| Clone Name | bags21l17 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_472371.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1614 Score = 208 bits (105), Expect = 1e-50 Identities = 290/352 (82%) Strand = Plus / Plus Query: 6 tttgacancattctaattgctgatgatgagaaggtagccatgtctatcttggagaagaca 65 ||||||| |||| | || ||||||||||||||||| |||| |||||| |||||||| | Sbjct: 1129 tttgacaacattttgatcgctgatgatgagaaggttgccacttctatcctggagaagtct 1188 Query: 66 tggaagcctaagtttgttgttgagaaggaaaagcagaaggctgaggaggctgcagcagcc 125 |||||||| |||| | || |||||||| ||| |||||||||||||||| ||||| || Sbjct: 1189 tggaagcccaagtacgaagtagagaaggagaaggagaaggctgaggaggcagcagcggca 1248 Query: 126 gagtcagaggacctttctgagttccagaagaagatcttcagcgttttgtacaaaatcgcc 185 | || | |||||||||||||||||||||||||| |||| |||||||| |||| Sbjct: 1249 gcaggtgatggtctttctgagttccagaagaagatctttgacgttctgtacaaactcgct 1308 Query: 186 gacattccgttcttggaaccatacaagatcaagatcattgatttaattgagaagggagag 245 |||||||| ||||||||||| ||||||| |||||||||||| ||||||||||||||||| Sbjct: 1309 gacattccattcttggaaccctacaagactaagatcattgatgtaattgagaagggagag 1368 Query: 246 aagcagcccaacattacaatttcgattttggcctcagttgctgtcatccttgttactgtg 305 |||||||||||||| || ||| ||| ||| ||| | | |||| || |||| |||||| Sbjct: 1369 aagcagcccaacatcaccattggaattctggtctccatcgttgtcgtctttgtgactgtg 1428 Query: 306 ctcttcagaaccattttcggtggcaagaaggcagtggcacctgtgaagcccg 357 |||||||| | | | ||||| ||||||||| ||| ||| ||||||||||||| Sbjct: 1429 ctcttcaggatcctgttcggcggcaagaagccagcggctcctgtgaagcccg 1480 Score = 40.1 bits (20), Expect = 6.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 402 ggaagcagcggtgacaaggaggac 425 ||||||||||||| |||||||||| Sbjct: 1525 ggaagcagcggtggcaaggaggac 1548
>dbj|AK069118.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023008D14, full insert sequence Length = 2059 Score = 208 bits (105), Expect = 1e-50 Identities = 290/352 (82%) Strand = Plus / Plus Query: 6 tttgacancattctaattgctgatgatgagaaggtagccatgtctatcttggagaagaca 65 ||||||| |||| | || ||||||||||||||||| |||| |||||| |||||||| | Sbjct: 1235 tttgacaacattttgatcgctgatgatgagaaggttgccacttctatcctggagaagtct 1294 Query: 66 tggaagcctaagtttgttgttgagaaggaaaagcagaaggctgaggaggctgcagcagcc 125 |||||||| |||| | || |||||||| ||| |||||||||||||||| ||||| || Sbjct: 1295 tggaagcccaagtacgaagtagagaaggagaaggagaaggctgaggaggcagcagcggca 1354 Query: 126 gagtcagaggacctttctgagttccagaagaagatcttcagcgttttgtacaaaatcgcc 185 | || | |||||||||||||||||||||||||| |||| |||||||| |||| Sbjct: 1355 gcaggtgatggtctttctgagttccagaagaagatctttgacgttctgtacaaactcgct 1414 Query: 186 gacattccgttcttggaaccatacaagatcaagatcattgatttaattgagaagggagag 245 |||||||| ||||||||||| ||||||| |||||||||||| ||||||||||||||||| Sbjct: 1415 gacattccattcttggaaccctacaagactaagatcattgatgtaattgagaagggagag 1474 Query: 246 aagcagcccaacattacaatttcgattttggcctcagttgctgtcatccttgttactgtg 305 |||||||||||||| || ||| ||| ||| ||| | | |||| || |||| |||||| Sbjct: 1475 aagcagcccaacatcaccattggaattctggtctccatcgttgtcgtctttgtgactgtg 1534 Query: 306 ctcttcagaaccattttcggtggcaagaaggcagtggcacctgtgaagcccg 357 |||||||| | | | ||||| ||||||||| ||| ||| ||||||||||||| Sbjct: 1535 ctcttcaggatcctgttcggcggcaagaagccagcggctcctgtgaagcccg 1586 Score = 40.1 bits (20), Expect = 6.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 402 ggaagcagcggtgacaaggaggac 425 ||||||||||||| |||||||||| Sbjct: 1631 ggaagcagcggtggcaaggaggac 1654
>dbj|AK061185.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-209-E03, full insert sequence Length = 945 Score = 208 bits (105), Expect = 1e-50 Identities = 290/352 (82%) Strand = Plus / Plus Query: 6 tttgacancattctaattgctgatgatgagaaggtagccatgtctatcttggagaagaca 65 ||||||| |||| | || ||||||||||||||||| |||| |||||| |||||||| | Sbjct: 121 tttgacaacattttgatcgctgatgatgagaaggttgccacttctatcctggagaagtct 180 Query: 66 tggaagcctaagtttgttgttgagaaggaaaagcagaaggctgaggaggctgcagcagcc 125 |||||||| |||| | || |||||||| ||| |||||||||||||||| ||||| || Sbjct: 181 tggaagcccaagtacgaagtagagaaggagaaggagaaggctgaggaggcagcagcggca 240 Query: 126 gagtcagaggacctttctgagttccagaagaagatcttcagcgttttgtacaaaatcgcc 185 | || | |||||||||||||||||||||||||| |||| |||||||| |||| Sbjct: 241 gcaggtgatggtctttctgagttccagaagaagatctttgacgttctgtacaaactcgct 300 Query: 186 gacattccgttcttggaaccatacaagatcaagatcattgatttaattgagaagggagag 245 |||||||| ||||||||||| ||||||| |||||||||||| ||||||||||||||||| Sbjct: 301 gacattccattcttggaaccctacaagactaagatcattgatgtaattgagaagggagag 360 Query: 246 aagcagcccaacattacaatttcgattttggcctcagttgctgtcatccttgttactgtg 305 |||||||||||||| || ||| ||| ||| ||| | | |||| || |||| |||||| Sbjct: 361 aagcagcccaacatcaccattggaattctggtctccatcgttgtcgtctttgtgactgtg 420 Query: 306 ctcttcagaaccattttcggtggcaagaaggcagtggcacctgtgaagcccg 357 |||||||| | | | ||||| ||||||||| ||| ||| ||||||||||||| Sbjct: 421 ctcttcaggatcctgttcggcggcaagaagccagcggctcctgtgaagcccg 472 Score = 40.1 bits (20), Expect = 6.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 402 ggaagcagcggtgacaaggaggac 425 ||||||||||||| |||||||||| Sbjct: 517 ggaagcagcggtggcaaggaggac 540
>emb|X77569.1|ZMCNXRNA Z.mays CNX mRNA Length = 1559 Score = 161 bits (81), Expect = 3e-36 Identities = 200/239 (83%), Gaps = 3/239 (1%) Strand = Plus / Plus Query: 21 attgctgatgatgagaaggtagccatgtctatcttggagaagacatggaagcctaagttt 80 ||||||||||||||||| || |||| || || ||||||||||||||||||| |||| | Sbjct: 824 attgctgatgatgagaaagttgccacctccattctggagaagacatggaagcccaagtat 883 Query: 81 gttgttgagaaggaaaagcagaaggctgaggaggctgcagcagccgagtcagaggacctt 140 | |||||||||||||||| ||||||||||||||||||| || | | |||| | ||| Sbjct: 884 gatgttgagaaggaaaaggagaaggctgaggaggctgctgctggtg---cagatggtctt 940 Query: 141 tctgagttccagaagaagatcttcagcgttttgtacaaaatcgccgacattccgttcttg 200 ||||| |||||||||||||| || ||| ||||||| || || || |||||||||||| Sbjct: 941 tctgacttccagaagaagatttttgacgtcctgtacaagattgctgatattccgttcttg 1000 Query: 201 gaaccatacaagatcaagatcattgatttaattgagaagggagagaagcagcccaacat 259 | ||| ||||||| |||||| |||||| | || |||||||||||||||||||||||||| Sbjct: 1001 gcaccctacaagaccaagattattgatgttatcgagaagggagagaagcagcccaacat 1059 Score = 50.1 bits (25), Expect = 0.007 Identities = 37/41 (90%) Strand = Plus / Plus Query: 402 ggaagcagcggtgacaaggaggacaaggaggatgaaaagga 442 |||||||| ||||||||||| || || |||||||||||||| Sbjct: 1207 ggaagcagtggtgacaaggatgagaaagaggatgaaaagga 1247
>gb|AY112482.1| Zea mays CL2224_1 mRNA sequence Length = 1661 Score = 83.8 bits (42), Expect = 5e-13 Identities = 63/70 (90%) Strand = Plus / Plus Query: 190 ttccgttcttggaaccatacaagatcaagatcattgatttaattgagaagggagagaagc 249 |||||||||||| ||| ||||| | ||||||||||||| | || |||||||||||||||| Sbjct: 993 ttccgttcttggcaccctacaaaaccaagatcattgatgttatcgagaagggagagaagc 1052 Query: 250 agcccaacat 259 |||||||||| Sbjct: 1053 agcccaacat 1062
>emb|AL606610.3|OSJN00045 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0012E08, complete sequence Length = 106975 Score = 81.8 bits (41), Expect = 2e-12 Identities = 97/116 (83%) Strand = Plus / Minus Query: 6 tttgacancattctaattgctgatgatgagaaggtagccatgtctatcttggagaagaca 65 ||||||| |||| | || ||||||||||||||||| |||| |||||| |||||||| | Sbjct: 77818 tttgacaacattttgatcgctgatgatgagaaggttgccacttctatcctggagaagtct 77759 Query: 66 tggaagcctaagtttgttgttgagaaggaaaagcagaaggctgaggaggctgcagc 121 |||||||| |||| | || |||||||| ||| |||||||||||||||| ||||| Sbjct: 77758 tggaagcccaagtacgaagtagagaaggagaaggagaaggctgaggaggcagcagc 77703 Score = 71.9 bits (36), Expect = 2e-09 Identities = 66/76 (86%) Strand = Plus / Minus Query: 150 cagaagaagatcttcagcgttttgtacaaaatcgccgacattccgttcttggaaccatac 209 |||||||||||||| |||| |||||||| |||| |||||||| ||||||||||| ||| Sbjct: 77563 cagaagaagatctttgacgttctgtacaaactcgctgacattccattcttggaaccctac 77504 Query: 210 aagatcaagatcattg 225 |||| |||||||||| Sbjct: 77503 aagactaagatcattg 77488 Score = 61.9 bits (31), Expect = 2e-06 Identities = 31/31 (100%) Strand = Plus / Minus Query: 229 taattgagaagggagagaagcagcccaacat 259 ||||||||||||||||||||||||||||||| Sbjct: 77368 taattgagaagggagagaagcagcccaacat 77338 Score = 40.1 bits (20), Expect = 6.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 402 ggaagcagcggtgacaaggaggac 425 ||||||||||||| |||||||||| Sbjct: 77105 ggaagcagcggtggcaaggaggac 77082
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 81.8 bits (41), Expect = 2e-12 Identities = 97/116 (83%) Strand = Plus / Minus Query: 6 tttgacancattctaattgctgatgatgagaaggtagccatgtctatcttggagaagaca 65 ||||||| |||| | || ||||||||||||||||| |||| |||||| |||||||| | Sbjct: 19923010 tttgacaacattttgatcgctgatgatgagaaggttgccacttctatcctggagaagtct 19922951 Query: 66 tggaagcctaagtttgttgttgagaaggaaaagcagaaggctgaggaggctgcagc 121 |||||||| |||| | || |||||||| ||| |||||||||||||||| ||||| Sbjct: 19922950 tggaagcccaagtacgaagtagagaaggagaaggagaaggctgaggaggcagcagc 19922895 Score = 71.9 bits (36), Expect = 2e-09 Identities = 66/76 (86%) Strand = Plus / Minus Query: 150 cagaagaagatcttcagcgttttgtacaaaatcgccgacattccgttcttggaaccatac 209 |||||||||||||| |||| |||||||| |||| |||||||| ||||||||||| ||| Sbjct: 19922755 cagaagaagatctttgacgttctgtacaaactcgctgacattccattcttggaaccctac 19922696 Query: 210 aagatcaagatcattg 225 |||| |||||||||| Sbjct: 19922695 aagactaagatcattg 19922680 Score = 61.9 bits (31), Expect = 2e-06 Identities = 31/31 (100%) Strand = Plus / Minus Query: 229 taattgagaagggagagaagcagcccaacat 259 ||||||||||||||||||||||||||||||| Sbjct: 19922560 taattgagaagggagagaagcagcccaacat 19922530 Score = 40.1 bits (20), Expect = 6.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 402 ggaagcagcggtgacaaggaggac 425 ||||||||||||| |||||||||| Sbjct: 19922297 ggaagcagcggtggcaaggaggac 19922274
>gb|AC139708.15| Medicago truncatula clone mth2-9f16, complete sequence Length = 117358 Score = 54.0 bits (27), Expect = 4e-04 Identities = 45/51 (88%) Strand = Plus / Plus Query: 85 ttgagaaggaaaagcagaaggctgaggaggctgcagcagccgagtcagagg 135 ||||||| || |||||||||||||| |||| |||||||| |||||||||| Sbjct: 90947 ttgagaaagagaagcagaaggctgaagaggaggcagcagctgagtcagagg 90997
>gb|AC117567.12| Mus musculus chromosome 16, clone RP24-380O24, complete sequence Length = 195972 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Plus Query: 414 gacaaggaggacaaggaggatga 436 ||||||||||||||||||||||| Sbjct: 100308 gacaaggaggacaaggaggatga 100330
>emb|AL355388.30| Human DNA sequence from clone RP11-336K24 on chromosome 1 Contains the 5' end of the RIT1 gene for Ras-like without CAAX 1, the gene for a novel protein (KIAA0907), the ARHGEF2 gene for rho/rac guanine nucleotide exchange factor (GEF) 2, four novel genes, the SSR2 gene for signal sequence receptor beta (translocon-associated protein beta), the C1orf6 gene for chromosome 1 open reading frame 6, the gene for mitogen-activated protein-binding protein-interacting protein (MAPBPIP), the RAB25 gene for RAB25 (member RAS oncogene family), the 5' end of the LMNA gene for lamin A/C and three CpG islands, complete sequence Length = 205463 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Plus Query: 414 gacaaggaggacaaggaggatga 436 ||||||||||||||||||||||| Sbjct: 126597 gacaaggaggacaaggaggatga 126619
>emb|BX021091.1|CNS08OFR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA31BA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 358 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 203 accatacaagatcaagatcattg 225 ||||||||||||||||||||||| Sbjct: 61 accatacaagatcaagatcattg 39
>gb|AC159411.1| Trypanosoma brucei chromosome 3 clone RPCI93-1J15, complete sequence Length = 157158 Score = 44.1 bits (22), Expect = 0.41 Identities = 31/34 (91%) Strand = Plus / Minus Query: 85 ttgagaaggaaaagcagaaggctgaggaggctgc 118 ||||||||| |||| ||| ||||||||||||||| Sbjct: 75916 ttgagaaggcaaagaagatggctgaggaggctgc 75883
>gb|CP000066.1| Trypanosoma brucei chromosome 3, complete sequence Length = 1653225 Score = 44.1 bits (22), Expect = 0.41 Identities = 31/34 (91%) Strand = Plus / Plus Query: 85 ttgagaaggaaaagcagaaggctgaggaggctgc 118 ||||||||| |||| ||| ||||||||||||||| Sbjct: 345960 ttgagaaggcaaagaagatggctgaggaggctgc 345993
>gb|AC145376.3| Pan troglodytes BAC clone RP43-59A12 from 7, complete sequence Length = 221727 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 27 gatgatgagaaggtagccatgt 48 |||||||||||||||||||||| Sbjct: 30103 gatgatgagaaggtagccatgt 30082
>ref|XM_818675.1| Trypanosoma brucei TREU927 clone RPCI93-1J15 ATP synthase subunit beta precursor (Tb927.3.1380) partial mRNA Length = 1560 Score = 44.1 bits (22), Expect = 0.41 Identities = 31/34 (91%) Strand = Plus / Plus Query: 85 ttgagaaggaaaagcagaaggctgaggaggctgc 118 ||||||||| |||| ||| ||||||||||||||| Sbjct: 1478 ttgagaaggcaaagaagatggctgaggaggctgc 1511
>gb|AC142305.1| Pan troglodytes BAC clone RP43-130P22 from 7, complete sequence Length = 173535 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 27 gatgatgagaaggtagccatgt 48 |||||||||||||||||||||| Sbjct: 149924 gatgatgagaaggtagccatgt 149903
>gb|AY007706.1| Trypanosoma brucei brucei ATPase beta subunit mRNA, complete cds; nuclear gene for kinetoplast product Length = 1557 Score = 44.1 bits (22), Expect = 0.41 Identities = 31/34 (91%) Strand = Plus / Plus Query: 85 ttgagaaggaaaagcagaaggctgaggaggctgc 118 ||||||||| |||| ||| ||||||||||||||| Sbjct: 1475 ttgagaaggcaaagaagatggctgaggaggctgc 1508
>gb|AC009401.3|AC009401 Homo sapiens PAC clone RP4-603O16 from 7q31-q35, complete sequence Length = 122079 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 27 gatgatgagaaggtagccatgt 48 |||||||||||||||||||||| Sbjct: 34725 gatgatgagaaggtagccatgt 34746
>gb|AC078842.2|AC078842 Homo sapiens chromosome 7 clone RP11-102G17, complete sequence Length = 173844 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 27 gatgatgagaaggtagccatgt 48 |||||||||||||||||||||| Sbjct: 150198 gatgatgagaaggtagccatgt 150177
>emb|AL121821.7|CNS01DSN Human chromosome 14 DNA sequence BAC C-2298J14 of library CalTech-D from chromosome 14 of Homo sapiens (Human), complete sequence Length = 127539 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 414 gacaaggaggacaaggaggatg 435 |||||||||||||||||||||| Sbjct: 35074 gacaaggaggacaaggaggatg 35095
>gb|AY821658.1| Diaprepes abbreviatus putative IDGF mRNA, complete cds Length = 1403 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 cgacattccgttcttggaacc 205 ||||||||||||||||||||| Sbjct: 158 cgacattccgttcttggaacc 178
>gb|AC160118.2| Mus musculus BAC clone RP23-440L7 from chromosome 9, complete sequence Length = 198672 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 103 aggctgaggaggctgcagcag 123 ||||||||||||||||||||| Sbjct: 4842 aggctgaggaggctgcagcag 4822
>gb|AC114674.10| Mus musculus chromosome 9, clone RP24-209N21, complete sequence Length = 203120 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 103 aggctgaggaggctgcagcag 123 ||||||||||||||||||||| Sbjct: 149375 aggctgaggaggctgcagcag 149355
>gb|AC140354.2| Mus musculus BAC clone RP24-249A13 from chromosome 12, complete sequence Length = 157998 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 416 caaggaggacaaggaggatga 436 ||||||||||||||||||||| Sbjct: 114810 caaggaggacaaggaggatga 114830
>gb|AC110376.4| Mus musculus chromosome 12 clone RP23-441E7, complete sequence Length = 190516 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 416 caaggaggacaaggaggatga 436 ||||||||||||||||||||| Sbjct: 58013 caaggaggacaaggaggatga 58033
>gb|DQ160064.1| Taraxacum officinale TO49-2 (To49-2) mRNA, partial cds Length = 416 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 56 ggagaagacatggaagcctaagttt 80 ||||| ||||||||||||||||||| Sbjct: 391 ggagacgacatggaagcctaagttt 415
>gb|AC122015.3| Mus musculus BAC clone RP24-358M18 from chromosome 6, complete sequence Length = 166966 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Plus Query: 414 gacaaggaggacaaggaggatgaaaagga 442 ||||||||||| |||||||| |||||||| Sbjct: 159125 gacaaggaggaaaaggaggaggaaaagga 159153
>gb|AC092532.17| Papio anubis clone rp41-110d13, complete sequence Length = 157944 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 106 ctgaggaggctgcagcagccg 126 ||||||||||||||||||||| Sbjct: 113361 ctgaggaggctgcagcagccg 113341
>gb|AC006549.28| Homo sapiens chromosome 22 clone p215k21 map 22q11, complete sequence Length = 174840 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 106 ctgaggaggctgcagcagccg 126 ||||||||||||||||||||| Sbjct: 152035 ctgaggaggctgcagcagccg 152055
>gb|AC058790.14| Homo sapiens chromosome 22 clone b518b9 map 22q11, complete sequence Length = 184929 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 106 ctgaggaggctgcagcagccg 126 ||||||||||||||||||||| Sbjct: 132155 ctgaggaggctgcagcagccg 132175
>gb|AC007663.29| Homo sapiens chromosome 22 clone b444p24 map 22q11, complete sequence Length = 168239 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 106 ctgaggaggctgcagcagccg 126 ||||||||||||||||||||| Sbjct: 120281 ctgaggaggctgcagcagccg 120301
>gb|AC012181.8| Homo sapiens chromosome 16 clone RP11-325K4, complete sequence Length = 189712 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 233 tgagaagggagagaagcagcc 253 ||||||||||||||||||||| Sbjct: 120892 tgagaagggagagaagcagcc 120872
>gb|AC169088.2| Gallus gallus BAC clone CH261-100B3 from chromosome ul, complete sequence Length = 214859 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 126 gagtcagaggacctttctgag 146 ||||||||||||||||||||| Sbjct: 18128 gagtcagaggacctttctgag 18108
>gb|AC138721.4| Mus musculus BAC clone RP23-157G22 from 6, complete sequence Length = 187385 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Plus Query: 414 gacaaggaggacaaggaggatgaaaagga 442 ||||||||||| |||||||| |||||||| Sbjct: 111679 gacaaggaggaaaaggaggaggaaaagga 111707
>emb|AL953839.10| Mouse DNA sequence from clone RP23-325L22 on chromosome 4, complete sequence Length = 80682 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Plus Query: 414 gacaaggaggacaaggaggatgaaaagga 442 |||||||||||||||||||| || ||||| Sbjct: 67990 gacaaggaggacaaggaggaggagaagga 68018
>gb|AC160982.5| Mus musculus BAC clone RP23-351J19 from chromosome 12, complete sequence Length = 231693 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 414 gacaaggaggacaaggagga 433 |||||||||||||||||||| Sbjct: 121124 gacaaggaggacaaggagga 121143
>ref|NM_004565.1| Homo sapiens peroxisomal biogenesis factor 14 (PEX14), mRNA Length = 1908 Score = 40.1 bits (20), Expect = 6.4 Identities = 29/32 (90%) Strand = Plus / Plus Query: 414 gacaaggaggacaaggaggatgaaaaggatga 445 |||||||||||| |||||||||| ||||||| Sbjct: 969 gacaaggaggacgaggaggatgaggaggatga 1000
>gb|AC108852.9| Mus musculus chromosome 3, clone RP24-87H3, complete sequence Length = 220174 Score = 40.1 bits (20), Expect = 6.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 419 ggaggacaaggaggatgaaaagga 442 ||||||||||||||||||| |||| Sbjct: 76016 ggaggacaaggaggatgaagagga 76039
>gb|AC100381.9| Mus musculus chromosome 3, clone RP23-132C6, complete sequence Length = 190741 Score = 40.1 bits (20), Expect = 6.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 419 ggaggacaaggaggatgaaaagga 442 ||||||||||||||||||| |||| Sbjct: 141657 ggaggacaaggaggatgaagagga 141680
>ref|XM_599068.2| PREDICTED: Bos taurus similar to Killer cell immunoglobulin-like receptor 2DS4 precursor (MHC class I NK cell receptor) (Natural killer associated transcript 8) (NKAT-8) (P58 natural killer cell receptor clone CL-39) (p58 NK receptor) (CL-17) (LOC520818), partial mRNA Length = 510 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 414 gacaaggaggacaaggagga 433 |||||||||||||||||||| Sbjct: 27 gacaaggaggacaaggagga 8
>gb|BC010324.1| Mus musculus immunoglobulin heavy chain (J558 family), mRNA (cDNA clone MGC:6526 IMAGE:2651406), complete cds Length = 1673 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 414 gacaaggaggacaaggagga 433 |||||||||||||||||||| Sbjct: 813 gacaaggaggacaaggagga 794
>gb|BC004786.1| Mus musculus immunoglobulin heavy chain (J558 family), mRNA (cDNA clone MGC:6727 IMAGE:3588636), complete cds Length = 1588 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 414 gacaaggaggacaaggagga 433 |||||||||||||||||||| Sbjct: 817 gacaaggaggacaaggagga 798
>gb|BC052921.1| Mus musculus sterile alpha motif domain containing 10, mRNA (cDNA clone MGC:56770 IMAGE:6311715), complete cds Length = 2208 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 417 aaggaggacaaggaggatga 436 |||||||||||||||||||| Sbjct: 1698 aaggaggacaaggaggatga 1717
>ref|XM_863972.1| PREDICTED: Bos taurus similar to 55 kDa erythrocyte membrane protein (p55) (Membrane protein, palmitoylated 1), transcript variant 2 (LOC510998), mRNA Length = 2260 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 280 cagttgctgtcatccttgtt 299 |||||||||||||||||||| Sbjct: 985 cagttgctgtcatccttgtt 966
>ref|XM_871769.1| PREDICTED: Bos taurus similar to 55 kDa erythrocyte membrane protein (p55) (Membrane protein, palmitoylated 1), transcript variant 4 (LOC510998), mRNA Length = 1314 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 280 cagttgctgtcatccttgtt 299 |||||||||||||||||||| Sbjct: 985 cagttgctgtcatccttgtt 966
>ref|XM_588240.2| PREDICTED: Bos taurus similar to 55 kDa erythrocyte membrane protein (p55) (Membrane protein, palmitoylated 1), transcript variant 1 (LOC510998), mRNA Length = 2255 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 280 cagttgctgtcatccttgtt 299 |||||||||||||||||||| Sbjct: 985 cagttgctgtcatccttgtt 966
>ref|XM_587514.2| PREDICTED: Bos taurus similar to SP140 nuclear body protein isoform 1 (LOC510377), mRNA Length = 2461 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 330 aagaaggcagtggcacctgt 349 |||||||||||||||||||| Sbjct: 1107 aagaaggcagtggcacctgt 1126
>gb|CP000114.1| Streptococcus agalactiae A909, complete genome Length = 2127839 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 tttaattgagaagggagaga 246 |||||||||||||||||||| Sbjct: 1632874 tttaattgagaagggagaga 1632855
>gb|AC102806.18| Mus musculus chromosome 3, clone RP23-341B15, complete sequence Length = 229984 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 414 gacaaggaggacaaggagga 433 |||||||||||||||||||| Sbjct: 102480 gacaaggaggacaaggagga 102461
>gb|AC158617.9| Mus musculus 10 BAC RP23-283O2 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 240410 Score = 40.1 bits (20), Expect = 6.4 Identities = 26/28 (92%) Strand = Plus / Plus Query: 418 aggaggacaaggaggatgaaaaggatga 445 ||||||| ||||||||||| |||||||| Sbjct: 211067 aggaggaaaaggaggatgagaaggatga 211094
>gb|AC106745.4| Homo sapiens chromosome 16 clone RP11-134D3, complete sequence Length = 164238 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 334 aggcagtggcacctgtgaag 353 |||||||||||||||||||| Sbjct: 75311 aggcagtggcacctgtgaag 75292
>gb|AC132344.3| Mus musculus BAC clone RP24-177A17 from chromosome 13, complete sequence Length = 169661 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 414 gacaaggaggacaaggagga 433 |||||||||||||||||||| Sbjct: 60552 gacaaggaggacaaggagga 60571
>gb|DQ484024.1| Gymnogyps californianus clone 190G microsatellite sequence Length = 768 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 426 aaggaggatgaaaaggatga 445 |||||||||||||||||||| Sbjct: 335 aaggaggatgaaaaggatga 354
>gb|DQ483941.1| Gymnogyps californianus clone 107G microsatellite sequence Length = 520 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 426 aaggaggatgaaaaggatga 445 |||||||||||||||||||| Sbjct: 329 aaggaggatgaaaaggatga 348
>gb|DQ483422.1| Gymnogyps californianus clone 125H microsatellite sequence Length = 526 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 426 aaggaggatgaaaaggatga 445 |||||||||||||||||||| Sbjct: 335 aaggaggatgaaaaggatga 354
>ref|XM_749569.1| Aspergillus fumigatus Af293 hypothetical protein (Afu3g09570) partial mRNA Length = 618 Score = 40.1 bits (20), Expect = 6.4 Identities = 29/32 (90%) Strand = Plus / Plus Query: 87 gagaaggaaaagcagaaggctgaggaggctgc 118 |||||||||||||||| ||| || |||||||| Sbjct: 520 gagaaggaaaagcagatggcggaagaggctgc 551
>ref|XM_383889.1| Gibberella zeae PH-1 chromosome 2 hypothetical protein (FG03713.1) partial mRNA Length = 1116 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 414 gacaaggaggacaaggagga 433 |||||||||||||||||||| Sbjct: 943 gacaaggaggacaaggagga 962
>gb|AC078855.13| Homo sapiens 3 BAC RP11-558M24 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 173849 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 286 ctgtcatccttgttactgtg 305 |||||||||||||||||||| Sbjct: 153488 ctgtcatccttgttactgtg 153507
>gb|AC118198.7| Mus musculus chromosome 10, clone RP23-179O14, complete sequence Length = 225267 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 414 gacaaggaggacaaggagga 433 |||||||||||||||||||| Sbjct: 56604 gacaaggaggacaaggagga 56623 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 414 gacaaggaggacaaggagga 433 |||||||||||||||||||| Sbjct: 56595 gacaaggaggacaaggagga 56614
>gb|AC093686.6| Homo sapiens BAC clone RP11-713A20 from 7, complete sequence Length = 189854 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 414 gacaaggaggacaaggagga 433 |||||||||||||||||||| Sbjct: 63097 gacaaggaggacaaggagga 63078
>emb|CR633543.2|CNS0ENT9 Tetraodon nigroviridis full-length cDNA Length = 483 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 414 gacaaggaggacaaggagga 433 |||||||||||||||||||| Sbjct: 144 gacaaggaggacaaggagga 163
>emb|CR632997.2|CNS0ENE3 Tetraodon nigroviridis full-length cDNA Length = 483 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 414 gacaaggaggacaaggagga 433 |||||||||||||||||||| Sbjct: 144 gacaaggaggacaaggagga 163
>emb|CR632121.2|CNS0EMPR Tetraodon nigroviridis full-length cDNA Length = 483 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 414 gacaaggaggacaaggagga 433 |||||||||||||||||||| Sbjct: 144 gacaaggaggacaaggagga 163
>emb|CR631928.2|CNS0EMKE Tetraodon nigroviridis full-length cDNA Length = 483 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 414 gacaaggaggacaaggagga 433 |||||||||||||||||||| Sbjct: 144 gacaaggaggacaaggagga 163
>emb|CR631349.2|CNS0EM4A Tetraodon nigroviridis full-length cDNA Length = 479 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 414 gacaaggaggacaaggagga 433 |||||||||||||||||||| Sbjct: 144 gacaaggaggacaaggagga 163
>emb|CR631561.2|CNS0EMA7 Tetraodon nigroviridis full-length cDNA Length = 479 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 414 gacaaggaggacaaggagga 433 |||||||||||||||||||| Sbjct: 144 gacaaggaggacaaggagga 163
>gb|AC154352.2| Mus musculus BAC clone RP24-545J11 from chromosome 13, complete sequence Length = 199388 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 414 gacaaggaggacaaggagga 433 |||||||||||||||||||| Sbjct: 141358 gacaaggaggacaaggagga 141339
>gb|BC055919.1| Mus musculus cDNA clone IMAGE:4017147, **** WARNING: chimeric clone **** Length = 1551 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 414 gacaaggaggacaaggagga 433 |||||||||||||||||||| Sbjct: 781 gacaaggaggacaaggagga 762
>gb|BC114821.1| Bos taurus cDNA clone MGC:140309 IMAGE:8185806, complete cds Length = 1489 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 330 aagaaggcagtggcacctgt 349 |||||||||||||||||||| Sbjct: 1086 aagaaggcagtggcacctgt 1105
>emb|AL139423.25| Human DNA sequence from clone RP4-734G22 on chromosome 1 Contains the 3' end of the PEX14 gene for peroxisomal biogenesis factor 14, the 3' end of the gene for a novel protein (FLJ34970, FLJ20321, FLJ12223) and two CpG islands, complete sequence Length = 143285 Score = 40.1 bits (20), Expect = 6.4 Identities = 29/32 (90%) Strand = Plus / Plus Query: 414 gacaaggaggacaaggaggatgaaaaggatga 445 |||||||||||| |||||||||| ||||||| Sbjct: 38399 gacaaggaggacgaggaggatgaggaggatga 38430
>emb|AL157774.14| Human DNA sequence from clone RP11-442L12 on chromosome 6 Contains part of the PKHD1 gene for polycystic kidney and hepatic disease 1 (autosomal recessive) (TIG multiple domains-1, FCYT, ARPKD) and a CpG island, complete sequence Length = 154055 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 416 caaggaggacaaggaggatg 435 |||||||||||||||||||| Sbjct: 138553 caaggaggacaaggaggatg 138534
>gb|AE014266.1| Streptococcus agalactiae 2603V/R section 76 of 100 of the complete genome Length = 23817 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 tttaattgagaagggagaga 246 |||||||||||||||||||| Sbjct: 1701 tttaattgagaagggagaga 1682
>emb|AL645527.20| Mouse DNA sequence from clone RP23-26L6 on chromosome 11 Contains the Vamp2 gene for vesicle-associated membrane 2, the Per1 gene for period homolog 1 (Drosophila), the Hes7 gene for hairy and enhancer of split 7 (Drosophila), the Aloxe3 gene for arachidonate lipoxygenase 3, the Alox12b gene for arachidonate 12-lipoxygenase 12R type, the Alox15b gene for arachidonate 15-lipoxygenase second type, the Gucy2e gene for guanylate cyclase 2e, a novel gene, the gene for LYST-interacting protein LIP8 (Lip8-pending), the gene for the likely ortholog of H. sapiens trafficking protein particle complex 1 (TRAPPC1)), the Kcnab3 gene for potassium voltage-gated channel shaker-related subfamily beta member 3, a novel gene, the 3' end of the Chd3 gene for chromodomain helicase DNA binding protein 3 and six CpG islands, complete sequence Length = 261224 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 137 cctttctgagttccagaaga 156 |||||||||||||||||||| Sbjct: 44424 cctttctgagttccagaaga 44405
>emb|AL766852.1|SAG766852 Streptococcus agalactiae NEM316 complete genome, segment 10 Length = 174050 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 tttaattgagaagggagaga 246 |||||||||||||||||||| Sbjct: 108355 tttaattgagaagggagaga 108336
>gb|AY129465.1| Homo sapiens polycystic kidney and hepatic disease 1 (PKHD1) gene, complete cds, alternatively spliced Length = 469514 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 416 caaggaggacaaggaggatg 435 |||||||||||||||||||| Sbjct: 265247 caaggaggacaaggaggatg 265266
>emb|AJ720634.1| Gallus gallus mRNA for hypothetical protein, clone 22d9 Length = 2601 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 280 cagttgctgtcatccttgtt 299 |||||||||||||||||||| Sbjct: 716 cagttgctgtcatccttgtt 697
>ref|NM_001007917.1| Gallus gallus membrane protein, palmitoylated 1, 55kDa (MPP1), mRNA Length = 2601 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 280 cagttgctgtcatccttgtt 299 |||||||||||||||||||| Sbjct: 716 cagttgctgtcatccttgtt 697
>emb|CR450716.5| Zebrafish DNA sequence from clone DKEYP-84G1 in linkage group 18, complete sequence Length = 193900 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 210 aagatcaagatcattgattt 229 |||||||||||||||||||| Sbjct: 24758 aagatcaagatcattgattt 24739
>emb|CR613663.1| full-length cDNA clone CS0DI026YH02 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1410 Score = 40.1 bits (20), Expect = 6.4 Identities = 29/32 (90%) Strand = Plus / Plus Query: 414 gacaaggaggacaaggaggatgaaaaggatga 445 |||||||||||| |||||||||| ||||||| Sbjct: 521 gacaaggaggacgaggaggatgaggaggatga 552
>emb|CR601822.1| full-length cDNA clone CS0DC027YC08 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 1854 Score = 40.1 bits (20), Expect = 6.4 Identities = 29/32 (90%) Strand = Plus / Plus Query: 414 gacaaggaggacaaggaggatgaaaaggatga 445 |||||||||||| |||||||||| ||||||| Sbjct: 931 gacaaggaggacgaggaggatgaggaggatga 962
>emb|CR601012.1| full-length cDNA clone CS0DL012YF13 of B cells (Ramos cell line) Cot 25-normalized of Homo sapiens (human) Length = 1219 Score = 40.1 bits (20), Expect = 6.4 Identities = 29/32 (90%) Strand = Plus / Plus Query: 414 gacaaggaggacaaggaggatgaaaaggatga 445 |||||||||||| |||||||||| ||||||| Sbjct: 969 gacaaggaggacgaggaggatgaggaggatga 1000
>emb|CR599838.1| full-length cDNA clone CS0DI068YI22 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1837 Score = 40.1 bits (20), Expect = 6.4 Identities = 29/32 (90%) Strand = Plus / Plus Query: 414 gacaaggaggacaaggaggatgaaaaggatga 445 |||||||||||| |||||||||| ||||||| Sbjct: 959 gacaaggaggacgaggaggatgaggaggatga 990
>emb|BX769174.7| Zebrafish DNA sequence from clone DKEY-246O14, complete sequence Length = 187545 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 210 aagatcaagatcattgattt 229 |||||||||||||||||||| Sbjct: 180891 aagatcaagatcattgattt 180910
>dbj|AK002194.1| Homo sapiens cDNA FLJ11332 fis, clone PLACE1010599, highly similar to Homo sapiens Pex14 mRNA for peroxisomal membrane anchor protein Length = 1912 Score = 40.1 bits (20), Expect = 6.4 Identities = 29/32 (90%) Strand = Plus / Plus Query: 414 gacaaggaggacaaggaggatgaaaaggatga 445 |||||||||||| |||||||||| ||||||| Sbjct: 977 gacaaggaggacgaggaggatgaggaggatga 1008
>dbj|AK142609.1| Mus musculus 10 days lactation, adult female mammary gland cDNA, RIKEN full-length enriched library, clone:D730010N08 product:Ig alpha chain C region homolog [Mus musculus], full insert sequence Length = 1541 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 414 gacaaggaggacaaggagga 433 |||||||||||||||||||| Sbjct: 771 gacaaggaggacaaggagga 752
>dbj|AK136471.1| Mus musculus adult male colon cDNA, RIKEN full-length enriched library, clone:9030611D02 product:immunoglobulin heavy chain (J558 family), full insert sequence Length = 2959 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 414 gacaaggaggacaaggagga 433 |||||||||||||||||||| Sbjct: 818 gacaaggaggacaaggagga 799
>gb|AC009051.8| Homo sapiens chromosome 16 clone RP11-238M18, complete sequence Length = 157691 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 334 aggcagtggcacctgtgaag 353 |||||||||||||||||||| Sbjct: 132674 aggcagtggcacctgtgaag 132655
>ref|NM_172676.2| Mus musculus sterile alpha motif domain containing 10 (Samd10), mRNA Length = 2208 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 417 aaggaggacaaggaggatga 436 |||||||||||||||||||| Sbjct: 1698 aaggaggacaaggaggatga 1717
>dbj|AK164204.1| Mus musculus adult male hippocampus cDNA, RIKEN full-length enriched library, clone:C630049C13 product:hypothetical SAM domain profile/Sterile alpha motif homology containing protein, full insert sequence Length = 2103 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 417 aaggaggacaaggaggatga 436 |||||||||||||||||||| Sbjct: 1738 aaggaggacaaggaggatga 1757
>dbj|AK171151.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN full-length enriched library, clone:F630228D08 product:weakly similar to Hypothetical SAM domain [Mus musculus], full insert sequence Length = 2103 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 417 aaggaggacaaggaggatga 436 |||||||||||||||||||| Sbjct: 1704 aaggaggacaaggaggatga 1723
>gb|AY045742.1|AY045741S2 Mus musculus immunoglobulin alpha heavy chain constant region (Igh-2) gene, Igh-2b allotype, exon 2 Length = 336 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 414 gacaaggaggacaaggagga 433 |||||||||||||||||||| Sbjct: 27 gacaaggaggacaaggagga 8
>emb|CR542083.1| Homo sapiens full open reading frame cDNA clone RZPDo834B0137D for gene PEX14, peroxisomal biogenesis factor 14; complete cds, incl. stopcodon Length = 1134 Score = 40.1 bits (20), Expect = 6.4 Identities = 29/32 (90%) Strand = Plus / Plus Query: 414 gacaaggaggacaaggaggatgaaaaggatga 445 |||||||||||| |||||||||| ||||||| Sbjct: 964 gacaaggaggacgaggaggatgaggaggatga 995
>emb|CR450321.1| Homo sapiens full open reading frame cDNA clone RZPDo834G031D for gene PEX14, peroxisomal biogenesis factor 14; complete cds; without stopcodon Length = 1131 Score = 40.1 bits (20), Expect = 6.4 Identities = 29/32 (90%) Strand = Plus / Plus Query: 414 gacaaggaggacaaggaggatgaaaaggatga 445 |||||||||||| |||||||||| ||||||| Sbjct: 964 gacaaggaggacgaggaggatgaggaggatga 995
>gb|AC156275.6| Mus musculus 10 BAC RP24-192F16 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 160348 Score = 40.1 bits (20), Expect = 6.4 Identities = 26/28 (92%) Strand = Plus / Plus Query: 418 aggaggacaaggaggatgaaaaggatga 445 ||||||| ||||||||||| |||||||| Sbjct: 61023 aggaggaaaaggaggatgagaaggatga 61050
>gb|AC159327.8| Mus musculus 10 BAC RP23-207L3 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 215004 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 414 gacaaggaggacaaggagga 433 |||||||||||||||||||| Sbjct: 120462 gacaaggaggacaaggagga 120443 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 414 gacaaggaggacaaggagga 433 |||||||||||||||||||| Sbjct: 120453 gacaaggaggacaaggagga 120434
>dbj|AK002875.1| Mus musculus adult male kidney cDNA, RIKEN full-length enriched library, clone:0610041A01 product:IG ALPHA CHAIN C REGION homolog [Mus musculus], full insert sequence Length = 1384 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 414 gacaaggaggacaaggagga 433 |||||||||||||||||||| Sbjct: 629 gacaaggaggacaaggagga 610
>dbj|AK007826.1| Mus musculus 10 day old male pancreas cDNA, RIKEN full-length enriched library, clone:1810048H17 product:similar to Ig heavy chain precursor [Mus musculus], full insert sequence Length = 1524 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 414 gacaaggaggacaaggagga 433 |||||||||||||||||||| Sbjct: 776 gacaaggaggacaaggagga 757
>tpg|BK001427.1| TPA: TPA_exp: Homo sapiens NOELIN1 (OLFM1) gene, complete cds; alternatively spliced Length = 47757 Score = 40.1 bits (20), Expect = 6.4 Identities = 26/28 (92%) Strand = Plus / Minus Query: 418 aggaggacaaggaggatgaaaaggatga 445 ||||||| |||||||||||| ||||||| Sbjct: 21891 aggaggaaaaggaggatgaagaggatga 21864
>dbj|AK053884.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched library, clone:E130318E08 product:hypothetical protein, full insert sequence Length = 1681 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 417 aaggaggacaaggaggatga 436 |||||||||||||||||||| Sbjct: 1279 aaggaggacaaggaggatga 1298
>dbj|AK053048.1| Mus musculus 15 days embryo head cDNA, RIKEN full-length enriched library, clone:D930033N23 product:hypothetical protein, full insert sequence Length = 2050 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 417 aaggaggacaaggaggatga 436 |||||||||||||||||||| Sbjct: 1651 aaggaggacaaggaggatga 1670
>gb|AC010133.4|AC010133 Homo sapiens clone RP11-118E9, complete sequence Length = 152074 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 47 gtctatcttggagaagacat 66 |||||||||||||||||||| Sbjct: 120517 gtctatcttggagaagacat 120536
>gb|BC092056.1| Mus musculus immunoglobulin heavy chain (J558 family), mRNA (cDNA clone MGC:102606 IMAGE:4013094), complete cds Length = 1564 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 414 gacaaggaggacaaggagga 433 |||||||||||||||||||| Sbjct: 793 gacaaggaggacaaggagga 774
>gb|AC136285.2| Homo sapiens chromosome 16 clone RP11-899L11, complete sequence Length = 235286 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 334 aggcagtggcacctgtgaag 353 |||||||||||||||||||| Sbjct: 229749 aggcagtggcacctgtgaag 229730
>gb|AC091902.2| Homo sapiens chromosome 5 clone RP11-16L24, complete sequence Length = 188877 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 107 tgaggaggctgcagcagccg 126 |||||||||||||||||||| Sbjct: 120315 tgaggaggctgcagcagccg 120334
>gb|AF288038.1|AF288038 Streptococcus thermophilus putative oxidoreductase gene, complete cds; and putative HsdR gene, partial cds Length = 3292 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 410 cggtgacaaggaggacaagg 429 |||||||||||||||||||| Sbjct: 636 cggtgacaaggaggacaagg 655
>gb|AC139715.1| Homo sapiens BAC clone RP11-399D2 from 4, complete sequence Length = 174076 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 86 tgagaaggaaaagcagaagg 105 |||||||||||||||||||| Sbjct: 45713 tgagaaggaaaagcagaagg 45694
>gb|AC016894.11| Homo sapiens BAC clone RP11-17D23 from 2, complete sequence Length = 135160 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 418 aggaggacaaggaggatgaa 437 |||||||||||||||||||| Sbjct: 54774 aggaggacaaggaggatgaa 54793
>dbj|AK218993.1| Mus musculus cDNA, clone:Y2G0147A04, strand:minus, reference:ENSEMBL:Mouse-Transcript- ENST:ENSMUST00000060173, based on BLAT search Length = 398 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 417 aaggaggacaaggaggatga 436 |||||||||||||||||||| Sbjct: 342 aaggaggacaaggaggatga 361
>dbj|AB105684.1| Bovine viral diarrhea virus 1 gene for structural glycoprotein E2, partial cds, isolate: IS26 NCP/01 Length = 420 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 449 ggctgcaccacgcagaaggt 468 |||||||||||||||||||| Sbjct: 82 ggctgcaccacgcagaaggt 101
>dbj|AB105683.1| Bovine viral diarrhea virus 1 gene for structural glycoprotein E2, partial cds, isolate: IS25 CP/01 Length = 420 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 449 ggctgcaccacgcagaaggt 468 |||||||||||||||||||| Sbjct: 82 ggctgcaccacgcagaaggt 101
>dbj|AP006273.1| Papio hamadryas genomic DNA, BAC clone: RPCI41-30J10, chromosome 3, complete sequence Length = 183435 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 414 gacaaggaggacaaggagga 433 |||||||||||||||||||| Sbjct: 27171 gacaaggaggacaaggagga 27152
>gb|AY893549.1| Synthetic construct Homo sapiens clone FLH131159.01X peroxisomal biogenesis factor 14 (PEX14) mRNA, complete cds Length = 1134 Score = 40.1 bits (20), Expect = 6.4 Identities = 29/32 (90%) Strand = Plus / Plus Query: 414 gacaaggaggacaaggaggatgaaaaggatga 445 |||||||||||| |||||||||| ||||||| Sbjct: 964 gacaaggaggacgaggaggatgaggaggatga 995
>gb|AF029747.1|AF029747 Mus musculus IgA hinge/CH2 (Igh-A (Ig-2)) gene, partial cds Length = 485 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 414 gacaaggaggacaaggagga 433 |||||||||||||||||||| Sbjct: 191 gacaaggaggacaaggagga 172
>gb|BC006327.2| Homo sapiens peroxisomal biogenesis factor 14, mRNA (cDNA clone MGC:12767 IMAGE:4138822), complete cds Length = 1936 Score = 40.1 bits (20), Expect = 6.4 Identities = 29/32 (90%) Strand = Plus / Plus Query: 414 gacaaggaggacaaggaggatgaaaaggatga 445 |||||||||||| |||||||||| ||||||| Sbjct: 976 gacaaggaggacgaggaggatgaggaggatga 1007
>emb|AL844529.10| Mouse DNA sequence from clone RP23-138J20 on chromosome 2, complete sequence Length = 132763 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 417 aaggaggacaaggaggatga 436 |||||||||||||||||||| Sbjct: 34993 aaggaggacaaggaggatga 34974
>dbj|AP002768.3| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-673F18, complete sequence Length = 186084 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 234 gagaagggagagaagcagcc 253 |||||||||||||||||||| Sbjct: 2480 gagaagggagagaagcagcc 2499
>gb|AC172026.3| Gallus gallus BAC clone CH261-126J23 from chromosome ul, complete sequence Length = 179661 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 280 cagttgctgtcatccttgtt 299 |||||||||||||||||||| Sbjct: 37422 cagttgctgtcatccttgtt 37441
>gb|AF045186.1|AF045186 Homo sapiens peroxisomal membrane anchor protein HsPex14p (PEX14) mRNA, complete cds Length = 1247 Score = 40.1 bits (20), Expect = 6.4 Identities = 29/32 (90%) Strand = Plus / Plus Query: 414 gacaaggaggacaaggaggatgaaaaggatga 445 |||||||||||| |||||||||| ||||||| Sbjct: 969 gacaaggaggacgaggaggatgaggaggatga 1000
>gb|AF043636.1|AF043636 Plasmodium chabaudi circumsporozoite protein (CS) gene, partial cds Length = 1541 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 414 gacaaggaggacaaggagga 433 |||||||||||||||||||| Sbjct: 919 gacaaggaggacaaggagga 938
>emb|AL390778.31| Human DNA sequence from clone RP11-399H11 on chromosome 9 Contains the 3' end of the OLFM1 gene for olfactomedin 1, two putative novel transcripts and two CpG islands, complete sequence Length = 221372 Score = 40.1 bits (20), Expect = 6.4 Identities = 26/28 (92%) Strand = Plus / Plus Query: 418 aggaggacaaggaggatgaaaaggatga 445 ||||||| |||||||||||| ||||||| Sbjct: 205463 aggaggaaaaggaggatgaagaggatga 205490
>emb|AL034399.6|HS191P20 Human DNA sequence from clone RP6-191P20 on chromosome Xq23 Contains the TEX13B gene for testis expressed sequence 13B, a novel pseudogene, the 3' end of the MID2 gene for midline 2 (FXY2, RNF60, TRIM1), a novel gene and a CpG island, complete sequence Length = 118456 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 296 tgttactgtgctcttcagaa 315 |||||||||||||||||||| Sbjct: 10184 tgttactgtgctcttcagaa 10165
>dbj|AP006654.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT31E21, TM0340, complete sequence Length = 120480 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 213 atcaagatcattgatttaat 232 |||||||||||||||||||| Sbjct: 102824 atcaagatcattgatttaat 102843
>emb|AL808025.4| Mouse DNA sequence from clone RP23-45M22 on chromosome X, complete sequence Length = 227581 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 414 gacaaggaggacaaggagga 433 |||||||||||||||||||| Sbjct: 61986 gacaaggaggacaaggagga 61967 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 414 gacaaggaggacaaggagga 433 |||||||||||||||||||| Sbjct: 61977 gacaaggaggacaaggagga 61958
>emb|AL137065.10| Human DNA sequence from clone RP11-4P13 on chromosome Xq22.1-23, complete sequence Length = 119311 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 296 tgttactgtgctcttcagaa 315 |||||||||||||||||||| Sbjct: 66156 tgttactgtgctcttcagaa 66175
>emb|AL731838.19| Mouse DNA sequence from clone RP23-139O16 on chromosome X, complete sequence Length = 212472 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 414 gacaaggaggacaaggagga 433 |||||||||||||||||||| Sbjct: 111359 gacaaggaggacaaggagga 111340
>emb|AL732469.8| Mouse DNA sequence from clone RP23-434B15 on chromosome X, complete sequence Length = 197111 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 414 gacaaggaggacaaggagga 433 |||||||||||||||||||| Sbjct: 194897 gacaaggaggacaaggagga 194878
>dbj|AB017546.1| Homo sapiens Pex14 mRNA for peroxisomal membrane anchor protein, complete cds Length = 1908 Score = 40.1 bits (20), Expect = 6.4 Identities = 29/32 (90%) Strand = Plus / Plus Query: 414 gacaaggaggacaaggaggatgaaaaggatga 445 |||||||||||| |||||||||| ||||||| Sbjct: 969 gacaaggaggacgaggaggatgaggaggatga 1000
>emb|AL672157.5| Mouse DNA sequence from clone RP24-499M12 on chromosome 2, complete sequence Length = 67987 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 414 gacaaggaggacaaggagga 433 |||||||||||||||||||| Sbjct: 44903 gacaaggaggacaaggagga 44884 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,165,183 Number of Sequences: 3902068 Number of extensions: 5165183 Number of successful extensions: 127236 Number of sequences better than 10.0: 128 Number of HSP's better than 10.0 without gapping: 128 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 126876 Number of HSP's gapped (non-prelim): 354 length of query: 476 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 454 effective length of database: 17,147,199,772 effective search space: 7784828696488 effective search space used: 7784828696488 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)