>gb|AC154118.6| Mus musculus chromosome 19, clone RP24-340C10, complete sequence
          Length = 141422

 Score = 38.2 bits (19), Expect = 0.62
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 4     agttggacactgagagtga 22
             |||||||||||||||||||
Sbjct: 63868 agttggacactgagagtga 63850

>ref|XM_843453.1| PREDICTED: Canis familiaris similar to Ig lambda chain V region
          4A precursor (LOC606960), mRNA
          Length = 747

 Score = 36.2 bits (18), Expect = 2.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                            
Query: 9  gacactgagagtgatgga 26
          ||||||||||||||||||
Sbjct: 95 gacactgagagtgatgga 78

>ref|XM_849810.1| PREDICTED: Canis familiaris similar to Ig lambda chain V region 4A
           precursor (LOC612083), mRNA
          Length = 990

 Score = 36.2 bits (18), Expect = 2.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 9   gacactgagagtgatgga 26
           ||||||||||||||||||
Sbjct: 599 gacactgagagtgatgga 582

>emb|CR626886.6| Zebrafish DNA sequence from clone CH211-255I3 in linkage group 16,
             complete sequence
          Length = 165396

 Score = 36.2 bits (18), Expect = 2.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 7     tggacactgagagtgatg 24
             ||||||||||||||||||
Sbjct: 78814 tggacactgagagtgatg 78831

>gb|AC092357.2| Homo sapiens chromosome 16 clone RP11-332P24, complete sequence
          Length = 191768

 Score = 36.2 bits (18), Expect = 2.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 4     agttggacactgagagtg 21
             ||||||||||||||||||
Sbjct: 33333 agttggacactgagagtg 33316

>gb|AC018558.6| Homo sapiens chromosome 16 clone RP11-80F22, complete sequence
          Length = 151051

 Score = 36.2 bits (18), Expect = 2.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 4     agttggacactgagagtg 21
             ||||||||||||||||||
Sbjct: 83590 agttggacactgagagtg 83573

>gb|AC151775.1| Ornithorhynchus anatinus chromosome UNK clone OABb-307A1, complete
              sequence
          Length = 195598

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                               
Query: 2      tgagttggacactgaga 18
              |||||||||||||||||
Sbjct: 184719 tgagttggacactgaga 184703

>ref|XM_520692.1| PREDICTED: Pan troglodytes similar to hypothetical protein
            (LOC465230), mRNA
          Length = 3072

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                             
Query: 12   actgagagtgatggacc 28
            |||||||||||||||||
Sbjct: 1324 actgagagtgatggacc 1340

>ref|NM_012690.1| Rattus norvegicus ATP-binding cassette, sub-family B (MDR/TAP),
            member 4 (Abcb4), mRNA
          Length = 3912

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                             
Query: 6    ttggacactgagagtga 22
            |||||||||||||||||
Sbjct: 3642 ttggacactgagagtga 3658

>gb|AC102597.22| Mus musculus chromosome 18, clone RP23-361H2, complete sequence
          Length = 204401

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                               
Query: 11     cactgagagtgatggac 27
              |||||||||||||||||
Sbjct: 183936 cactgagagtgatggac 183952

>gb|AY369025.1| Lialis jicari NADH dehydrogenase subunit 1 (ND1) gene, partial cds;
            tRNA-Ile, tRNA-Gln, and tRNA-Met genes, complete
            sequence; NADH dehydrogenase subunit 2 (ND2) gene,
            complete cds; tRNA-Trp, tRNA-Ala, tRNA-Asn, tRNA-Cys, and
            tRNA-Tyr genes, complete sequence; and cytochrome c
            oxidase subunit I (COI) gene, partial cds; mitochondrial
          Length = 1753

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                             
Query: 8    ggacactgagagtgatg 24
            |||||||||||||||||
Sbjct: 1147 ggacactgagagtgatg 1131

>ref|XM_845328.1| PREDICTED: Canis familiaris similar to Ig lambda chain V region
          4A precursor (LOC608336), partial mRNA
          Length = 330

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                           
Query: 10 acactgagagtgatgga 26
          |||||||||||||||||
Sbjct: 94 acactgagagtgatgga 78

>ref|XM_843718.1| PREDICTED: Canis familiaris similar to Ig lambda chain V region
          4A precursor (LOC607125), mRNA
          Length = 366

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                           
Query: 9  gacactgagagtgatgg 25
          |||||||||||||||||
Sbjct: 95 gacactgagagtgatgg 79

>ref|XM_847838.1| PREDICTED: Canis familiaris similar to Ig lambda chain V region
          4A precursor (LOC610355), mRNA
          Length = 366

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                           
Query: 9  gacactgagagtgatgg 25
          |||||||||||||||||
Sbjct: 95 gacactgagagtgatgg 79

>ref|XM_543518.2| PREDICTED: Canis familiaris similar to Ig lambda chain V region 4A
           precursor (LOC486392), mRNA
          Length = 744

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                            
Query: 9   gacactgagagtgatgg 25
           |||||||||||||||||
Sbjct: 413 gacactgagagtgatgg 397

>ref|XM_548615.2| PREDICTED: Canis familiaris similar to Ig lambda chain V region
          4A precursor (LOC491494), mRNA
          Length = 366

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                           
Query: 9  gacactgagagtgatgg 25
          |||||||||||||||||
Sbjct: 95 gacactgagagtgatgg 79

>ref|XM_548485.2| PREDICTED: Canis familiaris similar to Ig lambda chain V-I region
           BL2 precursor (LOC491364), mRNA
          Length = 1290

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                            
Query: 9   gacactgagagtgatgg 25
           |||||||||||||||||
Sbjct: 107 gacactgagagtgatgg 91

>ref|XM_849862.1| PREDICTED: Canis familiaris similar to Ig lambda chain V region
          4A precursor (LOC612135), mRNA
          Length = 1203

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                           
Query: 9  gacactgagagtgatgg 25
          |||||||||||||||||
Sbjct: 95 gacactgagagtgatgg 79

>ref|XM_849792.1| PREDICTED: Canis familiaris similar to Ig lambda chain V region
          4A precursor (LOC612066), mRNA
          Length = 366

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                           
Query: 9  gacactgagagtgatgg 25
          |||||||||||||||||
Sbjct: 95 gacactgagagtgatgg 79

>ref|XM_548510.2| PREDICTED: Canis familiaris similar to 60S ribosomal protein L12
          (LOC491389), mRNA
          Length = 726

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                           
Query: 10 acactgagagtgatgga 26
          |||||||||||||||||
Sbjct: 94 acactgagagtgatgga 78

>ref|XM_543498.2| PREDICTED: Canis familiaris similar to Ig lambda chain V region
          4A precursor (LOC486372), mRNA
          Length = 366

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                           
Query: 9  gacactgagagtgatgg 25
          |||||||||||||||||
Sbjct: 95 gacactgagagtgatgg 79

>emb|AL136131.15| Human DNA sequence from clone RP1-261G23 on chromosome 6p12.2-21.1
             Contains the KIAA0110 gene, the FLJ30845 gene, the MRPS18A
             gene for mitochondrial ribosomal protein S18A, a
             pseudogene similar to OPA-interacting protein (OIP21) a
             novel gene, the VEGF gene for vascular endothelial growth
             factor and two CpG islands, complete sequence
          Length = 172033

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                              
Query: 3     gagttggacactgagag 19
             |||||||||||||||||
Sbjct: 48245 gagttggacactgagag 48229

>gb|AC109599.4| Homo sapiens chromosome 16 clone RP11-144N1, complete sequence
          Length = 166598

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                              
Query: 1     ttgagttggacactgag 17
             |||||||||||||||||
Sbjct: 46521 ttgagttggacactgag 46537

>emb|CR857835.1| Pongo pygmaeus mRNA; cDNA DKFZp459O1154 (from clone DKFZp459O1154)
          Length = 4362

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                             
Query: 12   actgagagtgatggacc 28
            |||||||||||||||||
Sbjct: 2010 actgagagtgatggacc 2026

>emb|CR857644.1| Pongo pygmaeus mRNA; cDNA DKFZp469O2329 (from clone DKFZp469O2329)
          Length = 2785

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                             
Query: 12   actgagagtgatggacc 28
            |||||||||||||||||
Sbjct: 1597 actgagagtgatggacc 1613

>emb|CR450850.9| Zebrafish DNA sequence from clone CH211-113J3 in linkage group 24,
              complete sequence
          Length = 136418

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                               
Query: 10     acactgagagtgatgga 26
              |||||||||||||||||
Sbjct: 119653 acactgagagtgatgga 119637

>gb|AC157516.2| Mus musculus BAC clone RP24-279F18 from chromosome 9, complete sequence
          Length = 175493

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 20/21 (95%)
 Strand = Plus / Minus

                                  
Query: 7     tggacactgagagtgatggac 27
             |||||| ||||||||||||||
Sbjct: 99202 tggacagtgagagtgatggac 99182

>gb|AY134600.1| Lialis jicari NADH dehydrogenase subunit 2 (ND2) gene, partial cds;
           mitochondrial
          Length = 1215

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                            
Query: 8   ggacactgagagtgatg 24
           |||||||||||||||||
Sbjct: 841 ggacactgagagtgatg 825

>emb|CR352352.1| Gallus gallus finished cDNA, clone ChEST532j16
          Length = 1634

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                             
Query: 2    tgagttggacactgaga 18
            |||||||||||||||||
Sbjct: 1049 tgagttggacactgaga 1065

>gb|AC129959.6| Bos taurus, clone RP42-518P7, complete sequence
          Length = 211988

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                               
Query: 3      gagttggacactgagag 19
              |||||||||||||||||
Sbjct: 184603 gagttggacactgagag 184619

>gb|AF108134.1|AF108134 Mus musculus ubi-d4/requiem gene, exons 2 through 11 and partial
           cds
          Length = 10939

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                            
Query: 2   tgagttggacactgaga 18
           |||||||||||||||||
Sbjct: 622 tgagttggacactgaga 638

>emb|CR925792.22| Zebrafish DNA sequence from clone DKEY-255G15 in linkage group 4,
              complete sequence
          Length = 183618

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                               
Query: 10     acactgagagtgatgga 26
              |||||||||||||||||
Sbjct: 151356 acactgagagtgatgga 151372

>gb|AY662546.1| Lialis jicari NADH dehydrogenase subunit 1 (ND1) gene, partial cds;
            tRNA-Ile, tRNA-Glu, and tRNA-Met genes, complete
            sequence; NADH dehydrogenase subunit 2 (ND2) gene,
            complete cds; tRNA-Trp, tRNA-Ala, tRNA-Asn, tRNA-Cys, and
            tRNA-Tyr genes, complete sequence; and cytochrome c
            oxidase subunit I (COI) gene, partial cds; mitochondrial
          Length = 1753

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                             
Query: 8    ggacactgagagtgatg 24
            |||||||||||||||||
Sbjct: 1147 ggacactgagagtgatg 1131

>gb|AC147041.3| Mus musculus BAC clone RP23-129J8 from 15, complete sequence
          Length = 190287

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                               
Query: 10     acactgagagtgatgga 26
              |||||||||||||||||
Sbjct: 120267 acactgagagtgatgga 120251



 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                               
Query: 10     acactgagagtgatgga 26
              |||||||||||||||||
Sbjct: 120201 acactgagagtgatgga 120185



 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                               
Query: 10     acactgagagtgatgga 26
              |||||||||||||||||
Sbjct: 120180 acactgagagtgatgga 120164



 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                               
Query: 10     acactgagagtgatgga 26
              |||||||||||||||||
Sbjct: 120081 acactgagagtgatgga 120065



 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                               
Query: 10     acactgagagtgatgga 26
              |||||||||||||||||
Sbjct: 120015 acactgagagtgatgga 119999



 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                               
Query: 10     acactgagagtgatgga 26
              |||||||||||||||||
Sbjct: 119916 acactgagagtgatgga 119900



 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                               
Query: 10     acactgagagtgatgga 26
              |||||||||||||||||
Sbjct: 119883 acactgagagtgatgga 119867

>gb|L25849.1|RATPGP3A Rat glycoprotein P (pgp3) mRNA, partial cds
          Length = 882

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                            
Query: 6   ttggacactgagagtga 22
           |||||||||||||||||
Sbjct: 533 ttggacactgagagtga 549

>emb|Z14206.1|HSE5442 H.sapiens rearranged Ig heavy chain variable region (VDJ)
          Length = 428

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                           
Query: 13 ctgagagtgatggacct 29
          |||||||||||||||||
Sbjct: 7  ctgagagtgatggacct 23

>gb|L15079.1|RATPGLYCO Rat p-glycoprotein mRNA, complete cds
          Length = 3912

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                             
Query: 6    ttggacactgagagtga 22
            |||||||||||||||||
Sbjct: 3642 ttggacactgagagtga 3658


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 158,580
Number of Sequences: 3902068
Number of extensions: 158580
Number of successful extensions: 41642
Number of sequences better than 10.0: 37
Number of HSP's better than 10.0 without gapping: 37
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 41597
Number of HSP's gapped (non-prelim): 45
length of query: 31
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 11
effective length of database: 17,155,003,908
effective search space: 188705042988
effective search space used: 188705042988
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)