| Clone Name | bags22a10 |
|---|---|
| Clone Library Name | barley_pub |
>emb|AJ234820.1|HVU234820 Hordeum vulgare genomic DNA fragment; clone MWG2171.rev Length = 386 Score = 99.6 bits (50), Expect = 8e-18 Identities = 58/60 (96%), Gaps = 1/60 (1%) Strand = Plus / Plus Query: 321 aggatttatggg-actattgaatattatgcgggccacagtgtctcaaattaccatttctg 379 |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 327 aggatttatggggmctattgaatattatgcgggccacagtgtctcaaattaccatttctg 386 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 304 ccgggtctacacaattgagg 323 |||||||||||||||||||| Sbjct: 1 ccgggtctacacaattgagg 20
>ref|NM_111068.2| Arabidopsis thaliana amino acid binding / aspartate kinase AT3G02020 mRNA, complete cds Length = 2185 Score = 69.9 bits (35), Expect = 7e-09 Identities = 44/47 (93%) Strand = Plus / Plus Query: 424 tgacatttgacgaggctgctcaacttgcttattttggtgcccaggtg 470 |||||||||| ||||||||| |||||||||| ||||||||||||||| Sbjct: 1314 tgacatttgatgaggctgctgaacttgcttactttggtgcccaggtg 1360
>gb|AY088366.1| Arabidopsis thaliana clone 6203 mRNA, complete sequence Length = 2164 Score = 69.9 bits (35), Expect = 7e-09 Identities = 44/47 (93%) Strand = Plus / Plus Query: 424 tgacatttgacgaggctgctcaacttgcttattttggtgcccaggtg 470 |||||||||| ||||||||| |||||||||| ||||||||||||||| Sbjct: 1313 tgacatttgatgaggctgctgaacttgcttactttggtgcccaggtg 1359
>gb|AC011664.10|ATAC011664 Arabidopsis thaliana chromosome III BAC F1C9 genomic sequence, complete sequence Length = 103960 Score = 67.9 bits (34), Expect = 3e-08 Identities = 43/46 (93%) Strand = Plus / Plus Query: 424 tgacatttgacgaggctgctcaacttgcttattttggtgcccaggt 469 |||||||||| ||||||||| |||||||||| |||||||||||||| Sbjct: 67372 tgacatttgatgaggctgctgaacttgcttactttggtgcccaggt 67417
>gb|AC010797.4|ATAC010797 Arabidopsis thaliana chromosome III BAC F28J7 genomic sequence, complete sequence Length = 89154 Score = 67.9 bits (34), Expect = 3e-08 Identities = 43/46 (93%) Strand = Plus / Minus Query: 424 tgacatttgacgaggctgctcaacttgcttattttggtgcccaggt 469 |||||||||| ||||||||| |||||||||| |||||||||||||| Sbjct: 86664 tgacatttgatgaggctgctgaacttgcttactttggtgcccaggt 86619
>ref|NM_189995.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1533 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Plus Query: 426 acatttgacgaggctgctcaacttgcttattttggtgcccaggt 469 |||||||| ||||| || ||||||||||||||||||||||||| Sbjct: 1039 acatttgaagaggcagcagaacttgcttattttggtgcccaggt 1082
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 426 acatttgacgaggctgctcaacttgcttattttggtgcccaggt 469 |||||||| ||||| || ||||||||||||||||||||||||| Sbjct: 40702973 acatttgaagaggcagcagaacttgcttattttggtgcccaggt 40702930 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 135 gaggaggatgaggaggctgt 154 |||||||||||||||||||| Sbjct: 31725968 gaggaggatgaggaggctgt 31725949
>dbj|AP004332.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJNBa0093F16 Length = 160925 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 426 acatttgacgaggctgctcaacttgcttattttggtgcccaggt 469 |||||||| ||||| || ||||||||||||||||||||||||| Sbjct: 144951 acatttgaagaggcagcagaacttgcttattttggtgcccaggt 144908
>dbj|AP004330.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJNBa0052O12 Length = 167881 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 426 acatttgacgaggctgctcaacttgcttattttggtgcccaggt 469 |||||||| ||||| || ||||||||||||||||||||||||| Sbjct: 5619 acatttgaagaggcagcagaacttgcttattttggtgcccaggt 5576
>dbj|AK073189.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033004I10, full insert sequence Length = 2037 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Plus Query: 426 acatttgacgaggctgctcaacttgcttattttggtgcccaggt 469 |||||||| ||||| || ||||||||||||||||||||||||| Sbjct: 1094 acatttgaagaggcagcagaacttgcttattttggtgcccaggt 1137
>dbj|AB042521.1| Oryza sativa mRNA for aspartate kinase, partial cds Length = 1343 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Plus Query: 426 acatttgacgaggctgctcaacttgcttattttggtgcccaggt 469 |||||||| ||||| || ||||||||||||||||||||||||| Sbjct: 391 acatttgaagaggcagcagaacttgcttattttggtgcccaggt 434
>ref|XM_477617.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1991 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Plus Query: 424 tgacatttgacgaggctgctcaacttgcttattttggtgcccaggt 469 |||||||||| ||||| ||| ||||||| ||||||||||| ||||| Sbjct: 1062 tgacatttgatgaggcagctgaacttgcctattttggtgcacaggt 1107
>ref|XM_477616.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1982 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Plus Query: 424 tgacatttgacgaggctgctcaacttgcttattttggtgcccaggt 469 |||||||||| ||||| ||| ||||||| ||||||||||| ||||| Sbjct: 1067 tgacatttgatgaggcagctgaacttgcctattttggtgcacaggt 1112
>gb|BT009484.1| Triticum aestivum clone wr1.pk0046.b11:fis, full insert mRNA sequence Length = 1658 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Plus Query: 424 tgacatttgacgaggctgctcaacttgcttattttggtgcccaggt 469 |||| ||||| ||||| ||| ||||||||||||||||||| ||||| Sbjct: 599 tgacttttgatgaggcagctgaacttgcttattttggtgcacaggt 644
>dbj|AK061941.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-042-D10, full insert sequence Length = 1991 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Plus Query: 424 tgacatttgacgaggctgctcaacttgcttattttggtgcccaggt 469 |||||||||| ||||| ||| ||||||| ||||||||||| ||||| Sbjct: 1062 tgacatttgatgaggcagctgaacttgcctattttggtgcacaggt 1107
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 424 tgacatttgacgaggctgctcaacttgcttattttggtgcccaggt 469 |||||||||| ||||| ||| ||||||| ||||||||||| ||||| Sbjct: 11898817 tgacatttgatgaggcagctgaacttgcctattttggtgcacaggt 11898772
>dbj|AP006343.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:B1032F05 Length = 151412 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 424 tgacatttgacgaggctgctcaacttgcttattttggtgcccaggt 469 |||||||||| ||||| ||| ||||||| ||||||||||| ||||| Sbjct: 131117 tgacatttgatgaggcagctgaacttgcctattttggtgcacaggt 131072
>dbj|AP006529.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:B1114D08 Length = 148354 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 424 tgacatttgacgaggctgctcaacttgcttattttggtgcccaggt 469 |||||||||| ||||| ||| ||||||| ||||||||||| ||||| Sbjct: 29858 tgacatttgatgaggcagctgaacttgcctattttggtgcacaggt 29813
>dbj|AK102162.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086G22, full insert sequence Length = 1983 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Plus Query: 424 tgacatttgacgaggctgctcaacttgcttattttggtgcccaggt 469 |||||||||| ||||| ||| ||||||| ||||||||||| ||||| Sbjct: 1067 tgacatttgatgaggcagctgaacttgcctattttggtgcacaggt 1112
>gb|AE000666.1| Methanothermobacter thermautotrophicus str. Delta H, complete genome Length = 1751377 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 108 ccgaggagagggaggggataga 129 |||||||||||||||||||||| Sbjct: 777091 ccgaggagagggaggggataga 777070
>emb|AL662835.11| Mouse DNA sequence from clone RP23-458A23 on chromosome 11, complete sequence Length = 162024 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 165 cctcccgcgccctcctccttcc 186 |||||||||||||||||||||| Sbjct: 86764 cctcccgcgccctcctccttcc 86743
>gb|AC102914.9| Mus musculus chromosome 15, clone RP24-274M4, complete sequence Length = 185807 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 111 aggagagggaggggatagata 131 ||||||||||||||||||||| Sbjct: 169676 aggagagggaggggatagata 169696
>gb|AC161194.14| Mus musculus chromosome 15, clone RP23-345C13, complete sequence Length = 193998 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 111 aggagagggaggggatagata 131 ||||||||||||||||||||| Sbjct: 8203 aggagagggaggggatagata 8223
>gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence Length = 3694126 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 72 gcggcctcgatccggcctcgg 92 ||||||||||||||||||||| Sbjct: 654693 gcggcctcgatccggcctcgg 654673
>gb|AC129040.5| Rattus norvegicus 6 BAC CH230-372A13 (Children's Hospital Oakland Research Institute) complete sequence Length = 176067 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 97 aagagctcgagccgaggagagggag 121 |||||||| |||||||||||||||| Sbjct: 165575 aagagctctagccgaggagagggag 165551
>emb|AL939124.1|SCO939124 Streptomyces coelicolor A3(2) complete genome; segment 21/29 Length = 308050 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 60 gcctcgacgagcgcggcctcg 80 ||||||||||||||||||||| Sbjct: 180679 gcctcgacgagcgcggcctcg 180659
>gb|AY109464.1| Zea mays CL754_1 mRNA sequence Length = 3000 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 445 aacttgcttattttggtgcccaggt 469 ||||||||||||||||||| ||||| Sbjct: 1200 aacttgcttattttggtgctcaggt 1224
>gb|AY754140.1| Anopheles gambiae clone GAM_RSP7 satellite AgY53A sequence Length = 163 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 taatggatggagagatttct 410 |||||||||||||||||||| Sbjct: 121 taatggatggagagatttct 140 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 taatggatggagagatttct 410 |||||||||||||||||||| Sbjct: 15 taatggatggagagatttct 34
>gb|AY754139.1| Anopheles gambiae clone GAM_RSP22 satellite AgY53A sequence Length = 162 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 taatggatggagagatttct 410 |||||||||||||||||||| Sbjct: 15 taatggatggagagatttct 34
>gb|AY754137.1| Anopheles gambiae clone GAM_RSP1 satellite AgY53A sequence Length = 163 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 taatggatggagagatttct 410 |||||||||||||||||||| Sbjct: 15 taatggatggagagatttct 34
>gb|AY754136.1| Anopheles gambiae clone GAM_RSP4 satellite AgY53A sequence Length = 215 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 taatggatggagagatttct 410 |||||||||||||||||||| Sbjct: 15 taatggatggagagatttct 34
>gb|AY754134.1| Anopheles gambiae clone GAM_GA-CAM24 satellite AgY53A sequence Length = 110 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 taatggatggagagatttct 410 |||||||||||||||||||| Sbjct: 68 taatggatggagagatttct 87
>gb|AY754133.1| Anopheles gambiae clone GAM_GA-CAM22 satellite AgY53A sequence Length = 109 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 taatggatggagagatttct 410 |||||||||||||||||||| Sbjct: 68 taatggatggagagatttct 87
>gb|AY754131.1| Anopheles gambiae clone GAM_GA-CAM20 satellite AgY53A sequence Length = 160 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 taatggatggagagatttct 410 |||||||||||||||||||| Sbjct: 15 taatggatggagagatttct 34
>gb|AY754130.1| Anopheles gambiae clone GAM_GA-CAM19 satellite AgY53A sequence Length = 163 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 taatggatggagagatttct 410 |||||||||||||||||||| Sbjct: 15 taatggatggagagatttct 34
>gb|AY754129.1| Anopheles gambiae clone GAM_GA-CAM9 satellite AgY53A sequence Length = 163 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 taatggatggagagatttct 410 |||||||||||||||||||| Sbjct: 15 taatggatggagagatttct 34
>gb|AY754128.1| Anopheles gambiae clone GAM_GA-CAM4 satellite AgY53A sequence Length = 163 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 taatggatggagagatttct 410 |||||||||||||||||||| Sbjct: 15 taatggatggagagatttct 34
>gb|AY754127.1| Anopheles gambiae clone GAM_BKO43 satellite AgY53A sequence Length = 162 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 taatggatggagagatttct 410 |||||||||||||||||||| Sbjct: 15 taatggatggagagatttct 34
>gb|AY754126.1| Anopheles gambiae clone GAM_BKO42 satellite AgY53A sequence Length = 109 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 taatggatggagagatttct 410 |||||||||||||||||||| Sbjct: 15 taatggatggagagatttct 34
>gb|AY754124.1| Anopheles gambiae clone GAM_BKO39 satellite AgY53A sequence Length = 109 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 taatggatggagagatttct 410 |||||||||||||||||||| Sbjct: 15 taatggatggagagatttct 34
>gb|AY754123.1| Anopheles gambiae clone GAM_BKO30 satellite AgY53A sequence Length = 163 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 taatggatggagagatttct 410 |||||||||||||||||||| Sbjct: 68 taatggatggagagatttct 87 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 taatggatggagagatttct 410 |||||||||||||||||||| Sbjct: 15 taatggatggagagatttct 34
>gb|AY754122.1| Anopheles gambiae clone GAM_BKO29 satellite AgY53A sequence Length = 109 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 taatggatggagagatttct 410 |||||||||||||||||||| Sbjct: 15 taatggatggagagatttct 34
>gb|AY754121.1| Anopheles gambiae clone GAM_BKO28 satellite AgY53A sequence Length = 215 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 taatggatggagagatttct 410 |||||||||||||||||||| Sbjct: 174 taatggatggagagatttct 193 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 taatggatggagagatttct 410 |||||||||||||||||||| Sbjct: 15 taatggatggagagatttct 34
>gb|AY754120.1| Anopheles gambiae clone GAM_BKO22 satellite AgY53A sequence Length = 109 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 taatggatggagagatttct 410 |||||||||||||||||||| Sbjct: 15 taatggatggagagatttct 34
>gb|AY754119.1| Anopheles gambiae clone GAM_BKO21 satellite AgY53A sequence Length = 109 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 taatggatggagagatttct 410 |||||||||||||||||||| Sbjct: 68 taatggatggagagatttct 87
>gb|AY754118.1| Anopheles gambiae clone GAM_GA-M-Mali20 satellite AgY53A sequence Length = 163 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 taatggatggagagatttct 410 |||||||||||||||||||| Sbjct: 15 taatggatggagagatttct 34
>gb|AY754117.1| Anopheles gambiae clone GAM_GA-M-Mali19 satellite AgY53A sequence Length = 163 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 taatggatggagagatttct 410 |||||||||||||||||||| Sbjct: 15 taatggatggagagatttct 34
>gb|AY754115.1| Anopheles gambiae clone GAM_GA-M-Mali17 satellite AgY53A sequence Length = 163 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 taatggatggagagatttct 410 |||||||||||||||||||| Sbjct: 15 taatggatggagagatttct 34
>gb|AY754114.1| Anopheles gambiae clone GAM_GA-M-Mali16 satellite AgY53A sequence Length = 110 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 taatggatggagagatttct 410 |||||||||||||||||||| Sbjct: 15 taatggatggagagatttct 34
>gb|AY754113.1| Anopheles gambiae clone GAM_GA-M-Mali12 satellite AgY53A sequence Length = 109 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 taatggatggagagatttct 410 |||||||||||||||||||| Sbjct: 15 taatggatggagagatttct 34
>gb|AY754112.1| Anopheles gambiae clone GAM_SUA18 satellite AgY53A sequence Length = 110 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 taatggatggagagatttct 410 |||||||||||||||||||| Sbjct: 15 taatggatggagagatttct 34
>gb|AY754110.1| Anopheles gambiae clone GAM_SUA13 satellite AgY53A sequence Length = 269 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 taatggatggagagatttct 410 |||||||||||||||||||| Sbjct: 15 taatggatggagagatttct 34
>gb|AY754108.1| Anopheles gambiae clone GAM_SUA10 satellite AgY53A sequence Length = 216 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 taatggatggagagatttct 410 |||||||||||||||||||| Sbjct: 68 taatggatggagagatttct 87 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 taatggatggagagatttct 410 |||||||||||||||||||| Sbjct: 15 taatggatggagagatttct 34
>gb|AY754107.1| Anopheles gambiae clone GAM_SUA9 satellite AgY53A sequence Length = 109 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 taatggatggagagatttct 410 |||||||||||||||||||| Sbjct: 15 taatggatggagagatttct 34
>gb|AY754106.1| Anopheles gambiae clone GAM_SUA8 satellite AgY53A sequence Length = 215 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 taatggatggagagatttct 410 |||||||||||||||||||| Sbjct: 15 taatggatggagagatttct 34
>gb|AY754105.1| Anopheles gambiae clone GAM_SUA7 satellite AgY53A sequence Length = 216 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 taatggatggagagatttct 410 |||||||||||||||||||| Sbjct: 174 taatggatggagagatttct 193 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 taatggatggagagatttct 410 |||||||||||||||||||| Sbjct: 15 taatggatggagagatttct 34
>gb|AY754104.1| Anopheles gambiae clone GAM_SUA3 satellite AgY53A sequence Length = 215 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 taatggatggagagatttct 410 |||||||||||||||||||| Sbjct: 15 taatggatggagagatttct 34
>gb|AY754103.1| Anopheles gambiae clone GAM_SUA12 satellite AgY53A sequence Length = 322 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 taatggatggagagatttct 410 |||||||||||||||||||| Sbjct: 68 taatggatggagagatttct 87 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 taatggatggagagatttct 410 |||||||||||||||||||| Sbjct: 15 taatggatggagagatttct 34
>ref|NM_001003874.1| Danio rerio hypothetical protein FLJ11749-like (H. sapiens) (flj11749l), mRNA Length = 2442 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 136 aggaggatgaggaggctgtg 155 |||||||||||||||||||| Sbjct: 546 aggaggatgaggaggctgtg 565
>ref|NM_121409.3| Arabidopsis thaliana CARAB-AK-LYS; amino acid binding / aspartate kinase AT5G14060 (CARAB-AK-LYS) mRNA, complete cds Length = 2229 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 447 cttgcttattttggtgcccaggtg 470 |||||||| ||||||||||||||| Sbjct: 1406 cttgcttactttggtgcccaggtg 1429
>ref|NM_191283.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 552 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 135 gaggaggatgaggaggctgt 154 |||||||||||||||||||| Sbjct: 142 gaggaggatgaggaggctgt 161
>gb|AC113444.9| Mus musculus chromosome 15, clone RP23-268C9, complete sequence Length = 189539 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 131 acgtgaggaggatgaggagg 150 |||||||||||||||||||| Sbjct: 171621 acgtgaggaggatgaggagg 171602
>gb|CP000078.1| Leishmania major strain Friedlin chromosome 2, complete sequence Length = 355714 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 172 cgccctcctccttcctctcc 191 |||||||||||||||||||| Sbjct: 42082 cgccctcctccttcctctcc 42063
>gb|AF196971.2| Homo sapiens chromosome X multiple clones map p11.23, complete sequence Length = 113853 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 172 cgccctcctccttcctctcc 191 |||||||||||||||||||| Sbjct: 13056 cgccctcctccttcctctcc 13075
>gb|AY648810.1| Danio rerio FLJ11749-like mRNA, complete cds Length = 2442 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 136 aggaggatgaggaggctgtg 155 |||||||||||||||||||| Sbjct: 546 aggaggatgaggaggctgtg 565
>gb|AC158594.12| Mus musculus 10 BAC RP23-197I5 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 218257 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 318 ttgaggatttatgggactat 337 |||||||||||||||||||| Sbjct: 179639 ttgaggatttatgggactat 179620
>gb|AC115341.6| Rattus norvegicus 3 BAC CH230-248O1 (Children's Hospital Oakland Research Institute) complete sequence Length = 237425 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 174 ccctcctccttcctctcccc 193 |||||||||||||||||||| Sbjct: 210338 ccctcctccttcctctcccc 210357
>gb|AC093104.2| Drosophila melanogaster clone BACR38O04, complete sequence Length = 167107 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 362 ctcaaattaccatttctgag 381 |||||||||||||||||||| Sbjct: 62374 ctcaaattaccatttctgag 62393
>ref|XM_426689.1| PREDICTED: Gallus gallus similar to galactose-3-O-sulfotransferase 2; glycoprotein beta-Gal 3-sulfotransferase-like; galactose 3-O-sulfotransferase 2; gene model 988, (NCBI) (LOC429133), mRNA Length = 1947 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 134 tgaggaggatgaggaggctg 153 |||||||||||||||||||| Sbjct: 82 tgaggaggatgaggaggctg 63
>gb|AC140247.3| Mus musculus BAC clone RP23-469I15 from chromosome 9, complete sequence Length = 189336 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 214 cgcgagcccctcctcttccc 233 |||||||||||||||||||| Sbjct: 41805 cgcgagcccctcctcttccc 41786
>ref|NM_012881.1| Rattus norvegicus secreted phosphoprotein 1 (Spp1), mRNA Length = 1457 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 376 tctgagtgtttgctgtaatg 395 |||||||||||||||||||| Sbjct: 192 tctgagtgtttgctgtaatg 173
>ref|NM_009945.3| Mus musculus cytochrome c oxidase, subunit VIIa 2 (Cox7a2), mRNA Length = 754 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 214 cgcgagcccctcctcttccc 233 |||||||||||||||||||| Sbjct: 58 cgcgagcccctcctcttccc 77
>gb|AE013206.1| Thermoanaerobacter tengcongensis MB4, section 233 of 244 of the complete genome Length = 14407 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 115 gagggaggggatagatacgt 134 |||||||||||||||||||| Sbjct: 12552 gagggaggggatagatacgt 12533
>gb|CP000051.1| Chlamydia trachomatis A/HAR-13, complete genome Length = 1044459 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 359 tgtctcaaattaccatttct 378 |||||||||||||||||||| Sbjct: 875107 tgtctcaaattaccatttct 875088
>gb|AC084163.4| Mus musculus strain C57BL6/J chromosome 6 clone RP23-287D23, complete sequence Length = 214292 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 110 gaggagagggaggggataga 129 |||||||||||||||||||| Sbjct: 95281 gaggagagggaggggataga 95262
>gb|AC183301.4| Pan troglodytes BAC clone CH251-243F23 from chromosome 19, complete sequence Length = 157473 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 137 ggaggatgaggaggctgtgg 156 |||||||||||||||||||| Sbjct: 52038 ggaggatgaggaggctgtgg 52057
>gb|AC126547.4| Mus musculus BAC clone RP24-180F1 from chromosome 13, complete sequence Length = 181823 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 174 ccctcctccttcctctcccc 193 |||||||||||||||||||| Sbjct: 27125 ccctcctccttcctctcccc 27106
>gb|AC110552.14| Mus musculus chromosome 17, clone RP23-247L7, complete sequence Length = 185205 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 110 gaggagagggaggggataga 129 |||||||||||||||||||| Sbjct: 35456 gaggagagggaggggataga 35437
>gb|AC109261.7| Mus musculus chromosome 17, clone RP23-23D19, complete sequence Length = 227994 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 174 ccctcctccttcctctcccc 193 |||||||||||||||||||| Sbjct: 194698 ccctcctccttcctctcccc 194717
>emb|AL450386.17| Human DNA sequence from clone RP11-466B20 on chromosome 10 Contains a novel gene and a CpG island, complete sequence Length = 91331 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 373 atttctgagtgtttgctgta 392 |||||||||||||||||||| Sbjct: 24818 atttctgagtgtttgctgta 24837
>ref|XM_505236.1| Yarrowia lipolytica CLIB122, YALI0F10131g predicted mRNA Length = 2211 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 134 tgaggaggatgaggaggctg 153 |||||||||||||||||||| Sbjct: 1706 tgaggaggatgaggaggctg 1687
>emb|AL109760.3|HSJ513G18 Human DNA sequence from clone RP3-513G18 on chromosome 4, complete sequence Length = 112560 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 174 ccctcctccttcctctcccc 193 |||||||||||||||||||| Sbjct: 51677 ccctcctccttcctctcccc 51696
>gb|AC005392.2| Homo sapiens chromosome 19 clone CTC-490G23, complete sequence Length = 243197 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 137 ggaggatgaggaggctgtgg 156 |||||||||||||||||||| Sbjct: 132605 ggaggatgaggaggctgtgg 132586 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 137 ggaggatgaggaggctgtgg 156 |||||||||||||||||||| Sbjct: 69158 ggaggatgaggaggctgtgg 69139
>gb|AC153523.7| Mus musculus 10 BAC RP23-463C2 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 200141 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 318 ttgaggatttatgggactat 337 |||||||||||||||||||| Sbjct: 140429 ttgaggatttatgggactat 140448
>emb|AL732587.8| Mouse DNA sequence from clone RP23-268K22 on chromosome 11 Contains the 3' end of the Galnt9 gene for UDP-N-acetyl-alpha-D-galactosamine: polypeptide N-acetylgalactosaminyltransferase 9, a novel gene, a novel gene (2310079P12Rik), the Hand1 gene for heart and neural crest derivatives expressed transcript 1 (eHAND, Thing1), a mitochondrial ribosomal protein S16 pseudogene (Mrps16) and two CpG islands, complete sequence Length = 132671 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 174 ccctcctccttcctctcccc 193 |||||||||||||||||||| Sbjct: 128360 ccctcctccttcctctcccc 128341
>gb|AC155256.2| Mus musculus BAC clone RP24-142I9 from chromosome 12, complete sequence Length = 163949 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 174 ccctcctccttcctctcccc 193 |||||||||||||||||||| Sbjct: 54248 ccctcctccttcctctcccc 54229
>gb|AC183545.2| Pan troglodytes BAC clone CH251-233G24 from chromosome 19, complete sequence Length = 151627 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 137 ggaggatgaggaggctgtgg 156 |||||||||||||||||||| Sbjct: 77637 ggaggatgaggaggctgtgg 77656 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 137 ggaggatgaggaggctgtgg 156 |||||||||||||||||||| Sbjct: 14291 ggaggatgaggaggctgtgg 14310
>gb|AC023705.4| Drosophila melanogaster X BAC RP98-7L6 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 184796 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 174 ccctcctccttcctctcccc 193 |||||||||||||||||||| Sbjct: 166004 ccctcctccttcctctcccc 165985
>gb|AC007784.7| Homo sapiens 12p13 BAC RPCI11-1092P21 (Roswell Park Cancer Library Human BAC Library) complete sequence Length = 188364 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 411 ggtatcattgttatgacatt 430 |||||||||||||||||||| Sbjct: 162065 ggtatcattgttatgacatt 162084
>gb|AF224562.1| Eulemur fulvus albocollaris isolate JP145 cytochrome oxidase subunit III (COIII) gene, partial cds; tRNA-Gly gene, complete sequence; NADH dehydrogenase subunit 3 (ND3) gene, complete cds; tRNA-Arg gene, complete sequence; NADH dehydrogenase subunit 4L (ND4L) and NADH dehydrogenase subunit 4 (ND4) genes, complete cds; tRNA-His and tRNA-Ser genes, complete sequence; and tRNA-Leu gene, partial sequence; mitochondrial genes for mitochondrial products Length = 2388 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 173 gccctcctccttcctctccc 192 |||||||||||||||||||| Sbjct: 331 gccctcctccttcctctccc 350
>gb|AF224560.1| Eulemur fulvus collaris isolate JP307 cytochrome oxidase subunit III (COIII) gene, partial cds; tRNA-Gly gene, complete sequence; NADH dehydrogenase subunit 3 (ND3) gene, complete cds; tRNA-Arg gene, complete sequence; NADH dehydrogenase subunit 4L (ND4L) and NADH dehydrogenase subunit 4 (ND4) genes, complete cds; tRNA-His and tRNA-Ser genes, complete sequence; and tRNA-Leu gene, partial sequence; mitochondrial genes for mitochondrial products Length = 2388 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 173 gccctcctccttcctctccc 192 |||||||||||||||||||| Sbjct: 331 gccctcctccttcctctccc 350
>gb|AF224559.1| Eulemur fulvus collaris isolate JP304 cytochrome oxidase subunit III (COIII) gene, partial cds; tRNA-Gly gene, complete sequence; NADH dehydrogenase subunit 3 (ND3) gene, complete cds; tRNA-Arg gene, complete sequence; NADH dehydrogenase subunit 4L (ND4L) and NADH dehydrogenase subunit 4 (ND4) genes, complete cds; tRNA-His and tRNA-Ser genes, complete sequence; and tRNA-Leu gene, partial sequence; mitochondrial genes for mitochondrial products Length = 2388 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 173 gccctcctccttcctctccc 192 |||||||||||||||||||| Sbjct: 331 gccctcctccttcctctccc 350
>gb|AF224558.1| Eulemur fulvus albocollaris isolate JP222 cytochrome oxidase subunit III (COIII) gene, partial cds; tRNA-Gly gene, complete sequence; NADH dehydrogenase subunit 3 (ND3) gene, complete cds; tRNA-Arg gene, complete sequence; NADH dehydrogenase subunit 4L (ND4L) and NADH dehydrogenase subunit 4 (ND4) genes, complete cds; tRNA-His and tRNA-Ser genes, complete sequence; and tRNA-Leu gene, partial sequence; mitochondrial genes for mitochondrial products Length = 2388 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 173 gccctcctccttcctctccc 192 |||||||||||||||||||| Sbjct: 331 gccctcctccttcctctccc 350
>gb|BC095171.1| Danio rerio hypothetical protein FLJ11749-like (H. sapiens), mRNA (cDNA clone MGC:110067 IMAGE:7281639), complete cds Length = 1214 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 136 aggaggatgaggaggctgtg 155 |||||||||||||||||||| Sbjct: 589 aggaggatgaggaggctgtg 608
>ref|NG_001095.1| Homo sapiens carcinoembryonic antigen-related cell adhesion molecule pseudogene 11 (CEACAMP11) on chromosome 19 Length = 1781 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 137 ggaggatgaggaggctgtgg 156 |||||||||||||||||||| Sbjct: 382 ggaggatgaggaggctgtgg 401
>ref|NG_001103.1| Homo sapiens carcinoembryonic antigen-related cell adhesion molecule pseudogene 9 (CEACAMP9) on chromosome 19 Length = 1782 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 137 ggaggatgaggaggctgtgg 156 |||||||||||||||||||| Sbjct: 382 ggaggatgaggaggctgtgg 401
>ref|NG_001102.1| Homo sapiens carcinoembryonic antigen-related cell adhesion molecule pseudogene 8 (CEACAMP8) on chromosome 19 Length = 1775 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 137 ggaggatgaggaggctgtgg 156 |||||||||||||||||||| Sbjct: 382 ggaggatgaggaggctgtgg 401
>ref|NG_001104.1| Homo sapiens carcinoembryonic antigen-related cell adhesion molecule pseudogene 10 (CEACAMP10) on chromosome 19 Length = 1462 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 137 ggaggatgaggaggctgtgg 156 |||||||||||||||||||| Sbjct: 75 ggaggatgaggaggctgtgg 94
>gb|AC093748.3| Homo sapiens BAC clone RP11-29P18 from 4, complete sequence Length = 112626 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 131 acgtgaggaggatgaggagg 150 |||||||||||||||||||| Sbjct: 74896 acgtgaggaggatgaggagg 74877
>emb|BX831392.1|CNS0A1N9 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS85ZE11 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 2171 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 447 cttgcttattttggtgcccaggtg 470 |||||||| ||||||||||||||| Sbjct: 1405 cttgcttactttggtgcccaggtg 1428
>emb|BX832366.1|CNS09ZR9 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH68ZC08 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 2013 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 447 cttgcttattttggtgcccaggtg 470 |||||||| ||||||||||||||| Sbjct: 1189 cttgcttactttggtgcccaggtg 1212
>emb|BX832513.1|CNS09ZM0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH78ZB10 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1979 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 447 cttgcttattttggtgcccaggtg 470 |||||||| ||||||||||||||| Sbjct: 1190 cttgcttactttggtgcccaggtg 1213
>dbj|AP003268.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0503C12 Length = 147180 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 135 gaggaggatgaggaggctgt 154 |||||||||||||||||||| Sbjct: 139700 gaggaggatgaggaggctgt 139681
>dbj|AP003375.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OJ1414_E05 Length = 105222 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 135 gaggaggatgaggaggctgt 154 |||||||||||||||||||| Sbjct: 4006 gaggaggatgaggaggctgt 3987
>gb|AE004884.1| Pseudomonas aeruginosa PAO1, section 445 of 529 of the complete genome Length = 13179 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 62 ctcgacgagcgcggcctcga 81 |||||||||||||||||||| Sbjct: 9881 ctcgacgagcgcggcctcga 9862
>gb|AC023732.5| Drosophila melanogaster X BAC RP98-42M11 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 177820 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 174 ccctcctccttcctctcccc 193 |||||||||||||||||||| Sbjct: 138755 ccctcctccttcctctcccc 138774
>gb|AE001273.1| Chlamydia trachomatis D/UW-3/CX, complete genome Length = 1042519 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 359 tgtctcaaattaccatttct 378 |||||||||||||||||||| Sbjct: 872361 tgtctcaaattaccatttct 872342
>gb|AC142113.2| Mus musculus BAC clone RP23-444K20 from chromosome 9, complete sequence Length = 188724 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 168 cccgcgccctcctccttcct 187 |||||||||||||||||||| Sbjct: 67204 cccgcgccctcctccttcct 67185
>dbj|AK069648.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023026P15, full insert sequence Length = 963 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 135 gaggaggatgaggaggctgt 154 |||||||||||||||||||| Sbjct: 241 gaggaggatgaggaggctgt 260
>gb|BC078874.1| Rattus norvegicus secreted phosphoprotein 1, mRNA (cDNA clone MGC:93552 IMAGE:7110677), complete cds Length = 1491 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 376 tctgagtgtttgctgtaatg 395 |||||||||||||||||||| Sbjct: 199 tctgagtgtttgctgtaatg 180
>gb|AC127373.3| Mus musculus BAC clone RP23-42M8 from 6, complete sequence Length = 233833 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 174 ccctcctccttcctctcccc 193 |||||||||||||||||||| Sbjct: 181279 ccctcctccttcctctcccc 181298
>gb|AC154661.2| Mus musculus BAC clone RP24-274N1 from 12, complete sequence Length = 159667 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 174 ccctcctccttcctctcccc 193 |||||||||||||||||||| Sbjct: 79267 ccctcctccttcctctcccc 79248
>gb|AC151971.3| Mus musculus BAC clone RP24-282C4 from 9, complete sequence Length = 179607 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 168 cccgcgccctcctccttcct 187 |||||||||||||||||||| Sbjct: 30755 cccgcgccctcctccttcct 30774
>gb|AE003839.4| Drosophila melanogaster chromosome 2R, section 11 of 73 of the complete sequence Length = 254177 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 362 ctcaaattaccatttctgag 381 |||||||||||||||||||| Sbjct: 251066 ctcaaattaccatttctgag 251085
>gb|AE003449.2| Drosophila melanogaster chromosome X, section 33 of 74 of the complete sequence Length = 307201 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 174 ccctcctccttcctctcccc 193 |||||||||||||||||||| Sbjct: 57032 ccctcctccttcctctcccc 57051
>gb|AC154246.3| Mus musculus BAC clone RP24-329G5 from chromosome 13, complete sequence Length = 177214 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 174 ccctcctccttcctctcccc 193 |||||||||||||||||||| Sbjct: 173677 ccctcctccttcctctcccc 173658
>gb|AC005473.1|AC005473 Drosophila melanogaster, chromosome 2R, region 44A3-44A4, P1 clone DS02142, complete sequence Length = 76743 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 362 ctcaaattaccatttctgag 381 |||||||||||||||||||| Sbjct: 71978 ctcaaattaccatttctgag 71959
>gb|AC005791.1|AC005791 Homo sapiens chromosome 19, cosmid R26371, complete sequence Length = 39266 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 137 ggaggatgaggaggctgtgg 156 |||||||||||||||||||| Sbjct: 23910 ggaggatgaggaggctgtgg 23891
>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome Length = 4751080 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 69 agcgcggcctcgatccggcc 88 |||||||||||||||||||| Sbjct: 4685105 agcgcggcctcgatccggcc 4685124
>gb|CP000159.1| Salinibacter ruber DSM 13855, complete genome Length = 3551823 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 279 ccagattgcggaggacgatctgca 302 ||||||||||||| |||||||||| Sbjct: 630754 ccagattgcggagcacgatctgca 630777
>gb|AC149319.2| Phakopsora pachyrhizi clone JGIAFNA-101K17, complete sequence Length = 37217 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 219 gcccctcctcttccctgtcc 238 |||||||||||||||||||| Sbjct: 16189 gcccctcctcttccctgtcc 16170 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 219 gcccctcctcttccctgtcc 238 |||||||||||||||||||| Sbjct: 5474 gcccctcctcttccctgtcc 5455
>gb|AC134554.6| Mus musculus BAC clone RP24-313F7 from chromosome 15, complete sequence Length = 148029 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 131 acgtgaggaggatgaggagg 150 |||||||||||||||||||| Sbjct: 132424 acgtgaggaggatgaggagg 132443
>gb|AC128697.4| Mus musculus BAC clone RP24-388P9 from 12, complete sequence Length = 169780 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 174 ccctcctccttcctctcccc 193 |||||||||||||||||||| Sbjct: 133645 ccctcctccttcctctcccc 133626
>gb|AC004784.1|AC004784 Homo sapiens chromosome 19, cosmid R26425, complete sequence Length = 44760 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 137 ggaggatgaggaggctgtgg 156 |||||||||||||||||||| Sbjct: 24756 ggaggatgaggaggctgtgg 24737
>gb|AF055999.1|AF055999 Pseudomonas aeruginosa hemin uptake locus, hypothetical protein PhuW (phuW), ATPase component (phuV), ABC-type permease (phuU), periplasmic binding protein (phuT), hemin degrading factor (phuS), and outer membrane hemin receptor (phuR) genes, complete cds Length = 7702 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 62 ctcgacgagcgcggcctcga 81 |||||||||||||||||||| Sbjct: 2027 ctcgacgagcgcggcctcga 2008
>gb|U62020.1|ATU62020 Arabidopsis thaliana lysine-sensitive aspartate kinase mRNA, complete cds Length = 1923 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 447 cttgcttattttggtgcccaggtg 470 |||||||| ||||||||||||||| Sbjct: 1128 cttgcttactttggtgcccaggtg 1151
>emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB122 of Yarrowia lipolytica Length = 4003362 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 134 tgaggaggatgaggaggctg 153 |||||||||||||||||||| Sbjct: 1367243 tgaggaggatgaggaggctg 1367262
>gb|AC165349.2| Mus musculus BAC clone RP23-212M22 from chromosome 12, complete sequence Length = 199483 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 174 ccctcctccttcctctcccc 193 |||||||||||||||||||| Sbjct: 28129 ccctcctccttcctctcccc 28110
>gb|U06679.1|HSU06679 Human carcinoembryonic antigen gene family member 18 (CGM18) gene, exons A1 and B1 Length = 1781 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 137 ggaggatgaggaggctgtgg 156 |||||||||||||||||||| Sbjct: 382 ggaggatgaggaggctgtgg 401
>gb|U06678.1|HSU06678 Human carcinoembryonic antigen gene family member 17 (CGM17) gene, exons A1 and B1 Length = 1462 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 137 ggaggatgaggaggctgtgg 156 |||||||||||||||||||| Sbjct: 75 ggaggatgaggaggctgtgg 94
>gb|U06677.1|HSU06677 Human carcinoembryonic antigen gene family member 16 (CGM16) gene, exons A1 and B1 Length = 1782 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 137 ggaggatgaggaggctgtgg 156 |||||||||||||||||||| Sbjct: 382 ggaggatgaggaggctgtgg 401
>gb|U06676.1|HSU06676 Human carcinoembryonic antigen gene family member 15 (CGM15) gene, exons A1 and B1 Length = 1775 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 137 ggaggatgaggaggctgtgg 156 |||||||||||||||||||| Sbjct: 382 ggaggatgaggaggctgtgg 401
>gb|M65161.1|MUSPACOLL Mouse pro-alpha1 (II) collagen chain gene, complete cds Length = 32492 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 131 acgtgaggaggatgaggagg 150 |||||||||||||||||||| Sbjct: 18596 acgtgaggaggatgaggagg 18577
>emb|AL669911.16| Mouse DNA sequence from clone RP23-65G8 on chromosome 11, complete sequence Length = 205030 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 174 ccctcctccttcctctcccc 193 |||||||||||||||||||| Sbjct: 78684 ccctcctccttcctctcccc 78703
>gb|M99252.1|RATOSTPNTN Rattus norvegicus osteopontin mRNA, complete cds Length = 1435 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 376 tctgagtgtttgctgtaatg 395 |||||||||||||||||||| Sbjct: 228 tctgagtgtttgctgtaatg 209
>gb|M14656.1|RATOSP Rat osteopontin mRNA, complete cds Length = 1457 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 376 tctgagtgtttgctgtaatg 395 |||||||||||||||||||| Sbjct: 192 tctgagtgtttgctgtaatg 173
>gb|AC010449.7| Homo sapiens chromosome 5 clone CTD-2241P19, complete sequence Length = 80772 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 394 tggatggagagatttctggt 413 |||||||||||||||||||| Sbjct: 45471 tggatggagagatttctggt 45490
>dbj|AB001382.1| Rattus norvegicus mRNA for osteopontin, complete cds Length = 954 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 376 tctgagtgtttgctgtaatg 395 |||||||||||||||||||| Sbjct: 113 tctgagtgtttgctgtaatg 94 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,359,638 Number of Sequences: 3902068 Number of extensions: 4359638 Number of successful extensions: 112307 Number of sequences better than 10.0: 138 Number of HSP's better than 10.0 without gapping: 139 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 111715 Number of HSP's gapped (non-prelim): 592 length of query: 479 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 457 effective length of database: 17,147,199,772 effective search space: 7836270295804 effective search space used: 7836270295804 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)