ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags22h18
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AK061725.1| Oryza sativa (japonica cultivar-group) cDNA clon... 718 0.0
2ref|XM_481630.1| Oryza sativa (japonica cultivar-group), mRNA 654 0.0
3ref|XM_507578.1| PREDICTED Oryza sativa (japonica cultivar-group... 654 0.0
4ref|XM_507194.2| PREDICTED Oryza sativa (japonica cultivar-group... 654 0.0
5dbj|AK121204.1| Oryza sativa (japonica cultivar-group) cDNA clon... 654 0.0
6dbj|AK098843.1| Oryza sativa (japonica cultivar-group) cDNA clon... 654 0.0
7dbj|AK062210.1| Oryza sativa (japonica cultivar-group) cDNA clon... 654 0.0
8dbj|D12631.1|RICRPL7AB Oryza sativa (japonica cultivar-group) mR... 654 0.0
9gb|BT016736.1| Zea mays clone Contig569 mRNA sequence 622 e-175
10gb|AY103834.1| Zea mays PCO109701 mRNA sequence 609 e-171
11gb|BT018084.1| Zea mays clone EL01N0552B03.c mRNA sequence 585 e-164
12gb|AY105417.1| Zea mays PCO109699 mRNA sequence 575 e-161
13dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 278 2e-71
14dbj|AP004637.3| Oryza sativa (japonica cultivar-group) genomic D... 278 2e-71
15dbj|AP003884.2| Oryza sativa (japonica cultivar-group) genomic D... 278 2e-71
16gb|AC108759.2| Oryza sativa (Japonica cultiva-group) chromosome ... 254 2e-64
17dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 254 2e-64
18ref|XM_463662.1| Oryza sativa (japonica cultivar-group), predic... 194 2e-46
19gb|DQ241858.1| Solanum tuberosum clone 014F11 60S ribosomal prot... 188 1e-44
20dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 182 7e-43
21dbj|AP004672.3| Oryza sativa (japonica cultivar-group) genomic D... 182 7e-43
22dbj|AP004223.2| Oryza sativa (japonica cultivar-group) genomic D... 182 7e-43
23ref|NM_116152.2| Arabidopsis thaliana structural constituent of ... 165 2e-37
24gb|AY114667.1| Arabidopsis thaliana 60S ribosomal protein L7A pr... 165 2e-37
25gb|AY062758.1| Arabidopsis thaliana 60S RIBOSOMAL PROTEIN L7A pr... 165 2e-37
26gb|AY060519.1| Arabidopsis thaliana AT3g62870/F26K9_300 mRNA, co... 165 2e-37
27gb|AY052264.1| Arabidopsis thaliana AT3g62870/F26K9_300 mRNA, co... 165 2e-37
28emb|BX825094.1|CNS0A7RE Arabidopsis thaliana Full-length cDNA Co... 165 2e-37
29emb|BX823982.1|CNS0A6PP Arabidopsis thaliana Full-length cDNA Co... 165 2e-37
30emb|BX824662.1|CNS0A4TO Arabidopsis thaliana Full-length cDNA Co... 165 2e-37
31gb|AY086353.1| Arabidopsis thaliana clone 24272 mRNA, complete s... 159 1e-35
32emb|BX824178.1|CNS0A6S9 Arabidopsis thaliana Full-length cDNA Co... 157 4e-35
33emb|BX822281.1|CNS0A71I Arabidopsis thaliana Full-length cDNA Co... 157 4e-35
34gb|BT014547.1| Lycopersicon esculentum clone 133964F, mRNA sequence 153 6e-34
35gb|DQ268850.1| Solanum tuberosum clone 155G10 60S ribosomal prot... 153 6e-34
36emb|BX824325.1|CNS0A7R8 Arabidopsis thaliana Full-length cDNA Co... 149 1e-32
37ref|NM_130329.2| Arabidopsis thaliana structural constituent of ... 145 2e-31
38gb|BT000500.1| Arabidopsis thaliana 60S ribosomal protein L7A (... 145 2e-31
39emb|AL162651.1|ATF26K9 Arabidopsis thaliana DNA chromosome 3, BA... 145 2e-31
40gb|AY052674.1| Arabidopsis thaliana At2g47610/T30B22.8 mRNA, com... 145 2e-31
41gb|AF385719.1|AF385719 Arabidopsis thaliana At2g47610/T30B22.8 m... 145 2e-31
42emb|BX821062.1|CNS0A8OD Arabidopsis thaliana Full-length cDNA Co... 145 2e-31
43emb|BX842094.1|CNS09Y94 Arabidopsis thaliana Full-length cDNA Co... 145 2e-31
44emb|BX842006.1|CNS09Y9Z Arabidopsis thaliana Full-length cDNA Co... 145 2e-31
45gb|AY088386.1| Arabidopsis thaliana clone 6394 mRNA, complete se... 145 2e-31
46emb|BX819217.1|CNS0A8T4 Arabidopsis thaliana Full-length cDNA Co... 137 4e-29
47gb|AC155335.1| Brassica rapa subsp. pekinensis chromosome Cytoge... 133 6e-28
48gb|AC002535.3| Arabidopsis thaliana chromosome 2 clone T30B22 ma... 125 1e-25
49gb|AC155339.1| Brassica rapa subsp. pekinensis chromosome Cytoge... 119 9e-24
50gb|BC106480.1| Xenopus laevis cDNA clone IMAGE:7211162 117 3e-23
51gb|AY393839.1| Xenopus laevis ribosomal protein L7a mRNA, partia... 117 3e-23
52emb|BX821934.1|CNS0A88T Arabidopsis thaliana Full-length cDNA Co... 117 3e-23
53gb|AY496113.1| Capsicum annuum 60S ribosomal protein L7A mRNA, p... 111 2e-21
54dbj|AK220651.1| Arabidopsis thaliana mRNA for 60S ribosomal prot... 105 1e-19
55emb|AJ718619.1| Nicotiana tabacum cDNA-AFLP-fragment BSTC3-31-30... 94 5e-16
56emb|BX821043.1|CNS0A8L9 Arabidopsis thaliana Full-length cDNA Co... 86 1e-13
57dbj|AK108838.1| Oryza sativa (japonica cultivar-group) cDNA clon... 82 2e-12
58gb|AY924998.1| Seculamonas ecuadoriensis Rpl7A mRNA, partial cds 80 8e-12
59gb|AY924999.1| Reclinomonas americana Rpl7A mRNA, partial cds 78 3e-11
60gb|AF401560.1| Ictalurus punctatus ribosomal protein L7a mRNA, c... 78 3e-11
61gb|AY924997.1| Jakoba libera Rpl7A mRNA, partial cds 70 7e-09
62gb|BC072834.1| Xenopus laevis MGC80199 protein, mRNA (cDNA clone... 64 4e-07
63gb|AY769275.1| Bombyx mori ribosomal protein L7A (RpL7A) mRNA, c... 62 2e-06
64gb|DQ118092.1| Trimastix pyriformis ribosomal protein L7A mRNA, ... 62 2e-06
65gb|AY310805.1| Nicotiana benthamiana clone 12-101 unknown mRNA 62 2e-06
66gb|AY439881.1| Armigeres subalbatus ASAP ID: 38933 cytosolic lar... 60 7e-06
67ref|XM_575193.1| PREDICTED: Rattus norvegicus similar to 60S rib... 60 7e-06
68gb|AC140446.5| Mus musculus BAC clone RP24-114J11 from chromosom... 60 7e-06
69emb|BX825080.1|CNS0A6S2 Arabidopsis thaliana Full-length cDNA Co... 56 1e-04
70gb|AY924996.1| Malawimonas jakobiformis Rpl7A mRNA, partial cds 56 1e-04
71gb|BC076693.1| Xenopus tropicalis hypothetical protein LOC447981... 54 4e-04
72gb|AY925004.1| Malawimonas jakobiformis isolate MJL00000703 Rpl7... 54 4e-04
73ref|XM_575291.1| PREDICTED: Rattus norvegicus similar to 60S rib... 54 4e-04
74emb|AL824703.12| Mouse DNA sequence from clone RP23-317M2 on chr... 54 4e-04
75gb|AC154486.2| Mus musculus BAC clone RP24-118H13 from chromosom... 52 0.002
76gb|AC110194.11| Mus musculus chromosome 7, clone RP23-238J3, com... 52 0.002
77gb|AC182749.2| Mus musculus BAC clone RP23-464D14 from chromosom... 52 0.002
78ref|XM_909062.2| PREDICTED: Mus musculus similar to 60S ribosoma... 52 0.002
79ref|XM_921134.2| PREDICTED: Mus musculus similar to 60S ribosoma... 52 0.002
80ref|XM_193790.7| PREDICTED: Mus musculus similar to 60S ribosoma... 52 0.002
81ref|XM_898600.2| PREDICTED: Mus musculus similar to 60S ribosoma... 52 0.002
82gb|AC110262.12| Mus musculus chromosome 17, clone RP23-291L10, c... 52 0.002
83ref|XR_002714.1| PREDICTED: Mus musculus similar to 60S ribosoma... 52 0.002
84ref|XM_751458.1| Ustilago maydis 521 hypothetical protein (UM004... 52 0.002
85gb|AC124412.3| Mus musculus BAC clone RP24-274J3 from chromosome... 52 0.002
86emb|AM049005.1| Meladema coriacea mRNA for ribosomal protein L7A... 52 0.002
87gb|AC115304.3| Mus musculus BAC clone RP24-156K1 from 15, comple... 52 0.002
88gb|AC154411.2| Mus musculus BAC clone RP24-221F4 from chromosome... 52 0.002
89gb|AC166246.1| Mus musculus BAC clone RP24-80F22 from chromosome... 52 0.002
90gb|AC093926.6| Genomic sequence for Mus musculus, clone RP23-342... 52 0.002
91gb|AC154546.2| Mus musculus BAC clone RP23-431I7 from chromosome... 52 0.002
92dbj|AK034073.1| Mus musculus adult male diencephalon cDNA, RIKEN... 52 0.002
93gb|AY925007.1| Reclinomonas americana Rpl7A gene, partial cds 52 0.002
94ref|XM_577004.1| PREDICTED: Rattus norvegicus similar to 60S rib... 52 0.002
95ref|XM_576987.1| PREDICTED: Rattus norvegicus similar to PRO1477... 52 0.002
96ref|XM_346319.2| PREDICTED: Rattus norvegicus similar to 60S rib... 52 0.002
97ref|XM_225910.3| PREDICTED: Rattus norvegicus similar to Rpl7a p... 52 0.002
98ref|XM_222251.3| PREDICTED: Rattus norvegicus E1A binding protei... 52 0.002
99ref|XM_573092.1| PREDICTED: Rattus norvegicus similar to 60S rib... 52 0.002
100ref|XM_575493.1| PREDICTED: Rattus norvegicus similar to 60S rib... 52 0.002
101ref|XM_345462.2| PREDICTED: Rattus norvegicus similar to Rpl7a p... 52 0.002
102ref|XM_575149.1| PREDICTED: Rattus norvegicus similar to 60S rib... 52 0.002
103ref|XM_216024.3| PREDICTED: Rattus norvegicus ribosomal protein ... 52 0.002
104ref|XM_574881.1| PREDICTED: Rattus norvegicus similar to 60S rib... 52 0.002
105ref|XM_574302.1| PREDICTED: Rattus norvegicus similar to 60S rib... 52 0.002
106gb|AC154252.1| Mus musculus BAC clone RP24-197M20 from chromosom... 52 0.002
107emb|X15013.1|RNPPL7A Rat mRNA for ribosomal protein L7a 52 0.002
108emb|AL603787.8| Mouse DNA sequence from clone RP23-169J19 on chr... 52 0.002
109gb|AC147366.5| Mus musculus BAC clone RP23-386J3 from 15, comple... 52 0.002
110gb|AC171211.1| Mus musculus BAC clone RP23-34I14 from chromosome... 52 0.002
111emb|AL772228.5| Mouse DNA sequence from clone RP23-236D1 on chro... 52 0.002
112gb|AC121151.11| Mus musculus chromosome 17, clone RP24-342C2, co... 50 0.007
113ref|XR_002826.1| PREDICTED: Mus musculus similar to 60S ribosoma... 50 0.007
114ref|XM_846090.1| PREDICTED: Canis familiaris similar to 60S ribo... 50 0.007
115emb|AJ718795.1| Nicotiana tabacum cDNA-AFLP-fragment BSTC31-3-31... 50 0.007
116dbj|AP003158.1| Mus musculus genomic DNA, chromosome 16q clone:R... 50 0.007
117dbj|AP003156.1| Mus musculus genomic DNA, chromosome 16q clone:R... 50 0.007
118gb|AY702208.1| Loligo pealei ribosomal protein L7 mRNA, partial cds 48 0.027
119gb|AY925011.1| Trimastix pyriformis ATCC50562 Rpl7A gene, partia... 48 0.027
120ref|XM_759559.1| Theileria parva strain Muguga 60S ribosomal pro... 48 0.027
121gb|AY130409.1| Scyliorhinus canicula ribosomal protein L7A-like ... 48 0.027
122gb|DQ214069.1| Taeniopygia guttata clone 0058P0022B08 ribosomal ... 46 0.11
123gb|AC114662.11| Mus musculus chromosome 1, clone RP24-170M24, co... 46 0.11
124gb|AY925003.1| Malawimonas californiana Rpl7A gene, partial cds 46 0.11
125gb|AY925000.1| Acanthamoeba castellanii Rpl7A mRNA, partial cds 46 0.11
126ref|XR_003122.1| PREDICTED: Mus musculus hypothetical protein LO... 46 0.11
127emb|AM049007.1| Scarabaeus laticollis mRNA for ribosomal protein... 46 0.11
128ref|XM_644983.1| Entamoeba histolytica HM-1:IMSS 60S ribosomal p... 46 0.11
129gb|AY925013.1| Capsaspora owczarzaki Rpl7A gene, partial cds 46 0.11
130ref|XM_223019.3| PREDICTED: Rattus norvegicus hypothetical LOC28... 46 0.11
131ref|XM_576280.1| PREDICTED: Rattus norvegicus similar to 60S rib... 46 0.11
132gb|AC107710.5| Mus musculus chromosome 19, clone RP23-269K10, co... 44 0.42
133gb|AC120404.25| Mus musculus chromosome 6, clone RP24-405O23, co... 44 0.42
134gb|BC084678.1| Mus musculus ribosomal protein L7a, mRNA (cDNA cl... 44 0.42
135gb|AE017348.1| Cryptococcus neoformans var. neoformans JEC21 chr... 44 0.42
136gb|AC128597.3| Rattus norvegicus BAC CH230-62C6 (Children's Hos... 44 0.42
137gb|AC138741.7| Mus musculus chromosome 1, clone RP24-260D21, com... 44 0.42
138gb|AC123658.9| Mus musculus chromosome 15, clone RP23-192C13, co... 44 0.42
139gb|BC065176.1| Mus musculus ribosomal protein L7a, mRNA (cDNA cl... 44 0.42
140gb|AC140799.6| Mus musculus chromosome 15, clone RP24-147N23, co... 44 0.42
141ref|NM_013721.2| Mus musculus ribosomal protein L7a (Rpl7a), mRNA 44 0.42
142gb|AC132575.3| Mus musculus BAC clone RP24-425F2 from chromosome... 44 0.42
143ref|XM_980392.1| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.42
144ref|XM_977480.1| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.42
145ref|XM_484651.4| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.42
146ref|XM_992217.1| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.42
147gb|AC116421.8| Mus musculus chromosome 9, clone RP24-142L1, comp... 44 0.42
148ref|XR_003588.1| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.42
149ref|XR_002452.1| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.42
150ref|XR_002706.1| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.42
151ref|XM_909282.2| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.42
152ref|XM_891531.2| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.42
153ref|XR_002439.1| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.42
154ref|XM_991689.1| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.42
155ref|XM_987783.1| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.42
156ref|XM_987455.1| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.42
157ref|XM_975817.1| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.42
158ref|XM_887179.2| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.42
159ref|XM_906238.2| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.42
160ref|XM_486245.4| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.42
161ref|XM_985293.1| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.42
162ref|XR_003443.1| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.42
163ref|XM_905543.2| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.42
164ref|XM_620604.3| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.42
165ref|XM_979771.1| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.42
166ref|XR_003274.1| PREDICTED: Mus musculus similar to Ribosomal pr... 44 0.42
167ref|XR_002857.1| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.42
168ref|XM_974409.1| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.42
169ref|XR_004630.1| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.42
170ref|XR_001873.1| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.42
171ref|XM_143236.6| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.42
172ref|XR_003744.1| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.42
173gb|AC120548.15| Mus musculus chromosome 17, clone RP23-211H11, c... 44 0.42
174ref|XM_572378.1| Cryptococcus neoformans var. neoformans JEC21 r... 44 0.42
175gb|AC083890.4| Mus musculus strain C57BL6/J chromosome 5 clone R... 44 0.42
176gb|AC121580.3| Mus musculus BAC clone RP23-255J21 from 9, comple... 44 0.42
177gb|AC098705.2| Mus musculus BAC clone RP23-1B19 from 3, complete... 44 0.42
178gb|AC098724.3| Mus musculus BAC clone RP23-3D14 from 4, complete... 44 0.42
179gb|BC052339.1| Mus musculus ribosomal protein L7a, mRNA (cDNA cl... 44 0.42
180gb|BC016489.1| Mus musculus ribosomal protein L7a, mRNA (cDNA cl... 44 0.42
181emb|CR648468.2|CNS0EZBU Tetraodon nigroviridis full-length cDNA 44 0.42
182gb|AC115910.6| Mus musculus, clone RP24-480O17, complete sequence 44 0.42
183gb|AC102675.9| Mus musculus, clone RP23-232O16, complete sequence 44 0.42
184gb|AC112406.5| Rattus norvegicus 11 BAC CH230-329D3 (Children's ... 44 0.42
185gb|BC099389.1| Mus musculus ribosomal protein L7a, mRNA (cDNA cl... 44 0.42
186emb|BX908789.1| Neurospora crassa DNA linkage group VII BAC clon... 44 0.42
187gb|AC153153.4| Mus musculus BAC clone RP23-79G18 from chromosome... 44 0.42
188emb|AL606528.7| Mouse DNA sequence from clone RP23-45H23 on chro... 44 0.42
189dbj|AB246884.1| Lethenteron japonicum RPL7A mRNA for ribosomal p... 44 0.42
190gb|AC083913.2| Genomic sequence for Mus musculus, clone RP23-376... 44 0.42
191dbj|AK135447.1| Mus musculus 12 days embryo female mullerian duc... 44 0.42
192dbj|AK160044.1| Mus musculus osteoclast-like cell cDNA, RIKEN fu... 44 0.42
193dbj|AK160622.1| Mus musculus 11 days embryo whole body cDNA, RIK... 44 0.42
194dbj|AK160621.1| Mus musculus 11 days embryo whole body cDNA, RIK... 44 0.42
195gb|AC162454.3| Mus musculus chromosome 1, clone RP23-7D20, compl... 44 0.42
196gb|AC119212.15| Mus musculus chromosome 1, clone RP24-192L21, co... 44 0.42
197gb|BC089624.1| Mus musculus ribosomal protein L7a, mRNA (cDNA cl... 44 0.42
198gb|AC155934.2| Mus musculus BAC clone RP23-58N8 from chromosome ... 44 0.42
199gb|AC156637.2| Mus musculus BAC clone RP24-241I18 from chromosom... 44 0.42
200dbj|AK081115.1| Mus musculus 10 days neonate cerebellum cDNA, RI... 44 0.42
201gb|AC153869.7| Mus musculus 6 BAC RP23-386A17 (Roswell Park Canc... 44 0.42
202dbj|AK019449.1| Mus musculus 14, 17 days embryo head cDNA, RIKEN... 44 0.42
203gb|AC153952.4| Mus musculus 10 BAC RP24-82M14 (Roswell Park Canc... 44 0.42
204dbj|AK030194.1| Mus musculus adult male testis cDNA, RIKEN full-... 44 0.42
205dbj|AK014551.1| Mus musculus 0 day neonate skin cDNA, RIKEN full... 44 0.42
206gb|AY967504.1| Schmidtea mediterranea clone HE.3.01B mRNA sequence 44 0.42
207gb|AC130530.4| Mus musculus BAC clone RP23-153P2 from chromosome... 44 0.42
208gb|AY130406.1| Branchiostoma lanceolatum ribosomal protein L7A-l... 44 0.42
209ref|XM_221603.3| PREDICTED: Rattus norvegicus similar to 60S rib... 44 0.42
210ref|XM_580204.1| PREDICTED: Rattus norvegicus LOC501505 (LOC5015... 44 0.42
211ref|XM_221473.3| PREDICTED: Rattus norvegicus similar to 60S rib... 44 0.42
212ref|XM_576256.1| PREDICTED: Rattus norvegicus similar to 60S rib... 44 0.42
213ref|XM_578581.1| PREDICTED: Rattus norvegicus similar to 60S rib... 44 0.42
214ref|XM_576046.1| PREDICTED: Rattus norvegicus similar to 60S rib... 44 0.42
215ref|XM_574700.1| PREDICTED: Rattus norvegicus similar to Rpl7a p... 44 0.42
216ref|NM_001013830.1| Mus musculus similar to 60S ribosomal protei... 44 0.42
217gb|BC091731.1| Mus musculus ribosomal protein L7a, mRNA (cDNA cl... 44 0.42
218gb|BC091769.1| Mus musculus ribosomal protein L7a, mRNA (cDNA cl... 44 0.42
219gb|BC080712.1| Mus musculus ribosomal protein L7a, mRNA (cDNA cl... 44 0.42
220gb|BC080669.1| Mus musculus ribosomal protein L7a, mRNA (cDNA cl... 44 0.42
221gb|BC080663.1| Mus musculus ribosomal protein L7a, mRNA (cDNA cl... 44 0.42
222gb|AC154477.2| Mus musculus BAC clone RP24-134B24 from 14, compl... 44 0.42
223gb|AC133581.22| Mus musculus chromosome 1, clone RP24-395P3, com... 44 0.42
224gb|AC153627.2| Mus musculus 6 BAC RP23-104H13 (Roswell Park Canc... 44 0.42
225gb|AC153621.5| Mus musculus 6 BAC RP23-272K20 (Roswell Park Canc... 44 0.42
226emb|AJ871581.1| Streptomyces achromogenes subsp. rubradiris comp... 44 0.42
227gb|AC139040.8| Mus musculus chromosome 19, clone RP23-292H20, co... 44 0.42
228emb|AL671935.30| Mouse DNA sequence from clone RP23-421J13 on ch... 44 0.42
229gb|AC154649.3| Mus musculus BAC clone RP23-156O5 from chromosome... 44 0.42
230gb|AC123825.5| Mus musculus BAC clone RP24-93F18 from 8, complet... 44 0.42
231gb|BC029992.1| Mus musculus ribosomal protein L7a, mRNA (cDNA cl... 44 0.42
232gb|AC132438.3| Mus musculus BAC clone RP23-234G15 from 3, comple... 44 0.42
233gb|AC112266.6| Mus musculus BAC clone RP23-422B6 from 13, comple... 44 0.42
234gb|AC139575.3| Mus musculus BAC clone RP23-430K5 from 8, complet... 44 0.42
235ref|NG_005356.1| Mus musculus ribosomal protein L7a pseudogene (... 44 0.42
236emb|AL831733.4| Mouse DNA sequence from clone RP23-109O11 on chr... 44 0.42
237emb|AL732328.12| Mouse DNA sequence from clone RP23-106P4 on chr... 44 0.42
238emb|AL670660.8| Mouse DNA sequence from clone RP23-265D6 on chro... 44 0.42
239emb|AL606915.12| Mouse DNA sequence from clone RP23-185C16 on ch... 44 0.42
240gb|AY067190.1| Schmidtea mediterranea clone H.16.9f unknown mRNA... 44 0.42
241gb|M20743.1|MUSSURFC Mouse surfeit locus (Surf-3) processed pseu... 44 0.42
242gb|M20741.1|MUSSURFB Mouse surfeit locus (Surf-3) processed pseu... 44 0.42
243ref|NM_023091.1| Rattus norvegicus gamma-aminobutyric acid A rec... 42 1.6
244ref|NM_017369.1| Mus musculus gamma-aminobutyric acid (GABA-A) r... 42 1.6
245gb|AF131866.2| Mus musculus chromosome X clone CT7-271B7 map qA7... 42 1.6
246gb|AC124212.2| Mus musculus chromosome X clone CT7-532E7 map qA7... 42 1.6
247ref|XM_535657.2| PREDICTED: Canis familiaris similar to 60S ribo... 42 1.6
248gb|AC117241.4| Mus musculus BAC clone RP24-147H15 from chromosom... 42 1.6
249gb|AC147798.30| Mus musculus strain C57BL/6J chromosome 17 clone... 42 1.6
250dbj|AB226265.1| Aspergillus oryzae cDNA, contig sequence: AoEST3124 42 1.6
251gb|CP000133.1| Rhizobium etli CFN 42, complete genome 42 1.6
252dbj|AP007155.1| Aspergillus oryzae RIB40 genomic DNA, SC003 42 1.6
253gb|AC102131.20| Mus musculus chromosome 18, clone RP23-223O13, c... 42 1.6
254dbj|AK079258.1| Mus musculus adult male urinary bladder cDNA, RI... 42 1.6
255emb|AL115993.1|CNS01CU9 Botrytis cinerea strain T4 cDNA library 42 1.6
256emb|AL116480.1|CNS01D7S Botrytis cinerea strain T4 cDNA library 42 1.6
257emb|AL114151.1|CNS01BF3 Botrytis cinerea strain T4 cDNA library 42 1.6
258emb|AL113067.1|CNS01AKZ Botrytis cinerea strain T4 cDNA library 42 1.6
259emb|AL112537.1|CNS01A69 Botrytis cinerea strain T4 cDNA library 42 1.6
260gb|AY925005.1| Seculamonas ecuadoriensis Rpl7A gene, partial cds 42 1.6
261gb|AC148610.9| Mus musculus chromosome 17, clone RP24-260D18, co... 42 1.6
262ref|XM_221689.3| PREDICTED: Rattus norvegicus similar to 60S rib... 42 1.6
263gb|AF189265.1|AF189264S2 Mus musculus GABA-A receptor epsilon-li... 42 1.6
264gb|AF189263.1|AF189263 Mus musculus GABA-A receptor epsilon-like... 42 1.6
265gb|AF189262.1|AF189262 Rattus norvegicus GABA-A receptor epsilon... 42 1.6
266dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 42 1.6
267gb|AC174679.2| Mus musculus BAC clone CH36-470B20 from chromosom... 42 1.6
268gb|AE015451.1| Pseudomonas putida KT2440 complete genome 42 1.6
269gb|AC166099.2| Mus musculus BAC clone RP24-254H22 from chromosom... 42 1.6
270gb|AC166360.4| Mus musculus BAC clone RP24-497L5 from chromosome... 42 1.6
271emb|AL807816.7| Mouse DNA sequence from clone RP23-13H12 on chro... 42 1.6
272gb|AC012166.6| Drosophila melanogaster clone BACR03A06, complete... 40 6.5
273gb|AC016159.5| Drosophila melanogaster clone BACR48D05, complete... 40 6.5
274ref|XM_478122.1| Oryza sativa (japonica cultivar-group), mRNA 40 6.5
275ref|XM_473071.1| Oryza sativa (japonica cultivar-group), predic... 40 6.5
276gb|AC166493.6| Mus musculus chromosome 1, clone RP24-317E14, com... 40 6.5
277gb|AC131343.4| Oryza sativa (japonica cultivar-group) chromosome... 40 6.5
278gb|CP000075.1| Pseudomonas syringae pv. syringae B728a, complete... 40 6.5
279ref|XM_453972.1| Kluyveromyces lactis NRRL Y-1140, KLLA0E00506g ... 40 6.5
280gb|CP000058.1| Pseudomonas syringae pv. phaseolicola 1448A, comp... 40 6.5
281gb|AC114011.5| Oryza sativa (japonica cultivar-group) chromosome... 40 6.5
282ref|XR_003404.1| PREDICTED: Mus musculus similar to 60S ribosoma... 40 6.5
283ref|XR_001826.1| PREDICTED: Mus musculus similar to 60S ribosoma... 40 6.5
284gb|AC114423.16| Mus musculus chromosome 6, clone RP23-461C23, co... 40 6.5
285emb|CR931997.1| Corynebacterium jeikeium K411 complete genome 40 6.5
286emb|AM049004.1| Curculio glandium mRNA for ribosomal protein L7A... 40 6.5
287gb|AC122915.2| Mus musculus BAC clone RP23-27G7 from 5, complete... 40 6.5
288emb|CR699967.2|CNS0G31N Tetraodon nigroviridis full-length cDNA 40 6.5
289gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, compl... 40 6.5
290emb|AL049842.5|HSDJ129L7 Human DNA sequence from clone RP1-129L7... 40 6.5
291emb|CR382125.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso... 40 6.5
292emb|BX572595.1| Rhodopseudomonas palustris CGA009 complete genom... 40 6.5
293gb|AC153615.4| Mus musculus 6 BAC RP23-24I14 (Roswell Park Cance... 40 6.5
294emb|AL606658.5|OSJN00098 Oryza sativa genomic DNA, chromosome 4,... 40 6.5
295emb|AL662957.2|OSJN00157 Oryza sativa genomic DNA, chromosome 4,... 40 6.5
296gb|AC154397.8| Mus musculus chromosome 7, clone RP23-53N23, comp... 40 6.5
297gb|AC101688.13| Mus musculus chromosome 5, clone RP23-212P12, co... 40 6.5
298gb|AE005872.1| Caulobacter crescentus CB15 section 198 of 359 of... 40 6.5
299gb|AC010007.4| Drosophila melanogaster 3L BAC RP98-17K17 (Roswel... 40 6.5
300gb|AE012546.1| Xanthomonas campestris pv. campestris str. ATCC 3... 40 6.5
301ref|NM_176271.1| Drosophila melanogaster CG2469-RB, transcript v... 40 6.5
302ref|NM_176270.1| Drosophila melanogaster CG2469-RA, transcript v... 40 6.5
303dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ... 40 6.5
304gb|AY069525.1| Drosophila melanogaster LD24034 full length cDNA 40 6.5
305emb|BX530060.6| Zebrafish DNA sequence from clone DKEY-283F16 in... 40 6.5
306gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, ... 40 6.5
307gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome 40 6.5
308dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.5
309dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.5
310dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.5
311ref|XM_574781.1| PREDICTED: Rattus norvegicus similar to 60S rib... 40 6.5
312dbj|AP004348.4| Oryza sativa (japonica cultivar-group) genomic D... 40 6.5
313dbj|AP005250.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.5
314gb|AY961486.1| Lysiphlebus testaceipes ribosomal protein L7a (Rp... 40 6.5
315dbj|AP003849.2| Oryza sativa (japonica cultivar-group) genomic D... 40 6.5
316gb|AC119176.10| Mus musculus chromosome 1, clone RP24-359F24, co... 40 6.5
317emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,comp... 40 6.5
318emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome comple... 40 6.5
319gb|AE003789.5| Drosophila melanogaster chromosome 2R, section 6 ... 40 6.5
320gb|AE003471.3| Drosophila melanogaster chromosome 3L, section 5 ... 40 6.5
321gb|AC118223.11| Mus musculus chromosome 7, clone RP23-337G6, com... 40 6.5
322gb|AC005847.1|AC005847 Drosophila melanogaster DNA sequence (P1s... 40 6.5
323gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 40 6.5
324emb|AL606604.4| Oryza sativa genomic DNA, chromosome 4, BAC clon... 40 6.5
325emb|CT033296.1| Platynereis dumerilii EST IB0AAA23AB07EM1 40 6.5
326emb|CT032318.1| Platynereis dumerilii EST IB0AAA40DB09EM1 40 6.5
327emb|CT032317.1| Platynereis dumerilii EST IB0AAA40DB09FM1 40 6.5
328emb|AL732626.8| Mouse DNA sequence from clone RP23-191F22 on chr... 40 6.5

>dbj|AK061725.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-B03, full
           insert sequence
          Length = 1055

 Score =  718 bits (362), Expect = 0.0
 Identities = 452/482 (93%)
 Strand = Plus / Plus

                                                                       
Query: 1   gcagttcggcatcggcggggcgctgccgcccaagaaggacctccaccggttcgtcaagtg 60
           |||||||||||||||||| |||||||| ||||||||||| || ||| ||||||| |||||
Sbjct: 168 gcagttcggcatcggcggcgcgctgccacccaagaaggatctgcacaggttcgtgaagtg 227

                                                                       
Query: 61  gcccaaggtcgtgcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcc 120
           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 228 gcccaaggtggtgcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggttcc 287

                                                                       
Query: 121 cccggcgctccaccagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaa 180
           |||||||||| |||||||||||||||||||||||||||||||||| ||||||||||| ||
Sbjct: 288 cccggcgctcaaccagttcacccgcaccctcgacaagaacctcgcaaccaacctgtttaa 347

                                                                       
Query: 181 gatgcttctcaagtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagag 240
           ||||||||||||||||||||||||||||||||  || ||||||||||||||| |||||||
Sbjct: 348 gatgcttctcaagtaccgccctgaggacaaggctgccaagaaggagaggcttttgaagag 407

                                                                       
Query: 241 ggcacaggctgaggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagta 300
           ||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 408 ggcccaggctgaggctgaagggaaaaccgttgaggccaagaagccaattgttgtgaagta 467

                                                                       
Query: 301 tggtcttaaccatgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgc 360
           |||||||||||| || |||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 468 tggtcttaaccacgtgacttacctcattgagcagagcaaggcccagctggttgtcatcgc 527

                                                                       
Query: 361 tcatgatgttgacccaattgagctggttgtgtggctcccagccctatgcaggaagatgga 420
           |||||||||||| ||||||||||||||||||||||| |||||||| || |||||||||||
Sbjct: 528 tcatgatgttgatccaattgagctggttgtgtggcttccagccctgtgtaggaagatgga 587

                                                                       
Query: 421 ggtcccatactgcattgttaagggaaaatcacgccttggatcgattgttcacaagaagac 480
           |||||| |||||||| |||||||| ||| | |||||||||||||||||||||||||||||
Sbjct: 588 ggtcccttactgcatcgttaagggcaaagctcgccttggatcgattgttcacaagaagac 647

             
Query: 481 tg 482
           ||
Sbjct: 648 tg 649



to top

>ref|XM_481630.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1023

 Score =  654 bits (330), Expect = 0.0
 Identities = 444/482 (92%)
 Strand = Plus / Plus

                                                                       
Query: 1   gcagttcggcatcggcggggcgctgccgcccaagaaggacctccaccggttcgtcaagtg 60
           ||||||||| |||||||| ||||||||||||||||||||||| |||||||||||||||||
Sbjct: 179 gcagttcggaatcggcggcgcgctgccgcccaagaaggaccttcaccggttcgtcaagtg 238

                                                                       
Query: 61  gcccaaggtcgtgcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcc 120
           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 239 gcccaaggtggtgcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcc 298

                                                                       
Query: 121 cccggcgctccaccagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaa 180
           |||||||||| |||||||||| ||||||||||||||||||||||| || || ||||| ||
Sbjct: 299 cccggcgctcaaccagttcactcgcaccctcgacaagaacctcgcaactaatctgtttaa 358

                                                                       
Query: 181 gatgcttctcaagtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagag 240
           |||||| |||||||||||||||||||||||||  |||||||||||||||||| |||||||
Sbjct: 359 gatgctcctcaagtaccgccctgaggacaaggctgctaagaaggagaggcttttgaagag 418

                                                                       
Query: 241 ggcacaggctgaggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagta 300
           ||| |||||||||||||| || |||||||||||||| ||||| |||||||||||||||||
Sbjct: 419 ggcccaggctgaggctgaaggtaaaaccgttgaggcaaagaaaccaattgttgtgaagta 478

                                                                       
Query: 301 tggtcttaaccatgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgc 360
           |||||||||||||||||| ||||| ||||||||||||||||| || ||||| ||||| ||
Sbjct: 479 tggtcttaaccatgtcacatacctcattgagcagagcaaggcccaactggtcgtcattgc 538

                                                                       
Query: 361 tcatgatgttgacccaattgagctggttgtgtggctcccagccctatgcaggaagatgga 420
           ||||||||| || || |||||||||||||||||||| |||||||| ||||||||||||||
Sbjct: 539 tcatgatgtcgatccgattgagctggttgtgtggcttccagccctgtgcaggaagatgga 598

                                                                       
Query: 421 ggtcccatactgcattgttaagggaaaatcacgccttggatcgattgttcacaagaagac 480
           |||||| ||||||||||| || |||||| | || |||||||| |||||||||||||| ||
Sbjct: 599 ggtcccttactgcattgtgaaaggaaaagcccgtcttggatcaattgttcacaagaaaac 658

             
Query: 481 tg 482
           ||
Sbjct: 659 tg 660



to top

>ref|XM_507578.1| PREDICTED Oryza sativa (japonica cultivar-group), P0703C03.43 mRNA
          Length = 1041

 Score =  654 bits (330), Expect = 0.0
 Identities = 444/482 (92%)
 Strand = Plus / Plus

                                                                       
Query: 1   gcagttcggcatcggcggggcgctgccgcccaagaaggacctccaccggttcgtcaagtg 60
           ||||||||| |||||||| ||||||||||||||||||||||| |||||||||||||||||
Sbjct: 180 gcagttcggaatcggcggcgcgctgccgcccaagaaggaccttcaccggttcgtcaagtg 239

                                                                       
Query: 61  gcccaaggtcgtgcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcc 120
           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 240 gcccaaggtggtgcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcc 299

                                                                       
Query: 121 cccggcgctccaccagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaa 180
           |||||||||| |||||||||| ||||||||||||||||||||||| || || ||||| ||
Sbjct: 300 cccggcgctcaaccagttcactcgcaccctcgacaagaacctcgcaactaatctgtttaa 359

                                                                       
Query: 181 gatgcttctcaagtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagag 240
           |||||| |||||||||||||||||||||||||  |||||||||||||||||| |||||||
Sbjct: 360 gatgctcctcaagtaccgccctgaggacaaggctgctaagaaggagaggcttttgaagag 419

                                                                       
Query: 241 ggcacaggctgaggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagta 300
           ||| |||||||||||||| || |||||||||||||| ||||| |||||||||||||||||
Sbjct: 420 ggcccaggctgaggctgaaggtaaaaccgttgaggcaaagaaaccaattgttgtgaagta 479

                                                                       
Query: 301 tggtcttaaccatgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgc 360
           |||||||||||||||||| ||||| ||||||||||||||||| || ||||| ||||| ||
Sbjct: 480 tggtcttaaccatgtcacatacctcattgagcagagcaaggcccaactggtcgtcattgc 539

                                                                       
Query: 361 tcatgatgttgacccaattgagctggttgtgtggctcccagccctatgcaggaagatgga 420
           ||||||||| || || |||||||||||||||||||| |||||||| ||||||||||||||
Sbjct: 540 tcatgatgtcgatccgattgagctggttgtgtggcttccagccctgtgcaggaagatgga 599

                                                                       
Query: 421 ggtcccatactgcattgttaagggaaaatcacgccttggatcgattgttcacaagaagac 480
           |||||| ||||||||||| || |||||| | || |||||||| |||||||||||||| ||
Sbjct: 600 ggtcccttactgcattgtgaaaggaaaagcccgtcttggatcaattgttcacaagaaaac 659

             
Query: 481 tg 482
           ||
Sbjct: 660 tg 661



to top

>ref|XM_507194.2| PREDICTED Oryza sativa (japonica cultivar-group), P0703C03.43 mRNA
          Length = 1091

 Score =  654 bits (330), Expect = 0.0
 Identities = 444/482 (92%)
 Strand = Plus / Plus

                                                                       
Query: 1   gcagttcggcatcggcggggcgctgccgcccaagaaggacctccaccggttcgtcaagtg 60
           ||||||||| |||||||| ||||||||||||||||||||||| |||||||||||||||||
Sbjct: 183 gcagttcggaatcggcggcgcgctgccgcccaagaaggaccttcaccggttcgtcaagtg 242

                                                                       
Query: 61  gcccaaggtcgtgcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcc 120
           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 243 gcccaaggtggtgcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcc 302

                                                                       
Query: 121 cccggcgctccaccagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaa 180
           |||||||||| |||||||||| ||||||||||||||||||||||| || || ||||| ||
Sbjct: 303 cccggcgctcaaccagttcactcgcaccctcgacaagaacctcgcaactaatctgtttaa 362

                                                                       
Query: 181 gatgcttctcaagtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagag 240
           |||||| |||||||||||||||||||||||||  |||||||||||||||||| |||||||
Sbjct: 363 gatgctcctcaagtaccgccctgaggacaaggctgctaagaaggagaggcttttgaagag 422

                                                                       
Query: 241 ggcacaggctgaggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagta 300
           ||| |||||||||||||| || |||||||||||||| ||||| |||||||||||||||||
Sbjct: 423 ggcccaggctgaggctgaaggtaaaaccgttgaggcaaagaaaccaattgttgtgaagta 482

                                                                       
Query: 301 tggtcttaaccatgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgc 360
           |||||||||||||||||| ||||| ||||||||||||||||| || ||||| ||||| ||
Sbjct: 483 tggtcttaaccatgtcacatacctcattgagcagagcaaggcccaactggtcgtcattgc 542

                                                                       
Query: 361 tcatgatgttgacccaattgagctggttgtgtggctcccagccctatgcaggaagatgga 420
           ||||||||| || || |||||||||||||||||||| |||||||| ||||||||||||||
Sbjct: 543 tcatgatgtcgatccgattgagctggttgtgtggcttccagccctgtgcaggaagatgga 602

                                                                       
Query: 421 ggtcccatactgcattgttaagggaaaatcacgccttggatcgattgttcacaagaagac 480
           |||||| ||||||||||| || |||||| | || |||||||| |||||||||||||| ||
Sbjct: 603 ggtcccttactgcattgtgaaaggaaaagcccgtcttggatcaattgttcacaagaaaac 662

             
Query: 481 tg 482
           ||
Sbjct: 663 tg 664



to top

>dbj|AK121204.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023087N22, full
           insert sequence
          Length = 1091

 Score =  654 bits (330), Expect = 0.0
 Identities = 444/482 (92%)
 Strand = Plus / Plus

                                                                       
Query: 1   gcagttcggcatcggcggggcgctgccgcccaagaaggacctccaccggttcgtcaagtg 60
           ||||||||| |||||||| ||||||||||||||||||||||| |||||||||||||||||
Sbjct: 183 gcagttcggaatcggcggcgcgctgccgcccaagaaggaccttcaccggttcgtcaagtg 242

                                                                       
Query: 61  gcccaaggtcgtgcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcc 120
           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 243 gcccaaggtggtgcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcc 302

                                                                       
Query: 121 cccggcgctccaccagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaa 180
           |||||||||| |||||||||| ||||||||||||||||||||||| || || ||||| ||
Sbjct: 303 cccggcgctcaaccagttcactcgcaccctcgacaagaacctcgcaactaatctgtttaa 362

                                                                       
Query: 181 gatgcttctcaagtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagag 240
           |||||| |||||||||||||||||||||||||  |||||||||||||||||| |||||||
Sbjct: 363 gatgctcctcaagtaccgccctgaggacaaggctgctaagaaggagaggcttttgaagag 422

                                                                       
Query: 241 ggcacaggctgaggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagta 300
           ||| |||||||||||||| || |||||||||||||| ||||| |||||||||||||||||
Sbjct: 423 ggcccaggctgaggctgaaggtaaaaccgttgaggcaaagaaaccaattgttgtgaagta 482

                                                                       
Query: 301 tggtcttaaccatgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgc 360
           |||||||||||||||||| ||||| ||||||||||||||||| || ||||| ||||| ||
Sbjct: 483 tggtcttaaccatgtcacatacctcattgagcagagcaaggcccaactggtcgtcattgc 542

                                                                       
Query: 361 tcatgatgttgacccaattgagctggttgtgtggctcccagccctatgcaggaagatgga 420
           ||||||||| || || |||||||||||||||||||| |||||||| ||||||||||||||
Sbjct: 543 tcatgatgtcgatccgattgagctggttgtgtggcttccagccctgtgcaggaagatgga 602

                                                                       
Query: 421 ggtcccatactgcattgttaagggaaaatcacgccttggatcgattgttcacaagaagac 480
           |||||| ||||||||||| || |||||| | || |||||||| |||||||||||||| ||
Sbjct: 603 ggtcccttactgcattgtgaaaggaaaagcccgtcttggatcaattgttcacaagaaaac 662

             
Query: 481 tg 482
           ||
Sbjct: 663 tg 664



to top

>dbj|AK098843.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000B08, full
           insert sequence
          Length = 1022

 Score =  654 bits (330), Expect = 0.0
 Identities = 444/482 (92%)
 Strand = Plus / Plus

                                                                       
Query: 1   gcagttcggcatcggcggggcgctgccgcccaagaaggacctccaccggttcgtcaagtg 60
           ||||||||| |||||||| ||||||||||||||||||||||| |||||||||||||||||
Sbjct: 179 gcagttcggaatcggcggcgcgctgccgcccaagaaggaccttcaccggttcgtcaagtg 238

                                                                       
Query: 61  gcccaaggtcgtgcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcc 120
           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 239 gcccaaggtggtgcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcc 298

                                                                       
Query: 121 cccggcgctccaccagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaa 180
           |||||||||| |||||||||| ||||||||||||||||||||||| || || ||||| ||
Sbjct: 299 cccggcgctcaaccagttcactcgcaccctcgacaagaacctcgcaactaatctgtttaa 358

                                                                       
Query: 181 gatgcttctcaagtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagag 240
           |||||| |||||||||||||||||||||||||  |||||||||||||||||| |||||||
Sbjct: 359 gatgctcctcaagtaccgccctgaggacaaggctgctaagaaggagaggcttttgaagag 418

                                                                       
Query: 241 ggcacaggctgaggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagta 300
           ||| |||||||||||||| || |||||||||||||| ||||| |||||||||||||||||
Sbjct: 419 ggcccaggctgaggctgaaggtaaaaccgttgaggcaaagaaaccaattgttgtgaagta 478

                                                                       
Query: 301 tggtcttaaccatgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgc 360
           |||||||||||||||||| ||||| ||||||||||||||||| || ||||| ||||| ||
Sbjct: 479 tggtcttaaccatgtcacatacctcattgagcagagcaaggcccaactggtcgtcattgc 538

                                                                       
Query: 361 tcatgatgttgacccaattgagctggttgtgtggctcccagccctatgcaggaagatgga 420
           ||||||||| || || |||||||||||||||||||| |||||||| ||||||||||||||
Sbjct: 539 tcatgatgtcgatccgattgagctggttgtgtggcttccagccctgtgcaggaagatgga 598

                                                                       
Query: 421 ggtcccatactgcattgttaagggaaaatcacgccttggatcgattgttcacaagaagac 480
           |||||| ||||||||||| || |||||| | || |||||||| |||||||||||||| ||
Sbjct: 599 ggtcccttactgcattgtgaaaggaaaagcccgtcttggatcaattgttcacaagaaaac 658

             
Query: 481 tg 482
           ||
Sbjct: 659 tg 660



to top

>dbj|AK062210.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-047-A04, full
           insert sequence
          Length = 1041

 Score =  654 bits (330), Expect = 0.0
 Identities = 444/482 (92%)
 Strand = Plus / Plus

                                                                       
Query: 1   gcagttcggcatcggcggggcgctgccgcccaagaaggacctccaccggttcgtcaagtg 60
           ||||||||| |||||||| ||||||||||||||||||||||| |||||||||||||||||
Sbjct: 180 gcagttcggaatcggcggcgcgctgccgcccaagaaggaccttcaccggttcgtcaagtg 239

                                                                       
Query: 61  gcccaaggtcgtgcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcc 120
           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 240 gcccaaggtggtgcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcc 299

                                                                       
Query: 121 cccggcgctccaccagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaa 180
           |||||||||| |||||||||| ||||||||||||||||||||||| || || ||||| ||
Sbjct: 300 cccggcgctcaaccagttcactcgcaccctcgacaagaacctcgcaactaatctgtttaa 359

                                                                       
Query: 181 gatgcttctcaagtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagag 240
           |||||| |||||||||||||||||||||||||  |||||||||||||||||| |||||||
Sbjct: 360 gatgctcctcaagtaccgccctgaggacaaggctgctaagaaggagaggcttttgaagag 419

                                                                       
Query: 241 ggcacaggctgaggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagta 300
           ||| |||||||||||||| || |||||||||||||| ||||| |||||||||||||||||
Sbjct: 420 ggcccaggctgaggctgaaggtaaaaccgttgaggcaaagaaaccaattgttgtgaagta 479

                                                                       
Query: 301 tggtcttaaccatgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgc 360
           |||||||||||||||||| ||||| ||||||||||||||||| || ||||| ||||| ||
Sbjct: 480 tggtcttaaccatgtcacatacctcattgagcagagcaaggcccaactggtcgtcattgc 539

                                                                       
Query: 361 tcatgatgttgacccaattgagctggttgtgtggctcccagccctatgcaggaagatgga 420
           ||||||||| || || |||||||||||||||||||| |||||||| ||||||||||||||
Sbjct: 540 tcatgatgtcgatccgattgagctggttgtgtggcttccagccctgtgcaggaagatgga 599

                                                                       
Query: 421 ggtcccatactgcattgttaagggaaaatcacgccttggatcgattgttcacaagaagac 480
           |||||| ||||||||||| || |||||| | || |||||||| |||||||||||||| ||
Sbjct: 600 ggtcccttactgcattgtgaaaggaaaagcccgtcttggatcaattgttcacaagaaaac 659

             
Query: 481 tg 482
           ||
Sbjct: 660 tg 661



to top

>dbj|D12631.1|RICRPL7AB Oryza sativa (japonica cultivar-group) mRNA for ribosomal protein
           L7A, complete cds
          Length = 954

 Score =  654 bits (330), Expect = 0.0
 Identities = 444/482 (92%)
 Strand = Plus / Plus

                                                                       
Query: 1   gcagttcggcatcggcggggcgctgccgcccaagaaggacctccaccggttcgtcaagtg 60
           ||||||||| |||||||| ||||||||||||||||||||||| |||||||||||||||||
Sbjct: 110 gcagttcggaatcggcggcgcgctgccgcccaagaaggaccttcaccggttcgtcaagtg 169

                                                                       
Query: 61  gcccaaggtcgtgcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcc 120
           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 170 gcccaaggtggtgcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcc 229

                                                                       
Query: 121 cccggcgctccaccagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaa 180
           |||||||||| |||||||||| ||||||||||||||||||||||| || || ||||| ||
Sbjct: 230 cccggcgctcaaccagttcactcgcaccctcgacaagaacctcgcaactaatctgtttaa 289

                                                                       
Query: 181 gatgcttctcaagtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagag 240
           |||||| |||||||||||||||||||||||||  |||||||||||||||||| |||||||
Sbjct: 290 gatgctcctcaagtaccgccctgaggacaaggctgctaagaaggagaggcttttgaagag 349

                                                                       
Query: 241 ggcacaggctgaggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagta 300
           ||| |||||||||||||| || |||||||||||||| ||||| |||||||||||||||||
Sbjct: 350 ggcccaggctgaggctgaaggtaaaaccgttgaggcaaagaaaccaattgttgtgaagta 409

                                                                       
Query: 301 tggtcttaaccatgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgc 360
           |||||||||||||||||| ||||| ||||||||||||||||| || ||||| ||||| ||
Sbjct: 410 tggtcttaaccatgtcacatacctcattgagcagagcaaggcccaactggtcgtcattgc 469

                                                                       
Query: 361 tcatgatgttgacccaattgagctggttgtgtggctcccagccctatgcaggaagatgga 420
           ||||||||| || || |||||||||||||||||||| |||||||| ||||||||||||||
Sbjct: 470 tcatgatgtcgatccgattgagctggttgtgtggcttccagccctgtgcaggaagatgga 529

                                                                       
Query: 421 ggtcccatactgcattgttaagggaaaatcacgccttggatcgattgttcacaagaagac 480
           |||||| ||||||||||| || |||||| | || |||||||| |||||||||||||| ||
Sbjct: 530 ggtcccttactgcattgtgaaaggaaaagcccgtcttggatcaattgttcacaagaaaac 589

             
Query: 481 tg 482
           ||
Sbjct: 590 tg 591



to top

>gb|BT016736.1| Zea mays clone Contig569 mRNA sequence
          Length = 1092

 Score =  622 bits (314), Expect = e-175
 Identities = 440/482 (91%)
 Strand = Plus / Plus

                                                                       
Query: 1   gcagttcggcatcggcggggcgctgccgcccaagaaggacctccaccggttcgtcaagtg 60
           |||||||||||||||||| ||| |||| |||||||||||||| ||||| |||||||||||
Sbjct: 157 gcagttcggcatcggcggcgcgttgcctcccaagaaggacctgcaccgattcgtcaagtg 216

                                                                       
Query: 61  gcccaaggtcgtgcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcc 120
           |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 217 gcccaaggtcgtgcgcatccagcgccagcgtcgcatcctcaagcagcgcctcaaggtgcc 276

                                                                       
Query: 121 cccggcgctccaccagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaa 180
            ||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 277 tccggcgctcaaccagttcacccgcaccctcgacaagaacctcgctaccaacctgttcaa 336

                                                                       
Query: 181 gatgcttctcaagtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagag 240
           ||||||||| |||||||| || || |||||||  || |||||||||||||||||||||||
Sbjct: 337 gatgcttcttaagtaccggcccgaagacaaggctgccaagaaggagaggcttctgaagag 396

                                                                       
Query: 241 ggcacaggctgaggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagta 300
           ||| |||||||||  ||| || ||||| |||||  ||||||| |||||||||||||||||
Sbjct: 397 ggcccaggctgagaatgaaggaaaaactgttgaatccaagaaaccaattgttgtgaagta 456

                                                                       
Query: 301 tggtcttaaccatgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgc 360
           ||| ||||||||||| |||||||| |||||||||| |||||||||||| |||||||||||
Sbjct: 457 tggccttaaccatgtgacttacctcattgagcagaacaaggctcagctcgttgtcatcgc 516

                                                                       
Query: 361 tcatgatgttgacccaattgagctggttgtgtggctcccagccctatgcaggaagatgga 420
           ||||||||| || || ||||| |||||||| ||||| |||||||| ||||||||||||||
Sbjct: 517 tcatgatgtggatccgattgaactggttgtttggcttccagccctgtgcaggaagatgga 576

                                                                       
Query: 421 ggtcccatactgcattgttaagggaaaatcacgccttggatcgattgttcacaagaagac 480
           ||||||||||||||||||||| |||||  | |||||||||||||| ||||||||||||||
Sbjct: 577 ggtcccatactgcattgttaaaggaaaggctcgccttggatcgatcgttcacaagaagac 636

             
Query: 481 tg 482
           ||
Sbjct: 637 tg 638



to top

>gb|AY103834.1| Zea mays PCO109701 mRNA sequence
          Length = 1105

 Score =  609 bits (307), Expect = e-171
 Identities = 436/479 (91%)
 Strand = Plus / Plus

                                                                       
Query: 1   gcagttcggcatcggcggggcgctgccgcccaagaaggacctccaccggttcgtcaagtg 60
           |||||||||||||||||| ||| ||||||||||||||||||| |||||||||||||||||
Sbjct: 161 gcagttcggcatcggcggcgcgttgccgcccaagaaggacctgcaccggttcgtcaagtg 220

                                                                       
Query: 61  gcccaaggtcgtgcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcc 120
           ||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| ||
Sbjct: 221 gcccaaggtcgtgcgtatccagcggcagcgccgcatcctcaagcagcgcctcaaggtacc 280

                                                                       
Query: 121 cccggcgctccaccagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaa 180
            ||||||||| |||||||||||||||||||||||||||||||||| || |||||||| ||
Sbjct: 281 accggcgctcaaccagttcacccgcaccctcgacaagaacctcgctacgaacctgtttaa 340

                                                                       
Query: 181 gatgcttctcaagtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagag 240
           |||||||||||||||||| ||||| |||||||  || |||||||||||||||||||||||
Sbjct: 341 gatgcttctcaagtaccggcctgaagacaaggctgccaagaaggagaggcttctgaagag 400

                                                                       
Query: 241 ggcacaggctgaggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagta 300
           ||| || ||||||  ||| || ||||| |||||| | ||||| |||||||||||||||||
Sbjct: 401 ggcccaagctgagaatgaaggaaaaactgttgagtcgaagaaaccaattgttgtgaagta 460

                                                                       
Query: 301 tggtcttaaccatgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgc 360
           ||| ||||||||||| |||||||| |||||||||| |||||||||||| |||||||||||
Sbjct: 461 tggccttaaccatgtgacttacctcattgagcagaacaaggctcagcttgttgtcatcgc 520

                                                                       
Query: 361 tcatgatgttgacccaattgagctggttgtgtggctcccagccctatgcaggaagatgga 420
           |||||| || || || ||||| |||||||||||||| |||||||| ||||||||||||||
Sbjct: 521 tcatgacgtggatccgattgaactggttgtgtggcttccagccctgtgcaggaagatgga 580

                                                                      
Query: 421 ggtcccatactgcattgttaagggaaaatcacgccttggatcgattgttcacaagaaga 479
           |||||| |||||||||||||| |||||  | ||||||||||||||||||||||||||||
Sbjct: 581 ggtcccttactgcattgttaaaggaaaggctcgccttggatcgattgttcacaagaaga 639



to top

>gb|BT018084.1| Zea mays clone EL01N0552B03.c mRNA sequence
          Length = 849

 Score =  585 bits (295), Expect = e-164
 Identities = 415/455 (91%)
 Strand = Plus / Plus

                                                                       
Query: 25  gccgcccaagaaggacctccaccggttcgtcaagtggcccaaggtcgtgcgcatccagcg 84
           |||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||
Sbjct: 8   gccgcccaagaaggacctgcaccggttcgtcaagtggcccaaggtcgtgcgtatccagcg 67

                                                                       
Query: 85  ccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcgctccaccagttcacccg 144
           ||||||||||||||||||||||||||||||||| || ||||||||| |||||||||||||
Sbjct: 68  ccagcgccgcatcctcaagcagcgcctcaaggtaccaccggcgctcaaccagttcacccg 127

                                                                       
Query: 145 caccctcgacaagaacctcgccaccaacctgttcaagatgcttctcaagtaccgccctga 204
           ||||||||||||||||||||| || |||||||| |||||||||||||||||||| |||||
Sbjct: 128 caccctcgacaagaacctcgctacgaacctgtttaagatgcttctcaagtaccggcctga 187

                                                                       
Query: 205 ggacaaggtggctaagaaggagaggcttctgaagagggcacaggctgaggctgaggggaa 264
            |||||||  || |||||||||||||||||||||||||| || ||||||  ||| || ||
Sbjct: 188 agacaaggctgccaagaaggagaggcttctgaagagggcccaagctgagaatgaaggaaa 247

                                                                       
Query: 265 aaccgttgaggccaagaagccaattgttgtgaagtatggtcttaaccatgtcacttacct 324
           ||| |||||| | ||||| |||||||||||||||||||| ||||||||||| ||||||||
Sbjct: 248 aactgttgagtcgaagaaaccaattgttgtgaagtatggccttaaccatgtgacttacct 307

                                                                       
Query: 325 tattgagcagagcaaggctcagctggttgtcatcgctcatgatgttgacccaattgagct 384
            |||||||||| |||||||||||| ||||||||||||||||| || || || ||||| ||
Sbjct: 308 cattgagcagaacaaggctcagcttgttgtcatcgctcatgacgtggatccgattgaact 367

                                                                       
Query: 385 ggttgtgtggctcccagccctatgcaggaagatggaggtcccatactgcattgttaaggg 444
           |||||||||||| |||||||| |||||||||||||||||||| |||||||||||||| ||
Sbjct: 368 ggttgtgtggcttccagccctgtgcaggaagatggaggtcccttactgcattgttaaagg 427

                                              
Query: 445 aaaatcacgccttggatcgattgttcacaagaaga 479
           |||  | ||||||||||||||||||||||||||||
Sbjct: 428 aaaggctcgccttggatcgattgttcacaagaaga 462



to top

>gb|AY105417.1| Zea mays PCO109699 mRNA sequence
          Length = 1103

 Score =  575 bits (290), Expect = e-161
 Identities = 434/482 (90%)
 Strand = Plus / Plus

                                                                       
Query: 1   gcagttcggcatcggcggggcgctgccgcccaagaaggacctccaccggttcgtcaagtg 60
           |||||| || |||||||| || || ||||||||||||||||||||||| |||||||||||
Sbjct: 156 gcagtttgggatcggcggcgcccttccgcccaagaaggacctccaccgcttcgtcaagtg 215

                                                                       
Query: 61  gcccaaggtcgtgcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcc 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 216 gcccaaggtcgtgcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcc 275

                                                                       
Query: 121 cccggcgctccaccagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaa 180
           |||||||||| |||||||||| || ||||||||||||||||| || || ||| |||||||
Sbjct: 276 cccggcgctcaaccagttcacacgtaccctcgacaagaaccttgcaacaaacttgttcaa 335

                                                                       
Query: 181 gatgcttctcaagtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagag 240
           ||||||||| ||||||||||| |||||||| |  || ||||||||||||||  |||||||
Sbjct: 336 gatgcttcttaagtaccgccccgaggacaaagctgccaagaaggagaggctcttgaagag 395

                                                                       
Query: 241 ggcacaggctgaggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagta 300
           ||| ||||||||    ||||||||||| |||||| | ||||| |||||||||||||||||
Sbjct: 396 ggcccaggctgaaaacgaggggaaaactgttgagtcaaagaaaccaattgttgtgaagta 455

                                                                       
Query: 301 tggtcttaaccatgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgc 360
            || ||||||||||| |||||||| || |||||||||||||| |||||||||||||| ||
Sbjct: 456 cggccttaaccatgtgacttacctcatcgagcagagcaaggcccagctggttgtcatagc 515

                                                                       
Query: 361 tcatgatgttgacccaattgagctggttgtgtggctcccagccctatgcaggaagatgga 420
           |||||||||||| || || |||||||| ||||||||||| ||||| |||||||| |||||
Sbjct: 516 tcatgatgttgatccgatcgagctggtcgtgtggctcccggccctttgcaggaaaatgga 575

                                                                       
Query: 421 ggtcccatactgcattgttaagggaaaatcacgccttggatcgattgttcacaagaagac 480
           ||| |||||||||||||| ||||||||| |||||||||||||||| ||||||||||||||
Sbjct: 576 ggttccatactgcattgtcaagggaaaagcacgccttggatcgatcgttcacaagaagac 635

             
Query: 481 tg 482
           ||
Sbjct: 636 tg 637



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score =  278 bits (140), Expect = 2e-71
 Identities = 158/164 (96%)
 Strand = Plus / Minus

                                                                            
Query: 1        gcagttcggcatcggcggggcgctgccgcccaagaaggacctccaccggttcgtcaagtg 60
                ||||||||| |||||||| ||||||||||||||||||||||| |||||||||||||||||
Sbjct: 14335148 gcagttcggaatcggcggcgcgctgccgcccaagaaggaccttcaccggttcgtcaagtg 14335089

                                                                            
Query: 61       gcccaaggtcgtgcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcc 120
                ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 14335088 gcccaaggtggtgcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcc 14335029

                                                            
Query: 121      cccggcgctccaccagttcacccgcaccctcgacaagaacctcg 164
                |||||||||| |||||||||| ||||||||||||||||||||||
Sbjct: 14335028 cccggcgctcaaccagttcactcgcaccctcgacaagaacctcg 14334985



 Score =  226 bits (114), Expect = 5e-56
 Identities = 150/162 (92%)
 Strand = Plus / Minus

                                                                            
Query: 173      ctgttcaagatgcttctcaagtaccgccctgaggacaaggtggctaagaaggagaggctt 232
                ||||| |||||||| |||||||||||||||||||||||||  ||||||||||||||||||
Sbjct: 14334381 ctgtttaagatgctcctcaagtaccgccctgaggacaaggctgctaagaaggagaggctt 14334322

                                                                            
Query: 233      ctgaagagggcacaggctgaggctgaggggaaaaccgttgaggccaagaagccaattgtt 292
                 |||||||||| |||||||||||||| || |||||||||||||| ||||| |||||||||
Sbjct: 14334321 ttgaagagggcccaggctgaggctgaaggtaaaaccgttgaggcaaagaaaccaattgtt 14334262

                                                          
Query: 293      gtgaagtatggtcttaaccatgtcacttaccttattgagcag 334
                |||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 14334261 gtgaagtatggtcttaaccatgtcacatacctcattgagcag 14334220



 Score =  143 bits (72), Expect = 6e-31
 Identities = 117/132 (88%)
 Strand = Plus / Minus

                                                                            
Query: 331      gcagagcaaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgt 390
                |||||||||||| || ||||| ||||| ||||||||||| || || ||||||||||||||
Sbjct: 14334109 gcagagcaaggcccaactggtcgtcattgctcatgatgtcgatccgattgagctggttgt 14334050

                                                                            
Query: 391      gtggctcccagccctatgcaggaagatggaggtcccatactgcattgttaagggaaaatc 450
                |||||| |||||||| |||||||||||||||||||| ||||||||||| || |||||| |
Sbjct: 14334049 gtggcttccagccctgtgcaggaagatggaggtcccttactgcattgtgaaaggaaaagc 14333990

                            
Query: 451      acgccttggatc 462
                 || ||||||||
Sbjct: 14333989 ccgtcttggatc 14333978



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 147     ccctcgacaagaacctcgccacca 170
               |||||| |||||||||||||||||
Sbjct: 1754251 ccctcgtcaagaacctcgccacca 1754228



to top

>dbj|AP004637.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
              clone:P0703C03
          Length = 162620

 Score =  278 bits (140), Expect = 2e-71
 Identities = 158/164 (96%)
 Strand = Plus / Minus

                                                                          
Query: 1      gcagttcggcatcggcggggcgctgccgcccaagaaggacctccaccggttcgtcaagtg 60
              ||||||||| |||||||| ||||||||||||||||||||||| |||||||||||||||||
Sbjct: 150704 gcagttcggaatcggcggcgcgctgccgcccaagaaggaccttcaccggttcgtcaagtg 150645

                                                                          
Query: 61     gcccaaggtcgtgcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcc 120
              ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 150644 gcccaaggtggtgcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcc 150585

                                                          
Query: 121    cccggcgctccaccagttcacccgcaccctcgacaagaacctcg 164
              |||||||||| |||||||||| ||||||||||||||||||||||
Sbjct: 150584 cccggcgctcaaccagttcactcgcaccctcgacaagaacctcg 150541



 Score =  226 bits (114), Expect = 5e-56
 Identities = 150/162 (92%)
 Strand = Plus / Minus

                                                                          
Query: 173    ctgttcaagatgcttctcaagtaccgccctgaggacaaggtggctaagaaggagaggctt 232
              ||||| |||||||| |||||||||||||||||||||||||  ||||||||||||||||||
Sbjct: 149937 ctgtttaagatgctcctcaagtaccgccctgaggacaaggctgctaagaaggagaggctt 149878

                                                                          
Query: 233    ctgaagagggcacaggctgaggctgaggggaaaaccgttgaggccaagaagccaattgtt 292
               |||||||||| |||||||||||||| || |||||||||||||| ||||| |||||||||
Sbjct: 149877 ttgaagagggcccaggctgaggctgaaggtaaaaccgttgaggcaaagaaaccaattgtt 149818

                                                        
Query: 293    gtgaagtatggtcttaaccatgtcacttaccttattgagcag 334
              |||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 149817 gtgaagtatggtcttaaccatgtcacatacctcattgagcag 149776



 Score =  143 bits (72), Expect = 6e-31
 Identities = 117/132 (88%)
 Strand = Plus / Minus

                                                                          
Query: 331    gcagagcaaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgt 390
              |||||||||||| || ||||| ||||| ||||||||||| || || ||||||||||||||
Sbjct: 149665 gcagagcaaggcccaactggtcgtcattgctcatgatgtcgatccgattgagctggttgt 149606

                                                                          
Query: 391    gtggctcccagccctatgcaggaagatggaggtcccatactgcattgttaagggaaaatc 450
              |||||| |||||||| |||||||||||||||||||| ||||||||||| || |||||| |
Sbjct: 149605 gtggcttccagccctgtgcaggaagatggaggtcccttactgcattgtgaaaggaaaagc 149546

                          
Query: 451    acgccttggatc 462
               || ||||||||
Sbjct: 149545 ccgtcttggatc 149534



to top

>dbj|AP003884.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1136_A10
          Length = 101249

 Score =  278 bits (140), Expect = 2e-71
 Identities = 158/164 (96%)
 Strand = Plus / Minus

                                                                         
Query: 1     gcagttcggcatcggcggggcgctgccgcccaagaaggacctccaccggttcgtcaagtg 60
             ||||||||| |||||||| ||||||||||||||||||||||| |||||||||||||||||
Sbjct: 38228 gcagttcggaatcggcggcgcgctgccgcccaagaaggaccttcaccggttcgtcaagtg 38169

                                                                         
Query: 61    gcccaaggtcgtgcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcc 120
             ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 38168 gcccaaggtggtgcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcc 38109

                                                         
Query: 121   cccggcgctccaccagttcacccgcaccctcgacaagaacctcg 164
             |||||||||| |||||||||| ||||||||||||||||||||||
Sbjct: 38108 cccggcgctcaaccagttcactcgcaccctcgacaagaacctcg 38065



 Score =  226 bits (114), Expect = 5e-56
 Identities = 150/162 (92%)
 Strand = Plus / Minus

                                                                         
Query: 173   ctgttcaagatgcttctcaagtaccgccctgaggacaaggtggctaagaaggagaggctt 232
             ||||| |||||||| |||||||||||||||||||||||||  ||||||||||||||||||
Sbjct: 37461 ctgtttaagatgctcctcaagtaccgccctgaggacaaggctgctaagaaggagaggctt 37402

                                                                         
Query: 233   ctgaagagggcacaggctgaggctgaggggaaaaccgttgaggccaagaagccaattgtt 292
              |||||||||| |||||||||||||| || |||||||||||||| ||||| |||||||||
Sbjct: 37401 ttgaagagggcccaggctgaggctgaaggtaaaaccgttgaggcaaagaaaccaattgtt 37342

                                                       
Query: 293   gtgaagtatggtcttaaccatgtcacttaccttattgagcag 334
             |||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 37341 gtgaagtatggtcttaaccatgtcacatacctcattgagcag 37300



 Score =  143 bits (72), Expect = 6e-31
 Identities = 117/132 (88%)
 Strand = Plus / Minus

                                                                         
Query: 331   gcagagcaaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgt 390
             |||||||||||| || ||||| ||||| ||||||||||| || || ||||||||||||||
Sbjct: 37189 gcagagcaaggcccaactggtcgtcattgctcatgatgtcgatccgattgagctggttgt 37130

                                                                         
Query: 391   gtggctcccagccctatgcaggaagatggaggtcccatactgcattgttaagggaaaatc 450
             |||||| |||||||| |||||||||||||||||||| ||||||||||| || |||||| |
Sbjct: 37129 gtggcttccagccctgtgcaggaagatggaggtcccttactgcattgtgaaaggaaaagc 37070

                         
Query: 451   acgccttggatc 462
              || ||||||||
Sbjct: 37069 ccgtcttggatc 37058



to top

>gb|AC108759.2| Oryza sativa (Japonica cultiva-group) chromosome 9 BAC clone
              OSJNBa0072P02, complete sequence
          Length = 157488

 Score =  254 bits (128), Expect = 2e-64
 Identities = 155/164 (94%)
 Strand = Plus / Minus

                                                                          
Query: 1      gcagttcggcatcggcggggcgctgccgcccaagaaggacctccaccggttcgtcaagtg 60
              |||||||||||||||||| |||||||| ||||||||||| || ||| ||||||| |||||
Sbjct: 109669 gcagttcggcatcggcggcgcgctgccacccaagaaggatctgcacaggttcgtgaagtg 109610

                                                                          
Query: 61     gcccaaggtcgtgcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcc 120
              ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 109609 gcccaaggtggtgcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggttcc 109550

                                                          
Query: 121    cccggcgctccaccagttcacccgcaccctcgacaagaacctcg 164
              |||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 109549 cccggcgctcaaccagttcacccgcaccctcgacaagaacctcg 109506



 Score =  254 bits (128), Expect = 2e-64
 Identities = 158/168 (94%)
 Strand = Plus / Minus

                                                                          
Query: 167    accaacctgttcaagatgcttctcaagtaccgccctgaggacaaggtggctaagaaggag 226
              ||||||||||| ||||||||||||||||||||||||||||||||||  || |||||||||
Sbjct: 108952 accaacctgtttaagatgcttctcaagtaccgccctgaggacaaggctgccaagaaggag 108893

                                                                          
Query: 227    aggcttctgaagagggcacaggctgaggctgaggggaaaaccgttgaggccaagaagcca 286
              |||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||
Sbjct: 108892 aggcttttgaagagggcccaggctgaggctgaagggaaaaccgttgaggccaagaagcca 108833

                                                              
Query: 287    attgttgtgaagtatggtcttaaccatgtcacttaccttattgagcag 334
              |||||||||||||||||||||||||| || |||||||| |||||||||
Sbjct: 108832 attgttgtgaagtatggtcttaaccacgtgacttacctcattgagcag 108785



 Score =  184 bits (93), Expect = 2e-43
 Identities = 123/133 (92%)
 Strand = Plus / Minus

                                                                          
Query: 331    gcagagcaaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgt 390
              |||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 108675 gcagagcaaggcccagctggttgtcatcgctcatgatgttgatccaattgagctggttgt 108616

                                                                          
Query: 391    gtggctcccagccctatgcaggaagatggaggtcccatactgcattgttaagggaaaatc 450
              |||||| |||||||| || ||||||||||||||||| |||||||| |||||||| ||| |
Sbjct: 108615 gtggcttccagccctgtgtaggaagatggaggtcccttactgcatcgttaagggcaaagc 108556

                           
Query: 451    acgccttggatcg 463
               ||||||||||||
Sbjct: 108555 tcgccttggatcg 108543



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 463    gattgttcacaagaagactg 482
              ||||||||||||||||||||
Sbjct: 108443 gattgttcacaagaagactg 108424



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score =  254 bits (128), Expect = 2e-64
 Identities = 155/164 (94%)
 Strand = Plus / Minus

                                                                            
Query: 1        gcagttcggcatcggcggggcgctgccgcccaagaaggacctccaccggttcgtcaagtg 60
                |||||||||||||||||| |||||||| ||||||||||| || ||| ||||||| |||||
Sbjct: 19390443 gcagttcggcatcggcggcgcgctgccacccaagaaggatctgcacaggttcgtgaagtg 19390384

                                                                            
Query: 61       gcccaaggtcgtgcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcc 120
                ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 19390383 gcccaaggtggtgcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggttcc 19390324

                                                            
Query: 121      cccggcgctccaccagttcacccgcaccctcgacaagaacctcg 164
                |||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 19390323 cccggcgctcaaccagttcacccgcaccctcgacaagaacctcg 19390280



 Score =  254 bits (128), Expect = 2e-64
 Identities = 158/168 (94%)
 Strand = Plus / Minus

                                                                            
Query: 167      accaacctgttcaagatgcttctcaagtaccgccctgaggacaaggtggctaagaaggag 226
                ||||||||||| ||||||||||||||||||||||||||||||||||  || |||||||||
Sbjct: 19389726 accaacctgtttaagatgcttctcaagtaccgccctgaggacaaggctgccaagaaggag 19389667

                                                                            
Query: 227      aggcttctgaagagggcacaggctgaggctgaggggaaaaccgttgaggccaagaagcca 286
                |||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||
Sbjct: 19389666 aggcttttgaagagggcccaggctgaggctgaagggaaaaccgttgaggccaagaagcca 19389607

                                                                
Query: 287      attgttgtgaagtatggtcttaaccatgtcacttaccttattgagcag 334
                |||||||||||||||||||||||||| || |||||||| |||||||||
Sbjct: 19389606 attgttgtgaagtatggtcttaaccacgtgacttacctcattgagcag 19389559



 Score =  184 bits (93), Expect = 2e-43
 Identities = 123/133 (92%)
 Strand = Plus / Minus

                                                                            
Query: 331      gcagagcaaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgt 390
                |||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 19389449 gcagagcaaggcccagctggttgtcatcgctcatgatgttgatccaattgagctggttgt 19389390

                                                                            
Query: 391      gtggctcccagccctatgcaggaagatggaggtcccatactgcattgttaagggaaaatc 450
                |||||| |||||||| || ||||||||||||||||| |||||||| |||||||| ||| |
Sbjct: 19389389 gtggcttccagccctgtgtaggaagatggaggtcccttactgcatcgttaagggcaaagc 19389330

                             
Query: 451      acgccttggatcg 463
                 ||||||||||||
Sbjct: 19389329 tcgccttggatcg 19389317



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 463      gattgttcacaagaagactg 482
                ||||||||||||||||||||
Sbjct: 19389217 gattgttcacaagaagactg 19389198



to top

>ref|XM_463662.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 927

 Score =  194 bits (98), Expect = 2e-46
 Identities = 221/262 (84%)
 Strand = Plus / Plus

                                                                       
Query: 219 agaaggagaggcttctgaagagggcacaggctgaggctgaggggaaaaccgttgaggcca 278
           ||||||| |||||| |||| || || || || |||||||| ||||| || ||||| ||||
Sbjct: 458 agaaggaaaggcttttgaaaagagcgcaagcagaggctgaagggaagactgttgaagcca 517

                                                                       
Query: 279 agaagccaattgttgtgaagtatggtcttaaccatgtcacttaccttattgagcagagca 338
           |||| |||||||||||||||||||||||| ||||||| || ||  | ||||| |||||||
Sbjct: 518 agaaaccaattgttgtgaagtatggtcttgaccatgtgacctatttgattgaacagagca 577

                                                                       
Query: 339 aggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggctcc 398
           |||| ||||| || ||||| ||||||||||| ||||| ||||| || || || |||||||
Sbjct: 578 aggcacagcttgtggtcattgctcatgatgtcgaccccattgaactcgtcgtttggctcc 637

                                                                       
Query: 399 cagccctatgcaggaagatggaggtcccatactgcattgttaagggaaaatcacgccttg 458
           ||||| | ||||||||||||||  |||| || |||||||| ||||||||  | || ||||
Sbjct: 638 cagccttgtgcaggaagatggaaatcccttattgcattgtgaagggaaaggctcgtcttg 697

                                 
Query: 459 gatcgattgttcacaagaagac 480
           |||||||||| |||||||||||
Sbjct: 698 gatcgattgtgcacaagaagac 719



 Score =  182 bits (92), Expect = 7e-43
 Identities = 146/164 (89%)
 Strand = Plus / Plus

                                                                       
Query: 1   gcagttcggcatcggcggggcgctgccgcccaagaaggacctccaccggttcgtcaagtg 60
           ||||||||| |||||||| ||||| ||||| | ||||||| | ||||| |||||||  ||
Sbjct: 288 gcagttcgggatcggcggcgcgctcccgccgaggaaggacttgcaccgcttcgtcagatg 347

                                                                       
Query: 61  gcccaaggtcgtgcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcc 120
           ||||||||  ||||| |||||||||||||||||| |||||||||||||||||||||| ||
Sbjct: 348 gcccaaggcggtgcggatccagcgccagcgccgcgtcctcaagcagcgcctcaaggttcc 407

                                                       
Query: 121 cccggcgctccaccagttcacccgcaccctcgacaagaacctcg 164
            || |||||| |||||||||||||||||||||||||||||||||
Sbjct: 408 acccgcgctcaaccagttcacccgcaccctcgacaagaacctcg 451



to top

>gb|DQ241858.1| Solanum tuberosum clone 014F11 60S ribosomal protein L7A-like mRNA,
           complete cds
          Length = 983

 Score =  188 bits (95), Expect = 1e-44
 Identities = 287/351 (81%)
 Strand = Plus / Plus

                                                                       
Query: 132 accagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaagatgcttctca 191
           |||||||||||   ||||| || |||||||||||||||||||| |||||||||||||| |
Sbjct: 229 accagttcaccaaaacccttgataagaacctcgccaccaaccttttcaagatgcttctta 288

                                                                       
Query: 192 agtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagagggcacaggctg 251
           ||||| | ||||||||||| |  || ||||||||| | ||| | || ||||| || ||||
Sbjct: 289 agtacaggcctgaggacaaagctgcaaagaaggagcgtcttgttaaaagggctcaagctg 348

                                                                       
Query: 252 aggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagtatggtcttaacc 311
           | ||||| || |||||   |||  | ||||| || ||| ||||||||||||| ||||| |
Sbjct: 349 aagctgaaggaaaaacacctgaaacaaagaaacccattattgtgaagtatggccttaagc 408

                                                                       
Query: 312 atgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgctcatgatgttg 371
           || ||||||||||||||||||||| ||| ||||| || || || || ||||||||||| |
Sbjct: 409 atatcacttaccttattgagcagaacaaagctcaactagtagtgattgctcatgatgtgg 468

                                                                       
Query: 372 acccaattgagctggttgtgtggctcccagccctatgcaggaagatggaggtcccatact 431
           ||||||| ||| ||||||| ||||| || || |||||||| ||||||||  | || ||||
Sbjct: 469 acccaatagagttggttgtctggcttcctgcactatgcagaaagatggaaattccttact 528

                                                              
Query: 432 gcattgttaagggaaaatcacgccttggatcgattgttcacaagaagactg 482
           ||||||| ||||| ||| ||||  | ||||| || || |||||||| ||||
Sbjct: 529 gcattgtgaaggggaaagcacgtttaggatcaatcgtgcacaagaaaactg 579



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  182 bits (92), Expect = 7e-43
 Identities = 146/164 (89%)
 Strand = Plus / Minus

                                                                            
Query: 1        gcagttcggcatcggcggggcgctgccgcccaagaaggacctccaccggttcgtcaagtg 60
                ||||||||| |||||||| ||||| ||||| | ||||||| | ||||| |||||||  ||
Sbjct: 40490455 gcagttcgggatcggcggcgcgctcccgccgaggaaggacttgcaccgcttcgtcagatg 40490396

                                                                            
Query: 61       gcccaaggtcgtgcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcc 120
                ||||||||  ||||| |||||||||||||||||| |||||||||||||||||||||| ||
Sbjct: 40490395 gcccaaggcggtgcggatccagcgccagcgccgcgtcctcaagcagcgcctcaaggttcc 40490336

                                                            
Query: 121      cccggcgctccaccagttcacccgcaccctcgacaagaacctcg 164
                 || |||||| |||||||||||||||||||||||||||||||||
Sbjct: 40490335 acccgcgctcaaccagttcacccgcaccctcgacaagaacctcg 40490292



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 100/117 (85%)
 Strand = Plus / Minus

                                                                            
Query: 331      gcagagcaaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgt 390
                |||||||||||| ||||| || ||||| ||||||||||| ||||| ||||| || || ||
Sbjct: 40489257 gcagagcaaggcacagcttgtggtcattgctcatgatgtcgaccccattgaactcgtcgt 40489198

                                                                         
Query: 391      gtggctcccagccctatgcaggaagatggaggtcccatactgcattgttaagggaaa 447
                 |||||||||||| | ||||||||||||||  |||| || |||||||| ||||||||
Sbjct: 40489197 ttggctcccagccttgtgcaggaagatggaaatcccttattgcattgtgaagggaaa 40489141



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 118/140 (84%), Gaps = 1/140 (0%)
 Strand = Plus / Minus

                                                                            
Query: 176      ttcaagatgcttctcaagtaccgccctgaggacaaggtggctaagaaggagaggcttctg 235
                |||||||||||  | |||||||||||||| || ||||  || | |||||| |||||| ||
Sbjct: 40489536 ttcaagatgctgttgaagtaccgccctgaagataaggctgcca-gaaggaaaggcttttg 40489478

                                                                            
Query: 236      aagagggcacaggctgaggctgaggggaaaaccgttgaggccaagaagccaattgttgtg 295
                || || || || || |||||||| ||||| || ||||| |||||||| ||||||||||||
Sbjct: 40489477 aaaagagcgcaagcagaggctgaagggaagactgttgaagccaagaaaccaattgttgtg 40489418

                                    
Query: 296      aagtatggtcttaaccatgt 315
                |||||||||||| |||||||
Sbjct: 40489417 aagtatggtcttgaccatgt 40489398



to top

>dbj|AP004672.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0592G05
          Length = 146220

 Score =  182 bits (92), Expect = 7e-43
 Identities = 146/164 (89%)
 Strand = Plus / Minus

                                                                          
Query: 1      gcagttcggcatcggcggggcgctgccgcccaagaaggacctccaccggttcgtcaagtg 60
              ||||||||| |||||||| ||||| ||||| | ||||||| | ||||| |||||||  ||
Sbjct: 141696 gcagttcgggatcggcggcgcgctcccgccgaggaaggacttgcaccgcttcgtcagatg 141637

                                                                          
Query: 61     gcccaaggtcgtgcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcc 120
              ||||||||  ||||| |||||||||||||||||| |||||||||||||||||||||| ||
Sbjct: 141636 gcccaaggcggtgcggatccagcgccagcgccgcgtcctcaagcagcgcctcaaggttcc 141577

                                                          
Query: 121    cccggcgctccaccagttcacccgcaccctcgacaagaacctcg 164
               || |||||| |||||||||||||||||||||||||||||||||
Sbjct: 141576 acccgcgctcaaccagttcacccgcaccctcgacaagaacctcg 141533



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 100/117 (85%)
 Strand = Plus / Minus

                                                                          
Query: 331    gcagagcaaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgt 390
              |||||||||||| ||||| || ||||| ||||||||||| ||||| ||||| || || ||
Sbjct: 140498 gcagagcaaggcacagcttgtggtcattgctcatgatgtcgaccccattgaactcgtcgt 140439

                                                                       
Query: 391    gtggctcccagccctatgcaggaagatggaggtcccatactgcattgttaagggaaa 447
               |||||||||||| | ||||||||||||||  |||| || |||||||| ||||||||
Sbjct: 140438 ttggctcccagccttgtgcaggaagatggaaatcccttattgcattgtgaagggaaa 140382



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 118/140 (84%), Gaps = 1/140 (0%)
 Strand = Plus / Minus

                                                                          
Query: 176    ttcaagatgcttctcaagtaccgccctgaggacaaggtggctaagaaggagaggcttctg 235
              |||||||||||  | |||||||||||||| || ||||  || | |||||| |||||| ||
Sbjct: 140777 ttcaagatgctgttgaagtaccgccctgaagataaggctgcca-gaaggaaaggcttttg 140719

                                                                          
Query: 236    aagagggcacaggctgaggctgaggggaaaaccgttgaggccaagaagccaattgttgtg 295
              || || || || || |||||||| ||||| || ||||| |||||||| ||||||||||||
Sbjct: 140718 aaaagagcgcaagcagaggctgaagggaagactgttgaagccaagaaaccaattgttgtg 140659

                                  
Query: 296    aagtatggtcttaaccatgt 315
              |||||||||||| |||||||
Sbjct: 140658 aagtatggtcttgaccatgt 140639



to top

>dbj|AP004223.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1033B05
          Length = 138882

 Score =  182 bits (92), Expect = 7e-43
 Identities = 146/164 (89%)
 Strand = Plus / Minus

                                                                         
Query: 1     gcagttcggcatcggcggggcgctgccgcccaagaaggacctccaccggttcgtcaagtg 60
             ||||||||| |||||||| ||||| ||||| | ||||||| | ||||| |||||||  ||
Sbjct: 52079 gcagttcgggatcggcggcgcgctcccgccgaggaaggacttgcaccgcttcgtcagatg 52020

                                                                         
Query: 61    gcccaaggtcgtgcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcc 120
             ||||||||  ||||| |||||||||||||||||| |||||||||||||||||||||| ||
Sbjct: 52019 gcccaaggcggtgcggatccagcgccagcgccgcgtcctcaagcagcgcctcaaggttcc 51960

                                                         
Query: 121   cccggcgctccaccagttcacccgcaccctcgacaagaacctcg 164
              || |||||| |||||||||||||||||||||||||||||||||
Sbjct: 51959 acccgcgctcaaccagttcacccgcaccctcgacaagaacctcg 51916



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 100/117 (85%)
 Strand = Plus / Minus

                                                                         
Query: 331   gcagagcaaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgt 390
             |||||||||||| ||||| || ||||| ||||||||||| ||||| ||||| || || ||
Sbjct: 50881 gcagagcaaggcacagcttgtggtcattgctcatgatgtcgaccccattgaactcgtcgt 50822

                                                                      
Query: 391   gtggctcccagccctatgcaggaagatggaggtcccatactgcattgttaagggaaa 447
              |||||||||||| | ||||||||||||||  |||| || |||||||| ||||||||
Sbjct: 50821 ttggctcccagccttgtgcaggaagatggaaatcccttattgcattgtgaagggaaa 50765



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 118/140 (84%), Gaps = 1/140 (0%)
 Strand = Plus / Minus

                                                                         
Query: 176   ttcaagatgcttctcaagtaccgccctgaggacaaggtggctaagaaggagaggcttctg 235
             |||||||||||  | |||||||||||||| || ||||  || | |||||| |||||| ||
Sbjct: 51160 ttcaagatgctgttgaagtaccgccctgaagataaggctgcca-gaaggaaaggcttttg 51102

                                                                         
Query: 236   aagagggcacaggctgaggctgaggggaaaaccgttgaggccaagaagccaattgttgtg 295
             || || || || || |||||||| ||||| || ||||| |||||||| ||||||||||||
Sbjct: 51101 aaaagagcgcaagcagaggctgaagggaagactgttgaagccaagaaaccaattgttgtg 51042

                                 
Query: 296   aagtatggtcttaaccatgt 315
             |||||||||||| |||||||
Sbjct: 51041 aagtatggtcttgaccatgt 51022



to top

>ref|NM_116152.2| Arabidopsis thaliana structural constituent of ribosome AT3G62870
           mRNA, complete cds
          Length = 1048

 Score =  165 bits (83), Expect = 2e-37
 Identities = 284/351 (80%)
 Strand = Plus / Plus

                                                                       
Query: 132 accagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaagatgcttctca 191
           |||||||||||   ||||| || ||||| |||||||||| ||| |||||||| ||||| |
Sbjct: 295 accagttcaccaagacccttgataagaatctcgccaccagcctcttcaagattcttctga 354

                                                                       
Query: 192 agtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagagggcacaggctg 251
           ||||  | || |||||||| |  || ||||||||  | ||| |||| | ||| || ||||
Sbjct: 355 agtataggccagaggacaaagccgcaaagaaggaacgccttttgaacaaggctcaagctg 414

                                                                       
Query: 252 aggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagtatggtcttaacc 311
           |||| || || ||  | | |||  |||||||||| |||||||| ||||||||||| ||||
Sbjct: 415 aggcagaaggaaagcctgctgaatccaagaagcccattgttgttaagtatggtctcaacc 474

                                                                       
Query: 312 atgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgctcatgatgttg 371
           |||| |||||||| || ||||||| |||||| ||||| || ||||| || || |||||||
Sbjct: 475 atgtgacttacctcatcgagcagaacaaggcacagcttgtggtcattgcacacgatgttg 534

                                                                       
Query: 372 acccaattgagctggttgtgtggctcccagccctatgcaggaagatggaggtcccatact 431
           |||| || ||| |||| || ||| | || || || |||||||| ||||| ||||| ||||
Sbjct: 535 accctatcgagttggtggtctggttacctgcactctgcaggaaaatggaagtcccttact 594

                                                              
Query: 432 gcattgttaagggaaaatcacgccttggatcgattgttcacaagaagactg 482
           ||||||||||||||||||| || |||||| || | |||||| |||||||||
Sbjct: 595 gcattgttaagggaaaatctcgtcttggagcggtcgttcaccagaagactg 645



to top

>gb|AY114667.1| Arabidopsis thaliana 60S ribosomal protein L7A protein (At3g62870)
           mRNA, complete cds
          Length = 883

 Score =  165 bits (83), Expect = 2e-37
 Identities = 284/351 (80%)
 Strand = Plus / Plus

                                                                       
Query: 132 accagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaagatgcttctca 191
           |||||||||||   ||||| || ||||| |||||||||| ||| |||||||| ||||| |
Sbjct: 215 accagttcaccaagacccttgataagaatctcgccaccagcctcttcaagattcttctga 274

                                                                       
Query: 192 agtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagagggcacaggctg 251
           ||||  | || |||||||| |  || ||||||||  | ||| |||| | ||| || ||||
Sbjct: 275 agtataggccagaggacaaagccgcaaagaaggaacgccttttgaacaaggctcaagctg 334

                                                                       
Query: 252 aggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagtatggtcttaacc 311
           |||| || || ||  | | |||  |||||||||| |||||||| ||||||||||| ||||
Sbjct: 335 aggcagaaggaaagcctgctgaatccaagaagcccattgttgttaagtatggtctcaacc 394

                                                                       
Query: 312 atgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgctcatgatgttg 371
           |||| |||||||| || ||||||| |||||| ||||| || ||||| || || |||||||
Sbjct: 395 atgtgacttacctcatcgagcagaacaaggcacagcttgtggtcattgcacacgatgttg 454

                                                                       
Query: 372 acccaattgagctggttgtgtggctcccagccctatgcaggaagatggaggtcccatact 431
           |||| || ||| |||| || ||| | || || || |||||||| ||||| ||||| ||||
Sbjct: 455 accctatcgagttggtggtctggttacctgcactctgcaggaaaatggaagtcccttact 514

                                                              
Query: 432 gcattgttaagggaaaatcacgccttggatcgattgttcacaagaagactg 482
           ||||||||||||||||||| || |||||| || | |||||| |||||||||
Sbjct: 515 gcattgttaagggaaaatctcgtcttggagcggtcgttcaccagaagactg 565



to top

>gb|AY062758.1| Arabidopsis thaliana 60S RIBOSOMAL PROTEIN L7A protein (At3g62870;
           F26K9_300) mRNA, complete cds
          Length = 976

 Score =  165 bits (83), Expect = 2e-37
 Identities = 284/351 (80%)
 Strand = Plus / Plus

                                                                       
Query: 132 accagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaagatgcttctca 191
           |||||||||||   ||||| || ||||| |||||||||| ||| |||||||| ||||| |
Sbjct: 251 accagttcaccaagacccttgataagaatctcgccaccagcctcttcaagattcttctga 310

                                                                       
Query: 192 agtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagagggcacaggctg 251
           ||||  | || |||||||| |  || ||||||||  | ||| |||| | ||| || ||||
Sbjct: 311 agtataggccagaggacaaagccgcaaagaaggaacgccttttgaacaaggctcaagctg 370

                                                                       
Query: 252 aggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagtatggtcttaacc 311
           |||| || || ||  | | |||  |||||||||| |||||||| ||||||||||| ||||
Sbjct: 371 aggcagaaggaaagcctgctgaatccaagaagcccattgttgttaagtatggtctcaacc 430

                                                                       
Query: 312 atgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgctcatgatgttg 371
           |||| |||||||| || ||||||| |||||| ||||| || ||||| || || |||||||
Sbjct: 431 atgtgacttacctcatcgagcagaacaaggcacagcttgtggtcattgcacacgatgttg 490

                                                                       
Query: 372 acccaattgagctggttgtgtggctcccagccctatgcaggaagatggaggtcccatact 431
           |||| || ||| |||| || ||| | || || || |||||||| ||||| ||||| ||||
Sbjct: 491 accctatcgagttggtggtctggttacctgcactctgcaggaaaatggaagtcccttact 550

                                                              
Query: 432 gcattgttaagggaaaatcacgccttggatcgattgttcacaagaagactg 482
           ||||||||||||||||||| || |||||| || | |||||| |||||||||
Sbjct: 551 gcattgttaagggaaaatctcgtcttggagcggtcgttcaccagaagactg 601



to top

>gb|AY060519.1| Arabidopsis thaliana AT3g62870/F26K9_300 mRNA, complete cds
          Length = 771

 Score =  165 bits (83), Expect = 2e-37
 Identities = 284/351 (80%)
 Strand = Plus / Plus

                                                                       
Query: 132 accagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaagatgcttctca 191
           |||||||||||   ||||| || ||||| |||||||||| ||| |||||||| ||||| |
Sbjct: 215 accagttcaccaagacccttgataagaatctcgccaccagcctcttcaagattcttctga 274

                                                                       
Query: 192 agtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagagggcacaggctg 251
           ||||  | || |||||||| |  || ||||||||  | ||| |||| | ||| || ||||
Sbjct: 275 agtataggccagaggacaaagccgcaaagaaggaacgccttttgaacaaggctcaagctg 334

                                                                       
Query: 252 aggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagtatggtcttaacc 311
           |||| || || ||  | | |||  |||||||||| |||||||| ||||||||||| ||||
Sbjct: 335 aggcagaaggaaagcctgctgaatccaagaagcccattgttgttaagtatggtctcaacc 394

                                                                       
Query: 312 atgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgctcatgatgttg 371
           |||| |||||||| || ||||||| |||||| ||||| || ||||| || || |||||||
Sbjct: 395 atgtgacttacctcatcgagcagaacaaggcacagcttgtggtcattgcacacgatgttg 454

                                                                       
Query: 372 acccaattgagctggttgtgtggctcccagccctatgcaggaagatggaggtcccatact 431
           |||| || ||| |||| || ||| | || || || |||||||| ||||| ||||| ||||
Sbjct: 455 accctatcgagttggtggtctggttacctgcactctgcaggaaaatggaagtcccttact 514

                                                              
Query: 432 gcattgttaagggaaaatcacgccttggatcgattgttcacaagaagactg 482
           ||||||||||||||||||| || |||||| || | |||||| |||||||||
Sbjct: 515 gcattgttaagggaaaatctcgtcttggagcggtcgttcaccagaagactg 565



to top

>gb|AY052264.1| Arabidopsis thaliana AT3g62870/F26K9_300 mRNA, complete cds
          Length = 1013

 Score =  165 bits (83), Expect = 2e-37
 Identities = 284/351 (80%)
 Strand = Plus / Plus

                                                                       
Query: 132 accagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaagatgcttctca 191
           |||||||||||   ||||| || ||||| |||||||||| ||| |||||||| ||||| |
Sbjct: 288 accagttcaccaagacccttgataagaatctcgccaccagcctcttcaagattcttctga 347

                                                                       
Query: 192 agtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagagggcacaggctg 251
           ||||  | || |||||||| |  || ||||||||  | ||| |||| | ||| || ||||
Sbjct: 348 agtataggccagaggacaaagccgcaaagaaggaacgccttttgaacaaggctcaagctg 407

                                                                       
Query: 252 aggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagtatggtcttaacc 311
           |||| || || ||  | | |||  |||||||||| |||||||| ||||||||||| ||||
Sbjct: 408 aggcagaaggaaagcctgctgaatccaagaagcccattgttgttaagtatggtctcaacc 467

                                                                       
Query: 312 atgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgctcatgatgttg 371
           |||| |||||||| || ||||||| |||||| ||||| || ||||| || || |||||||
Sbjct: 468 atgtgacttacctcatcgagcagaacaaggcacagcttgtggtcattgcacacgatgttg 527

                                                                       
Query: 372 acccaattgagctggttgtgtggctcccagccctatgcaggaagatggaggtcccatact 431
           |||| || ||| |||| || ||| | || || || |||||||| ||||| ||||| ||||
Sbjct: 528 accctatcgagttggtggtctggttacctgcactctgcaggaaaatggaagtcccttact 587

                                                              
Query: 432 gcattgttaagggaaaatcacgccttggatcgattgttcacaagaagactg 482
           ||||||||||||||||||| || |||||| || | |||||| |||||||||
Sbjct: 588 gcattgttaagggaaaatctcgtcttggagcggtcgttcaccagaagactg 638



to top

>emb|BX825094.1|CNS0A7RE Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH9ZD11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 835

 Score =  165 bits (83), Expect = 2e-37
 Identities = 284/351 (80%)
 Strand = Plus / Plus

                                                                       
Query: 132 accagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaagatgcttctca 191
           |||||||||||   ||||| || ||||| |||||||||| ||| |||||||| ||||| |
Sbjct: 171 accagttcaccaagacccttgataagaatctcgccaccagcctcttcaagattcttctga 230

                                                                       
Query: 192 agtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagagggcacaggctg 251
           ||||  | || |||||||| |  || ||||||||  | ||| |||| | ||| || ||||
Sbjct: 231 agtataggccagaggacaaagccgcaaagaaggaacgccttttgaacaaggctcaagctg 290

                                                                       
Query: 252 aggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagtatggtcttaacc 311
           |||| || || ||  | | |||  |||||||||| |||||||| ||||||||||| ||||
Sbjct: 291 aggcagaaggaaagcctgctgaatccaagaagcccattgttgttaagtatggtctcaacc 350

                                                                       
Query: 312 atgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgctcatgatgttg 371
           |||| |||||||| || ||||||| |||||| ||||| || ||||| || || |||||||
Sbjct: 351 atgtgacttacctcatcgagcagaacaaggcacagcttgtggtcattgcacacgatgttg 410

                                                                       
Query: 372 acccaattgagctggttgtgtggctcccagccctatgcaggaagatggaggtcccatact 431
           |||| || ||| |||| || ||| | || || || |||||||| ||||| ||||| ||||
Sbjct: 411 accctatcgagttggtggtctggttacctgcactctgcaggaaaatggaagtcccttact 470

                                                              
Query: 432 gcattgttaagggaaaatcacgccttggatcgattgttcacaagaagactg 482
           ||||||||||||||||||| || |||||| || | |||||| |||||||||
Sbjct: 471 gcattgttaagggaaaatctcgtcttggagcggtcgttcaccagaagactg 521



to top

>emb|BX823982.1|CNS0A6PP Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH12ZB02 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 946

 Score =  165 bits (83), Expect = 2e-37
 Identities = 284/351 (80%)
 Strand = Plus / Plus

                                                                       
Query: 132 accagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaagatgcttctca 191
           |||||||||||   ||||| || ||||| |||||||||| ||| |||||||| ||||| |
Sbjct: 235 accagttcaccaagacccttgataagaatctcgccaccagcctcttcaagattcttctga 294

                                                                       
Query: 192 agtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagagggcacaggctg 251
           ||||  | || |||||||| |  || ||||||||  | ||| |||| | ||| || ||||
Sbjct: 295 agtataggccagaggacaaagccgcaaagaaggaacgccttttgaacaaggctcaagctg 354

                                                                       
Query: 252 aggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagtatggtcttaacc 311
           |||| || || ||  | | |||  |||||||||| |||||||| ||||||||||| ||||
Sbjct: 355 aggcagaaggaaagcctgctgaatccaagaagcccattgttgttaagtatggtctcaacc 414

                                                                       
Query: 312 atgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgctcatgatgttg 371
           |||| |||||||| || ||||||| |||||| ||||| || ||||| || || |||||||
Sbjct: 415 atgtgacttacctcatcgagcagaacaaggcacagcttgtggtcattgcacacgatgttg 474

                                                                       
Query: 372 acccaattgagctggttgtgtggctcccagccctatgcaggaagatggaggtcccatact 431
           |||| || ||| |||| || ||| | || || || |||||||| ||||| ||||| ||||
Sbjct: 475 accctatcgagttggtggtctggttacctgcactctgcaggaaaatggaagtcccttact 534

                                                              
Query: 432 gcattgttaagggaaaatcacgccttggatcgattgttcacaagaagactg 482
           ||||||||||||||||||| || |||||| || | |||||| |||||||||
Sbjct: 535 gcattgttaagggaaaatctcgtcttggagcggtcgttcaccagaagactg 585



to top

>emb|BX824662.1|CNS0A4TO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH63ZA03 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 940

 Score =  165 bits (83), Expect = 2e-37
 Identities = 284/351 (80%)
 Strand = Plus / Plus

                                                                       
Query: 132 accagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaagatgcttctca 191
           |||||||||||   ||||| || ||||| |||||||||| ||| |||||||| ||||| |
Sbjct: 253 accagttcaccaagacccttgataagaatctcgccaccagcctcttcaagattcttctga 312

                                                                       
Query: 192 agtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagagggcacaggctg 251
           ||||  | || |||||||| |  || ||||||||  | ||| |||| | ||| || ||||
Sbjct: 313 agtataggccagaggacaaagccgcaaagaaggaacgccttttgaacaaggctcaagctg 372

                                                                       
Query: 252 aggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagtatggtcttaacc 311
           |||| || || ||  | | |||  |||||||||| |||||||| ||||||||||| ||||
Sbjct: 373 aggcagaaggaaagcctgctgaatccaagaagcccattgttgttaagtatggtctcaacc 432

                                                                       
Query: 312 atgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgctcatgatgttg 371
           |||| |||||||| || ||||||| |||||| ||||| || ||||| || || |||||||
Sbjct: 433 atgtgacttacctcatcgagcagaacaaggcacagcttgtggtcattgcacacgatgttg 492

                                                                       
Query: 372 acccaattgagctggttgtgtggctcccagccctatgcaggaagatggaggtcccatact 431
           |||| || ||| |||| || ||| | || || || |||||||| ||||| ||||| ||||
Sbjct: 493 accctatcgagttggtggtctggttacctgcactctgcaggaaaatggaagtcccttact 552

                                                              
Query: 432 gcattgttaagggaaaatcacgccttggatcgattgttcacaagaagactg 482
           ||||||||||||||||||| || |||||| || | |||||| |||||||||
Sbjct: 553 gcattgttaagggaaaatctcgtcttggagcggtcgttcaccagaagactg 603



to top

>gb|AY086353.1| Arabidopsis thaliana clone 24272 mRNA, complete sequence
          Length = 1020

 Score =  159 bits (80), Expect = 1e-35
 Identities = 266/328 (81%)
 Strand = Plus / Plus

                                                                       
Query: 155 aagaacctcgccaccaacctgttcaagatgcttctcaagtaccgccctgaggacaaggtg 214
           ||||| |||||||||| ||| |||||||| ||||| |||||  | || |||||||| |  
Sbjct: 318 aagaatctcgccaccagcctcttcaagattcttctgaagtataggccagaggacaaagcc 377

                                                                       
Query: 215 gctaagaaggagaggcttctgaagagggcacaggctgaggctgaggggaaaaccgttgag 274
           || ||||||||  | ||| |||| | ||| || |||||||| || || ||  | | ||| 
Sbjct: 378 gcaaagaaggaacgccttttgaacaaggctcaagctgaggcagaaggaaagcctgctgaa 437

                                                                       
Query: 275 gccaagaagccaattgttgtgaagtatggtcttaaccatgtcacttaccttattgagcag 334
            |||||||||| |||||||| ||||||||||| |||||||| |||||||| || ||||||
Sbjct: 438 tccaagaagcccattgttgttaagtatggtctcaaccatgtgacttacctcatcgagcag 497

                                                                       
Query: 335 agcaaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtgg 394
           | |||||| ||||| || ||||| || || ||||||||||| || ||| |||| || |||
Sbjct: 498 aacaaggcacagcttgtggtcattgcacacgatgttgaccctatcgagttggtggtctgg 557

                                                                       
Query: 395 ctcccagccctatgcaggaagatggaggtcccatactgcattgttaagggaaaatcacgc 454
            | || || || |||||||| ||||| ||||| ||||||||||||||||||||||| || 
Sbjct: 558 ttacctgcactctgcaggaaaatggaagtcccttactgcattgttaagggaaaatctcgt 617

                                       
Query: 455 cttggatcgattgttcacaagaagactg 482
           |||||| || | |||||| |||||||||
Sbjct: 618 cttggagcggtcgttcaccagaagactg 645



to top

>emb|BX824178.1|CNS0A6S9 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH28ZG05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 983

 Score =  157 bits (79), Expect = 4e-35
 Identities = 283/351 (80%)
 Strand = Plus / Plus

                                                                       
Query: 132 accagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaagatgcttctca 191
           |||||||||||   ||||| || ||||| |||||||||| ||| |||||||| ||||| |
Sbjct: 254 accagttcaccaagacccttgataagaatctcgccaccagcctcttcaagattcttctga 313

                                                                       
Query: 192 agtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagagggcacaggctg 251
           ||||  | || |||||||| |  || ||||||||  | ||| |||| | ||| || ||||
Sbjct: 314 agtataggccagaggacaaagccgcaaagaaggaacgccttttgaacaaggctcaagctg 373

                                                                       
Query: 252 aggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagtatggtcttaacc 311
           |||| || || ||  | | |||  |||||||||| |||||||| ||||||||| | ||||
Sbjct: 374 aggcagaaggaaagcctgctgaatccaagaagcccattgttgttaagtatggtgtaaacc 433

                                                                       
Query: 312 atgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgctcatgatgttg 371
           |||| |||||||| || ||||||| |||||| ||||| || ||||| || || |||||||
Sbjct: 434 atgtgacttacctcatcgagcagaacaaggcacagcttgtggtcattgcacacgatgttg 493

                                                                       
Query: 372 acccaattgagctggttgtgtggctcccagccctatgcaggaagatggaggtcccatact 431
           |||| || ||| |||| || ||| | || || || |||||||| ||||| ||||| ||||
Sbjct: 494 accctatcgagttggtggtctggttacctgcactctgcaggaaaatggaagtcccttact 553

                                                              
Query: 432 gcattgttaagggaaaatcacgccttggatcgattgttcacaagaagactg 482
           ||||||||||||||||||| || |||||| || | |||||| |||||||||
Sbjct: 554 gcattgttaagggaaaatctcgtcttggagcggtcgttcaccagaagactg 604



to top

>emb|BX822281.1|CNS0A71I Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB26ZA10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 870

 Score =  157 bits (79), Expect = 4e-35
 Identities = 283/351 (80%)
 Strand = Plus / Plus

                                                                       
Query: 132 accagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaagatgcttctca 191
           |||||||||||   ||||| || ||||| |||||||||| ||| |||||||| ||||| |
Sbjct: 208 accagttcaccaagacccttgataagaatctcgccaccagcctcttcaagattcttctga 267

                                                                       
Query: 192 agtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagagggcacaggctg 251
           ||||  | || |||||||| |  || ||||||||  | ||| |||| | ||| || ||||
Sbjct: 268 agtataggccagaggacaaagccgcaaagaaggaacgccttttgaacaaggctcaagctg 327

                                                                       
Query: 252 aggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagtatggtcttaacc 311
           |||| || || ||  | | |||  |||||||||| |||||||| ||||||||||| ||||
Sbjct: 328 aggcagaaggaaagcctgctgaatccaagaagcccattgttgttaagtatggtctcaacc 387

                                                                       
Query: 312 atgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgctcatgatgttg 371
           |||| |||||||| || ||||||| |||||| ||||| || ||||| || || |||||||
Sbjct: 388 atgtaacttacctcatcgagcagaacaaggcacagcttgtggtcattgcacacgatgttg 447

                                                                       
Query: 372 acccaattgagctggttgtgtggctcccagccctatgcaggaagatggaggtcccatact 431
           |||| || ||| |||| || ||| | || || || |||||||| ||||| |||||  |||
Sbjct: 448 accctatcgagttggtggtctggttacctgcactctgcaggaaaatggaagtccctaact 507

                                                              
Query: 432 gcattgttaagggaaaatcacgccttggatcgattgttcacaagaagactg 482
           ||||||||||||||||||| || |||||| || | |||||| |||||||||
Sbjct: 508 gcattgttaagggaaaatctcgtcttggagcggtcgttcaccagaagactg 558



to top

>gb|BT014547.1| Lycopersicon esculentum clone 133964F, mRNA sequence
          Length = 1092

 Score =  153 bits (77), Expect = 6e-34
 Identities = 254/313 (81%)
 Strand = Plus / Plus

                                                                       
Query: 132 accagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaagatgcttctca 191
           |||||||||||   ||||| |||||||||| ||| || | ||| |||||||||||||| |
Sbjct: 276 accagttcaccaaaacccttgacaagaaccccgctacaacccttttcaagatgcttctta 335

                                                                       
Query: 192 agtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagagggcacaggctg 251
           ||||| | ||||||||||| |  || ||||||||| | ||| | || ||||| || ||||
Sbjct: 336 agtacaggcctgaggacaaagctgcaaagaaggagcgtcttgtcaaaagggctcaagctg 395

                                                                       
Query: 252 aggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagtatggtcttaacc 311
           | || || || |||||   |||  | ||||| || ||||||||||||||||| ||||| |
Sbjct: 396 aagcagaaggaaaaactcctgaaacaaagaaacccattgttgtgaagtatgggcttaagc 455

                                                                       
Query: 312 atgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgctcatgatgttg 371
           |  ||||||||||||||||||||| ||| |||||| |||| || || |||||||| || |
Sbjct: 456 acatcacttaccttattgagcagaacaaagctcagttggtagtgattgctcatgacgtgg 515

                                                                       
Query: 372 acccaattgagctggttgtgtggctcccagccctatgcaggaagatggaggtcccatact 431
           ||||||| ||| ||||||| ||||| || || |||||||| ||||||||  | || ||||
Sbjct: 516 acccaatagagttggttgtctggcttcctgcgctatgcagaaagatggaaattccttact 575

                        
Query: 432 gcattgttaaggg 444
           ||||||| |||||
Sbjct: 576 gcattgtgaaggg 588



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 1   gcagttcggcatcggcggggcgctgccgcccaagaa 36
           ||||||||| ||||| |||||||||||||| |||||
Sbjct: 145 gcagttcggtatcggtggggcgctgccgccgaagaa 180



to top

>gb|DQ268850.1| Solanum tuberosum clone 155G10 60S ribosomal protein L7A-like
           protein mRNA, complete cds
          Length = 1003

 Score =  153 bits (77), Expect = 6e-34
 Identities = 254/313 (81%)
 Strand = Plus / Plus

                                                                       
Query: 132 accagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaagatgcttctca 191
           |||||||||||   ||||| |||||||||||||| || ||||| |||||||||||||| |
Sbjct: 235 accagttcaccaaaacccttgacaagaacctcgctacaaaccttttcaagatgcttctta 294

                                                                       
Query: 192 agtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagagggcacaggctg 251
           ||||| | || |||||||| |  || ||||||||| | ||| | || || || || ||||
Sbjct: 295 agtacaggcccgaggacaaagctgcaaagaaggagcgtcttgtcaaaagagctcaagctg 354

                                                                       
Query: 252 aggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagtatggtcttaacc 311
           | || || || |||||   |||  | ||||| || ||| ||||||||||||| ||||| |
Sbjct: 355 aagcagaaggaaaaactcctgaaacaaagaaacctattattgtgaagtatgggcttaagc 414

                                                                       
Query: 312 atgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgctcatgatgttg 371
           |  ||||||||||||||||||||| ||| |||||| |||| || || ||||||||||| |
Sbjct: 415 acatcacttaccttattgagcagaacaaagctcagttggtagtgattgctcatgatgtgg 474

                                                                       
Query: 372 acccaattgagctggttgtgtggctcccagccctatgcaggaagatggaggtcccatact 431
           ||||||| ||| ||||||| ||||| || || |||||||| ||||||||  | || ||||
Sbjct: 475 acccaatagagttggttgtctggcttcctgcgctatgcagaaagatggaaattccttact 534

                        
Query: 432 gcattgttaaggg 444
           ||||||| |||||
Sbjct: 535 gcattgtgaaggg 547



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 37/39 (94%)
 Strand = Plus / Plus

                                                  
Query: 1   gcagttcggcatcggcggggcgctgccgcccaagaagga 39
           ||||||||| |||||||||||||||||||| ||||||||
Sbjct: 104 gcagttcggtatcggcggggcgctgccgccgaagaagga 142



to top

>emb|BX824325.1|CNS0A7R8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH3ZF06 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 793

 Score =  149 bits (75), Expect = 1e-32
 Identities = 282/351 (80%)
 Strand = Plus / Plus

                                                                       
Query: 132 accagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaagatgcttctca 191
           |||||||||||   ||||| || ||||| |||||||||| ||| |||||||| ||||| |
Sbjct: 165 accagttcaccaagacccttgataagaatctcgccaccagcctcttcaagattcttctga 224

                                                                       
Query: 192 agtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagagggcacaggctg 251
           ||||  | || || ||||| |  || ||||||||  | ||| |||| | ||| || ||||
Sbjct: 225 agtataggccagaagacaaagccgcaaagaaggaacgccttttgaacaaggctcaagctg 284

                                                                       
Query: 252 aggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagtatggtcttaacc 311
           |||| || || ||  | | |||  |||||||||| |||||||| ||||||||||| ||||
Sbjct: 285 aggcagaaggaaagcctgctgaatccaagaagcccattgttgttaagtatggtctcaacc 344

                                                                       
Query: 312 atgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgctcatgatgttg 371
           ||||||||||||| || ||||||| |||||| ||||| || ||||| || || |||||||
Sbjct: 345 atgtcacttacctcatcgagcagaacaaggcacagcttgtggtcattgcacacgatgttg 404

                                                                       
Query: 372 acccaattgagctggttgtgtggctcccagccctatgcaggaagatggaggtcccatact 431
           |||| || ||| |||| || ||| | || || || |||||||| ||||| |||||  |||
Sbjct: 405 accctatcgagttggtggtctggttacctgcactctgcaggaaaatggaagtccctcact 464

                                                              
Query: 432 gcattgttaagggaaaatcacgccttggatcgattgttcacaagaagactg 482
           ||||| ||||||||||||| || |||||| || | |||||| |||||||||
Sbjct: 465 gcatttttaagggaaaatctcgtcttggagcggtcgttcaccagaagactg 515



to top

>ref|NM_130329.2| Arabidopsis thaliana structural constituent of ribosome AT2G47610
           mRNA, complete cds
          Length = 1092

 Score =  145 bits (73), Expect = 2e-31
 Identities = 172/205 (83%)
 Strand = Plus / Plus

                                                                       
Query: 278 aagaagccaattgttgtgaagtatggtcttaaccatgtcacttaccttattgagcagagc 337
           |||||||| ||||| || || || || || |||||||| || ||||| |||||||||| |
Sbjct: 428 aagaagcccattgtagtcaaatacggcctcaaccatgtgacctacctcattgagcagaac 487

                                                                       
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggctc 397
           ||||| || || ||||| || ||||||||||| |||||||||||| ||||||| ||| | 
Sbjct: 488 aaggcccaacttgttgttattgctcatgatgtcgacccaattgagttggttgtctggttg 547

                                                                       
Query: 398 ccagccctatgcaggaagatggaggtcccatactgcattgttaagggaaaatcacgcctt 457
           || || || |||||||||||||| ||||| ||||||||||| ||||| ||||| || |||
Sbjct: 548 cctgctctgtgcaggaagatggaagtcccgtactgcattgtcaagggcaaatctcgtctt 607

                                    
Query: 458 ggatcgattgttcacaagaagactg 482
           ||| || |||||||| |||||||||
Sbjct: 608 ggagcggttgttcaccagaagactg 632



to top

>gb|BT000500.1| Arabidopsis thaliana 60S ribosomal protein L7A
           (At2g47610/T30B22.8) mRNA, complete cds
          Length = 774

 Score =  145 bits (73), Expect = 2e-31
 Identities = 172/205 (83%)
 Strand = Plus / Plus

                                                                       
Query: 278 aagaagccaattgttgtgaagtatggtcttaaccatgtcacttaccttattgagcagagc 337
           |||||||| ||||| || || || || || |||||||| || ||||| |||||||||| |
Sbjct: 364 aagaagcccattgtagtcaaatacggcctcaaccatgtgacctacctcattgagcagaac 423

                                                                       
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggctc 397
           ||||| || || ||||| || ||||||||||| |||||||||||| ||||||| ||| | 
Sbjct: 424 aaggcccaacttgttgttattgctcatgatgtcgacccaattgagttggttgtctggttg 483

                                                                       
Query: 398 ccagccctatgcaggaagatggaggtcccatactgcattgttaagggaaaatcacgcctt 457
           || || || |||||||||||||| ||||| ||||||||||| ||||| ||||| || |||
Sbjct: 484 cctgctctgtgcaggaagatggaagtcccgtactgcattgtcaagggcaaatctcgtctt 543

                                    
Query: 458 ggatcgattgttcacaagaagactg 482
           ||| || |||||||| |||||||||
Sbjct: 544 ggagcggttgttcaccagaagactg 568



to top

>emb|AL162651.1|ATF26K9 Arabidopsis thaliana DNA chromosome 3, BAC clone F26K9
          Length = 110257

 Score =  145 bits (73), Expect = 2e-31
 Identities = 157/185 (84%)
 Strand = Plus / Minus

                                                                         
Query: 276   ccaagaagccaattgttgtgaagtatggtcttaaccatgtcacttaccttattgagcaga 335
             |||||||||| |||||||| ||||||||||| |||||||| |||||||| || |||||||
Sbjct: 96455 ccaagaagcccattgttgttaagtatggtctcaaccatgtgacttacctcatcgagcaga 96396

                                                                         
Query: 336   gcaaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggc 395
              |||||| ||||| || ||||| || || ||||||||||| || ||| |||| || ||| 
Sbjct: 96395 acaaggcacagcttgtggtcattgcacacgatgttgaccctatcgagttggtggtctggt 96336

                                                                         
Query: 396   tcccagccctatgcaggaagatggaggtcccatactgcattgttaagggaaaatcacgcc 455
             | || || || |||||||| ||||| ||||| ||||||||||||||||||||||| || |
Sbjct: 96335 tacctgcactctgcaggaaaatggaagtcccttactgcattgttaagggaaaatctcgtc 96276

                  
Query: 456   ttgga 460
             |||||
Sbjct: 96275 ttgga 96271



to top

>gb|AY052674.1| Arabidopsis thaliana At2g47610/T30B22.8 mRNA, complete cds
          Length = 984

 Score =  145 bits (73), Expect = 2e-31
 Identities = 172/205 (83%)
 Strand = Plus / Plus

                                                                       
Query: 278 aagaagccaattgttgtgaagtatggtcttaaccatgtcacttaccttattgagcagagc 337
           |||||||| ||||| || || || || || |||||||| || ||||| |||||||||| |
Sbjct: 426 aagaagcccattgtagtcaaatacggcctcaaccatgtgacctacctcattgagcagaac 485

                                                                       
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggctc 397
           ||||| || || ||||| || ||||||||||| |||||||||||| ||||||| ||| | 
Sbjct: 486 aaggcccaacttgttgttattgctcatgatgtcgacccaattgagttggttgtctggttg 545

                                                                       
Query: 398 ccagccctatgcaggaagatggaggtcccatactgcattgttaagggaaaatcacgcctt 457
           || || || |||||||||||||| ||||| ||||||||||| ||||| ||||| || |||
Sbjct: 546 cctgctctgtgcaggaagatggaagtcccgtactgcattgtcaagggcaaatctcgtctt 605

                                    
Query: 458 ggatcgattgttcacaagaagactg 482
           ||| || |||||||| |||||||||
Sbjct: 606 ggagcggttgttcaccagaagactg 630



to top

>gb|AF385719.1|AF385719 Arabidopsis thaliana At2g47610/T30B22.8 mRNA, complete cds
          Length = 999

 Score =  145 bits (73), Expect = 2e-31
 Identities = 172/205 (83%)
 Strand = Plus / Plus

                                                                       
Query: 278 aagaagccaattgttgtgaagtatggtcttaaccatgtcacttaccttattgagcagagc 337
           |||||||| ||||| || || || || || |||||||| || ||||| |||||||||| |
Sbjct: 426 aagaagcccattgtagtcaaatacggcctcaaccatgtgacctacctcattgagcagaac 485

                                                                       
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggctc 397
           ||||| || || ||||| || ||||||||||| |||||||||||| ||||||| ||| | 
Sbjct: 486 aaggcccaacttgttgttattgctcatgatgtcgacccaattgagttggttgtctggttg 545

                                                                       
Query: 398 ccagccctatgcaggaagatggaggtcccatactgcattgttaagggaaaatcacgcctt 457
           || || || |||||||||||||| ||||| ||||||||||| ||||| ||||| || |||
Sbjct: 546 cctgctctgtgcaggaagatggaagtcccgtactgcattgtcaagggcaaatctcgtctt 605

                                    
Query: 458 ggatcgattgttcacaagaagactg 482
           ||| || |||||||| |||||||||
Sbjct: 606 ggagcggttgttcaccagaagactg 630



to top

>emb|BX821062.1|CNS0A8OD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH9ZF10 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 897

 Score =  145 bits (73), Expect = 2e-31
 Identities = 172/205 (83%)
 Strand = Plus / Plus

                                                                       
Query: 278 aagaagccaattgttgtgaagtatggtcttaaccatgtcacttaccttattgagcagagc 337
           |||||||| ||||| || || || || || |||||||| || ||||| |||||||||| |
Sbjct: 362 aagaagcccattgtagtcaaatacggcctcaaccatgtgacctacctcattgagcagaac 421

                                                                       
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggctc 397
           ||||| || || ||||| || ||||||||||| |||||||||||| ||||||| ||| | 
Sbjct: 422 aaggcccaacttgttgttattgctcatgatgtcgacccaattgagttggttgtctggttg 481

                                                                       
Query: 398 ccagccctatgcaggaagatggaggtcccatactgcattgttaagggaaaatcacgcctt 457
           || || || |||||||||||||| ||||| ||||||||||| ||||| ||||| || |||
Sbjct: 482 cctgctctgtgcaggaagatggaagtcccgtactgcattgtcaagggcaaatctcgtctt 541

                                    
Query: 458 ggatcgattgttcacaagaagactg 482
           ||| || |||||||| |||||||||
Sbjct: 542 ggagcggttgttcaccagaagactg 566



to top

>emb|BX842094.1|CNS09Y94 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL87ZH02 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 877

 Score =  145 bits (73), Expect = 2e-31
 Identities = 172/205 (83%)
 Strand = Plus / Plus

                                                                       
Query: 278 aagaagccaattgttgtgaagtatggtcttaaccatgtcacttaccttattgagcagagc 337
           |||||||| ||||| || || || || || |||||||| || ||||| |||||||||| |
Sbjct: 403 aagaagcccattgtagtcaaatacggcctcaaccatgtgacctacctcattgagcagaac 462

                                                                       
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggctc 397
           ||||| || || ||||| || ||||||||||| |||||||||||| ||||||| ||| | 
Sbjct: 463 aaggcccaacttgttgttattgctcatgatgtcgacccaattgagttggttgtctggttg 522

                                                                       
Query: 398 ccagccctatgcaggaagatggaggtcccatactgcattgttaagggaaaatcacgcctt 457
           || || || |||||||||||||| ||||| ||||||||||| ||||| ||||| || |||
Sbjct: 523 cctgctctgtgcaggaagatggaagtcccgtactgcattgtcaagggcaaatctcgtctt 582

                                    
Query: 458 ggatcgattgttcacaagaagactg 482
           ||| || |||||||| |||||||||
Sbjct: 583 ggagcggttgttcaccagaagactg 607



to top

>emb|BX842006.1|CNS09Y9Z Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB87ZC11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 979

 Score =  145 bits (73), Expect = 2e-31
 Identities = 172/205 (83%)
 Strand = Plus / Plus

                                                                       
Query: 278 aagaagccaattgttgtgaagtatggtcttaaccatgtcacttaccttattgagcagagc 337
           |||||||| ||||| || || || || || |||||||| || ||||| |||||||||| |
Sbjct: 407 aagaagcccattgtagtcaaatacggcctcaaccatgtgacctacctcattgagcagaac 466

                                                                       
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggctc 397
           ||||| || || ||||| || ||||||||||| |||||||||||| ||||||||||| | 
Sbjct: 467 aaggcccaacttgttgttattgctcatgatgtcgacccaattgagttggttgtgtggttg 526

                                                                       
Query: 398 ccagccctatgcaggaagatggaggtcccatactgcattgttaagggaaaatcacgcctt 457
           || || || |||||||||||||| ||||| ||||||||||| ||||| ||||  || |||
Sbjct: 527 cctgctctgtgcaggaagatggaagtcccgtactgcattgtgaagggcaaatgtcgtctt 586

                                    
Query: 458 ggatcgattgttcacaagaagactg 482
           ||| || |||||||| |||||||||
Sbjct: 587 ggagcggttgttcaccagaagactg 611



to top

>gb|AY088386.1| Arabidopsis thaliana clone 6394 mRNA, complete sequence
          Length = 1092

 Score =  145 bits (73), Expect = 2e-31
 Identities = 172/205 (83%)
 Strand = Plus / Plus

                                                                       
Query: 278 aagaagccaattgttgtgaagtatggtcttaaccatgtcacttaccttattgagcagagc 337
           |||||||| ||||| || || || || || |||||||| || ||||| |||||||||| |
Sbjct: 429 aagaagcccattgtagtcaaatacggcctcaaccatgtgacctacctcattgagcagaac 488

                                                                       
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggctc 397
           ||||| || || ||||| || ||||||||||| |||||||||||| ||||||| ||| | 
Sbjct: 489 aaggcccaacttgttgttattgctcatgatgtcgacccaattgagttggttgtctggttg 548

                                                                       
Query: 398 ccagccctatgcaggaagatggaggtcccatactgcattgttaagggaaaatcacgcctt 457
           || || || |||||||||||||| ||||| ||||||||||| ||||| ||||| || |||
Sbjct: 549 cctgctctgtgcaggaagatggaagtcccgtactgcattgtcaagggcaaatctcgtctt 608

                                    
Query: 458 ggatcgattgttcacaagaagactg 482
           ||| || |||||||| |||||||||
Sbjct: 609 ggagcggttgttcaccagaagactg 633



to top

>emb|BX819217.1|CNS0A8T4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB58ZF10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 747

 Score =  137 bits (69), Expect = 4e-29
 Identities = 171/205 (83%)
 Strand = Plus / Plus

                                                                       
Query: 278 aagaagccaattgttgtgaagtatggtcttaaccatgtcacttaccttattgagcagagc 337
           |||||||| ||||| ||||| || || || |||||||| || ||||| |||||||||| |
Sbjct: 174 aagaagcccattgtagtgaaatacggcctcaaccatgtgacctacctcattgagcagaac 233

                                                                       
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggctc 397
           ||||| || || ||||| || ||||||||||| ||||||||| || ||||||| ||| | 
Sbjct: 234 aaggcccaacttgttgttattgctcatgatgtcgacccaattaagttggttgtctggttg 293

                                                                       
Query: 398 ccagccctatgcaggaagatggaggtcccatactgcattgttaagggaaaatcacgcctt 457
           || || || |||||||||||||| ||||| ||||||||| | ||||| ||||| || |||
Sbjct: 294 cctgctctgtgcaggaagatggaagtcccgtactgcattttcaagggcaaatctcgtctt 353

                                    
Query: 458 ggatcgattgttcacaagaagactg 482
           ||| || |||||||| |||||||||
Sbjct: 354 ggagcggttgttcaccagaagactg 378



to top

>gb|AC155335.1| Brassica rapa subsp. pekinensis chromosome Cytogenetic chromosome 1 clone
              KBrH001H24, complete sequence
          Length = 118144

 Score =  133 bits (67), Expect = 6e-28
 Identities = 294/367 (80%), Gaps = 2/367 (0%)
 Strand = Plus / Minus

                                                                          
Query: 95     atcctcaagcagcgcctcaaggtgcccccggcgctccaccagttcacccgcaccctcgac 154
              |||||||||||| | |||||||| || || ||  |  |||||||||||   || || |||
Sbjct: 112419 atcctcaagcagaggctcaaggtccctcctgctttgaaccagttcaccaagactcttgac 112360

                                                                          
Query: 155    aagaacctcgccaccaacctgttcaagatgcttctcaagtaccgccctgaggacaaggtg 214
              ||||||||||| ||| | || |||||| | ||| | |||||| | |||||||||||||  
Sbjct: 112359 aagaacctcgcgacccagcttttcaagcttcttatgaagtacaggcctgaggacaaggct 112300

                                                                          
Query: 215    gctaagaaggagaggcttctgaagagggcacaggctgaggctgaggggaaaaccgt-tga 273
              || ||||||||  | ||| |||| | ||| || || ||||||||||| ||| || | |||
Sbjct: 112299 gcaaagaaggatcgtcttttgaaaaaggctcaagccgaggctgaggg-aaagccttctga 112241

                                                                          
Query: 274    ggccaagaagccaattgttgtgaagtatggtcttaaccatgtcacttaccttattgagca 333
                |||||||||| |||||||| |||||||| || ||||| || |||||| | || |||||
Sbjct: 112240 atccaagaagcccattgttgtcaagtatgggctcaaccacgtgacttacttgatcgagca 112181

                                                                          
Query: 334    gagcaaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtg 393
              || |||||| ||||| |||||||| ||||| ||||||||||| |||||||| || || ||
Sbjct: 112180 gaacaaggcgcagcttgttgtcattgctcacgatgttgaccccattgagcttgtcgtctg 112121

                                                                          
Query: 394    gctcccagccctatgcaggaagatggaggtcccatactgcattgttaagggaaaatcacg 453
              | | || || || || ||||||||||| || || |||||||||||||| || ||||| ||
Sbjct: 112120 gttacctgctctttgtaggaagatggaagtgccttactgcattgttaaaggcaaatctcg 112061

                     
Query: 454    ccttgga 460
               ||||||
Sbjct: 112060 tcttgga 112054



to top

>gb|AC002535.3| Arabidopsis thaliana chromosome 2 clone T30B22 map CIC06C03, complete
             sequence
          Length = 98937

 Score =  125 bits (63), Expect = 1e-25
 Identities = 153/183 (83%)
 Strand = Plus / Minus

                                                                         
Query: 278   aagaagccaattgttgtgaagtatggtcttaaccatgtcacttaccttattgagcagagc 337
             |||||||| ||||| || || || || || |||||||| || ||||| |||||||||| |
Sbjct: 17822 aagaagcccattgtagtcaaatacggcctcaaccatgtgacctacctcattgagcagaac 17763

                                                                         
Query: 338   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggctc 397
             ||||| || || ||||| || ||||||||||| |||||||||||| ||||||| ||| | 
Sbjct: 17762 aaggcccaacttgttgttattgctcatgatgtcgacccaattgagttggttgtctggttg 17703

                                                                         
Query: 398   ccagccctatgcaggaagatggaggtcccatactgcattgttaagggaaaatcacgcctt 457
             || || || |||||||||||||| ||||| ||||||||||| ||||| ||||| || |||
Sbjct: 17702 cctgctctgtgcaggaagatggaagtcccgtactgcattgtcaagggcaaatctcgtctt 17643

                
Query: 458   gga 460
             |||
Sbjct: 17642 gga 17640



to top

>gb|AC155339.1| Brassica rapa subsp. pekinensis chromosome Cytogenetic chromosome 1
             clone KBrH015H17, complete sequence
          Length = 110885

 Score =  119 bits (60), Expect = 9e-24
 Identities = 294/368 (79%), Gaps = 3/368 (0%)
 Strand = Plus / Minus

                                                                         
Query: 95    atcctcaagcagcgcctcaaggtgcccccggcgctccaccagttcacccgcaccctcgac 154
             |||||||||||| | |||||||| || || ||  |  |||||||||||   || || |||
Sbjct: 26243 atcctcaagcagaggctcaaggtccctcctgctttgaaccagttcaccaagactcttgac 26184

                                                                         
Query: 155   aagaacctcgccaccaacctgttcaagatgcttctcaagtaccgccctgaggacaaggtg 214
             ||||||||||| ||| | || |||||| | ||| | |||||| | |||||||||||||  
Sbjct: 26183 aagaacctcgcgacccagcttttcaagcttcttatgaagtacaggcctgaggacaaggct 26124

                                                                         
Query: 215   gctaagaaggagaggcttctgaagagggcacaggctgaggctgaggggaaaaccgt-tga 273
             || ||||||||  | ||| |||| | ||| || || ||||||||||| ||| || | |||
Sbjct: 26123 gcaaagaaggatcgtcttttgaaaaaggctcaagccgaggctgaggg-aaagccttctga 26065

                                                                         
Query: 274   ggccaagaagccaattgttgtgaagtatggtcttaaccatgtcacttaccttattgagca 333
               |||||||||| |||||||| |||||||| || ||||| || |||||| | || |||||
Sbjct: 26064 atccaagaagcccattgttgtcaagtatgggctcaaccacgtgacttacttgatcgagca 26005

                                                                         
Query: 334   gagcaaggctcagctggttgtcatcgctcat-gatgttgacccaattgagctggttgtgt 392
             || |||||| ||||| |||||||| |||||  ||||||||||| |||||||| || || |
Sbjct: 26004 gaacaaggcgcagcttgttgtcattgctcaacgatgttgaccccattgagcttgtcgtct 25945

                                                                         
Query: 393   ggctcccagccctatgcaggaagatggaggtcccatactgcattgttaagggaaaatcac 452
             || | || || || || ||||||||||| || || |||||||||||||| || ||||| |
Sbjct: 25944 ggttacctgctctttgtaggaagatggaagtgccttactgcattgttaaaggcaaatctc 25885

                     
Query: 453   gccttgga 460
             | ||||||
Sbjct: 25884 gtcttgga 25877



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 76/89 (85%)
 Strand = Plus / Plus

                                                                         
Query: 296   aagtatggtcttaaccatgtcacttaccttattgagcagagcaaggctcagctggttgtc 355
             |||||||| || ||||| || |||||| | || ||||||| |||||| ||||| ||||||
Sbjct: 27302 aagtatgggctcaaccacgtgacttacttgatcgagcagaacaaggcgcagcttgttgtc 27361

                                          
Query: 356   atcgctcatgatgttgacccaattgagct 384
             || ||||| ||||||||||| ||||||||
Sbjct: 27362 attgctcacgatgttgaccccattgagct 27390



to top

>gb|BC106480.1| Xenopus laevis cDNA clone IMAGE:7211162
          Length = 935

 Score =  117 bits (59), Expect = 3e-23
 Identities = 95/107 (88%)
 Strand = Plus / Minus

                                                                       
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggctc 397
           ||||||||||| ||||| ||||||||||||||||| ||||||||||| |||||||  |||
Sbjct: 441 aaggctcagcttgttgtgatcgctcatgatgttgatccaattgagcttgttgtgttcctc 382

                                                          
Query: 398 ccagccctatgcaggaagatggaggtcccatactgcattgttaaggg 444
           || ||| | |||||||||||||  ||||||||||||||||| |||||
Sbjct: 381 cctgccttgtgcaggaagatgggagtcccatactgcattgtcaaggg 335



to top

>gb|AY393839.1| Xenopus laevis ribosomal protein L7a mRNA, partial cds
          Length = 715

 Score =  117 bits (59), Expect = 3e-23
 Identities = 95/107 (88%)
 Strand = Plus / Plus

                                                                       
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggctc 397
           ||||||||||| ||||| ||||||||||||||||| ||||||||||| |||||||  |||
Sbjct: 416 aaggctcagcttgttgtgatcgctcatgatgttgatccaattgagcttgttgtgttcctc 475

                                                          
Query: 398 ccagccctatgcaggaagatggaggtcccatactgcattgttaaggg 444
           || ||| | |||||||||||||  ||||||||||||||||| |||||
Sbjct: 476 cctgccttgtgcaggaagatgggagtcccatactgcattgtcaaggg 522



to top

>emb|BX821934.1|CNS0A88T Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL86ZA06 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 829

 Score =  117 bits (59), Expect = 3e-23
 Identities = 146/175 (83%)
 Strand = Plus / Plus

                                                                       
Query: 308 aaccatgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgctcatgat 367
           |||||||| || ||||| |||||||||| |||||| || || ||||| || |||||||||
Sbjct: 275 aaccatgtgacctacctcattgagcagaacaaggcccaacttgttgttattgctcatgat 334

                                                                       
Query: 368 gttgacccaattgagctggttgtgtggctcccagccctatgcaggaagatggaggtccca 427
           || ||||||||| || ||||||| ||| | || || || |||||||||||||| ||||| 
Sbjct: 335 gtcgacccaattaagttggttgtctggttacctgctctgtgcaggaagatggaagtcccg 394

                                                                  
Query: 428 tactgcattgttaagggaaaatcacgccttggatcgattgttcacaagaagactg 482
            |||||||| | ||||| ||||| || |||||| || |||||||| |||||||||
Sbjct: 395 aactgcattataaagggcaaatctcgtcttggagcggttgttcaccagaagactg 449



to top

>gb|AY496113.1| Capsicum annuum 60S ribosomal protein L7A mRNA, partial cds
          Length = 737

 Score =  111 bits (56), Expect = 2e-21
 Identities = 227/284 (79%)
 Strand = Plus / Plus

                                                                       
Query: 155 aagaacctcgccaccaacctgttcaagatgcttctcaagtaccgccctgaggacaaggtg 214
           |||||||| || || | ||| |||||||||||||| |||||| | ||||||||||| |  
Sbjct: 271 aagaaccttgctacaacccttttcaagatgcttctgaagtacaggcctgaggacaaagct 330

                                                                       
Query: 215 gctaagaaggagaggcttctgaagagggcacaggctgaggctgaggggaaaaccgttgag 274
           || ||||||||| | ||| | || ||||| || ||||| ||||| || || ||   ||| 
Sbjct: 331 gcaaagaaggagcgtcttgtcaaaagggctcaagctgaagctgaaggaaagactcctgaa 390

                                                                       
Query: 275 gccaagaagccaattgttgtgaagtatggtcttaaccatgtcacttaccttattgagcag 334
            | ||||| || ||| | ||||| ||||| ||||| ||  |||| |||||||||||||||
Sbjct: 391 acaaagaaacccattatcgtgaaatatgggcttaagcacatcacgtaccttattgagcag 450

                                                                       
Query: 335 agcaaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtgg 394
           |  || |||||| | || || || ||||||||||| |||||||||||| ||||||| |||
Sbjct: 451 aataaagctcagttagtagtgattgctcatgatgtggacccaattgagttggttgtctgg 510

                                                       
Query: 395 ctcccagccctatgcaggaagatggaggtcccatactgcattgt 438
           || || ||||||||||| ||||||||  | || |||||||||||
Sbjct: 511 cttccggccctatgcagaaagatggaaattccttactgcattgt 554



to top

>dbj|AK220651.1| Arabidopsis thaliana mRNA for 60S ribosomal protein L7A, complete
           cds, clone: RAFL21-65-D24
          Length = 498

 Score =  105 bits (53), Expect = 1e-19
 Identities = 104/121 (85%)
 Strand = Plus / Plus

                                                                       
Query: 362 catgatgttgacccaattgagctggttgtgtggctcccagccctatgcaggaagatggag 421
           |||||||| |||||||||||| ||||||| ||| | || || || |||||||||||||| 
Sbjct: 1   catgatgtcgacccaattgagttggttgtctggttgcctgctctgtgcaggaagatggaa 60

                                                                       
Query: 422 gtcccatactgcattgttaagggaaaatcacgccttggatcgattgttcacaagaagact 481
           ||||| ||||||||||| ||||| ||||| || |||||| || |||||||| ||||||||
Sbjct: 61  gtcccgtactgcattgtcaagggcaaatctcgtcttggagcggttgttcaccagaagact 120

            
Query: 482 g 482
           |
Sbjct: 121 g 121



to top

>emb|AJ718619.1| Nicotiana tabacum cDNA-AFLP-fragment BSTC3-31-300, cultivar Bright
           Yellow 2
          Length = 236

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 103/122 (84%)
 Strand = Plus / Plus

                                                                       
Query: 146 accctcgacaagaacctcgccaccaacctgttcaagatgcttctcaagtaccgccctgag 205
           ||||| ||||  |||||||| |||||||||||||||||||||||||||||| | ||||||
Sbjct: 77  accctggacanaaacctcgcgaccaacctgttcaagatgcttctcaagtacaggcctgag 136

                                                                       
Query: 206 gacaaggtggctaagaaggagaggcttctgaagagggcacaggctgaggctgaggggaaa 265
           ||||| |  || ||||||||| | ||| |||| ||||| || ||||| ||||| || |||
Sbjct: 137 gacaaagctgcaaagaaggagcgtcttgtgaaaagggctcaagctgaagctgaaggaaaa 196

             
Query: 266 ac 267
           ||
Sbjct: 197 ac 198



to top

>emb|BX821043.1|CNS0A8L9 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH94ZE02 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 764

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 130/159 (81%)
 Strand = Plus / Plus

                                                                       
Query: 321 accttattgagcagagcaaggctcagctggttgtcatcgctcatgatgttgacccaattg 380
           |||| ||||||||||  ||||| |  || ||||| || || |||||||| ||||||||||
Sbjct: 236 acctgattgagcagaagaaggccccacttgttgtgattgcgcatgatgtcgacccaattg 295

                                                                       
Query: 381 agctggttgtgtggctcccagccctatgcaggaagatggaggtcccatactgcattgtta 440
           || ||||||||||| | || ||  | |||||||||||||| || || ||||||||||| |
Sbjct: 296 agttggttgtgtggtttcctgctatgtgcaggaagatggaagtgccgtactgcattgtga 355

                                                  
Query: 441 agggaaaatcacgccttggatcgattgttcacaagaaga 479
           |||| ||||| |  |||||| || |||||||| ||||||
Sbjct: 356 agggcaaatctcctcttggagcggttgttcaccagaaga 394



to top

>dbj|AK108838.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-151-H01, full
           insert sequence
          Length = 983

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 92/109 (84%)
 Strand = Plus / Plus

                                                                       
Query: 336 gcaaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggc 395
           ||||||| |||||||| |||||||| || || || ||||| ||||||||||| |||||||
Sbjct: 473 gcaaggcgcagctggtggtcatcgcccacgacgtggaccccattgagctggtggtgtggc 532

                                                            
Query: 396 tcccagccctatgcaggaagatggaggtcccatactgcattgttaaggg 444
           | ||||| || |||| ||||||||  || ||||||||||| || |||||
Sbjct: 533 tgccagcactgtgcaagaagatgggcgtgccatactgcatcgtcaaggg 581



to top

>gb|AY924998.1| Seculamonas ecuadoriensis Rpl7A mRNA, partial cds
          Length = 653

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 55/60 (91%)
 Strand = Plus / Plus

                                                                       
Query: 152 gacaagaacctcgccaccaacctgttcaagatgcttctcaagtaccgccctgaggacaag 211
           ||||||||||| |||||||||||||||||| ||||  ||||||||||||| |||||||||
Sbjct: 239 gacaagaacctggccaccaacctgttcaagctgctcatcaagtaccgcccggaggacaag 298



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 62/74 (83%)
 Strand = Plus / Plus

                                                                       
Query: 371 gacccaattgagctggttgtgtggctcccagccctatgcaggaagatggaggtcccatac 430
           ||||| |||||||| || || ||||||||  |||| |||| ||||||||  ||||| |||
Sbjct: 449 gacccgattgagctcgtcgtctggctcccgaccctctgcaagaagatgggtgtcccgtac 508

                         
Query: 431 tgcattgttaaggg 444
           |||||||| |||||
Sbjct: 509 tgcattgtcaaggg 522



to top

>gb|AY924999.1| Reclinomonas americana Rpl7A mRNA, partial cds
          Length = 618

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 117/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 59  tggcccaaggtcgtgcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtg 118
           |||||||||  ||||||| | |||||||||||| ||||||| || |  ||||| ||||||
Sbjct: 92  tggcccaagtacgtgcgcctgcagcgccagcgcagcatcctgaaccgccgcctgaaggtg 151

                                                                       
Query: 119 cccccggcgctccaccagttcacccgcaccctcgacaagaacctcgccaccaacctgttc 178
           || || ||| || |||| ||||||  ||| ||  ||||||||   |||||||||||||||
Sbjct: 152 ccaccagcgatcaaccacttcaccttcacgctgaacaagaacgcggccaccaacctgttc 211

                                  
Query: 179 aagatgcttctcaagtaccgccc 201
           ||| |||| || |||||||||||
Sbjct: 212 aagctgctgctgaagtaccgccc 234



to top

>gb|AF401560.1| Ictalurus punctatus ribosomal protein L7a mRNA, complete cds
          Length = 860

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 93/111 (83%)
 Strand = Plus / Plus

                                                                       
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggctc 397
           ||||| ||||||||||| |||||||||||||| |||||||| ||||||||  |||  || 
Sbjct: 456 aaggcccagctggttgtgatcgctcatgatgtcgacccaatcgagctggtgttgttcctg 515

                                                              
Query: 398 ccagccctatgcaggaagatggaggtcccatactgcattgttaagggaaaa 448
           || || || ||| | |||||||  |||||||||||||| ||||| ||||||
Sbjct: 516 cctgctctgtgccgtaagatgggtgtcccatactgcatcgttaaaggaaaa 566



to top

>gb|AY924997.1| Jakoba libera Rpl7A mRNA, partial cds
          Length = 750

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 77/91 (84%)
 Strand = Plus / Plus

                                                                       
Query: 345 agctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggctcccagccc 404
           ||||||| |||||||| || ||||||||||| || ||||||||  | |||||||| ||||
Sbjct: 516 agctggtggtcatcgcccacgatgttgaccccatcgagctggtcctctggctccccgccc 575

                                          
Query: 405 tatgcaggaagatggaggtcccatactgcat 435
           | ||| | |||||||| ||||| ||||||||
Sbjct: 576 tgtgccgcaagatggatgtcccctactgcat 606



to top

>gb|BC072834.1| Xenopus laevis MGC80199 protein, mRNA (cDNA clone MGC:80199
           IMAGE:4970819), complete cds
          Length = 916

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 86/104 (82%)
 Strand = Plus / Plus

                                                                       
Query: 341 gctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggctccca 400
           |||||||| ||||| || || ||||| || || || |||||||| |||||||  ||||| 
Sbjct: 499 gctcagcttgttgtgattgcccatgacgtggatcccattgagctcgttgtgttcctccct 558

                                                       
Query: 401 gccctatgcaggaagatggaggtcccatactgcattgttaaggg 444
           ||| | ||| |||||||||  ||||||||||||||||| |||||
Sbjct: 559 gccttgtgccggaagatgggagtcccatactgcattgtcaaggg 602



to top

>gb|AY769275.1| Bombyx mori ribosomal protein L7A (RpL7A) mRNA, complete cds
          Length = 964

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggtt 388
           ||||| ||||| || |||||||||||||||||||| || ||||||||||||
Sbjct: 574 aaggcgcagcttgtggtcatcgctcatgatgttgatcctattgagctggtt 624



to top

>gb|DQ118092.1| Trimastix pyriformis ribosomal protein L7A mRNA, complete cds
          Length = 804

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                       
Query: 132 accagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaagatgcttctca 191
           ||||||||||||  ||||| |||||| || |||||||  |  |||||||| | || | ||
Sbjct: 242 accagttcacccagacccttgacaagcacgtcgccactgagatgttcaagctcctccaca 301

                                              
Query: 192 agtaccgccctgaggacaaggtggctaagaaggag 226
           ||||||||||||||||||||  ||| |||||||||
Sbjct: 302 agtaccgccctgaggacaagaaggccaagaaggag 336



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 413 aagatggaggtcccatactgcattgttaaggg 444
           |||||||| ||||| |||||||||||||||||
Sbjct: 526 aagatggacgtcccctactgcattgttaaggg 557



to top

>gb|AY310805.1| Nicotiana benthamiana clone 12-101 unknown mRNA
          Length = 417

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 90/110 (81%)
 Strand = Plus / Plus

                                                                       
Query: 291 ttgtgaagtatggtcttaaccatgtcacttaccttattgagcagagcaaggctcagctgg 350
           |||| |||||||||||||| ||  |||| |||||||| ||||| |  || || ||| |||
Sbjct: 51  ttgtaaagtatggtcttaagcacatcacctaccttatcgagcanaataaagcgcagttgg 110

                                                             
Query: 351 ttgtcatcgctcatgatgttgacccaattgagctggttgtgtggctccca 400
           | || || || ||||||||||||||||| ||  ||||||| |||||||||
Sbjct: 111 tggttattgcacatgatgttgacccaatagaattggttgtctggctccca 160



to top

>gb|AY439881.1| Armigeres subalbatus ASAP ID: 38933 cytosolic large ribosomal
           subunit L7a mRNA sequence
          Length = 786

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           ||||| || |||||||||||| |||| |||||||| ||||||||||||||
Sbjct: 522 aaggcacaactggttgtcatctctcacgatgttgatccaattgagctggt 571



to top

>ref|XM_575193.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L7a
           (LOC499852), mRNA
          Length = 684

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || ||||||||||| ||||| |||||||||||
Sbjct: 334 aaggctcagctggtggtgattgctcatgatgtagaccccattgagctggt 383



to top

>gb|AC140446.5| Mus musculus BAC clone RP24-114J11 from chromosome 8, complete sequence
          Length = 152392

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                               
Query: 338   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
             |||||||||||||| || || || |||||||||||||| |||||||||||
Sbjct: 44543 aaggctcagctggtggtgattgcccatgatgttgaccccattgagctggt 44592



to top

>emb|BX825080.1|CNS0A6S2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH94ZH07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 932

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                   
Query: 276 ccaagaagccaattgttgtgaagtatggtcttaaccatgt 315
           |||||||||| |||||||||||||||||||| ||| ||||
Sbjct: 388 ccaagaagcccattgttgtgaagtatggtctaaacgatgt 427



to top

>gb|AY924996.1| Malawimonas jakobiformis Rpl7A mRNA, partial cds
          Length = 735

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 348 tggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggctccc 399
           |||| ||||||||||| ||||||||||| |||||||| ||| | ||||||||
Sbjct: 517 tggtcgtcatcgctcacgatgttgacccgattgagcttgttctctggctccc 568



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 174 tgttcaagatgcttctcaagtaccgccctgaggacaagg 212
           |||||||| |||| | |||||||||||||||||||||||
Sbjct: 343 tgttcaagctgctccacaagtaccgccctgaggacaagg 381



to top

>gb|BC076693.1| Xenopus tropicalis hypothetical protein LOC447981, mRNA (cDNA clone
           IMAGE:6983424), partial cds
          Length = 864

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 87/107 (81%)
 Strand = Plus / Plus

                                                                       
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggctc 397
           ||||||||||| ||||| ||||| |||||||| || || || ||||| || ||||  |||
Sbjct: 447 aaggctcagcttgttgtgatcgcccatgatgtcgatcccatcgagctcgtcgtgttcctc 506

                                                          
Query: 398 ccagccctatgcaggaagatggaggtcccatactgcattgttaaggg 444
           || ||  | ||| | |||||||  ||||||||||||||||| |||||
Sbjct: 507 cctgctttgtgccgcaagatgggagtcccatactgcattgtcaaggg 553



to top

>gb|AY925004.1| Malawimonas jakobiformis isolate MJL00000703 Rpl7A gene, partial
           cds
          Length = 488

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 174 tgttcaagatgcttctcaagtaccgccctgaggacaagg 212
           |||||||| |||| | |||||||||||||||||||||||
Sbjct: 178 tgttcaagctgctccacaagtaccgccctgaggacaagg 216



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 348 tggttgtcatcgctcatgatgttgacccaattgag 382
           |||| ||||||||||| ||||||||||| ||||||
Sbjct: 352 tggtcgtcatcgctcacgatgttgacccgattgag 386



to top

>ref|XM_575291.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L7a
           (LOC366258), mRNA
          Length = 651

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                              
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggtt 388
           |||||||||||||| || || || |||||||| ||||| ||||||||||||
Sbjct: 421 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggtt 471



to top

>emb|AL824703.12| Mouse DNA sequence from clone RP23-317M2 on chromosome 4, complete
             sequence
          Length = 80922

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                            
Query: 338   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagct 384
             ||||||||||||||||| || || |||||||| ||||| ||||||||
Sbjct: 32562 aaggctcagctggttgtgattgcccatgatgtagaccccattgagct 32516



to top

>gb|AC154486.2| Mus musculus BAC clone RP24-118H13 from chromosome 17, complete
             sequence
          Length = 197387

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                               
Query: 338   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
             |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 26822 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 26773



to top

>gb|AC110194.11| Mus musculus chromosome 7, clone RP23-238J3, complete sequence
          Length = 223663

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                                
Query: 338    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
              |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 161186 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 161235



to top

>gb|AC182749.2| Mus musculus BAC clone RP23-464D14 from chromosome 17, complete
             sequence
          Length = 211198

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                               
Query: 338   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
             |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 64046 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 64095



to top

>ref|XM_909062.2| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3), transcript variant 3
           (LOC268795), mRNA
          Length = 892

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 479 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 528



to top

>ref|XM_921134.2| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3), transcript variant 4
           (LOC268795), mRNA
          Length = 878

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 465 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 514



to top

>ref|XM_193790.7| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3), transcript variant 1
           (LOC268795), mRNA
          Length = 892

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 479 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 528



to top

>ref|XM_898600.2| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3), transcript variant 2
           (LOC268795), mRNA
          Length = 878

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 465 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 514



to top

>gb|AC110262.12| Mus musculus chromosome 17, clone RP23-291L10, complete sequence
          Length = 210850

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                                
Query: 338    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
              |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 127023 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 126974



to top

>ref|XR_002714.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC434227), mRNA
          Length = 834

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 435 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 484



to top

>ref|XM_751458.1| Ustilago maydis 521 hypothetical protein (UM00404.1) partial mRNA
          Length = 957

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Plus

                                                                       
Query: 104 cagcgcctcaaggtgcccccggcgctccaccagttcacccgcaccctcgacaagaacctc 163
           |||||| | ||||| ||||| ||| ||  ||||||| ||  |||||| |||||||||  |
Sbjct: 328 cagcgcttgaaggtcccccctgcgatcgcccagttcgccaacacccttgacaagaacacc 387

                                                 
Query: 164 gccaccaacctgttcaagatgcttctcaagtaccgccc 201
           |||||||| ||||||||| ||||   ||||||||||||
Sbjct: 388 gccaccaatctgttcaagctgctcaacaagtaccgccc 425



to top

>gb|AC124412.3| Mus musculus BAC clone RP24-274J3 from chromosome 9, complete sequence
          Length = 175945

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                                
Query: 338    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
              |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 130199 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 130248



to top

>emb|AM049005.1| Meladema coriacea mRNA for ribosomal protein L7Ae (rpL7Ae gene)
          Length = 807

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 89/110 (80%)
 Strand = Plus / Plus

                                                                       
Query: 329 gagcagagcaaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggtt 388
           |||||||  ||||| || || ||||| || |||||||||||||| ||  ||||| |||||
Sbjct: 448 gagcagaaaaaggcccaacttgttgttattgctcatgatgttgatcctcttgagttggtt 507

                                                             
Query: 389 gtgtggctcccagccctatgcaggaagatggaggtcccatactgcattgt 438
            | |  ||||||||||| |||||||| ||||  |||||||| || |||||
Sbjct: 508 ctctatctcccagccctgtgcaggaaaatgggtgtcccatattgtattgt 557



to top

>gb|AC115304.3| Mus musculus BAC clone RP24-156K1 from 15, complete sequence
          Length = 144026

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                               
Query: 338   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
             |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 19465 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 19416



to top

>gb|AC154411.2| Mus musculus BAC clone RP24-221F4 from chromosome 17, complete sequence
          Length = 174229

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                               
Query: 338   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
             |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 19419 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 19370



to top

>gb|AC166246.1| Mus musculus BAC clone RP24-80F22 from chromosome 17, complete sequence
          Length = 194452

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                                
Query: 338    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
              |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 161567 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 161518



to top

>gb|AC093926.6| Genomic sequence for Mus musculus, clone RP23-342N3, complete sequence
          Length = 210913

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                               
Query: 338   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
             |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 20902 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 20951



to top

>gb|AC154546.2| Mus musculus BAC clone RP23-431I7 from chromosome 16, complete sequence
          Length = 180261

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                                
Query: 338    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
              |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 173718 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 173669



to top

>dbj|AK034073.1| Mus musculus adult male diencephalon cDNA, RIKEN full-length
           enriched library, clone:9330154F04
           product:unclassifiable, full insert sequence
          Length = 4030

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 476 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 427



to top

>gb|AY925007.1| Reclinomonas americana Rpl7A gene, partial cds
          Length = 1357

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 164 gccaccaacctgttcaagatgcttctcaagtaccgccc 201
           |||||||||||||||||| |||| || |||||||||||
Sbjct: 208 gccaccaacctgttcaagctgctgctgaagtaccgccc 245



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 59  tggcccaaggtcgtgcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtg 118
           |||||||||  ||||||| | |||||||||||| ||||||| || |  ||||| ||||||
Sbjct: 23  tggcccaagtacgtgcgcctgcagcgccagcgcagcatcctgaaccgccgcctgaaggtg 82

                
Query: 119 ccccc 123
           |||||
Sbjct: 83  ccccc 87



to top

>ref|XM_577004.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L7a
           (LOC501604), mRNA
          Length = 877

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 479 aaggctcagctggtggtgattgcccatgatgtagaccctattgagctggt 528



to top

>ref|XM_576987.1| PREDICTED: Rattus norvegicus similar to PRO1477 (LOC501585), mRNA
          Length = 858

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 412 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 363



to top

>ref|XM_346319.2| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L7a
           (LOC367835), mRNA
          Length = 831

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 439 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 488



to top

>ref|XM_225910.3| PREDICTED: Rattus norvegicus similar to Rpl7a protein (LOC307416),
           mRNA
          Length = 900

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 550 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 599



to top

>ref|XM_222251.3| PREDICTED: Rattus norvegicus E1A binding protein p400 (predicted)
            (Ep400_predicted), mRNA
          Length = 11061

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 338  aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
            |||||||||||||| || || ||||||||||| |||||  ||||||||||
Sbjct: 3102 aaggctcagctggtggtgattgctcatgatgtagaccccgttgagctggt 3053



to top

>ref|XM_573092.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L7a
           (LOC497905), mRNA
          Length = 903

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 505 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 554



to top

>ref|XM_575493.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L7a
           (LOC500141), mRNA
          Length = 1008

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 478 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 527



to top

>ref|XM_345462.2| PREDICTED: Rattus norvegicus similar to Rpl7a protein (LOC366239),
           mRNA
          Length = 621

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 274 aaggctcagctggtggtgattgcccatgatgtggaccccattgagctggt 323



to top

>ref|XM_575149.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L7a
           (LOC499809), mRNA
          Length = 880

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 491 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 540



to top

>ref|XM_216024.3| PREDICTED: Rattus norvegicus ribosomal protein L7a (predicted)
           (Rpl7a_predicted), mRNA
          Length = 865

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 472 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 521



to top

>ref|XM_574881.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L7a
           (LOC499556), mRNA
          Length = 880

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 479 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 528



to top

>ref|XM_574302.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L7a
           (LOC499009), mRNA
          Length = 858

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 451 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 500



to top

>gb|AC154252.1| Mus musculus BAC clone RP24-197M20 from chromosome 13, complete sequence
          Length = 176702

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                                
Query: 338    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
              |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 143470 aaggctcagctggtggtaattgcccatgatgtagaccccattgagctggt 143421



to top

>emb|X15013.1|RNPPL7A Rat mRNA for ribosomal protein L7a
          Length = 851

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 458 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 507



to top

>emb|AL603787.8| Mouse DNA sequence from clone RP23-169J19 on chromosome 11 Contains the
              3' end of a novel gene, the gene for a novel protein
              similar to nascent polypeptide-associated complex alpha
              polypeptide Naca, the Tbrg4 gene for transforming growth
              factor beta regulated gene 4, the Wap gene for whey acidic
              protein, an ethanol induced 6 (Etohi6) pseudogene, two
              novel genes, the Ramp3 gene for receptor (calcitonin)
              activity modifying protein 3, a lactate dehydrogenase 1 A
              chain (Ldh1) pseudogene, a mitochondrial ribosomal protein
              L36 (Mrpl36) pseudogene, a retinoblastoma binding protein 5
              (Rbbp5) pseudogene, a ribosomal protein L7A (Rpl7a)
              pseudogene and two CpG islands, complete sequence
          Length = 225879

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                                
Query: 338    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
              |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 199605 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 199556



to top

>gb|AC147366.5| Mus musculus BAC clone RP23-386J3 from 15, complete sequence
          Length = 175781

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                               
Query: 338   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
             |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 52150 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 52199



to top

>gb|AC171211.1| Mus musculus BAC clone RP23-34I14 from chromosome 16, complete sequence
          Length = 230462

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                                
Query: 338    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
              |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 175827 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 175876



to top

>emb|AL772228.5| Mouse DNA sequence from clone RP23-236D1 on chromosome 4, complete
              sequence
          Length = 167555

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                                
Query: 338    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
              |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 144352 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 144303



to top

>gb|AC121151.11| Mus musculus chromosome 17, clone RP24-342C2, complete sequence
          Length = 205467

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                               
Query: 338    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctgg 386
              |||||||||||||| || || || |||||||| ||||| ||||||||||
Sbjct: 113221 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctgg 113269



to top

>ref|XR_002826.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (LOC670147), mRNA
          Length = 821

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctgg 386
           |||||||||||||| || || || |||||||| ||||| ||||||||||
Sbjct: 471 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctgg 519



to top

>ref|XM_846090.1| PREDICTED: Canis familiaris similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC490635), mRNA
          Length = 809

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgt 390
           |||||||||||||| || || || |||||||| || || ||||||||||||||
Sbjct: 412 aaggctcagctggtagtgatagcacatgatgtggatcccattgagctggttgt 464



to top

>emb|AJ718795.1| Nicotiana tabacum cDNA-AFLP-fragment BSTC31-3-310, cultivar Bright
           Yellow 2
          Length = 262

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 167 accaacctgttcaagatgcttctcaagtaccgccctgaggacaa 210
           ||||||||||  ||||||||||||||| || | |||||||||||
Sbjct: 123 accaacctgtggaagatgcttctcaagnacaggcctgaggacaa 166



to top

>dbj|AP003158.1| Mus musculus genomic DNA, chromosome 16q clone:RP21-662M24, complete
              sequences
          Length = 194260

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                               
Query: 339    aggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
              ||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 182322 aggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 182370



to top

>dbj|AP003156.1| Mus musculus genomic DNA, chromosome 16q clone:RP21-56O15, complete
             sequences
          Length = 162128

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                              
Query: 339   aggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
             ||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 46361 aggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 46409



to top

>gb|AY702208.1| Loligo pealei ribosomal protein L7 mRNA, partial cds
          Length = 862

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 341 gctcagctggttgtcatcgctcatgatgttgacccaattgagct 384
           |||||| ||| | |||| ||||||||||||||||| ||||||||
Sbjct: 469 gctcagttggatatcattgctcatgatgttgaccccattgagct 512



to top

>gb|AY925011.1| Trimastix pyriformis ATCC50562 Rpl7A gene, partial cds
          Length = 608

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 413 aagatggaggtcccatactgcattgttaaggg 444
           |||||||| ||||| |||||||||||||||||
Sbjct: 342 aagatggacgtcccctactgcattgttaaggg 373



to top

>ref|XM_759559.1| Theileria parva strain Muguga 60S ribosomal protein L7a (TP02_0083)
           partial mRNA
          Length = 915

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 72/88 (81%)
 Strand = Plus / Plus

                                                                       
Query: 345 agctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggctcccagccc 404
           |||| ||||| |||||||| || || || ||||| ||| | ||| | |||||||| || |
Sbjct: 548 agctcgttgtaatcgctcacgacgtagatccaatcgagttagttttatggctccctgcac 607

                                       
Query: 405 tatgcaggaagatggaggtcccatactg 432
           |||||||||| | ||||||||| |||||
Sbjct: 608 tatgcaggaaaaaggaggtcccgtactg 635



to top

>gb|AY130409.1| Scyliorhinus canicula ribosomal protein L7A-like mRNA, partial
           sequence
          Length = 796

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 341 gctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgt 392
           |||||||||||  |  |||| |||||||||||||| ||||||||||| ||||
Sbjct: 453 gctcagctggtgattgtcgcacatgatgttgaccccattgagctggtcgtgt 504



to top

>gb|DQ214069.1| Taeniopygia guttata clone 0058P0022B08 ribosomal protein L7a-like
           mRNA, complete sequence
          Length = 889

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 341 gctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||| ||||| || || |||||||| ||||| |||||||||||
Sbjct: 472 gctcagcttgttgttattgcccatgatgtggaccctattgagctggt 518



to top

>gb|AC114662.11| Mus musculus chromosome 1, clone RP24-170M24, complete sequence
          Length = 131587

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                            
Query: 338   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagct 384
             |||||||||||||| || || || |||||||| ||||| ||||||||
Sbjct: 72711 aaggctcagctggtggtgattgcccatgatgtagaccccattgagct 72757



to top

>gb|AY925003.1| Malawimonas californiana Rpl7A gene, partial cds
          Length = 514

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 190 caagtaccgccctgaggacaagg 212
           |||||||||||||||||||||||
Sbjct: 4   caagtaccgccctgaggacaagg 26



to top

>gb|AY925000.1| Acanthamoeba castellanii Rpl7A mRNA, partial cds
          Length = 1040

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                      
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggct 396
           |||||| |||| || || |||||||| ||||||||||| || ||||| || ||||||||
Sbjct: 567 aaggctaagctcgtcgtgatcgctcacgatgttgaccccatcgagctcgtcgtgtggct 625



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 132 accagttcacccgcaccctcgacaagaacctcgcca 167
           ||||||||||| | ||||| ||||||||||| ||||
Sbjct: 349 accagttcaccaggacccttgacaagaaccttgcca 384



to top

>ref|XR_003122.1| PREDICTED: Mus musculus hypothetical protein LOC670782 (LOC670782),
           mRNA
          Length = 880

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagct 384
           |||||||||||||| || || || |||||||| ||||| ||||||||
Sbjct: 466 aaggctcagctggtggtgattgcccatgatgtagaccccattgagct 512



to top

>emb|AM049007.1| Scarabaeus laticollis mRNA for ribosomal protein L7Ae (rpL7Ae gene)
          Length = 810

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 350 gttgtcatcgctcatgatgttgacccaattgagct 384
           |||||||| || |||||||||||||| ||||||||
Sbjct: 472 gttgtcattgcgcatgatgttgacccgattgagct 506



to top

>ref|XM_644983.1| Entamoeba histolytica HM-1:IMSS 60S ribosomal protein L7a, putative
           (248.t00005) partial mRNA
          Length = 861

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 425 ccatactgcattgttaagggaaa 447
           |||||||||||||||||||||||
Sbjct: 517 ccatactgcattgttaagggaaa 539



to top

>gb|AY925013.1| Capsaspora owczarzaki Rpl7A gene, partial cds
          Length = 394

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 392 tggctcccagccctatgcaggaagatggaggtcccatactgcattgt 438
           |||||||| ||||| ||| | ||||||||  ||||||||||||||||
Sbjct: 161 tggctccccgccctctgccgcaagatggacatcccatactgcattgt 207



to top

>ref|XM_223019.3| PREDICTED: Rattus norvegicus hypothetical LOC289340 (LOC289340),
           mRNA
          Length = 816

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 341 gctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           ||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 469 gctcagctggtggtgattgcccatgatgtagaccccattgagctggt 515



to top

>ref|XM_576280.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L7a
           (LOC500880), mRNA
          Length = 868

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 341 gctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           ||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 478 gctcagctggtggtgattgcccatgatgtagaccccattgagctggt 524



to top

>gb|AC107710.5| Mus musculus chromosome 19, clone RP23-269K10, complete sequence
          Length = 188708

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                                
Query: 338    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
              |||||||||||||| || || || |||| ||| ||||| |||||||||||
Sbjct: 114194 aaggctcagctggtggtgattgcccatgttgtagaccccattgagctggt 114243



to top

>gb|AC120404.25| Mus musculus chromosome 6, clone RP24-405O23, complete sequence
          Length = 202146

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                                
Query: 338    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
              |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 181352 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 181303



to top

>gb|BC084678.1| Mus musculus ribosomal protein L7a, mRNA (cDNA clone MGC:103146
           IMAGE:30431224), complete cds
          Length = 897

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 473 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 522



to top

>gb|AE017348.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 8, complete
              sequence
          Length = 1194300

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 67/82 (81%)
 Strand = Plus / Plus

                                                                          
Query: 338    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggctc 397
              ||||||||||| || ||||| ||  | ||||||||||| |||||||| || || |  |||
Sbjct: 557741 aaggctcagctcgtcgtcattgccgacgatgttgaccctattgagctcgtcgtcttcctc 557800

                                    
Query: 398    ccagccctatgcaggaagatgg 419
              || || || |||||||||||||
Sbjct: 557801 cccgctctctgcaggaagatgg 557822



to top

>gb|AC128597.3| Rattus norvegicus  BAC CH230-62C6 (Children's Hospital Oakland Research
              Institute Rat (BN/SsNHsd/MCW) BAC library) complete
              sequence
          Length = 198520

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                                
Query: 338    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
              |||||||||||||| || || || || ||||| ||||| |||||||||||
Sbjct: 173125 aaggctcagctggtagttattgcccacgatgtagaccccattgagctggt 173174



to top

>gb|AC138741.7| Mus musculus chromosome 1, clone RP24-260D21, complete sequence
          Length = 161846

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                               
Query: 338   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
             |||||||||||||| || || || |||||||| ||||| | |||||||||
Sbjct: 80992 aaggctcagctggtggtgattgcccatgatgtagaccccactgagctggt 80943



to top

>gb|AC123658.9| Mus musculus chromosome 15, clone RP23-192C13, complete sequence
          Length = 211158

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                                
Query: 338    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
              |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 195311 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 195360



to top

>gb|BC065176.1| Mus musculus ribosomal protein L7a, mRNA (cDNA clone MGC:63353
           IMAGE:6819288), complete cds
          Length = 891

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 460 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 509



to top

>gb|AC140799.6| Mus musculus chromosome 15, clone RP24-147N23, complete sequence
          Length = 162329

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 299 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 348



to top

>ref|NM_013721.2| Mus musculus ribosomal protein L7a (Rpl7a), mRNA
          Length = 867

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 475 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 524



to top

>gb|AC132575.3| Mus musculus BAC clone RP24-425F2 from chromosome 16, complete sequence
          Length = 139828

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                               
Query: 338   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
             |||||||||||||| || || |  |||||||| ||||| |||||||||||
Sbjct: 79789 aaggctcagctggtggtgattgaccatgatgtagaccccattgagctggt 79838



to top

>ref|XM_980392.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC433128), mRNA
          Length = 879

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || ||  | |||||||| ||||| |||||||||||
Sbjct: 476 aaggctcagctggtggtgattacccatgatgtagaccccattgagctggt 525



to top

>ref|XM_977480.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC674419), mRNA
          Length = 901

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || ||  | |||||||| ||||| |||||||||||
Sbjct: 498 aaggctcagctggtggtgattacccatgatgtagaccccattgagctggt 547



to top

>ref|XM_484651.4| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC433128), mRNA
          Length = 879

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || ||  | |||||||| ||||| |||||||||||
Sbjct: 476 aaggctcagctggtggtgattacccatgatgtagaccccattgagctggt 525



to top

>ref|XM_992217.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC633858), mRNA
          Length = 889

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 480 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 529



to top

>gb|AC116421.8| Mus musculus chromosome 9, clone RP24-142L1, complete sequence
          Length = 175142

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                               
Query: 338   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
             |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 64690 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 64641



to top

>ref|XR_003588.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC435442), mRNA
          Length = 889

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 500 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 549



to top

>ref|XR_002452.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (LOC545567), mRNA
          Length = 919

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 491 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 540



to top

>ref|XR_002706.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (LOC619865), mRNA
          Length = 909

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 487 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 536



to top

>ref|XM_909282.2| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC633858), mRNA
          Length = 889

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 480 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 529



to top

>ref|XM_891531.2| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC626683), mRNA
          Length = 889

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 480 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 529



to top

>ref|XR_002439.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC268300), mRNA
          Length = 880

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 470 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 519



to top

>ref|XM_991689.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC672190), mRNA
          Length = 876

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 473 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 522



to top

>ref|XM_987783.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC434426), mRNA
          Length = 958

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 517 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 566



to top

>ref|XM_987455.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC671501), mRNA
          Length = 923

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 502 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 551



to top

>ref|XM_975817.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC674598), mRNA
          Length = 876

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 473 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 522



to top

>ref|XM_887179.2| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3), transcript variant 1
           (LOC622727), mRNA
          Length = 889

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 486 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 535



to top

>ref|XM_906238.2| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3), transcript variant 2
           (LOC622727), mRNA
          Length = 887

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 484 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 533



to top

>ref|XM_486245.4| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC434426), mRNA
          Length = 958

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 517 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 566



to top

>ref|XM_985293.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC666669), mRNA
          Length = 932

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 511 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 560



to top

>ref|XR_003443.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (LOC671487), mRNA
          Length = 802

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 452 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 501



to top

>ref|XM_905543.2| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC243872), mRNA
          Length = 801

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 451 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 500



to top

>ref|XM_620604.3| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC243872), mRNA
          Length = 801

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 451 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 500



to top

>ref|XM_979771.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (LOC670197), mRNA
          Length = 607

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 476 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 525



to top

>ref|XR_003274.1| PREDICTED: Mus musculus similar to Ribosomal protein L7A CG3314-PD,
           isoform D (LOC435775), mRNA
          Length = 795

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || |  |||||||| ||||| |||||||||||
Sbjct: 441 aaggctcagctggtggtgattgaccatgatgtagaccctattgagctggt 490



to top

>ref|XR_002857.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (LOC670202), mRNA
          Length = 904

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || |||||||| ||||| | |||||||||
Sbjct: 562 aaggctcagctggtggtgattgcccatgatgtagaccccactgagctggt 611



to top

>ref|XM_974409.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC669323), mRNA
          Length = 723

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || |||| ||| ||||| |||||||||||
Sbjct: 373 aaggctcagctggtggtgattgcccatggtgtagaccccattgagctggt 422



to top

>ref|XR_004630.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC674259), mRNA
          Length = 834

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || |||||||| ||||| | |||||||||
Sbjct: 492 aaggctcagctggtggtgattgcccatgatgtagaccccactgagctggt 541



to top

>ref|XR_001873.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC666444), mRNA
          Length = 746

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || |||| ||| ||||| |||||||||||
Sbjct: 373 aaggctcagctggtggtgattgcccatggtgtagaccccattgagctggt 422



to top

>ref|XM_143236.6| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC242025), mRNA
          Length = 744

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || |||| ||| ||||| |||||||||||
Sbjct: 373 aaggctcagctggtggtgattgcccatggtgtagaccccattgagctggt 422



to top

>ref|XR_003744.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (LOC672193), mRNA
          Length = 889

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 477 aaggctcagctggtggtgatggcccatgacgtagaccccattgagctggt 526



to top

>gb|AC120548.15| Mus musculus chromosome 17, clone RP23-211H11, complete sequence
          Length = 198829

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                               
Query: 338   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
             |||||||||||||| || ||  | |||||||| ||||| |||||||||||
Sbjct: 38034 aaggctcagctggtggtgattacccatgatgtagaccccattgagctggt 38083



to top

>ref|XM_572378.1| Cryptococcus neoformans var. neoformans JEC21 ribosomal protein L4
           (CNH02040) partial mRNA
          Length = 921

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 67/82 (81%)
 Strand = Plus / Plus

                                                                       
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggctc 397
           ||||||||||| || ||||| ||  | ||||||||||| |||||||| || || |  |||
Sbjct: 466 aaggctcagctcgtcgtcattgccgacgatgttgaccctattgagctcgtcgtcttcctc 525

                                 
Query: 398 ccagccctatgcaggaagatgg 419
           || || || |||||||||||||
Sbjct: 526 cccgctctctgcaggaagatgg 547



to top

>gb|AC083890.4| Mus musculus strain C57BL6/J chromosome 5 clone RP23-284P20, complete
             sequence
          Length = 203967

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                               
Query: 338   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
             |||||||||||||| || |  || |||||||| ||||| |||||||||||
Sbjct: 32862 aaggctcagctggtggtgactgcccatgatgtagaccccattgagctggt 32813



to top

>gb|AC121580.3| Mus musculus BAC clone RP23-255J21 from 9, complete sequence
          Length = 200282

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                                
Query: 338    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
              |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 174065 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 174114



to top

>gb|AC098705.2| Mus musculus BAC clone RP23-1B19 from 3, complete sequence
          Length = 202444

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                               
Query: 338   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
             |||||||||||||| || || || |||||||| ||||| | |||||||||
Sbjct: 93482 aaggctcagctggtggtgattgcccatgatgtagaccccactgagctggt 93433



to top

>gb|AC098724.3| Mus musculus BAC clone RP23-3D14 from 4, complete sequence
          Length = 190437

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                               
Query: 338   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
             |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 19298 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 19347



to top

>gb|BC052339.1| Mus musculus ribosomal protein L7a, mRNA (cDNA clone
           IMAGE:30071790), partial cds
          Length = 880

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 465 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 514



to top

>gb|BC016489.1| Mus musculus ribosomal protein L7a, mRNA (cDNA clone
           IMAGE:3155705), complete cds
          Length = 501

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 93  aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 142



to top

>emb|CR648468.2|CNS0EZBU Tetraodon nigroviridis full-length cDNA
          Length = 829

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgaccc 375
           ||||| ||||||||  |||| |||||||||||||||||
Sbjct: 449 aaggcccagctggtcatcattgctcatgatgttgaccc 486



to top

>gb|AC115910.6| Mus musculus, clone RP24-480O17, complete sequence
          Length = 257036

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                              
Query: 338  aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
            |||||||||||||| || || || |||||||| ||||| ||||| |||||
Sbjct: 1712 aaggctcagctggtagtgattgcccatgatgtagaccccattgaactggt 1761



to top

>gb|AC102675.9| Mus musculus, clone RP23-232O16, complete sequence
          Length = 208734

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                               
Query: 338   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
             |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 25520 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 25471



to top

>gb|AC112406.5| Rattus norvegicus 11 BAC CH230-329D3 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 182245

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                               
Query: 338   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
             |||||||||||||| || || || || ||||| ||||| |||||||||||
Sbjct: 33487 aaggctcagctggtagttattgcccacgatgtagaccccattgagctggt 33536



to top

>gb|BC099389.1| Mus musculus ribosomal protein L7a, mRNA (cDNA clone MGC:117534
           IMAGE:30526878), complete cds
          Length = 880

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 456 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 505



to top

>emb|BX908789.1| Neurospora crassa DNA linkage group VII BAC clone B13D24
          Length = 107482

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 224   gagaggcttctgaagagggcacaggc 249
             ||||||||||||| ||||||||||||
Sbjct: 82500 gagaggcttctgacgagggcacaggc 82525



to top

>gb|AC153153.4| Mus musculus BAC clone RP23-79G18 from chromosome 13, complete sequence
          Length = 222383

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                               
Query: 338   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
             |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 87839 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 87790



to top

>emb|AL606528.7| Mouse DNA sequence from clone RP23-45H23 on chromosome 13 Contains a
             ribosomal protein 7A (Rpl7a) pseudogene and a novel gene
             (2610307P16Rik), complete sequence
          Length = 148066

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                               
Query: 338   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
             |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 36692 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 36741



to top

>dbj|AB246884.1| Lethenteron japonicum RPL7A mRNA for ribosomal protein L7A, partial
           cds
          Length = 710

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           ||||| |||||||| ||||||||||| || || ||||| || ||||||||
Sbjct: 457 aaggcgcagctggtggtcatcgctcacgacgtcgaccccatcgagctggt 506



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                
Query: 105 agcgcctcaaggtgcccccggcgctccaccagttcac 141
           |||||||||||||||| |||||  || ||||||||||
Sbjct: 221 agcgcctcaaggtgcctccggccatcaaccagttcac 257



to top

>gb|AC083913.2| Genomic sequence for Mus musculus, clone RP23-376A14, complete sequence
          Length = 218940

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                                
Query: 338    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
              |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 187820 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 187869



to top

>dbj|AK135447.1| Mus musculus 12 days embryo female mullerian duct includes
           surrounding region cDNA, RIKEN full-length enriched
           library, clone:6820422F17 product:ribosomal protein L7a,
           full insert sequence
          Length = 870

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 478 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 527



to top

>dbj|AK160044.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched
           library, clone:I420045F08 product:ribosomal protein L7a,
           full insert sequence
          Length = 865

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 474 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 523



to top

>dbj|AK160622.1| Mus musculus 11 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2700055M03 product:ribosomal
           protein L7a, full insert sequence
          Length = 866

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 480 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 529



to top

>dbj|AK160621.1| Mus musculus 11 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2700055H02 product:ribosomal
           protein L7a, full insert sequence
          Length = 859

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 473 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 522



to top

>gb|AC162454.3| Mus musculus chromosome 1, clone RP23-7D20, complete sequence
          Length = 209951

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                                
Query: 338    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
              |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 174598 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 174549



to top

>gb|AC119212.15| Mus musculus chromosome 1, clone RP24-192L21, complete sequence
          Length = 174380

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                                
Query: 338    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
              |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 102287 aaggctcagctggtggtgatggcccatgacgtagaccccattgagctggt 102238



to top

>gb|BC089624.1| Mus musculus ribosomal protein L7a, mRNA (cDNA clone MGC:107696
           IMAGE:6763528), complete cds
          Length = 907

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 477 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 526



to top

>gb|AC155934.2| Mus musculus BAC clone RP23-58N8 from chromosome 9, complete sequence
          Length = 198059

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                               
Query: 338   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
             |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 35909 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 35958



to top

>gb|AC156637.2| Mus musculus BAC clone RP24-241I18 from chromosome 12, complete
             sequence
          Length = 156014

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                               
Query: 338   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
             |||||||||||||| || || || |||||||| ||||| ||||| |||||
Sbjct: 31843 aaggctcagctggtagtgattgcccatgatgtagaccccattgaactggt 31892



to top

>dbj|AK081115.1| Mus musculus 10 days neonate cerebellum cDNA, RIKEN full-length
            enriched library, clone:B930089I02
            product:unclassifiable, full insert sequence
          Length = 3858

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                              
Query: 338  aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
            |||||||||||||| || || || |||||||| ||||| ||||| |||||
Sbjct: 2042 aaggctcagctggtagtgattgcccatgatgtagaccccattgaactggt 1993



to top

>gb|AC153869.7| Mus musculus 6 BAC RP23-386A17 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 222826

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                               
Query: 338   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
             |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 41989 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 42038



to top

>dbj|AK019449.1| Mus musculus 14, 17 days embryo head cDNA, RIKEN full-length
           enriched library, clone:3230401N15 product:ribosomal
           protein L7a, full insert sequence
          Length = 867

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 475 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 524



to top

>gb|AC153952.4| Mus musculus 10 BAC RP24-82M14 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 183398

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                               
Query: 338   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
             |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 81103 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 81152



to top

>dbj|AK030194.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
            library, clone:4933415M11 product:ribosomal protein L7a,
            full insert sequence
          Length = 1977

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                              
Query: 338  aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
            |||||||||||||| || || |  |||||||| ||||| |||||||||||
Sbjct: 1522 aaggctcagctggtggtgattgaccatgatgtagaccccattgagctggt 1571



to top

>dbj|AK014551.1| Mus musculus 0 day neonate skin cDNA, RIKEN full-length enriched
            library, clone:4632404N19 product:unclassifiable, full
            insert sequence
          Length = 3701

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                              
Query: 338  aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
            |||||||||||||| || || || |||||||| ||||| | |||||||||
Sbjct: 1617 aaggctcagctggtggtgattgcccatgatgtagaccccactgagctggt 1568



to top

>gb|AY967504.1| Schmidtea mediterranea clone HE.3.01B mRNA sequence
          Length = 850

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 348 tggttgtcatcgctcatgatgttgacccaattga 381
           ||||||| || ||||||||||||||||| |||||
Sbjct: 388 tggttgtgattgctcatgatgttgaccctattga 355



to top

>gb|AC130530.4| Mus musculus BAC clone RP23-153P2 from chromosome 7, complete sequence
          Length = 202012

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                                
Query: 338    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
              |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 174042 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 173993



to top

>gb|AY130406.1| Branchiostoma lanceolatum ribosomal protein L7A-like mRNA, partial
           sequence
          Length = 715

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 338 aaggctcagctggttgtcatcgctcatgat 367
           ||||| |||||||| |||||||||||||||
Sbjct: 419 aaggcacagctggtggtcatcgctcatgat 448



to top

>ref|XM_221603.3| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L7a
           (LOC304035), mRNA
          Length = 879

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || |||||||| ||||| ||||| |||||
Sbjct: 486 aaggctcagctggtggtgattgcccatgatgtagaccccattgaactggt 535



to top

>ref|XM_580204.1| PREDICTED: Rattus norvegicus LOC501505 (LOC501505), mRNA
          Length = 927

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || ||||||||  |||| |||||||||||
Sbjct: 414 aaggctcagctggtggtgattgcccatgatgtaaaccccattgagctggt 365



to top

>ref|XM_221473.3| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L7a
           (LOC498078), mRNA
          Length = 868

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||  || || || |||||||| ||||| |||||||||||
Sbjct: 461 aaggctcagctggcggtgattgcccatgatgtagaccccattgagctggt 510



to top

>ref|XM_576256.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L7a
           (LOC500859), mRNA
          Length = 886

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||  || || || |||||||| ||||| |||||||||||
Sbjct: 479 aaggctcagctggcggtgattgcccatgatgtagaccccattgagctggt 528



to top

>ref|XM_578581.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L7a
           (LOC366702), mRNA
          Length = 801

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || |||||||  ||||| |||||||||||
Sbjct: 451 aaggctcagctggtggtgattgcccatgatgcagaccccattgagctggt 500



to top

>ref|XM_576046.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L7a
           (LOC500669), mRNA
          Length = 622

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || |||||||| ||||| || ||||||||
Sbjct: 232 aaggctcagctggtggtgattgcccatgatgtagaccccatagagctggt 281



to top

>ref|XM_574700.1| PREDICTED: Rattus norvegicus similar to Rpl7a protein (LOC499382),
           mRNA
          Length = 907

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || | |||||| ||||| |||||||||||
Sbjct: 517 aaggctcagctggtggtgattgcccgtgatgtagaccccattgagctggt 566



to top

>ref|NM_001013830.1| Mus musculus similar to 60S ribosomal protein L7a (Surfeit locus
            protein 3) (PLA-X polypeptide) (LOC436332), mRNA
          Length = 1977

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                              
Query: 338  aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
            |||||||||||||| || || |  |||||||| ||||| |||||||||||
Sbjct: 1522 aaggctcagctggtggtgattgaccatgatgtagaccccattgagctggt 1571



to top

>gb|BC091731.1| Mus musculus ribosomal protein L7a, mRNA (cDNA clone MGC:102480
           IMAGE:2655142), complete cds
          Length = 872

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 456 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 505



to top

>gb|BC091769.1| Mus musculus ribosomal protein L7a, mRNA (cDNA clone MGC:102481
           IMAGE:4158894), complete cds
          Length = 868

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 461 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 510



to top

>gb|BC080712.1| Mus musculus ribosomal protein L7a, mRNA (cDNA clone MGC:91049
           IMAGE:4457484), complete cds
          Length = 865

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 456 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 505



to top

>gb|BC080669.1| Mus musculus ribosomal protein L7a, mRNA (cDNA clone MGC:91051
           IMAGE:5060194), complete cds
          Length = 869

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 461 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 510



to top

>gb|BC080663.1| Mus musculus ribosomal protein L7a, mRNA (cDNA clone MGC:91050
           IMAGE:4487611), complete cds
          Length = 870

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 461 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 510



to top

>gb|AC154477.2| Mus musculus BAC clone RP24-134B24 from 14, complete sequence
          Length = 167259

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                               
Query: 338   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
             |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 40213 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 40262



to top

>gb|AC133581.22| Mus musculus chromosome 1, clone RP24-395P3, complete sequence
          Length = 158696

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                               
Query: 338   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
             |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 64062 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 64111



to top

>gb|AC153627.2| Mus musculus 6 BAC RP23-104H13 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 198060

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                               
Query: 338   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
             |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 38874 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 38825



to top

>gb|AC153621.5| Mus musculus 6 BAC RP23-272K20 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 215547

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                               
Query: 338   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
             |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 22443 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 22492



to top

>emb|AJ871581.1| Streptomyces achromogenes subsp. rubradiris complete rubradirin gene
             cluster, strain NRRL 3061
          Length = 105657

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 98    ctcaagcagcgcctcaaggtgc 119
             ||||||||||||||||||||||
Sbjct: 59311 ctcaagcagcgcctcaaggtgc 59290



to top

>gb|AC139040.8| Mus musculus chromosome 19, clone RP23-292H20, complete sequence
          Length = 206197

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                                
Query: 338    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
              |||||||||||||| || || || |||| ||| ||||| |||||||||||
Sbjct: 199911 aaggctcagctggtggtgattgcccatgttgtagaccccattgagctggt 199862



to top

>emb|AL671935.30| Mouse DNA sequence from clone RP23-421J13 on chromosome X, complete
              sequence
          Length = 194258

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                                
Query: 338    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
              |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 113977 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 114026



to top

>gb|AC154649.3| Mus musculus BAC clone RP23-156O5 from chromosome 14, complete sequence
          Length = 227676

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                                
Query: 338    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
              |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 144437 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 144486



to top

>gb|AC123825.5| Mus musculus BAC clone RP24-93F18 from 8, complete sequence
          Length = 236875

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                          
Query: 342  ctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
            |||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 4882 ctcagctggtggtgattgcccatgatgtagaccccattgagctggt 4837



to top

>gb|BC029992.1| Mus musculus ribosomal protein L7a, mRNA (cDNA clone IMAGE:3482983)
          Length = 868

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 461 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 510



to top

>gb|AC132438.3| Mus musculus BAC clone RP23-234G15 from 3, complete sequence
          Length = 180660

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                               
Query: 338   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
             |||||||||||||| || || || |||| ||| ||||| |||||||||||
Sbjct: 20849 aaggctcagctggtggtgattgcccatggtgtagaccccattgagctggt 20898



to top

>gb|AC112266.6| Mus musculus BAC clone RP23-422B6 from 13, complete sequence
          Length = 190943

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                               
Query: 338   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
             |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 32246 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 32197



to top

>gb|AC139575.3| Mus musculus BAC clone RP23-430K5 from 8, complete sequence
          Length = 192317

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                            
Query: 342    ctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
              |||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 115231 ctcagctggtggtgattgcccatgatgtagaccccattgagctggt 115186



to top

>ref|NG_005356.1| Mus musculus ribosomal protein L7a pseudogene (LOC641660) on
           chromosome X
          Length = 1067

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 575 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 624



to top

>emb|AL831733.4| Mouse DNA sequence from clone RP23-109O11 on chromosome 4, complete
              sequence
          Length = 196863

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                                
Query: 338    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
              |||||||||||||| || || |  |||||||| ||||| |||||||||||
Sbjct: 150185 aaggctcagctggtggtgattgaccatgatgtagaccctattgagctggt 150234



to top

>emb|AL732328.12| Mouse DNA sequence from clone RP23-106P4 on chromosome 2, complete
              sequence
          Length = 177649

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                                
Query: 338    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
              |||||||||||||| || || || |||||||| ||||| | |||||||||
Sbjct: 108984 aaggctcagctggtggtgattgcccatgatgtagaccccaatgagctggt 108935



to top

>emb|AL670660.8| Mouse DNA sequence from clone RP23-265D6 on chromosome X, complete
             sequence
          Length = 181805

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                               
Query: 338   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
             |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 34672 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 34623



to top

>emb|AL606915.12| Mouse DNA sequence from clone RP23-185C16 on chromosome 4, complete
              sequence
          Length = 182248

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                                
Query: 338    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
              |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 134642 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 134691



to top

>gb|AY067190.1| Schmidtea mediterranea clone H.16.9f unknown mRNA sequence
          Length = 669

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 348 tggttgtcatcgctcatgatgttgacccaattga 381
           ||||||| || ||||||||||||||||| |||||
Sbjct: 388 tggttgtgattgctcatgatgttgaccctattga 355



to top

>gb|M20743.1|MUSSURFC Mouse surfeit locus (Surf-3) processed pseudogene 2
          Length = 1200

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 571 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 620



to top

>gb|M20741.1|MUSSURFB Mouse surfeit locus (Surf-3) processed pseudogene 1
          Length = 1024

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 387
           |||||||||||||| || |  || |||||||| ||||| |||||||||||
Sbjct: 596 aaggctcagctggtggtgactgcccatgatgtagaccccattgagctggt 645



to top

>ref|NM_023091.1| Rattus norvegicus gamma-aminobutyric acid A receptor, epsilon
           (Gabre), mRNA
          Length = 3000

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 241 ggcacaggctgaggctgaggg 261
           |||||||||||||||||||||
Sbjct: 157 ggcacaggctgaggctgaggg 137



to top

>ref|NM_017369.1| Mus musculus gamma-aminobutyric acid (GABA-A) receptor, subunit
           epsilon (Gabre), mRNA
          Length = 2779

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 241 ggcacaggctgaggctgaggg 261
           |||||||||||||||||||||
Sbjct: 157 ggcacaggctgaggctgaggg 137



to top

>gb|AF131866.2| Mus musculus chromosome X clone CT7-271B7 map qA7.1, complete sequence
          Length = 110310

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 241   ggcacaggctgaggctgaggg 261
             |||||||||||||||||||||
Sbjct: 18446 ggcacaggctgaggctgaggg 18466



to top

>gb|AC124212.2| Mus musculus chromosome X clone CT7-532E7 map qA7.1, complete sequence
          Length = 109783

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 241    ggcacaggctgaggctgaggg 261
              |||||||||||||||||||||
Sbjct: 102407 ggcacaggctgaggctgaggg 102427



to top

>ref|XM_535657.2| PREDICTED: Canis familiaris similar to 60S ribosomal protein L7a
           (LOC478479), mRNA
          Length = 574

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 338 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgt 390
           |||||||||||||| || || || |||||||| || || | ||||||||||||
Sbjct: 175 aaggctcagctggtagtgatagcccatgatgtggatcccactgagctggttgt 227



to top

>gb|AC117241.4| Mus musculus BAC clone RP24-147H15 from chromosome 17, complete
             sequence
          Length = 191713

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 230   cttctgaagagggcacaggct 250
             |||||||||||||||||||||
Sbjct: 31695 cttctgaagagggcacaggct 31715



to top

>gb|AC147798.30| Mus musculus strain C57BL/6J chromosome 17 clone rp24-129d12, complete
             sequence
          Length = 168127

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 230   cttctgaagagggcacaggct 250
             |||||||||||||||||||||
Sbjct: 88255 cttctgaagagggcacaggct 88235



to top

>dbj|AB226265.1| Aspergillus oryzae cDNA, contig sequence: AoEST3124
          Length = 1440

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                
Query: 354 tcatcgctcatgatgttgacccaattgagctggttgt 390
           ||||||| || || |||||||| ||||||||||||||
Sbjct: 788 tcatcgcccacgacgttgaccccattgagctggttgt 824


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,699,864
Number of Sequences: 3902068
Number of extensions: 3699864
Number of successful extensions: 78250
Number of sequences better than 10.0: 328
Number of HSP's better than 10.0 without gapping: 329
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 76873
Number of HSP's gapped (non-prelim): 1367
length of query: 482
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 460
effective length of database: 17,147,199,772
effective search space: 7887711895120
effective search space used: 7887711895120
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top