| || || |||||||||||||||||||| |||||||||||||||||| Sbjct: 21251554 aggaatcttatccgtaataattcaattgtgtatggtggtggttcagcagaaatatcttgc 21251495 Query: 232 tcaattgctgttgacgctgcagcagatcggcatcctggagttga 275 ||| |||||||||| ||||| ||||||||| | || |||||||| Sbjct: 21251494 tcagttgctgttgaagctgctgcagatcggtacccaggagttga 21251451 Score = 141 bits (71), Expect = 3e-30 Identities = 137/159 (86%) Strand = Plus / Minus Query: 408 ctgtggcatcgattgcaatgatgttggtaccaacgacatgaaagagcagaatgttttcga 467 ||||||||| || ||||| |||||||| || ||| ||||||| || || |||||||| || Sbjct: 21250967 ctgtggcattgactgcaacgatgttgggacaaaccacatgaaggaacaaaatgtttttga 21250908 Query: 468 gactctgatcggcaagcagcagcagatcttgctggcaacacaggttgtcaagatgatcct 527 || ||||| |||||||||||||||||||| |||||||| ||||| || |||||||| || Sbjct: 21250907 aacactgataggcaagcagcagcagatcttactggcaacccaggtggtgaagatgattct 21250848 Query: 528 caagatcgatgatgttataacgccttccgagtattgatg 566 |||||||||||||||||| ||||||| || |||||||| Sbjct: 21250847 caagatcgatgatgttatctcgccttctgactattgatg 21250809 Score = 117 bits (59), Expect = 5e-23 Identities = 98/111 (88%) Strand = Plus / Minus Query: 276 gcagtatgcaatcagggcatttgctgatgctttggatgccattccactagctttagctga 335 |||||||||||||||| ||||||||||||| |||||||| ||||||||||| || || || Sbjct: 21251378 gcagtatgcaatcaggtcatttgctgatgcgttggatgctattccactagccttggccga 21251319 Query: 336 aaacagtggtttggcacctattgatactctcaccgtcgtaaaatctcaaca 386 ||||||||||||| | ||||||||||| || || | |||||||||||||| Sbjct: 21251318 aaacagtggtttgtctcctattgatacactgacagcagtaaaatctcaaca 21251268 Score = 107 bits (54), Expect = 4e-20 Identities = 93/106 (87%) Strand = Plus / Minus Query: 8 aggccggattagtccgagagaagtcatttggaacaacaaaagatcggatgctttacatcg 67 |||| ||| ||||| ||||||| ||||||||||||||||||||||| ||||||||||| | Sbjct: 21252155 aggctggaatagtcagagagaaatcatttggaacaacaaaagatcgcatgctttacattg 21252096 Query: 68 agaagtgtgccaattccaaagctgtaactattttcatccgcggtgg 113 | |||||||||| |||| |||||||||||| ||||| || ||||| Sbjct: 21252095 aacagtgtgccaactccagagctgtaactatcttcatacgtggtgg 21252050 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 49 gatcggatgctttacatcga 68 |||||||||||||||||||| Sbjct: 30375999 gatcggatgctttacatcga 30376018
>dbj|AP003714.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0656E03 Length = 181786 Score = 206 bits (104), Expect = 6e-50 Identities = 149/164 (90%) Strand = Plus / Minus Query: 112 ggcaacaaaatgatgattgaggagaccaagcgaagtattcatgatgctctatgtgttgca 171 |||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||| Sbjct: 46990 ggcaacaaaatgatgattgaggagaccaagcgaagtcttcatgatgctctttgtgttgca 46931 Query: 172 aggaatctgatcatcaacaactcaattgtgtatggtggtggctcagcagaaatatcttgc 231 |||||||| ||| || || |||||||||||||||||||| |||||||||||||||||| Sbjct: 46930 aggaatcttatccgtaataattcaattgtgtatggtggtggttcagcagaaatatcttgc 46871 Query: 232 tcaattgctgttgacgctgcagcagatcggcatcctggagttga 275 ||| |||||||||| ||||| ||||||||| | || |||||||| Sbjct: 46870 tcagttgctgttgaagctgctgcagatcggtacccaggagttga 46827 Score = 141 bits (71), Expect = 3e-30 Identities = 137/159 (86%) Strand = Plus / Minus Query: 408 ctgtggcatcgattgcaatgatgttggtaccaacgacatgaaagagcagaatgttttcga 467 ||||||||| || ||||| |||||||| || ||| ||||||| || || |||||||| || Sbjct: 46343 ctgtggcattgactgcaacgatgttgggacaaaccacatgaaggaacaaaatgtttttga 46284 Query: 468 gactctgatcggcaagcagcagcagatcttgctggcaacacaggttgtcaagatgatcct 527 || ||||| |||||||||||||||||||| |||||||| ||||| || |||||||| || Sbjct: 46283 aacactgataggcaagcagcagcagatcttactggcaacccaggtggtgaagatgattct 46224 Query: 528 caagatcgatgatgttataacgccttccgagtattgatg 566 |||||||||||||||||| ||||||| || |||||||| Sbjct: 46223 caagatcgatgatgttatctcgccttctgactattgatg 46185 Score = 117 bits (59), Expect = 5e-23 Identities = 98/111 (88%) Strand = Plus / Minus Query: 276 gcagtatgcaatcagggcatttgctgatgctttggatgccattccactagctttagctga 335 |||||||||||||||| ||||||||||||| |||||||| ||||||||||| || || || Sbjct: 46754 gcagtatgcaatcaggtcatttgctgatgcgttggatgctattccactagccttggccga 46695 Query: 336 aaacagtggtttggcacctattgatactctcaccgtcgtaaaatctcaaca 386 ||||||||||||| | ||||||||||| || || | |||||||||||||| Sbjct: 46694 aaacagtggtttgtctcctattgatacactgacagcagtaaaatctcaaca 46644 Score = 107 bits (54), Expect = 4e-20 Identities = 93/106 (87%) Strand = Plus / Minus Query: 8 aggccggattagtccgagagaagtcatttggaacaacaaaagatcggatgctttacatcg 67 |||| ||| ||||| ||||||| ||||||||||||||||||||||| ||||||||||| | Sbjct: 47531 aggctggaatagtcagagagaaatcatttggaacaacaaaagatcgcatgctttacattg 47472 Query: 68 agaagtgtgccaattccaaagctgtaactattttcatccgcggtgg 113 | |||||||||| |||| |||||||||||| ||||| || ||||| Sbjct: 47471 aacagtgtgccaactccagagctgtaactatcttcatacgtggtgg 47426
>gb|AF097668.1|AF097668 Mesembryanthemum crystallinum T-complex protein 1 epsilon subunit (TCP-1-EPSILON) mRNA, partial cds Length = 1458 Score = 163 bits (82), Expect = 9e-37 Identities = 229/278 (82%) Strand = Plus / Plus Query: 34 tttggaacaacaaaagatcggatgctttacatcgagaagtgtgccaattccaaagctgta 93 ||||| |||||||| ||| | ||||| || ||||| | ||||| ||||| | ||||| Sbjct: 727 tttggtacaacaaaggatagaatgctgtatatcgaacattgtgcaaattcaagggctgtt 786 Query: 94 actattttcatccgcggtggcaacaaaatgatgattgaggagaccaagcgaagtattcat 153 || |||||||| || ||||| |||||||||||| |||| ||||| ||| |||| |||||| Sbjct: 787 accattttcattcgtggtggtaacaaaatgatggttgaagagacaaagagaagcattcat 846 Query: 154 gatgctctatgtgttgcaaggaatctgatcatcaacaactcaattgtgtatggtggtggc 213 ||||| || |||||||| |||||||||||| ||| || || |||||||||||||||||| Sbjct: 847 gatgcactttgtgttgctaggaatctgatccgcaataattctattgtgtatggtggtggc 906 Query: 214 tcagcagaaatatcttgctcaattgctgttgacgctgcagcagatcggcatcctggagtt 273 || |||||||| ||||||| ||||||| || || || || || || | || |||||| Sbjct: 907 tctgcagaaattgcttgctctcttgctgtagaggccgctgctgaccgatacccaggagtt 966 Query: 274 gagcagtatgcaatcagggcatttgctgatgctttgga 311 ||||| ||||| |||||||| ||||||||||||||||| Sbjct: 967 gagcaatatgccatcagggcctttgctgatgctttgga 1004 Score = 107 bits (54), Expect = 4e-20 Identities = 141/170 (82%) Strand = Plus / Plus Query: 376 aaatctcaacacgtcaaggagaacaattcccgctgtggcatcgattgcaatgatgttggt 435 |||||||| || || |||||||||||| | ||||||| || || ||||| |||||||| Sbjct: 1069 aaatctcagcaagttaaggagaacaatccatgctgtggtatagactgcaacgatgttggc 1128 Query: 436 accaacgacatgaaagagcagaatgttttcgagactctgatcggcaagcagcagcagatc 495 || ||||||||| |||||||||||||||||||| |||| || ||| |||| ||| | Sbjct: 1129 acaaacgacatgcgtgagcagaatgttttcgagacattgattggaaagaagcaacagctt 1188 Query: 496 ttgctggcaacacaggttgtcaagatgatcctcaagatcgatgatgttat 545 |||||||| || |||||||| |||||||| | ||||||||||||||||| Sbjct: 1189 ttgctggctactcaggttgtgaagatgattttgaagatcgatgatgttat 1238
>emb|X85013.1|CSRNATCP1 C.sativus mRNA for T-complex polypeptide 1 Length = 2030 Score = 141 bits (71), Expect = 3e-30 Identities = 251/311 (80%) Strand = Plus / Plus Query: 1 cttgggaaggccggattagtccgagagaagtcatttggaacaacaaaagatcggatgctt 60 ||||| ||||| || || || ||||| || |||||||| |||||||||||||||||||| Sbjct: 1089 cttggaaaggctggcttggttcgagaaaaatcatttggtacaacaaaagatcggatgcta 1148 Query: 61 tacatcgagaagtgtgccaattccaaagctgtaactattttcatccgcggtggcaacaaa 120 ||||| || | ||||| ||||| | || || |||||||| ||||| || || |||||| Sbjct: 1149 tacattgaacattgtgcaaattcaagggccgtgactatttttatccgtggaggtaacaaa 1208 Query: 121 atgatgattgaggagaccaagcgaagtattcatgatgctctatgtgttgcaaggaatctg 180 |||||||| || ||||| || || ||||| ||||||||| ||||||| || || ||||| Sbjct: 1209 atgatgatagaagagacaaaacgcagtatccatgatgctttatgtgtggctagaaatctc 1268 Query: 181 atcatcaacaactcaattgtgtatggtggtggctcagcagaaatatcttgctcaattgct 240 || ||| ||||| || || || |||||||||||||| || || ||||| ||| ||||| Sbjct: 1269 attcgcaataactccatagtatacggtggtggctcagctgagatttcttgttcagttgct 1328 Query: 241 gttgacgctgcagcagatcggcatcctggagttgagcagtatgcaatcagggcatttgct 300 ||||| | || || ||| | |||||||||||||||||||| || |||||||||||| Sbjct: 1329 gttgagacagctgctgataaataccctggagttgagcagtatgctattagggcatttgct 1388 Query: 301 gatgctttgga 311 |||||| |||| Sbjct: 1389 gatgctctgga 1399 Score = 67.9 bits (34), Expect = 4e-08 Identities = 136/170 (80%) Strand = Plus / Plus Query: 373 gtaaaatctcaacacgtcaaggagaacaattcccgctgtggcatcgattgcaatgatgtt 432 ||||||||||| || | |||||||||||| | ||||| || || ||||||||| || Sbjct: 1461 gtaaaatctcagcaaattaaggagaacaatccttattgtggaattgactgcaatgatatt 1520 Query: 433 ggtaccaacgacatgaaagagcagaatgttttcgagactctgatcggcaagcagcagcag 492 || || || ||||||| ||||| || || || |||||| ||||||| ||||| || ||| Sbjct: 1521 ggcacaaatgacatgagggagcaaaacgtatttgagactttgatcggtaagcaacaacag 1580 Query: 493 atcttgctggcaacacaggttgtcaagatgatcctcaagatcgatgatgt 542 || || |||||||| ||||| || |||||||| || ||||| |||||||| Sbjct: 1581 attttactggcaactcaggtcgtgaagatgattctgaagattgatgatgt 1630
>ref|NM_102295.3| Arabidopsis thaliana ATP binding / protein binding AT1G24510 transcript variant AT1G24510.1 mRNA, complete cds Length = 1906 Score = 125 bits (63), Expect = 2e-25 Identities = 231/287 (80%) Strand = Plus / Plus Query: 25 gagaagtcatttggaacaacaaaagatcggatgctttacatcgagaagtgtgccaattcc 84 ||||| || ||||| ||||||||||| || ||||| || || ||| | ||||| || || Sbjct: 1173 gagaaatcttttggcacaacaaaagaacgaatgctgtatattgagcactgtgcgaactca 1232 Query: 85 aaagctgtaactattttcatccgcggtggcaacaaaatgatgattgaggagaccaagcga 144 |||||||| ||| |||||||||| || || |||||||||||||| || ||||| || || Sbjct: 1233 aaagctgtcactgttttcatccgtggaggtaacaaaatgatgatagaagagacgaaacgt 1292 Query: 145 agtattcatgatgctctatgtgttgcaaggaatctgatcatcaacaactcaattgtgtat 204 ||||| || |||||||| ||||| || |||||||| ||| |||||| |||||||| ||| Sbjct: 1293 agtatccacgatgctctgtgtgtggctaggaatctcatccgcaacaaatcaattgtttat 1352 Query: 205 ggtggtggctcagcagaaatatcttgctcaattgctgttgacgctgcagcagatcggcat 264 || ||||| |||| ||||| |||||||| |||| ||||| || || || ||| | Sbjct: 1353 ggaggtggggcagctgaaatcgcttgctcacttgcggttgatgcagctgctgataaatac 1412 Query: 265 cctggagttgagcagtatgcaatcagggcatttgctgatgctttgga 311 ||||| || |||||||||||||| ||||| ||||| || |||||||| Sbjct: 1413 cctggcgtggagcagtatgcaattagggcgtttgcagaagctttgga 1459
>ref|NM_202178.1| Arabidopsis thaliana ATP binding / protein binding AT1G24510 transcript variant AT1G24510.2 mRNA, complete cds Length = 2157 Score = 125 bits (63), Expect = 2e-25 Identities = 231/287 (80%) Strand = Plus / Plus Query: 25 gagaagtcatttggaacaacaaaagatcggatgctttacatcgagaagtgtgccaattcc 84 ||||| || ||||| ||||||||||| || ||||| || || ||| | ||||| || || Sbjct: 1424 gagaaatcttttggcacaacaaaagaacgaatgctgtatattgagcactgtgcgaactca 1483 Query: 85 aaagctgtaactattttcatccgcggtggcaacaaaatgatgattgaggagaccaagcga 144 |||||||| ||| |||||||||| || || |||||||||||||| || ||||| || || Sbjct: 1484 aaagctgtcactgttttcatccgtggaggtaacaaaatgatgatagaagagacgaaacgt 1543 Query: 145 agtattcatgatgctctatgtgttgcaaggaatctgatcatcaacaactcaattgtgtat 204 ||||| || |||||||| ||||| || |||||||| ||| |||||| |||||||| ||| Sbjct: 1544 agtatccacgatgctctgtgtgtggctaggaatctcatccgcaacaaatcaattgtttat 1603 Query: 205 ggtggtggctcagcagaaatatcttgctcaattgctgttgacgctgcagcagatcggcat 264 || ||||| |||| ||||| |||||||| |||| ||||| || || || ||| | Sbjct: 1604 ggaggtggggcagctgaaatcgcttgctcacttgcggttgatgcagctgctgataaatac 1663 Query: 265 cctggagttgagcagtatgcaatcagggcatttgctgatgctttgga 311 ||||| || |||||||||||||| ||||| ||||| || |||||||| Sbjct: 1664 cctggcgtggagcagtatgcaattagggcgtttgcagaagctttgga 1710
>gb|BT000818.1| Arabidopsis thaliana T-complex chaperonin protein , epsilon subunit (At1g24510/F21J9_150) mRNA, complete cds Length = 1608 Score = 125 bits (63), Expect = 2e-25 Identities = 231/287 (80%) Strand = Plus / Plus Query: 25 gagaagtcatttggaacaacaaaagatcggatgctttacatcgagaagtgtgccaattcc 84 ||||| || ||||| ||||||||||| || ||||| || || ||| | ||||| || || Sbjct: 1069 gagaaatcttttggcacaacaaaagaacgaatgctgtatattgagcactgtgcgaactca 1128 Query: 85 aaagctgtaactattttcatccgcggtggcaacaaaatgatgattgaggagaccaagcga 144 |||||||| ||| |||||||||| || || |||||||||||||| || ||||| || || Sbjct: 1129 aaagctgtcactgttttcatccgtggaggtaacaaaatgatgatagaagagacgaaacgt 1188 Query: 145 agtattcatgatgctctatgtgttgcaaggaatctgatcatcaacaactcaattgtgtat 204 ||||| || |||||||| ||||| || |||||||| ||| |||||| |||||||| ||| Sbjct: 1189 agtatccacgatgctctgtgtgtggctaggaatctcatccgcaacaaatcaattgtttat 1248 Query: 205 ggtggtggctcagcagaaatatcttgctcaattgctgttgacgctgcagcagatcggcat 264 || ||||| |||| ||||| |||||||| |||| ||||| || || || ||| | Sbjct: 1249 ggaggtggggcagctgaaatcgcttgctcacttgcggttgatgcagctgctgataaatac 1308 Query: 265 cctggagttgagcagtatgcaatcagggcatttgctgatgctttgga 311 ||||| || |||||||||||||| ||||| ||||| || |||||||| Sbjct: 1309 cctggcgtggagcagtatgcaattagggcgtttgcagaagctttgga 1355
>gb|AY075611.1| Arabidopsis thaliana At1g24510/F21J9_150 mRNA, complete cds Length = 1885 Score = 125 bits (63), Expect = 2e-25 Identities = 231/287 (80%) Strand = Plus / Plus Query: 25 gagaagtcatttggaacaacaaaagatcggatgctttacatcgagaagtgtgccaattcc 84 ||||| || ||||| ||||||||||| || ||||| || || ||| | ||||| || || Sbjct: 1173 gagaaatcttttggcacaacaaaagaacgaatgctgtatattgagcactgtgcgaactca 1232 Query: 85 aaagctgtaactattttcatccgcggtggcaacaaaatgatgattgaggagaccaagcga 144 |||||||| ||| |||||||||| || || |||||||||||||| || ||||| || || Sbjct: 1233 aaagctgtcactgttttcatccgtggaggtaacaaaatgatgatagaagagacgaaacgt 1292 Query: 145 agtattcatgatgctctatgtgttgcaaggaatctgatcatcaacaactcaattgtgtat 204 ||||| || |||||||| ||||| || |||||||| ||| |||||| |||||||| ||| Sbjct: 1293 agtatccacgatgctctgtgtgtggctaggaatctcatccgcaacaaatcaattgtttat 1352 Query: 205 ggtggtggctcagcagaaatatcttgctcaattgctgttgacgctgcagcagatcggcat 264 || ||||| |||| ||||| |||||||| |||| ||||| || || || ||| | Sbjct: 1353 ggaggtggggcagctgaaatcgcttgctcacttgcggttgatgcagctgctgataaatac 1412 Query: 265 cctggagttgagcagtatgcaatcagggcatttgctgatgctttgga 311 ||||| || |||||||||||||| ||||| ||||| || |||||||| Sbjct: 1413 cctggcgtggagcagtatgcaattagggcgtttgcagaagctttgga 1459
>emb|BX815337.1|CNS0AAT9 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS53ZC04 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 2067 Score = 125 bits (63), Expect = 2e-25 Identities = 231/287 (80%) Strand = Plus / Plus Query: 25 gagaagtcatttggaacaacaaaagatcggatgctttacatcgagaagtgtgccaattcc 84 ||||| || ||||| ||||||||||| || ||||| || || ||| | ||||| || || Sbjct: 1428 gagaaatcttttggcacaacaaaagaacgaatgctgtatattgagcactgtgcgaactca 1487 Query: 85 aaagctgtaactattttcatccgcggtggcaacaaaatgatgattgaggagaccaagcga 144 |||||||| ||| |||||||||| || || |||||||||||||| || ||||| || || Sbjct: 1488 aaagctgtcactgttttcatccgtggaggtaacaaaatgatgatagaagagacgaaacgt 1547 Query: 145 agtattcatgatgctctatgtgttgcaaggaatctgatcatcaacaactcaattgtgtat 204 ||||| || |||||||| ||||| || |||||||| ||| |||||| |||||||| ||| Sbjct: 1548 agtatccacgatgctctgtgtgtggctaggaatctcatccgcaacaaatcaattgtttat 1607 Query: 205 ggtggtggctcagcagaaatatcttgctcaattgctgttgacgctgcagcagatcggcat 264 || ||||| |||| ||||| |||||||| |||| ||||| || || || ||| | Sbjct: 1608 ggaggtggggcagctgaaatcgcttgctcacttgcggttgatgcagctgctgataaatac 1667 Query: 265 cctggagttgagcagtatgcaatcagggcatttgctgatgctttgga 311 ||||| || |||||||||||||| ||||| ||||| || |||||||| Sbjct: 1668 cctggcgtggagcagtatgcaattagggcgtttgcagaagctttgga 1714
>gb|AC077693.19| Oryza sativa chromosome 10 BAC OSJNBa0095C07 genomic sequence, complete sequence Length = 187707 Score = 101 bits (51), Expect = 3e-18 Identities = 102/118 (86%), Gaps = 2/118 (1%) Strand = Plus / Plus Query: 119 aaatgatgattgaggagaccaagcgaagtattcatgatgctctatgtgttgcaaggaatc 178 ||||||| ||||||||||||||| |||||||||||||||||| ||||| || ||||||| Sbjct: 13673 aaatgattattgaggagaccaagtgaagtattcatgatgctc--tgtgtggctaggaatc 13730 Query: 179 tgatcatcaacaactcaattgtgtatggtggtggctcagcagaaatatcttgctcaat 236 |||| ||| ||||| ||||| ||||||||||||||||| | ||||| |||||||| Sbjct: 13731 tgattcgcaagaactctattgtttatggtggtggctcagctcagatatcatgctcaat 13788 Score = 56.0 bits (28), Expect = 1e-04 Identities = 52/60 (86%) Strand = Plus / Plus Query: 480 caagcagcagcagatcttgctggcaacacaggttgtcaagatgatcctcaagatcgatga 539 |||||||||||||||| ||||| |||| ||||| || || ||||| |||||||| ||||| Sbjct: 15618 caagcagcagcagatcgtgctgacaactcaggtggtgaaaatgattctcaagattgatga 15677 Score = 48.1 bits (24), Expect = 0.035 Identities = 39/44 (88%) Strand = Plus / Plus Query: 319 ccactagctttagctgaaaacagtggtttggcacctattgatac 362 |||||||| |||||||||||||||||||| | ||| ||||||| Sbjct: 15116 ccactagccctagctgaaaacagtggtttgcccccttttgatac 15159
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 101 bits (51), Expect = 3e-18 Identities = 102/118 (86%), Gaps = 2/118 (1%) Strand = Plus / Plus Query: 119 aaatgatgattgaggagaccaagcgaagtattcatgatgctctatgtgttgcaaggaatc 178 ||||||| ||||||||||||||| |||||||||||||||||| ||||| || ||||||| Sbjct: 22009129 aaatgattattgaggagaccaagtgaagtattcatgatgctc--tgtgtggctaggaatc 22009186 Query: 179 tgatcatcaacaactcaattgtgtatggtggtggctcagcagaaatatcttgctcaat 236 |||| ||| ||||| ||||| ||||||||||||||||| | ||||| |||||||| Sbjct: 22009187 tgattcgcaagaactctattgtttatggtggtggctcagctcagatatcatgctcaat 22009244 Score = 56.0 bits (28), Expect = 1e-04 Identities = 52/60 (86%) Strand = Plus / Plus Query: 480 caagcagcagcagatcttgctggcaacacaggttgtcaagatgatcctcaagatcgatga 539 |||||||||||||||| ||||| |||| ||||| || || ||||| |||||||| ||||| Sbjct: 22011074 caagcagcagcagatcgtgctgacaactcaggtggtgaaaatgattctcaagattgatga 22011133 Score = 48.1 bits (24), Expect = 0.035 Identities = 39/44 (88%) Strand = Plus / Plus Query: 319 ccactagctttagctgaaaacagtggtttggcacctattgatac 362 |||||||| |||||||||||||||||||| | ||| ||||||| Sbjct: 22010572 ccactagccctagctgaaaacagtggtttgcccccttttgatac 22010615
>dbj|AK070073.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023043F15, full insert sequence Length = 3156 Score = 101 bits (51), Expect = 3e-18 Identities = 102/118 (86%), Gaps = 2/118 (1%) Strand = Plus / Plus Query: 119 aaatgatgattgaggagaccaagcgaagtattcatgatgctctatgtgttgcaaggaatc 178 ||||||| ||||||||||||||| |||||||||||||||||| ||||| || ||||||| Sbjct: 469 aaatgattattgaggagaccaagtgaagtattcatgatgctc--tgtgtggctaggaatc 526 Query: 179 tgatcatcaacaactcaattgtgtatggtggtggctcagcagaaatatcttgctcaat 236 |||| ||| ||||| ||||| ||||||||||||||||| | ||||| |||||||| Sbjct: 527 tgattcgcaagaactctattgtttatggtggtggctcagctcagatatcatgctcaat 584 Score = 56.0 bits (28), Expect = 1e-04 Identities = 52/60 (86%) Strand = Plus / Plus Query: 480 caagcagcagcagatcttgctggcaacacaggttgtcaagatgatcctcaagatcgatga 539 |||||||||||||||| ||||| |||| ||||| || || ||||| |||||||| ||||| Sbjct: 1968 caagcagcagcagatcgtgctgacaactcaggtggtgaaaatgattctcaagattgatga 2027 Score = 48.1 bits (24), Expect = 0.035 Identities = 39/44 (88%) Strand = Plus / Plus Query: 319 ccactagctttagctgaaaacagtggtttggcacctattgatac 362 |||||||| |||||||||||||||||||| | ||| ||||||| Sbjct: 1792 ccactagccctagctgaaaacagtggtttgcccccttttgatac 1835
>dbj|AK063744.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-120-G02, full insert sequence Length = 977 Score = 101 bits (51), Expect = 3e-18 Identities = 102/118 (86%), Gaps = 2/118 (1%) Strand = Plus / Plus Query: 119 aaatgatgattgaggagaccaagcgaagtattcatgatgctctatgtgttgcaaggaatc 178 ||||||| ||||||||||||||| |||||||||||||||||| ||||| || ||||||| Sbjct: 786 aaatgattattgaggagaccaagtgaagtattcatgatgctc--tgtgtggctaggaatc 843 Query: 179 tgatcatcaacaactcaattgtgtatggtggtggctcagcagaaatatcttgctcaat 236 |||| ||| ||||| ||||| ||||||||||||||||| | ||||| |||||||| Sbjct: 844 tgattcgcaagaactctattgtttatggtggtggctcagctcagatatcatgctcaat 901
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 101 bits (51), Expect = 3e-18 Identities = 102/118 (86%), Gaps = 2/118 (1%) Strand = Plus / Plus Query: 119 aaatgatgattgaggagaccaagcgaagtattcatgatgctctatgtgttgcaaggaatc 178 ||||||| ||||||||||||||| |||||||||||||||||| ||||| || ||||||| Sbjct: 22020792 aaatgattattgaggagaccaagtgaagtattcatgatgctc--tgtgtggctaggaatc 22020849 Query: 179 tgatcatcaacaactcaattgtgtatggtggtggctcagcagaaatatcttgctcaat 236 |||| ||| ||||| ||||| ||||||||||||||||| | ||||| |||||||| Sbjct: 22020850 tgattcgcaagaactctattgtttatggtggtggctcagctcagatatcatgctcaat 22020907 Score = 56.0 bits (28), Expect = 1e-04 Identities = 52/60 (86%) Strand = Plus / Plus Query: 480 caagcagcagcagatcttgctggcaacacaggttgtcaagatgatcctcaagatcgatga 539 |||||||||||||||| ||||| |||| ||||| || || ||||| |||||||| ||||| Sbjct: 22022737 caagcagcagcagatcgtgctgacaactcaggtggtgaaaatgattctcaagattgatga 22022796 Score = 48.1 bits (24), Expect = 0.035 Identities = 39/44 (88%) Strand = Plus / Plus Query: 319 ccactagctttagctgaaaacagtggtttggcacctattgatac 362 |||||||| |||||||||||||||||||| | ||| ||||||| Sbjct: 22022235 ccactagccctagctgaaaacagtggtttgcccccttttgatac 22022278
>gb|AC141435.28| Medicago truncatula clone mth2-21i11, complete sequence Length = 132497 Score = 93.7 bits (47), Expect = 7e-16 Identities = 113/135 (83%) Strand = Plus / Plus Query: 411 tggcatcgattgcaatgatgttggtaccaacgacatgaaagagcagaatgttttcgagac 470 |||||| ||||||||||||||||| ||||| ||||||| ||||| || || || || || Sbjct: 107476 tggcattgattgcaatgatgttggcaccaatgacatgagggagcaaaacgtctttgaaac 107535 Query: 471 tctgatcggcaagcagcagcagatcttgctggcaacacaggttgtcaagatgatcctcaa 530 | ||||||| |||||||| ||||||||||| || || || |||||||||||||| | || Sbjct: 107536 tttgatcggaaagcagcaacagatcttgcttgctactcaagttgtcaagatgatattaaa 107595 Query: 531 gatcgatgatgttat 545 || ||||||||||| Sbjct: 107596 aattgatgatgttat 107610 Score = 79.8 bits (40), Expect = 1e-11 Identities = 88/104 (84%) Strand = Plus / Plus Query: 115 aacaaaatgatgattgaggagaccaagcgaagtattcatgatgctctatgtgttgcaagg 174 ||||||||||| ||||||||||| ||||| |||||||||||||| | ||||| || ||| Sbjct: 105963 aacaaaatgatcattgaggagacaaagcgcagtattcatgatgcattgtgtgtggctagg 106022 Query: 175 aatctgatcatcaacaactcaattgtgtatggtggtggctcagc 218 ||||| || ||| || ||||||||||||||||| || ||||| Sbjct: 106023 aatcttattcgcaataattcaattgtgtatggtggcggttcagc 106066 Score = 40.1 bits (20), Expect = 8.5 Identities = 32/36 (88%) Strand = Plus / Plus Query: 276 gcagtatgcaatcagggcatttgctgatgctttgga 311 |||||||||||| || ||||||| ||||||||||| Sbjct: 107210 gcagtatgcaattagagcatttggggatgctttgga 107245
>emb|CT030174.3| M.truncatula DNA sequence from clone MTH2-71J12 on chromosome 3, complete sequence Length = 133240 Score = 93.7 bits (47), Expect = 7e-16 Identities = 113/135 (83%) Strand = Plus / Minus Query: 411 tggcatcgattgcaatgatgttggtaccaacgacatgaaagagcagaatgttttcgagac 470 |||||| ||||||||||||||||| ||||| ||||||| ||||| || || || || || Sbjct: 96387 tggcattgattgcaatgatgttggcaccaatgacatgagggagcaaaacgtctttgaaac 96328 Query: 471 tctgatcggcaagcagcagcagatcttgctggcaacacaggttgtcaagatgatcctcaa 530 | ||||||| |||||||| ||||||||||| || || || |||||||||||||| | || Sbjct: 96327 tttgatcggaaagcagcaacagatcttgcttgctactcaagttgtcaagatgatattaaa 96268 Query: 531 gatcgatgatgttat 545 || ||||||||||| Sbjct: 96267 aattgatgatgttat 96253 Score = 79.8 bits (40), Expect = 1e-11 Identities = 88/104 (84%) Strand = Plus / Minus Query: 115 aacaaaatgatgattgaggagaccaagcgaagtattcatgatgctctatgtgttgcaagg 174 ||||||||||| ||||||||||| ||||| |||||||||||||| | ||||| || ||| Sbjct: 97900 aacaaaatgatcattgaggagacaaagcgcagtattcatgatgcattgtgtgtggctagg 97841 Query: 175 aatctgatcatcaacaactcaattgtgtatggtggtggctcagc 218 ||||| || ||| || ||||||||||||||||| || ||||| Sbjct: 97840 aatcttattcgcaataattcaattgtgtatggtggcggttcagc 97797 Score = 40.1 bits (20), Expect = 8.5 Identities = 32/36 (88%) Strand = Plus / Minus Query: 276 gcagtatgcaatcagggcatttgctgatgctttgga 311 |||||||||||| || ||||||| ||||||||||| Sbjct: 96653 gcagtatgcaattagagcatttggggatgctttgga 96618
>gb|AC000103.2|AC000103 Genomic sequence for Arabidopsis thaliana BAC F21J9 from chromosome I, complete sequence Length = 99392 Score = 77.8 bits (39), Expect = 4e-11 Identities = 108/131 (82%) Strand = Plus / Minus Query: 115 aacaaaatgatgattgaggagaccaagcgaagtattcatgatgctctatgtgttgcaagg 174 |||||||||||||| || ||||| || || ||||| || |||||||| ||||| || ||| Sbjct: 46968 aacaaaatgatgatagaagagacgaaacgtagtatccacgatgctctgtgtgtggctagg 46909 Query: 175 aatctgatcatcaacaactcaattgtgtatggtggtggctcagcagaaatatcttgctca 234 ||||| ||| |||||| |||||||| ||||| ||||| |||| ||||| |||||||| Sbjct: 46908 aatctcatccgcaacaaatcaattgtttatggaggtggggcagctgaaatcgcttgctca 46849 Query: 235 attgctgttga 245 |||| ||||| Sbjct: 46848 cttgcggttga 46838 Score = 46.1 bits (23), Expect = 0.14 Identities = 68/83 (81%) Strand = Plus / Minus Query: 25 gagaagtcatttggaacaacaaaagatcggatgctttacatcgagaagtgtgccaattcc 84 ||||| || ||||| ||||||||||| || ||||| || || ||| | ||||| || || Sbjct: 47231 gagaaatcttttggcacaacaaaagaacgaatgctgtatattgagcactgtgcgaactca 47172 Query: 85 aaagctgtaactattttcatccg 107 |||||||| ||| |||||||||| Sbjct: 47171 aaagctgtcactgttttcatccg 47149
>emb|CR734406.2|CNS0GTG5 Tetraodon nigroviridis full-length cDNA Length = 275 Score = 58.0 bits (29), Expect = 4e-05 Identities = 62/73 (84%) Strand = Plus / Plus Query: 464 tcgagactctgatcggcaagcagcagcagatcttgctggcaacacaggttgtcaagatga 523 ||||||| ||||||||||| ||||||| ||| |||| || || || || |||||||||| Sbjct: 23 tcgagaccctgatcggcaaaaagcagcaaatcctgctcgccacccaagtcgtcaagatga 82 Query: 524 tcctcaagatcga 536 |||| |||||||| Sbjct: 83 tcctaaagatcga 95
>emb|CR734368.2|CNS0GTF3 Tetraodon nigroviridis full-length cDNA Length = 1888 Score = 58.0 bits (29), Expect = 4e-05 Identities = 62/73 (84%) Strand = Plus / Plus Query: 464 tcgagactctgatcggcaagcagcagcagatcttgctggcaacacaggttgtcaagatga 523 ||||||| ||||||||||| ||||||| ||| |||| || || || || |||||||||| Sbjct: 1636 tcgagaccctgatcggcaaaaagcagcaaatcctgctcgccacccaagtcgtcaagatga 1695 Query: 524 tcctcaagatcga 536 |||| |||||||| Sbjct: 1696 tcctaaagatcga 1708
>emb|CR704636.2|CNS0G6NC Tetraodon nigroviridis full-length cDNA Length = 1816 Score = 58.0 bits (29), Expect = 4e-05 Identities = 62/73 (84%) Strand = Plus / Plus Query: 464 tcgagactctgatcggcaagcagcagcagatcttgctggcaacacaggttgtcaagatga 523 ||||||| ||||||||||| ||||||| ||| |||| || || || || |||||||||| Sbjct: 1625 tcgagaccctgatcggcaaaaagcagcaaatcctgctcgccacccaagtcgtcaagatga 1684 Query: 524 tcctcaagatcga 536 |||| |||||||| Sbjct: 1685 tcctaaagatcga 1697 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Plus Query: 97 attttcatccgcggtggcaacaaaatgat 125 ||||| |||||||| |||||||||||||| Sbjct: 1259 atttttatccgcggaggcaacaaaatgat 1287
>emb|CR702647.2|CNS0G543 Tetraodon nigroviridis full-length cDNA Length = 1848 Score = 58.0 bits (29), Expect = 4e-05 Identities = 62/73 (84%) Strand = Plus / Plus Query: 464 tcgagactctgatcggcaagcagcagcagatcttgctggcaacacaggttgtcaagatga 523 ||||||| ||||||||||| ||||||| ||| |||| || || || || |||||||||| Sbjct: 1604 tcgagaccctgatcggcaaaaagcagcaaatcctgctcgccacccaagtcgtcaagatga 1663 Query: 524 tcctcaagatcga 536 |||| |||||||| Sbjct: 1664 tcctaaagatcga 1676 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Plus Query: 97 attttcatccgcggtggcaacaaaatgat 125 ||||| |||||||| |||||||||||||| Sbjct: 1238 atttttatccgcggaggcaacaaaatgat 1266
>emb|CR693702.2|CNS0FY7M Tetraodon nigroviridis full-length cDNA Length = 1102 Score = 58.0 bits (29), Expect = 4e-05 Identities = 62/73 (84%) Strand = Plus / Plus Query: 464 tcgagactctgatcggcaagcagcagcagatcttgctggcaacacaggttgtcaagatga 523 ||||||| ||||||||||| ||||||| ||| |||| || || || || |||||||||| Sbjct: 846 tcgagaccctgatcggcaaaaagcagcaaatcctgctcgccacccaagtcgtcaagatga 905 Query: 524 tcctcaagatcga 536 |||| |||||||| Sbjct: 906 tcctaaagatcga 918 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Plus Query: 97 attttcatccgcggtggcaacaaaatgat 125 ||||| |||||||| |||||||||||||| Sbjct: 479 atttttatccgcggaggcaacaaaatgat 507
>emb|CR693121.2|CNS0FXRH Tetraodon nigroviridis full-length cDNA Length = 1851 Score = 58.0 bits (29), Expect = 4e-05 Identities = 62/73 (84%) Strand = Plus / Plus Query: 464 tcgagactctgatcggcaagcagcagcagatcttgctggcaacacaggttgtcaagatga 523 ||||||| ||||||||||| ||||||| ||| |||| || || || || |||||||||| Sbjct: 1619 tcgagaccctgatcggcaaaaagcagcaaatcctgctcgccacccaagtcgtcaagatga 1678 Query: 524 tcctcaagatcga 536 |||| |||||||| Sbjct: 1679 tcctaaagatcga 1691 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Plus Query: 97 attttcatccgcggtggcaacaaaatgat 125 ||||| |||||||| |||||||||||||| Sbjct: 1253 atttttatccgcggaggcaacaaaatgat 1281
>emb|CR692993.2|CNS0FXNX Tetraodon nigroviridis full-length cDNA Length = 1013 Score = 58.0 bits (29), Expect = 4e-05 Identities = 62/73 (84%) Strand = Plus / Plus Query: 464 tcgagactctgatcggcaagcagcagcagatcttgctggcaacacaggttgtcaagatga 523 ||||||| ||||||||||| ||||||| ||| |||| || || || || |||||||||| Sbjct: 758 tcgagaccctgatcggcaaaaagcagcaaatcctgctcgccacccaagtcgtcaagatga 817 Query: 524 tcctcaagatcga 536 |||| |||||||| Sbjct: 818 tcctaaagatcga 830 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Plus Query: 97 attttcatccgcggtggcaacaaaatgat 125 ||||| |||||||| |||||||||||||| Sbjct: 391 atttttatccgcggaggcaacaaaatgat 419
>emb|CR682065.2|CNS0FP8D Tetraodon nigroviridis full-length cDNA Length = 1001 Score = 58.0 bits (29), Expect = 4e-05 Identities = 62/73 (84%) Strand = Plus / Plus Query: 464 tcgagactctgatcggcaagcagcagcagatcttgctggcaacacaggttgtcaagatga 523 ||||||| ||||||||||| ||||||| ||| |||| || || || || |||||||||| Sbjct: 752 tcgagaccctgatcggcaaaaagcagcaaatcctgctcgccacccaagtcgtcaagatga 811 Query: 524 tcctcaagatcga 536 |||| |||||||| Sbjct: 812 tcctaaagatcga 824 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Plus Query: 97 attttcatccgcggtggcaacaaaatgat 125 ||||| |||||||| |||||||||||||| Sbjct: 385 atttttatccgcggaggcaacaaaatgat 413
>emb|CR664385.2|CNS0FBLZ Tetraodon nigroviridis full-length cDNA Length = 1196 Score = 58.0 bits (29), Expect = 4e-05 Identities = 62/73 (84%) Strand = Plus / Plus Query: 464 tcgagactctgatcggcaagcagcagcagatcttgctggcaacacaggttgtcaagatga 523 ||||||| ||||||||||| ||||||| ||| |||| || || || || |||||||||| Sbjct: 941 tcgagaccctgatcggcaaaaagcagcaaatcctgctcgccacccaagtcgtcaagatga 1000 Query: 524 tcctcaagatcga 536 |||| |||||||| Sbjct: 1001 tcctaaagatcga 1013 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Plus Query: 97 attttcatccgcggtggcaacaaaatgat 125 ||||| |||||||| |||||||||||||| Sbjct: 574 atttttatccgcggaggcaacaaaatgat 602
>emb|CR659491.2|CNS0F7U1 Tetraodon nigroviridis full-length cDNA Length = 1879 Score = 58.0 bits (29), Expect = 4e-05 Identities = 62/73 (84%) Strand = Plus / Plus Query: 464 tcgagactctgatcggcaagcagcagcagatcttgctggcaacacaggttgtcaagatga 523 ||||||| ||||||||||| ||||||| ||| |||| || || || || |||||||||| Sbjct: 1631 tcgagaccctgatcggcaaaaagcagcaaatcctgctcgccacccaagtcgtcaagatga 1690 Query: 524 tcctcaagatcga 536 |||| |||||||| Sbjct: 1691 tcctaaagatcga 1703 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Plus Query: 97 attttcatccgcggtggcaacaaaatgat 125 ||||| |||||||| |||||||||||||| Sbjct: 1264 atttttatccgcggaggcaacaaaatgat 1292
>ref|XM_774923.1| PREDICTED: Strongylocentrotus purpuratus similar to chaperonin containing TCP1, subunit 5 (epsilon), transcript variant 1 (LOC575808), mRNA Length = 2235 Score = 56.0 bits (28), Expect = 1e-04 Identities = 52/60 (86%) Strand = Plus / Plus Query: 436 accaacgacatgaaagagcagaatgttttcgagactctgatcggcaagcagcagcagatc 495 ||||| |||||||| |||||| |||| || ||||||||||| |||||| |||| |||||| Sbjct: 1591 accaatgacatgaaggagcagcatgtgtttgagactctgattggcaagaagcaacagatc 1650
>ref|XM_796613.1| PREDICTED: Strongylocentrotus purpuratus similar to chaperonin containing TCP1, subunit 5 (epsilon), transcript variant 2 (LOC575808), mRNA Length = 2250 Score = 56.0 bits (28), Expect = 1e-04 Identities = 52/60 (86%) Strand = Plus / Plus Query: 436 accaacgacatgaaagagcagaatgttttcgagactctgatcggcaagcagcagcagatc 495 ||||| |||||||| |||||| |||| || ||||||||||| |||||| |||| |||||| Sbjct: 1606 accaatgacatgaaggagcagcatgtgtttgagactctgattggcaagaagcaacagatc 1665
>dbj|AK106739.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-115-B02, full insert sequence Length = 1961 Score = 56.0 bits (28), Expect = 1e-04 Identities = 52/60 (86%) Strand = Plus / Plus Query: 480 caagcagcagcagatcttgctggcaacacaggttgtcaagatgatcctcaagatcgatga 539 |||||||||||||||| ||||| |||| ||||| || || ||||| |||||||| ||||| Sbjct: 329 caagcagcagcagatcgtgctgacaactcaggtggtgaaaatgattctcaagattgatga 388 Score = 48.1 bits (24), Expect = 0.035 Identities = 39/44 (88%) Strand = Plus / Plus Query: 319 ccactagctttagctgaaaacagtggtttggcacctattgatac 362 |||||||| |||||||||||||||||||| | ||| ||||||| Sbjct: 153 ccactagccctagctgaaaacagtggtttgcccccttttgatac 196
>ref|XM_635364.1| Dictyostelium discoideum hypothetical protein (DDB0204244), partial mRNA Length = 1617 Score = 54.0 bits (27), Expect = 6e-04 Identities = 45/51 (88%) Strand = Plus / Plus Query: 295 tttgctgatgctttggatgccattccactagctttagctgaaaacagtggt 345 |||||||||||||| ||||| |||||| |||| || |||||||| |||||| Sbjct: 1339 tttgctgatgctttagatgctattccattagcattggctgaaaatagtggt 1389
>emb|BX064596.1|CNS09M08 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46DG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 888 Score = 54.0 bits (27), Expect = 6e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 485 agcagcagatcttgctggcaacacaggttgtcaagatgatcctcaagatcgatga 539 ||||||||||| |||| || || ||| | ||||||||||| |||||||||||||| Sbjct: 399 agcagcagatcgtgctcgccacccagctcgtcaagatgattctcaagatcgatga 345
>emb|BX059609.1|CNS09I5P Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4CB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 668 Score = 54.0 bits (27), Expect = 6e-04 Identities = 48/55 (87%) Strand = Plus / Plus Query: 485 agcagcagatcttgctggcaacacaggttgtcaagatgatcctcaagatcgatga 539 ||||||||||| |||| || || ||| | ||||||||||| |||||||||||||| Sbjct: 490 agcagcagatcgtgctcgccacccagctcgtcaagatgattctcaagatcgatga 544
>emb|BX058534.1|CNS09HBU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39AA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1000 Score = 54.0 bits (27), Expect = 6e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 485 agcagcagatcttgctggcaacacaggttgtcaagatgatcctcaagatcgatga 539 ||||||||||| |||| || || ||| | ||||||||||| |||||||||||||| Sbjct: 438 agcagcagatcgtgctcgccacccagctcgtcaagatgattctcaagatcgatga 384
>emb|BX058090.1|CNS09GZI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC38BC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 862 Score = 54.0 bits (27), Expect = 6e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 485 agcagcagatcttgctggcaacacaggttgtcaagatgatcctcaagatcgatga 539 ||||||||||| |||| || || ||| | ||||||||||| |||||||||||||| Sbjct: 470 agcagcagatcgtgctcgccacccagctcgtcaagatgattctcaagatcgatga 416
>emb|BX047036.1|CNS098GG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC21AB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 592 Score = 54.0 bits (27), Expect = 6e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 485 agcagcagatcttgctggcaacacaggttgtcaagatgatcctcaagatcgatga 539 ||||||||||| |||| || || ||| | ||||||||||| |||||||||||||| Sbjct: 405 agcagcagatcgtgctcgccacccagctcgtcaagatgattctcaagatcgatga 351
>emb|BX042897.1|CNS0959H Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC15AE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 686 Score = 54.0 bits (27), Expect = 6e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 485 agcagcagatcttgctggcaacacaggttgtcaagatgatcctcaagatcgatga 539 ||||||||||| |||| || || ||| | ||||||||||| |||||||||||||| Sbjct: 412 agcagcagatcgtgctcgccacccagctcgtcaagatgattctcaagatcgatga 358
>emb|BX037203.1|CNS090VB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA9CC07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 615 Score = 54.0 bits (27), Expect = 6e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 485 agcagcagatcttgctggcaacacaggttgtcaagatgatcctcaagatcgatga 539 ||||||||||| |||| || || ||| | ||||||||||| |||||||||||||| Sbjct: 458 agcagcagatcgtgctcgccacccagctcgtcaagatgattctcaagatcgatga 404
>emb|BX032800.1|CNS08XH0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA48DF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 470 Score = 54.0 bits (27), Expect = 6e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 485 agcagcagatcttgctggcaacacaggttgtcaagatgatcctcaagatcgatga 539 ||||||||||| |||| || || ||| | ||||||||||| |||||||||||||| Sbjct: 395 agcagcagatcgtgctcgccacccagctcgtcaagatgattctcaagatcgatga 341
>emb|BX022454.1|CNS08PHM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA34BE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 896 Score = 54.0 bits (27), Expect = 6e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 485 agcagcagatcttgctggcaacacaggttgtcaagatgatcctcaagatcgatga 539 ||||||||||| |||| || || ||| | ||||||||||| |||||||||||||| Sbjct: 414 agcagcagatcgtgctcgccacccagctcgtcaagatgattctcaagatcgatga 360
>emb|BX025429.1|CNS08RS9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA39AA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 889 Score = 54.0 bits (27), Expect = 6e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 485 agcagcagatcttgctggcaacacaggttgtcaagatgatcctcaagatcgatga 539 ||||||||||| |||| || || ||| | ||||||||||| |||||||||||||| Sbjct: 215 agcagcagatcgtgctcgccacccagctcgtcaagatgattctcaagatcgatga 161
>emb|BX025374.1|CNS08RQQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA38DF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 977 Score = 54.0 bits (27), Expect = 6e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 485 agcagcagatcttgctggcaacacaggttgtcaagatgatcctcaagatcgatga 539 ||||||||||| |||| || || ||| | ||||||||||| |||||||||||||| Sbjct: 456 agcagcagatcgtgctcgccacccagctcgtcaagatgattctcaagatcgatga 402
>emb|BX025373.1|CNS08RQP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA38DF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1012 Score = 54.0 bits (27), Expect = 6e-04 Identities = 48/55 (87%) Strand = Plus / Plus Query: 485 agcagcagatcttgctggcaacacaggttgtcaagatgatcctcaagatcgatga 539 ||||||||||| |||| || || ||| | ||||||||||| |||||||||||||| Sbjct: 617 agcagcagatcgtgctcgccacccagctcgtcaagatgattctcaagatcgatga 671
>emb|BX015203.1|CNS08JW7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA22DD06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 984 Score = 54.0 bits (27), Expect = 6e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 485 agcagcagatcttgctggcaacacaggttgtcaagatgatcctcaagatcgatga 539 ||||||||||| |||| || || ||| | ||||||||||| |||||||||||||| Sbjct: 383 agcagcagatcgtgctcgccacccagctcgtcaagatgattctcaagatcgatga 329
>emb|BX013195.1|CNS08ICF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA2DE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 985 Score = 54.0 bits (27), Expect = 6e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 485 agcagcagatcttgctggcaacacaggttgtcaagatgatcctcaagatcgatga 539 ||||||||||| |||| || || ||| | ||||||||||| |||||||||||||| Sbjct: 401 agcagcagatcgtgctcgccacccagctcgtcaagatgattctcaagatcgatga 347
>emb|BX010233.1|CNS08G25 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA16BH08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 692 Score = 54.0 bits (27), Expect = 6e-04 Identities = 48/55 (87%) Strand = Plus / Plus Query: 485 agcagcagatcttgctggcaacacaggttgtcaagatgatcctcaagatcgatga 539 ||||||||||| |||| || || ||| | ||||||||||| |||||||||||||| Sbjct: 616 agcagcagatcgtgctcgccacccagctcgtcaagatgattctcaagatcgatga 670
>emb|BX009560.1|CNS08FJG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA15BH08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 972 Score = 54.0 bits (27), Expect = 6e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 485 agcagcagatcttgctggcaacacaggttgtcaagatgatcctcaagatcgatga 539 ||||||||||| |||| || || ||| | ||||||||||| |||||||||||||| Sbjct: 379 agcagcagatcgtgctcgccacccagctcgtcaagatgattctcaagatcgatga 325
>emb|AJ306236.1|PFL306236 Platichthys flesus partial mRNA for T-complex protein 1 epsilon subunit (tcp-1 epsilon gene) Length = 343 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 97 attttcatccgcggtggcaacaaaatgatgattgaggagaccaagcg 143 ||||||||||| || |||||||||||||| ||||| ||| ||||||| Sbjct: 246 attttcatccgtggaggcaacaaaatgatcattgaagaggccaagcg 292
>ref|XM_317219.2| Anopheles gambiae str. PEST ENSANGP00000012024 (ENSANGG00000009535), partial mRNA Length = 1779 Score = 54.0 bits (27), Expect = 6e-04 Identities = 48/55 (87%) Strand = Plus / Plus Query: 485 agcagcagatcttgctggcaacacaggttgtcaagatgatcctcaagatcgatga 539 ||||||||||| |||| || || ||| | ||||||||||| |||||||||||||| Sbjct: 1715 agcagcagatcgtgctcgccacccagctcgtcaagatgattctcaagatcgatga 1769
>ref|XM_307323.1| Anopheles gambiae str. PEST ENSANGP00000001996 (ENSANGG00000001693), partial mRNA Length = 1515 Score = 54.0 bits (27), Expect = 6e-04 Identities = 48/55 (87%) Strand = Plus / Plus Query: 485 agcagcagatcttgctggcaacacaggttgtcaagatgatcctcaagatcgatga 539 ||||||||||| |||| || || ||| | ||||||||||| |||||||||||||| Sbjct: 1451 agcagcagatcgtgctcgccacccagctcgtcaagatgattctcaagatcgatga 1505
>gb|AY398321.1| Danio rerio clone RK074A2D01 chaperonin containing TCP1, subunit 5 (epsilon) (CCT5) mRNA, complete cds Length = 1896 Score = 52.0 bits (26), Expect = 0.002 Identities = 80/98 (81%) Strand = Plus / Plus Query: 442 gacatgaaagagcagaatgttttcgagactctgatcggcaagcagcagcagatcttgctg 501 |||||||| ||||| |||| ||||||| || ||||| ||| |||||||||||| ||| Sbjct: 1612 gacatgaagcagcagcatgtaatcgagacccttatcgggaagaagcagcagatctctctg 1671 Query: 502 gcaacacaggttgtcaagatgatcctcaagatcgatga 539 || || || ||||| |||||||| || ||||| ||||| Sbjct: 1672 gccactcaagttgtaaagatgattctgaagattgatga 1709
>gb|AY648807.1| Danio rerio TCP-1 epsilon mRNA, complete cds Length = 1853 Score = 52.0 bits (26), Expect = 0.002 Identities = 80/98 (81%) Strand = Plus / Plus Query: 442 gacatgaaagagcagaatgttttcgagactctgatcggcaagcagcagcagatcttgctg 501 |||||||| ||||| |||| ||||||| || ||||| ||| |||||||||||| ||| Sbjct: 1587 gacatgaagcagcagcatgtaatcgagacccttatcgggaagaagcagcagatctctctg 1646 Query: 502 gcaacacaggttgtcaagatgatcctcaagatcgatga 539 || || || ||||| |||||||| || ||||| ||||| Sbjct: 1647 gccactcaagttgtaaagatgattctgaagattgatga 1684 Score = 40.1 bits (20), Expect = 8.5 Identities = 56/68 (82%) Strand = Plus / Plus Query: 100 ttcatccgcggtggcaacaaaatgatgattgaggagaccaagcgaagtattcatgatgct 159 |||||||| || || ||||||||||| ||||| ||| |||| || | ||||||||||| Sbjct: 1245 ttcatccgtggcgggaacaaaatgattattgaagaggccaaaagagctcttcatgatgct 1304 Query: 160 ctatgtgt 167 || ||||| Sbjct: 1305 ctgtgtgt 1312
>gb|BC068037.1| Danio rerio chaperonin containing TCP1, subunit 5 (epsilon), mRNA (cDNA clone MGC:77639 IMAGE:6996933), complete cds Length = 1879 Score = 52.0 bits (26), Expect = 0.002 Identities = 80/98 (81%) Strand = Plus / Plus Query: 442 gacatgaaagagcagaatgttttcgagactctgatcggcaagcagcagcagatcttgctg 501 |||||||| ||||| |||| ||||||| || ||||| ||| |||||||||||| ||| Sbjct: 1597 gacatgaagcagcagcatgtaatcgagacccttatcgggaagaagcagcagatctctctg 1656 Query: 502 gcaacacaggttgtcaagatgatcctcaagatcgatga 539 || || || ||||| |||||||| || ||||| ||||| Sbjct: 1657 gccactcaagttgtaaagatgattctgaagattgatga 1694
>emb|BX469922.12| Zebrafish DNA sequence from clone DKEY-30N5 in linkage group 24, complete sequence Length = 200409 Score = 52.0 bits (26), Expect = 0.002 Identities = 80/98 (81%) Strand = Plus / Minus Query: 442 gacatgaaagagcagaatgttttcgagactctgatcggcaagcagcagcagatcttgctg 501 |||||||| ||||| |||| ||||||| || ||||| ||| |||||||||||| ||| Sbjct: 166073 gacatgaagcagcagcatgtaatcgagacccttatcgggaagaagcagcagatctctctg 166014 Query: 502 gcaacacaggttgtcaagatgatcctcaagatcgatga 539 || || || ||||| |||||||| || ||||| ||||| Sbjct: 166013 gccactcaagttgtaaagatgattctgaagattgatga 165976
>ref|NM_212613.1| Danio rerio chaperonin containing TCP1, subunit 5 (epsilon) (cct5), mRNA Length = 1896 Score = 52.0 bits (26), Expect = 0.002 Identities = 80/98 (81%) Strand = Plus / Plus Query: 442 gacatgaaagagcagaatgttttcgagactctgatcggcaagcagcagcagatcttgctg 501 |||||||| ||||| |||| ||||||| || ||||| ||| |||||||||||| ||| Sbjct: 1612 gacatgaagcagcagcatgtaatcgagacccttatcgggaagaagcagcagatctctctg 1671 Query: 502 gcaacacaggttgtcaagatgatcctcaagatcgatga 539 || || || ||||| |||||||| || ||||| ||||| Sbjct: 1672 gccactcaagttgtaaagatgattctgaagattgatga 1709
>ref|XM_824388.1| Trypanosoma brucei TREU927 t-complex protein 1 subunit epsilon (Tb11.01.5860) partial mRNA Length = 1617 Score = 50.1 bits (25), Expect = 0.009 Identities = 37/41 (90%) Strand = Plus / Plus Query: 100 ttcatccgcggtggcaacaaaatgatgattgaggagaccaa 140 ||||| || ||||| ||||||||||||||||||||| |||| Sbjct: 1144 ttcattcgtggtggtaacaaaatgatgattgaggaggccaa 1184
>emb|BX010234.1|CNS08G26 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA16BH08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 685 Score = 50.1 bits (25), Expect = 0.009 Identities = 46/53 (86%) Strand = Plus / Minus Query: 485 agcagcagatcttgctggcaacacaggttgtcaagatgatcctcaagatcgat 537 ||||||||||| |||| || || ||| | ||||||||||| |||||||||||| Sbjct: 459 agcagcagatcgtgctcgccacccagctcgtcaagatgattctcaagatcgat 407
>ref|XM_762836.1| Giardia lamblia ATCC 50803 hypothetical protein (GLP_549_7513_8304) partial mRNA Length = 792 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Minus Query: 497 tgctggcaacacaggttgtcaagatgatcctcaagatcgatga 539 ||||||| |||||||| ||| |||||||||||||||||||| Sbjct: 635 tgctggccacacaggtcgtccgcatgatcctcaagatcgatga 593
>ref|XM_762838.1| Giardia lamblia ATCC 50803 chaperonin subunit epsilon (GLP_549_9744_8083) partial mRNA Length = 1662 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Plus Query: 497 tgctggcaacacaggttgtcaagatgatcctcaagatcgatga 539 ||||||| |||||||| ||| |||||||||||||||||||| Sbjct: 1598 tgctggccacacaggtcgtccgcatgatcctcaagatcgatga 1640
>emb|BX024353.1|CNS08QYD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA37AE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 608 Score = 46.1 bits (23), Expect = 0.14 Identities = 47/55 (85%) Strand = Plus / Minus Query: 485 agcagcagatcttgctggcaacacaggttgtcaagatgatcctcaagatcgatga 539 ||||||||| | |||| || || ||| | ||||||||||| |||||||||||||| Sbjct: 393 agcagcagaacgtgctcgccacccagctcgtcaagatgattctcaagatcgatga 339
>emb|AJ851489.1| Gallus gallus mRNA for hypothetical protein, clone 3n20 Length = 1819 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Plus Query: 277 cagtatgcaatcagggcatttgctgatgctttgga 311 ||||||||||| ||||||||||| ||||| ||||| Sbjct: 1365 cagtatgcaatgagggcatttgcagatgccttgga 1399
>gb|AF226724.1|AF226724 Giardia intestinalis chaperonin subunit epsilon CCTepsilon (Ccte) gene, complete cds Length = 1829 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Plus Query: 497 tgctggcaacacaggttgtcaagatgatcctcaagatcgatga 539 ||||||| |||||||| ||| |||||||||||||||||||| Sbjct: 1688 tgctggccacacaggtcgtccgcatgatcctcaagatcgatga 1730
>ref|NM_001012563.1| Gallus gallus chaperonin containing TCP1, subunit 5 (epsilon) (CCT5), mRNA Length = 1819 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Plus Query: 277 cagtatgcaatcagggcatttgctgatgctttgga 311 ||||||||||| ||||||||||| ||||| ||||| Sbjct: 1365 cagtatgcaatgagggcatttgcagatgccttgga 1399
>emb|CR699738.2|CNS0G2VA Tetraodon nigroviridis full-length cDNA Length = 1834 Score = 44.1 bits (22), Expect = 0.55 Identities = 62/74 (83%), Gaps = 1/74 (1%) Strand = Plus / Plus Query: 464 tcgagactctgatcggcaagcagcagcagatcttgctggcaacacaggttgtca-agatg 522 ||||||| ||||||||||| ||||||| ||| |||| || || || || |||| ||||| Sbjct: 1596 tcgagaccctgatcggcaaaaagcagcaaatcctgctcgccacccaagtcgtcatagatg 1655 Query: 523 atcctcaagatcga 536 ||||| |||||||| Sbjct: 1656 atccttaagatcga 1669
>emb|AL031429.11|HS333A15 Human DNA sequence from clone RP3-333A15 on chromosome 1p31.1-31.3 Contains the 5' end of the PTGER3 gene for prostaglandin E receptor 3 (subtype EP3), part of a novel gene and a CpG island, complete sequence Length = 133221 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Minus Query: 267 tggagttgagcagtatgcaatc 288 |||||||||||||||||||||| Sbjct: 113693 tggagttgagcagtatgcaatc 113672
>emb|BX033735.1|CNS08Y6Z Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA5BD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 707 Score = 44.1 bits (22), Expect = 0.55 Identities = 25/26 (96%) Strand = Plus / Minus Query: 514 gtcaagatgatcctcaagatcgatga 539 ||||||||||| |||||||||||||| Sbjct: 355 gtcaagatgattctcaagatcgatga 330
>emb|BX025983.1|CNS08S7N Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA4AC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 148 Score = 44.1 bits (22), Expect = 0.55 Identities = 25/26 (96%) Strand = Plus / Minus Query: 514 gtcaagatgatcctcaagatcgatga 539 ||||||||||| |||||||||||||| Sbjct: 104 gtcaagatgattctcaagatcgatga 79
>gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome Length = 4403837 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 242 ttgacgctgcagcagatcggc 262 ||||||||||||||||||||| Sbjct: 4299679 ttgacgctgcagcagatcggc 4299699
>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence Length = 4126292 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 429 tgttggtaccaacgacatgaa 449 ||||||||||||||||||||| Sbjct: 4018094 tgttggtaccaacgacatgaa 4018074
>emb|CR682761.2|CNS0FPRP Tetraodon nigroviridis full-length cDNA Length = 615 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Plus Query: 97 attttcatccgcggtggcaacaaaatgat 125 ||||| |||||||| |||||||||||||| Sbjct: 418 atttttatccgcggaggcaacaaaatgat 446
>emb|AL135789.18| Human DNA sequence from clone RP11-412H14 on chromosome 9q32-33.3 Contains the 5' end of one variant of the AKAP2 (PALM2) gene for A kinase (PRKA) anchor protein 2 (paralemmin 2) and a CpG island, complete sequence Length = 133394 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 286 atcagggcatttgctgatgct 306 ||||||||||||||||||||| Sbjct: 25352 atcagggcatttgctgatgct 25332
>emb|BX842584.1| Mycobacterium tuberculosis H37Rv complete genome; segment 13/13 Length = 244800 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 242 ttgacgctgcagcagatcggc 262 ||||||||||||||||||||| Sbjct: 140624 ttgacgctgcagcagatcggc 140644
>emb|BX248347.1| Mycobacterium bovis subsp. bovis AF2122/97 complete genome; segment 14/14 Length = 278492 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 242 ttgacgctgcagcagatcggc 262 ||||||||||||||||||||| Sbjct: 176629 ttgacgctgcagcagatcggc 176649
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 472 ctgatcggcaagcagcagcag 492 ||||||||||||||||||||| Sbjct: 31442983 ctgatcggcaagcagcagcag 31442963
>gb|AC092660.2| Homo sapiens BAC clone RP11-502A5 from 2, complete sequence Length = 154704 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 487 cagcagatcttgctggcaaca 507 ||||||||||||||||||||| Sbjct: 104621 cagcagatcttgctggcaaca 104641
>gb|AC150477.3| Monodelphis domestica clone VMRC6-470J24, complete sequence Length = 60867 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 31 tcatttggaacaacaaaagatcgga 55 |||||||||| |||||||||||||| Sbjct: 36145 tcatttggaataacaaaagatcgga 36121
>dbj|AP005848.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBa0078N11 Length = 155168 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 472 ctgatcggcaagcagcagcag 492 ||||||||||||||||||||| Sbjct: 78380 ctgatcggcaagcagcagcag 78360
>gb|AD000017.1|MSGY409 Mycobacterium tuberculosis sequence from clone y409 Length = 41321 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 242 ttgacgctgcagcagatcggc 262 ||||||||||||||||||||| Sbjct: 10844 ttgacgctgcagcagatcggc 10824
>gb|DP000021.1| Monodelphis domestica target 1 genomic scaffold Length = 1833844 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 31 tcatttggaacaacaaaagatcgga 55 |||||||||| |||||||||||||| Sbjct: 815070 tcatttggaataacaaaagatcgga 815046
>gb|AY377120.1| Liparthrum semidegener isolate sem-Madeira elongation factor 1-alpha (EF-1alpha) gene, partial cds Length = 889 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 507 tgatgctttggatgccattc 526
>gb|AY377081.1| Liparthrum canum isolate can-LaGomera elongation factor 1-alpha (EF-1alpha) gene, partial cds Length = 885 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 507 tgatgctttggatgccattc 526
>gb|AY377073.1| Liparthrum artemisiae isolate art-Tenerife elongation factor 1-alpha (EF-1alpha) gene, partial cds Length = 890 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 507 tgatgctttggatgccattc 526
>gb|AY377072.1| Liparthrum artemisiae isolate art-LaGomera elongation factor 1-alpha (EF-1alpha) gene, partial cds Length = 890 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 507 tgatgctttggatgccattc 526
>gb|AY377067.1| Liparthrum bartschti elongation factor 1-alpha (EF-1alpha) gene, partial cds Length = 762 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 455 tgatgctttggatgccattc 474
>emb|BX936408.10| Zebrafish DNA sequence from clone CH211-195A15 in linkage group 17, complete sequence Length = 198387 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 29 agtcatttggaacaacaaaa 48 |||||||||||||||||||| Sbjct: 109499 agtcatttggaacaacaaaa 109480
>gb|BC044997.1| Xenopus laevis chaperonin containing TCP1, subunit 5 (epsilon), mRNA (cDNA clone MGC:53061 IMAGE:5541942), complete cds Length = 1788 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 82 tccaaagctgtaactattttcatc 105 |||| ||||||||||||||||||| Sbjct: 1205 tccagagctgtaactattttcatc 1228
>gb|DQ141315.1| Xyleborus amputatus elongation factor 1-alpha (EF-1a) gene, partial cds Length = 716 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 573 tgatgctttggatgccattc 592
>emb|AL772262.4| Human DNA sequence from clone RP11-444C24 on chromosome X, complete sequence Length = 147079 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 187 aacaactcaattgtgtatggtggt 210 |||||||||||||| ||||||||| Sbjct: 18165 aacaactcaattgtctatggtggt 18188
>emb|AL590138.7| Human DNA sequence from clone RP11-243A2 on chromosome 1 Contains part of the PLXNA2 gene for plexin A2, complete sequence Length = 164057 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 479 gcaagcagcagcagatcttgctgg 502 |||||||||||||||| ||||||| Sbjct: 116430 gcaagcagcagcagatgttgctgg 116407
>gb|AY131133.1| Diocalandra frumenti elongation factor 1-alpha gene, partial cds Length = 906 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 519 tgatgctttggatgccattc 538
>emb|AL139376.17| Human DNA sequence from clone RP11-23E3 on chromosome 13 Contains a novel gene, the CLDN10 gene for claudin 10 (OSP-L, CPETRL3), the gene for novel zinc-finger protein (DZIP1, KIAA0996) and 3 CpG islands, complete sequence Length = 152794 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 594 gccaagtgacatgcacctccagtt 617 ||||| |||||||||||||||||| Sbjct: 82648 gccaaatgacatgcacctccagtt 82671
>gb|AF508886.1| Xylosandrus sp. nov (cf. ursa) elongation factor 1-alpha (EF-1a) gene, partial cds Length = 949 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 536 tgatgctttggatgccattc 555
>gb|AF508882.1| Webbia cf. platypoides elongation factor 1-alpha (EF-1a) gene, partial cds Length = 933 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 520 tgatgctttggatgccattc 539
>gb|AF508869.1| Ambrosiodmus compressus elongation factor 1-alpha (EF-1a) gene, partial cds Length = 863 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 478 tgatgctttggatgccattc 497
>emb|Z29961.1|OSCHITIA O.sativa (PCH16) mRNA for chitinase class I Length = 1159 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 49 gatcggatgctttacatcga 68 |||||||||||||||||||| Sbjct: 1132 gatcggatgctttacatcga 1151
>emb|X66049.1|PPDNAPOLD P.polycephalum mRNA (partial) for DNA polymerase delta (large subunit) Length = 444 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 123 gatgattgaggagaccaagc 142 |||||||||||||||||||| Sbjct: 348 gatgattgaggagaccaagc 367
>emb|X56063.1|OSENDO O.sativa mRNA for endochitinase Length = 1160 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 49 gatcggatgctttacatcga 68 |||||||||||||||||||| Sbjct: 964 gatcggatgctttacatcga 983
>emb|AJ243431.1|ALW243431 Acinetobacter lwoffii wzc, wzb, wza, weeA, weeB, wceC, wzx, wzy, weeD, weeE, weeF, weeG, weeH, weeI, weeJ, weeK, galU, ugd, pgi, galE, pgm (partial) and mip (partial) genes (emulsan biosynthetic gene cluster), strain RAG-1 Length = 26953 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 292 gcatttgctgatgctttgga 311 |||||||||||||||||||| Sbjct: 16525 gcatttgctgatgctttgga 16544
>gb|AF444076.1| Coccotrypes advena isolate Dry20 elongation factor 1-alpha (EF-1a) gene, partial cds Length = 937 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 537 tgatgctttggatgccattc 556
>gb|AF444074.1| Coccotrypes cyperi elongation factor 1-alpha (EF-1a) gene, partial cds Length = 945 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 536 tgatgctttggatgccattc 555
>gb|AF444071.1| Coccotrypes cf. rhizophorae elongation factor 1-alpha (EF-1a) gene, partial cds Length = 922 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 515 tgatgctttggatgccattc 534
>gb|AF439740.1| Ozopemon uniseriatus elongation factor 1-alpha (EF-1a) gene, partial cds Length = 912 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 516 tgatgctttggatgccattc 535
>gb|AF308414.1| Liparthrum nigrescens elongation factor 1 alpha (ef-1a) gene, partial cds Length = 955 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 513 tgatgctttggatgccattc 532
>gb|AF308412.1| Hylesinopsis sp. HLH11 elongation factor 1 alpha (ef-1a) gene, partial cds Length = 910 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 532 tgatgctttggatgccattc 551
>gb|AF308411.1| Alniphagus aspericollis elongation factor 1 alpha (ef-1a) gene, partial cds Length = 746 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 393 tgatgctttggatgccattc 412
>gb|AF186693.2| Xylosandrus mancus elongation factor 1 alpha (ef-1a) gene, partial cds Length = 921 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 522 tgatgctttggatgccattc 541
>gb|AF186675.1| Ips perturbatus elongation factor 1 alpha (ef-1a) gene, partial cds Length = 914 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 510 tgatgctttggatgccattc 529
>gb|AF186673.1| Pityokteines minutus elongation factor 1 alpha (ef-1a) gene, partial cds Length = 913 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 510 tgatgctttggatgccattc 529
>gb|AF186671.1| Araptus sp. SCH05 elongation factor 1 alpha (ef-1a) gene, partial cds Length = 909 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 510 tgatgctttggatgccattc 529
>gb|AF186661.2| Dryocoetes affaber elongation factor 1 alpha (ef-1a) gene, partial cds Length = 889 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 516 tgatgctttggatgccattc 535
>gb|AF186660.2| Dryoxylon onoharaensum elongation factor 1 alpha (ef-1a) gene, partial cds Length = 754 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 495 tgatgctttggatgccattc 514
>gb|AC007155.16| Arabidopsis thaliana chromosome 2 clone T18E17 map PR1, complete sequence Length = 96095 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 473 tgatcggcaagcagcagcagatct 496 |||||||| ||||||||||||||| Sbjct: 27553 tgatcggcgagcagcagcagatct 27576
>gb|AC006437.5| Arabidopsis thaliana chromosome 2 clone T19K21 map mi421, complete sequence Length = 76713 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 473 tgatcggcaagcagcagcagatct 496 |||||||| ||||||||||||||| Sbjct: 71197 tgatcggcgagcagcagcagatct 71220
>gb|AF397647.1| Pityokteines sparsus elongation factor 1 alpha (EF-1alpha) gene, partial cds Length = 688 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 481 tgatgctttggatgccattc 500
>gb|AF397640.1| Ips woodi elongation factor 1 alpha (EF-1alpha) gene, partial cds Length = 687 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 481 tgatgctttggatgccattc 500
>gb|AF397638.1| Ips tridens elongation factor 1 alpha (EF-1alpha) gene, partial cds Length = 689 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 481 tgatgctttggatgccattc 500
>gb|AF397636.1| Ips pini elongation factor 1 alpha (EF-1alpha) gene, partial cds Length = 686 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 481 tgatgctttggatgccattc 500
>gb|AF397635.1| Ips pilifrons elongation factor 1 alpha (EF-1alpha) gene, partial cds Length = 689 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 481 tgatgctttggatgccattc 500
>gb|AF397634.1| Ips plastographus elongation factor 1 alpha (EF-1alpha) gene, partial cds Length = 687 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 481 tgatgctttggatgccattc 500
>gb|AF397633.1| Ips perturbatus elongation factor 1 alpha (EF-1alpha) gene, partial cds Length = 689 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 481 tgatgctttggatgccattc 500
>gb|AF397632.1| Ips perroti elongation factor 1 alpha (EF-1alpha) gene, partial cds Length = 689 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 481 tgatgctttggatgccattc 500
>gb|AF397631.1| Ips paraconfusus elongation factor 1 alpha (EF-1alpha) gene, partial cds Length = 689 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 481 tgatgctttggatgccattc 500
>gb|AF397630.1| Ips montanus elongation factor 1 alpha (EF-1alpha) gene, partial cds Length = 689 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 481 tgatgctttggatgccattc 500
>gb|AF397629.1| Ips lecontei elongation factor 1 alpha (EF-1alpha) gene, partial cds Length = 691 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 481 tgatgctttggatgccattc 500
>gb|AF397627.1| Ips integer elongation factor 1 alpha (EF-1alpha) gene, partial cds Length = 687 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 481 tgatgctttggatgccattc 500
>gb|AF397626.1| Ips hunteri elongation factor 1 alpha (EF-1alpha) gene, partial cds Length = 689 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 481 tgatgctttggatgccattc 500
>gb|AF397624.1| Ips grandicollis elongation factor 1 alpha (EF-1alpha) gene, partial cds Length = 689 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 481 tgatgctttggatgccattc 500
>gb|AF397621.1| Ips cribricollis elongation factor 1 alpha (EF-1alpha) gene, partial cds Length = 688 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 481 tgatgctttggatgccattc 500
>gb|AF397620.1| Ips confusus elongation factor 1 alpha (EF-1alpha) gene, partial cds Length = 689 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 481 tgatgctttggatgccattc 500
>gb|AF397619.1| Ips cembrae elongation factor 1 alpha (EF-1alpha) gene, partial cds Length = 687 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 481 tgatgctttggatgccattc 500
>gb|AF397618.1| Ips calligraphus elongation factor 1 alpha (EF-1alpha) gene, partial cds Length = 688 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 481 tgatgctttggatgccattc 500
>gb|AF397617.1| Ips borealis elongation factor 1 alpha (EF-1alpha) gene, partial cds Length = 687 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 481 tgatgctttggatgccattc 500
>gb|AF397615.1| Ips avulsus elongation factor 1 alpha (EF-1alpha) gene, partial cds Length = 687 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 481 tgatgctttggatgccattc 500
>gb|AF397614.1| Ips apache elongation factor 1 alpha (EF-1alpha) gene, partial cds Length = 688 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 481 tgatgctttggatgccattc 500
>gb|AF397613.1| Ips amitinus elongation factor 1 alpha (EF-1alpha) gene, partial cds Length = 420 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 209 tgatgctttggatgccattc 228
>gb|AF397612.1| Ips acuminatus elongation factor 1 alpha (EF-1alpha) gene, partial cds Length = 689 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 481 tgatgctttggatgccattc 500
>gb|AF259884.1| Webbia bicornis elongation factor 1 alpha (ef-1a) gene, partial cds Length = 915 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 510 tgatgctttggatgccattc 529
>gb|AF259882.1| Webbia quattuordecimspinatus elongation factor 1 alpha (ef-1a) gene, partial cds Length = 862 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 531 tgatgctttggatgccattc 550
>gb|AF259877.1| Ambrosiodmus aegir elongation factor 1 alpha (ef-1a) gene, partial cds Length = 931 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 531 tgatgctttggatgccattc 550
>gb|AF259875.1| Coccotrypes medius elongation factor 1 alpha (ef-1a) gene, partial cds Length = 885 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 483 tgatgctttggatgccattc 502
>gb|AF259873.1| Dryocoetes autographus elongation factor 1 alpha (ef-1a) gene, partial cds Length = 889 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 489 tgatgctttggatgccattc 508
>gb|AF259871.1| Coccotrypes longior elongation factor 1 alpha (ef-1a) gene, partial cds Length = 922 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 519 tgatgctttggatgccattc 538
>gb|AF259870.1| Ozopemon brownei elongation factor 1 alpha (ef-1a) gene, partial cds Length = 933 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 531 tgatgctttggatgccattc 550
>gb|AF259868.1| Coccotrypes advena elongation factor 1 alpha (ef-1a) gene, partial cds Length = 933 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 531 tgatgctttggatgccattc 550
>gb|AF259867.1| Coccotrypes gedeanus elongation factor 1 alpha (ef-1a) gene, partial cds Length = 925 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 531 tgatgctttggatgccattc 550
>gb|AF308432.1| Scolytodes parvulus elongation factor 1 alpha (ef-1a) gene, partial cds Length = 962 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 522 tgatgctttggatgccattc 541
>gb|AF308428.1| Dendroctonus ponderosae elongation factor 1 alpha (ef-1a) gene, partial cds Length = 922 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 534 tgatgctttggatgccattc 553
>gb|AF308427.1| Dendroctonus murrayanae elongation factor 1 alpha (ef-1a) gene, partial cds Length = 890 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 507 tgatgctttggatgccattc 526
>gb|AF308425.1| Dendroctonus jeffreyi elongation factor 1 alpha (ef-1a) gene, partial cds Length = 944 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 537 tgatgctttggatgccattc 556
>gb|AF308423.1| Dendroctonus adjunctus isolate hlt12 elongation factor 1 alpha (ef-1a) gene, partial cds Length = 925 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 528 tgatgctttggatgccattc 547
>gb|AF308401.1| Hylesinopsis sp. HLD02 elongation factor 1 alpha (ef-1a) gene, partial cds Length = 927 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 522 tgatgctttggatgccattc 541
>gb|AF375274.1| Gnathotrupes sp. SCL07 elongation factor-1 alpha (ef-1a) gene, partial cds Length = 1004 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 560 tgatgctttggatgccattc 579
>gb|AF375273.1| Gnathotrupes sp. SCL06 elongation factor-1 alpha (ef-1a) gene, partial cds Length = 1029 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 534 tgatgctttggatgccattc 553
>gb|AF375264.1| Stenancylus sp. COR01 elongation factor 1-alpha (ef1a) gene, partial cds Length = 693 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 549 tgatgctttggatgccattc 568
>gb|AC027323.5| Homo sapiens chromosome 5 clone CTD-2034A10, complete sequence Length = 140016 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 203 atggtggtggctcagcagaa 222 |||||||||||||||||||| Sbjct: 16286 atggtggtggctcagcagaa 16267
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 360 tactctcaccgtcgtaaaat 379 |||||||||||||||||||| Sbjct: 610033 tactctcaccgtcgtaaaat 610014
>dbj|AP000039.1| Homo sapiens genomic DNA, chromosome 21q22.1, segment 10/28, complete sequence Length = 100000 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 170 caaggaatctgatcatcaac 189 |||||||||||||||||||| Sbjct: 88232 caaggaatctgatcatcaac 88251
>gb|AC098820.3| Homo sapiens BAC clone RP11-253L15 from 2, complete sequence Length = 155669 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 agaagtcatttggaacaaca 45 |||||||||||||||||||| Sbjct: 107325 agaagtcatttggaacaaca 107306
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome Length = 5013479 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 243 tgacgctgcagcagatcggcatcc 266 |||||| ||||||||||||||||| Sbjct: 3752686 tgacgcggcagcagatcggcatcc 3752709
>dbj|AP004685.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0017G10 Length = 166700 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 49 gatcggatgctttacatcga 68 |||||||||||||||||||| Sbjct: 13360 gatcggatgctttacatcga 13379
>dbj|AP003685.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0548E04 Length = 138037 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 49 gatcggatgctttacatcga 68 |||||||||||||||||||| Sbjct: 122594 gatcggatgctttacatcga 122613
>dbj|AP002882.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0439B06 Length = 135991 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 360 tactctcaccgtcgtaaaat 379 |||||||||||||||||||| Sbjct: 84638 tactctcaccgtcgtaaaat 84619
>emb|AL954212.1| Pan troglodytes chromosome 22 clone RP43-043L10 map 22q22.11, complete sequence Length = 192328 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 170 caaggaatctgatcatcaac 189 |||||||||||||||||||| Sbjct: 24455 caaggaatctgatcatcaac 24474
>emb|AL954211.1| Pan troglodytes chromosome 22 clone PTB-034G05 map 22q22.11, complete sequence Length = 138573 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 170 caaggaatctgatcatcaac 189 |||||||||||||||||||| Sbjct: 120902 caaggaatctgatcatcaac 120921
>gb|AY500988.1| Coleobothrus luridus voucher Co12lurT elongation factor 1 alpha (EF1a) gene, partial cds Length = 899 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 522 tgatgctttggatgccattc 541
>gb|AY500987.1| Coleobothrus luridus voucher Co11lurLP elongation factor 1 alpha (EF1a) gene, partial cds Length = 899 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 522 tgatgctttggatgccattc 541
>gb|AY500986.1| Coleobothrus luridus voucher Co10lurLG elongation factor 1 alpha (EF1a) gene, partial cds Length = 899 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 522 tgatgctttggatgccattc 541
>gb|AY500985.1| Coleobothrus luridus voucher Co09lurGC elongation factor 1 alpha (EF1a) gene, partial cds Length = 899 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 522 tgatgctttggatgccattc 541
>gb|AY500982.1| Cisurgus wollastoni voucher Ci11wolLP elongation factor 1 alpha (EF1a) gene, partial cds Length = 899 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 522 tgatgctttggatgccattc 541
>gb|AY500981.1| Cisurgus wollastoni voucher Ci09wolEH elongation factor 1 alpha (EF1a) gene, partial cds Length = 899 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 522 tgatgctttggatgccattc 541
>gb|AY500980.1| Cisurgus occidentalis voucher Ci07occMo elongation factor 1 alpha (EF1a) gene, partial cds Length = 901 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 522 tgatgctttggatgccattc 541
>gb|AY500977.1| Cisurgus wollastoni voucher Ci01wolT elongation factor 1 alpha (EF1a) gene, partial cds Length = 899 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 522 tgatgctttggatgccattc 541
>gb|AY500952.1| Aphanarthrum canariense voucher A61carLP elongation factor 1 alpha (EF1a) gene, partial cds Length = 901 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 522 tgatgctttggatgccattc 541
>gb|AY500926.1| Aphanarthrum mairei voucher A29maiMo elongation factor 1 alpha (EF1a) gene, partial cds Length = 903 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 522 tgatgctttggatgccattc 541
>gb|AY500925.1| Aphanarthrum mairei voucher A28maiMo elongation factor 1 alpha (EF1a) gene, partial cds Length = 903 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 522 tgatgctttggatgccattc 541
>gb|AY500922.1| Aphanarthrum mairei voucher A25maiMo elongation factor 1 alpha (EF1a) gene, partial cds Length = 903 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 522 tgatgctttggatgccattc 541
>gb|AY500920.1| Aphanarthrum canariense voucher A23carLP elongation factor 1 alpha (EF1a) gene, partial cds Length = 917 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgatgctttggatgccattc 319 |||||||||||||||||||| Sbjct: 522 tgatgctttggatgccattc 541
>dbj|AK105798.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-A08, full insert sequence Length = 1141 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 49 gatcggatgctttacatcga 68 |||||||||||||||||||| Sbjct: 1069 gatcggatgctttacatcga 1088
>dbj|AK104020.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-008-C04, full insert sequence Length = 1136 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 49 gatcggatgctttacatcga 68 |||||||||||||||||||| Sbjct: 1064 gatcggatgctttacatcga 1083
>dbj|AK099339.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033028I21, full insert sequence Length = 1174 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 49 gatcggatgctttacatcga 68 |||||||||||||||||||| Sbjct: 1045 gatcggatgctttacatcga 1064
>dbj|AK061042.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-D05, full insert sequence Length = 1217 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 49 gatcggatgctttacatcga 68 |||||||||||||||||||| Sbjct: 1067 gatcggatgctttacatcga 1086
>emb|BX005105.6| Zebrafish DNA sequence from clone DKEY-37M8 in linkage group 22, complete sequence Length = 171403 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 178 ctgatcatcaacaactcaat 197 |||||||||||||||||||| Sbjct: 58365 ctgatcatcaacaactcaat 58384 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 178 ctgatcatcaacaactcaat 197 |||||||||||||||||||| Sbjct: 36948 ctgatcatcaacaactcaat 36929
>dbj|AP001715.1| Homo sapiens genomic DNA, chromosome 21q, section 59/105 Length = 340000 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 170 caaggaatctgatcatcaac 189 |||||||||||||||||||| Sbjct: 153382 caaggaatctgatcatcaac 153401
>dbj|D16221.1|RICCHT1 Oryza sativa (japonica cultivar-group) Cht-1 gene for endochitinase, complete cds Length = 2739 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 49 gatcggatgctttacatcga 68 |||||||||||||||||||| Sbjct: 2329 gatcggatgctttacatcga 2348
>emb|CT030194.5| Mouse DNA sequence from clone RP23-463F7 on chromosome 13, complete sequence Length = 195497 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 165 tgttgcaaggaatctgatca 184 |||||||||||||||||||| Sbjct: 57627 tgttgcaaggaatctgatca 57608
>emb|AL683876.5| Mouse DNA sequence from clone RP23-100E6 on chromosome 2, complete sequence Length = 207486 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 31 tcatttggaacaacaaaaga 50 |||||||||||||||||||| Sbjct: 38414 tcatttggaacaacaaaaga 38433
>dbj|AP000281.1| Homo sapiens genomic DNA, chromosome 21q22.1, D21S226-AML region, clone:T1588, complete sequence Length = 66129 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 170 caaggaatctgatcatcaac 189 |||||||||||||||||||| Sbjct: 32291 caaggaatctgatcatcaac 32310
>dbj|AP000183.1| Homo sapiens genomic DNA, chromosome 21q22.1, D21S226-AML region, clone Q78C10-f32E9, segment 10/21, complete sequence Length = 100000 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 170 caaggaatctgatcatcaac 189 |||||||||||||||||||| Sbjct: 94208 caaggaatctgatcatcaac 94227
>dbj|AP000107.1| Homo sapiens genomic DNA of 21q22.1, GART and AML related, Q78C10-149C3 region, segment 10/20, complete sequence Length = 100000 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 170 caaggaatctgatcatcaac 189 |||||||||||||||||||| Sbjct: 94208 caaggaatctgatcatcaac 94227 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,629,927 Number of Sequences: 3902068 Number of extensions: 5629927 Number of successful extensions: 92618 Number of sequences better than 10.0: 196 Number of HSP's better than 10.0 without gapping: 196 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 92048 Number of HSP's gapped (non-prelim): 561 length of query: 626 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 603 effective length of database: 17,143,297,704 effective search space: 10337408515512 effective search space used: 10337408515512 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
