Clone Name	bags21i07
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	dbj|AK101088.1| Oryza sativa (japonica cultivar-group) cDNA clon...	603	e-169
2	dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D...	436	e-119
3	gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome...	436	e-119
4	emb|AL713942.4|CNS07YPB Oryza sativa chromosome 12, . BAC OSJNBa...	436	e-119
5	emb|AL954826.3|CNS08CD2 Oryza sativa chromosome 12, . BAC OSJNBb...	436	e-119
6	dbj|AK105983.1| Oryza sativa (japonica cultivar-group) cDNA clon...	398	e-108
7	dbj|AK105624.1| Oryza sativa (japonica cultivar-group) cDNA clon...	398	e-108
8	dbj|AK101450.1| Oryza sativa (japonica cultivar-group) cDNA clon...	398	e-108
9	dbj|AK071541.1| Oryza sativa (japonica cultivar-group) cDNA clon...	398	e-108
10	gb|AY105338.1| Zea mays PCO102700 mRNA sequence	369	7e-99
11	gb|AC137752.4| Oryza sativa (japonica cultivar-group) chromosome...	303	4e-79
12	dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D...	303	4e-79
13	gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome...	303	4e-79
14	gb|AY224188.1| Medicago truncatula adenosylhomocysteinase (AHC1)...	163	8e-37
15	ref|NM_117467.2| Arabidopsis thaliana SHM4 (SERINE HYDROXYMETHYL...	135	2e-28
16	gb|AY142551.1| Arabidopsis thaliana clone RAFL08-14-N15 (R11225)...	135	2e-28
17	gb|AY093987.1| Arabidopsis thaliana AT4g13930/dl3005c mRNA, comp...	135	2e-28
18	gb|AF361589.1| Arabidopsis thaliana AT4g13930/dl3005c mRNA, comp...	135	2e-28
19	gb|AF324991.2|AF324991 Arabidopsis thaliana AT4g13930 (AT4g13930...	135	2e-28
20	emb|BX827403.1|CNS0A2GP Arabidopsis thaliana Full-length cDNA Co...	135	2e-28
21	gb|AY086929.1| Arabidopsis thaliana clone 29662 mRNA, complete s...	135	2e-28
22	dbj|AB154528.1| Cucumis melo 6F11 mRNA for hypothetical protein,...	111	3e-21
23	emb|Z97335.2|ATFCA0 Arabidopsis thaliana DNA chromosome 4, ESSA ...	107	4e-20
24	emb|AL161537.2|ATCHRIV37 Arabidopsis thaliana DNA chromosome 4, ...	107	4e-20
25	dbj|AK109000.1| Oryza sativa (japonica cultivar-group) cDNA clon...	82	2e-12
26	ref|NM_117463.2| Arabidopsis thaliana glycine hydroxymethyltrans...	72	2e-09
27	emb|AJ000226.1|HVJ000226 Hordeum vulgare mRNA for expressed sequ...	64	6e-07
28	gb|AY224189.1| Medicago truncatula adenosylhomocysteinase (AHC2)...	64	6e-07
29	emb|AL035528.2|ATF18A5 Arabidopsis thaliana DNA chromosome 4, BA...	62	2e-06
30	gb|AY189738.1| Leishmania donovani serine hydroxymethyltransfera...	56	1e-04
31	ref|XM_779683.1| PREDICTED: Strongylocentrotus purpuratus simila...	54	5e-04
32	emb|X91902.1|OCSERHMTF O.cuniculus mRNA for serine hydroxymethyl...	52	0.002
33	emb|BX569689.1| Synechococcus sp. WH8102 complete genome; segmen...	50	0.009
34	gb|CP000110.1| Synechococcus sp. CC9605, complete genome	48	0.034
35	ref|XM_844151.1| PREDICTED: Canis familiaris similar to serine h...	48	0.034
36	gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome	48	0.034
37	gb|CP000239.1| Synechococcus sp. JA-3-3Ab, complete genome	48	0.034
38	dbj|AK055053.1| Homo sapiens cDNA FLJ30491 fis, clone BRAWH20001...	48	0.034
39	gb|L11932.1|HUMSHMTB Human nuclear-encoded mitochondrial serine ...	48	0.034
40	ref|XM_853209.1| PREDICTED: Canis familiaris similar to serine h...	46	0.13
41	gb|BC103242.1| Bos taurus serine hydroxymethyltransferase 2 (mit...	46	0.13
42	ref|NM_001034282.1| Bos taurus serine hydroxymethyltransferase 2...	46	0.13
43	gb|AC108318.8| Rattus norvegicus 2 BAC CH230-256E18 (Children's ...	44	0.53
44	gb|DQ445126.1| Striga asiatica isolate St484 hydroxymethyltransf...	44	0.53
45	emb|CR522870.1| Desulfotalea psychrophila LSv54 chromosome	44	0.53
46	gb|AC177808.2| Pan troglodytes BAC clone CH251-703A9 from chromo...	44	0.53
47	ref|NM_106662.3| Arabidopsis thaliana unknown protein AT1G80130 ...	42	2.1
48	ref|NM_009171.2| Mus musculus serine hydroxymethyl transferase 1...	42	2.1
49	ref|XM_386466.1| Gibberella zeae PH-1 chromosome 3 GLYC_NEUCR Se...	42	2.1
50	gb|AY383687.1| Rattus norvegicus LRRGT00032 mRNA, complete cds	42	2.1
51	gb|AY063018.1| Arabidopsis thaliana unknown protein (At1g80130) ...	42	2.1
52	gb|AY034991.1| Arabidopsis thaliana unknown protein (At1g80130) ...	42	2.1
53	emb|AL596215.7| Mouse DNA sequence from clone RP23-278I21 on chr...	42	2.1
54	emb|BX294164.13| Zebrafish DNA sequence from clone CH211-266D19 ...	42	2.1
55	gb|BC099219.1| Rattus norvegicus cDNA clone IMAGE:7385410, parti...	42	2.1
56	dbj|AK132342.1| Mus musculus 15 days embryo head cDNA, RIKEN ful...	42	2.1
57	gb|BC026055.1| Mus musculus serine hydroxymethyl transferase 1 (...	42	2.1
58	dbj|AK010439.1| Mus musculus ES cells cDNA, RIKEN full-length en...	42	2.1
59	emb|BX821717.1|CNS0AA2F Arabidopsis thaliana Full-length cDNA Co...	42	2.1
60	gb|AF237702.1|AF237702 Mus musculus serine hydroxymethyltransfer...	42	2.1
61	gb|AE004954.1| Pseudomonas aeruginosa PAO1, section 515 of 529 o...	42	2.1
62	gb|AE004874.1| Pseudomonas aeruginosa PAO1, section 435 of 529 o...	42	2.1
63	gb|AE004671.1| Pseudomonas aeruginosa PAO1, section 232 of 529 o...	42	2.1
64	gb|AY087456.1| Arabidopsis thaliana clone 35675 mRNA, complete s...	42	2.1
65	ref|XM_213324.3| PREDICTED: Rattus norvegicus serine hydroxymeth...	42	2.1
66	dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome	42	2.1
67	emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,comp...	42	2.1
68	gb|AC009322.1|AC009322 Arabidopsis thaliana chromosome I BAC F18...	42	2.1
69	gb|AE015451.1| Pseudomonas putida KT2440 complete genome	42	2.1
70	gb|CP000159.1| Salinibacter ruber DSM 13855, complete genome	42	2.1
71	dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, comp...	42	2.1
72	emb|X94479.1|MMSHMT2 M.musculus mRNA for hydroxymethyltransferas...	42	2.1
73	emb|X94478.1|MMSHMT1 M.musculus mRNA for hydroxymethyltransferas...	42	2.1
74	ref|NM_103323.2| Arabidopsis thaliana glycine hydroxymethyltrans...	40	8.2
75	ref|XM_509157.1| PREDICTED: Pan troglodytes serine hydroxymethyl...	40	8.2
76	ref|NM_201034.1| Danio rerio zgc:63600 (zgc:63600), mRNA	40	8.2
77	ref|NM_178081.2| Mus musculus RIKEN cDNA 2210010L05 gene (221001...	40	8.2
78	ref|NM_133829.1| Mus musculus RIKEN cDNA 2210010L05 gene (221001...	40	8.2
79	gb|BC017534.1| Mus musculus RIKEN cDNA 2210010L05 gene, mRNA (cD...	40	8.2
80	ref|XM_414824.1| PREDICTED: Gallus gallus similar to Shmt1-prov ...	40	8.2
81	gb|BC055159.1| Danio rerio zgc:63600, mRNA (cDNA clone MGC:63600...	40	8.2
82	gb|BC013677.2| Homo sapiens serine hydroxymethyltransferase 2 (m...	40	8.2
83	gb|BC004825.1| Mus musculus serine hydroxymethyl transferase 2 (...	40	8.2
84	ref|NM_028230.2| Mus musculus serine hydroxymethyl transferase 2...	40	8.2
85	gb|AE016853.1| Pseudomonas syringae pv. tomato str. DC3000 compl...	40	8.2
86	gb|AC167719.2| Mus musculus BAC clone RP24-285I8 from chromosome...	40	8.2
87	gb|CP000058.1| Pseudomonas syringae pv. phaseolicola 1448A, comp...	40	8.2
88	gb|CP000352.1| Ralstonia metallidurans CH34, complete genome	40	8.2
89	gb|AC132302.3| Mus musculus BAC clone RP24-279N5 from chromosome...	40	8.2
90	gb|AC133190.2| Mus musculus BAC clone RP23-375H9 from chromosome...	40	8.2
91	gb|BC025355.1| Homo sapiens serine hydroxymethyltransferase 2 (m...	40	8.2
92	gb|BC032584.1| Homo sapiens serine hydroxymethyltransferase 2 (m...	40	8.2
93	gb|AC126007.16| Medicago truncatula clone mth2-11o4, complete se...	40	8.2
94	gb|BC008711.1| Homo sapiens serine hydroxymethyltransferase 2 (m...	40	8.2
95	ref|NM_005412.4| Homo sapiens serine hydroxymethyltransferase 2 ...	40	8.2
96	emb|BX647711.1|HSM807857 Homo sapiens mRNA; cDNA DKFZp686P09201 ...	40	8.2
97	emb|AL162755.2|NMA4Z2491 Neisseria meningitidis serogroup A stra...	40	8.2
98	gb|AY080702.1| Arabidopsis thaliana At1g36370 mRNA sequence	40	8.2
99	emb|AJ242841.1|NME242841 Neisseria meningitidis DNA for opcA reg...	40	8.2
100	gb|BT008088.1| Synthetic construct Homo sapiens serine hydroxyme...	40	8.2
101	gb|BT006866.1| Homo sapiens serine hydroxymethyltransferase 2 (m...	40	8.2
102	gb|BC044211.1| Homo sapiens serine hydroxymethyltransferase 2 (m...	40	8.2
103	emb|AJ276903.1|NME276903 Neisseria meningitidis glyA gene, parti...	40	8.2
104	gb|AC156615.7| Mus musculus chromosome 3, clone RP23-1B20, compl...	40	8.2
105	emb|CR613033.1| full-length cDNA clone CS0DA011YK08 of Neuroblas...	40	8.2
106	gb|AC025264.16| Homo sapiens 12 BAC RP11-704P17 (Roswell Park Ca...	40	8.2
107	gb|AC058822.6| Homo sapiens BAC clone RP11-809N18 from 4, comple...	40	8.2
108	dbj|AK162421.1| Mus musculus 12 days embryo embryonic body betwe...	40	8.2
109	ref|XM_683458.1| PREDICTED: Danio rerio similar to Spermidine sy...	40	8.2
110	dbj|AK171946.1| Mus musculus activated spleen cDNA, RIKEN full-l...	40	8.2
111	dbj|AK169192.1| Mus musculus 17 days embryo kidney cDNA, RIKEN f...	40	8.2
112	gb|U23143.1|HSU23143 Human mitochondrial serine hydroxymethyltra...	40	8.2
113	dbj|AK046866.1| Mus musculus 10 days neonate medulla oblongata c...	40	8.2
114	dbj|AK035995.1| Mus musculus 16 days neonate cerebellum cDNA, RI...	40	8.2
115	dbj|AK051207.1| Mus musculus 12 days embryo spinal ganglion cDNA...	40	8.2
116	dbj|AK012355.1| Mus musculus 11 days embryo whole body cDNA, RIK...	40	8.2
117	dbj|AK037339.1| Mus musculus 16 days neonate thymus cDNA, RIKEN ...	40	8.2
118	emb|BX813338.1|CNS0ADJ9 Arabidopsis thaliana Full-length cDNA Co...	40	8.2
119	dbj|AK223555.1| Homo sapiens mRNA for serine hydroxymethyltransf...	40	8.2
120	gb|AC021199.7|AC021199 Arabidopsis thaliana chromosome 1 BAC F7F...	40	8.2
121	gb|AC137834.9| Homo sapiens 12 BAC RP11-123K3 (Roswell Park Canc...	40	8.2
122	gb|AY084945.1| Arabidopsis thaliana clone 122515 mRNA, complete ...	40	8.2
123	ref|XM_237146.2| PREDICTED: Rattus norvegicus similar to express...	40	8.2
124	gb|BT002738.1| Arabidopsis thaliana clone C105220 putative hydro...	40	8.2
125	gb|BC091501.1| Homo sapiens serine hydroxymethyltransferase 2 (m...	40	8.2
126	emb|BX276083.4| Zebrafish DNA sequence from clone CH211-165N1 in...	40	8.2
127	gb|AY892794.1| Synthetic construct Homo sapiens clone FLH024514....	40	8.2
128	gb|AY890325.1| Synthetic construct Homo sapiens clone FLH024518....	40	8.2
129	gb|AY890324.1| Synthetic construct Homo sapiens clone FLH024517....	40	8.2
130	emb|BX648847.1|HSM808998 Homo sapiens mRNA; cDNA DKFZp686P05153 ...	40	8.2
131	emb|AJ276902.1|NME276902 Neisseria meningitidis glyA gene for pu...	40	8.2
132	emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome comple...	40	8.2
133	gb|BC011911.2| Homo sapiens serine hydroxymethyltransferase 2 (m...	40	8.2
134	gb|AC133936.5| Mus musculus BAC clone RP24-399H1 from chromosome...	40	8.2
135	gb|BC029324.1| Mus musculus RIKEN cDNA 2210010L05 gene, mRNA (cD...	40	8.2
136	gb|BC008066.2| Homo sapiens cDNA clone IMAGE:3010445, containing...	40	8.2
137	gb|BC051396.1| Mus musculus serine hydroxymethyl transferase 2 (...	40	8.2
138	gb|AC139299.3| Mus musculus BAC clone RP23-335D20 from 1, comple...	40	8.2
139	emb|CT009684.7| Mouse DNA sequence from clone RP23-127L21 on chr...	40	8.2
140	gb|AC160762.4| Mus musculus BAC clone RP24-330E8 from chromosome...	40	8.2

---

>dbj|AK101088.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033024L02, full
            insert sequence
          Length = 1944

 Score =  603 bits (304), Expect = e-169
 Identities = 521/592 (88%), Gaps = 1/592 (0%)
 Strand = Plus / Plus

                                                                        
Query: 5    atctgtggcgggagcgcgtacccacgggnactgggattatgccaggcttagggccatcgc 64
            ||||| ||||||||||||||||| |||| | |||||||| |||||| | |||||||||||
Sbjct: 834  atctgcggcgggagcgcgtacccgcggg-attgggattacgccaggttcagggccatcgc 892

                                                                        
Query: 65   ggacaagtgtggggccatgttgctgtgtgacatggcccatatcagcggtctcgttgctgc 124
            ||| ||||| || ||||||||||| || |||||||| || ||||| || || ||||| ||
Sbjct: 893  ggataagtgcggcgccatgttgctctgcgacatggctcacatcagtggcctagttgccgc 952

                                                                        
Query: 125  tcaggaggctacgaatccgtttgagtactctgatgtggttaccaccaccacccacaagag 184
             ||||||||| | ||||| ||| | || ||||||||||||||||||||||||||||||||
Sbjct: 953  gcaggaggctgcaaatccttttcaatattctgatgtggttaccaccaccacccacaagag 1012

                                                                        
Query: 185  tctccgagggccaaggtctggtatgatattctacaggaagggcccgaagcctcccaaaaa 244
            ||||||||||||||| ||||||||||| |||||||||||||||| |||||||||||| ||
Sbjct: 1013 tctccgagggccaagatctggtatgatcttctacaggaagggcctgaagcctcccaagaa 1072

                                                                        
Query: 245  aggccagcccgagggtgctctgtacgattatgaggacaagatcaactttgcagtgtttcc 304
            ||||||||| ||||| |||||||| || || ||||||| ||||||||| |||||||||||
Sbjct: 1073 aggccagcctgagggcgctctgtatgactacgaggacaggatcaacttcgcagtgtttcc 1132

                                                                        
Query: 305  atcacttcagggcggccctcacaaccaccagattgctgccctggcagttggccttaagca 364
             || || || || ||||||||||||||||| |||||||| || || |||||  | |||||
Sbjct: 1133 gtcgctccaagggggccctcacaaccaccaaattgctgcgctagcggttggtttgaagca 1192

                                                                        
Query: 365  ggccatgttacctggattcaaggcatatattcagcaggtcaaggtcaatgctgttgccct 424
            | | |||| ||||||||||||| | |||||| |||||||||||| |||||||||||||||
Sbjct: 1193 gactatgtcacctggattcaagtcttatattaagcaggtcaaggccaatgctgttgccct 1252

                                                                        
Query: 425  tggaaaccatctcatgagtaagggctacaagttggttactgatggaacagagaaccacct 484
            ||| |||||| | ||||||||||||||||| ||||||||||| |||||||||||||| ||
Sbjct: 1253 tggtaaccatttgatgagtaagggctacaaattggttactgacggaacagagaaccatct 1312

                                                                        
Query: 485  tgttctctgggatcttcgccctcttggcttgtctggtaacaaagtcgagaaagtatgtga 544
            ||||||||||||||| ||||||||||||||| ||||||||||||| ||||| || |||||
Sbjct: 1313 tgttctctgggatctgcgccctcttggcttgactggtaacaaagttgagaaggtctgtga 1372

                                                                
Query: 545  tctgagcagcattacactcaacaaaaatgctgtctttggtgacagcagtgca 596
            | || ||||||||||||| |||||||||||||||||||| || |||||||||
Sbjct: 1373 tttgtgcagcattacactgaacaaaaatgctgtctttggggatagcagtgca 1424

---

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score =  436 bits (220), Expect = e-119
 Identities = 352/396 (88%)
 Strand = Plus / Minus

                                                                            
Query: 127      aggaggctacgaatccgtttgagtactctgatgtggttaccaccaccacccacaagagtc 186
                |||||||| | ||||| ||| | || ||||||||||||||||||||||||||||||||||
Sbjct: 12439011 aggaggctgcaaatccttttcaatattctgatgtggttaccaccaccacccacaagagtc 12438952

                                                                            
Query: 187      tccgagggccaaggtctggtatgatattctacaggaagggcccgaagcctcccaaaaaag 246
                ||||||||||||| ||||||||||| |||||||||||||||| |||||||||||| ||||
Sbjct: 12438951 tccgagggccaagatctggtatgatcttctacaggaagggcctgaagcctcccaagaaag 12438892

                                                                            
Query: 247      gccagcccgagggtgctctgtacgattatgaggacaagatcaactttgcagtgtttccat 306
                ||||||| ||||| |||||||| || || ||||||| ||||||||| ||||||||||| |
Sbjct: 12438891 gccagcctgagggcgctctgtatgactacgaggacaggatcaacttcgcagtgtttccgt 12438832

                                                                            
Query: 307      cacttcagggcggccctcacaaccaccagattgctgccctggcagttggccttaagcagg 366
                | || || || ||||||||||||||||| |||||||| || || |||||  | |||||| 
Sbjct: 12438831 cgctccaagggggccctcacaaccaccaaattgctgcgctagcggttggtttgaagcaga 12438772

                                                                            
Query: 367      ccatgttacctggattcaaggcatatattcagcaggtcaaggtcaatgctgttgcccttg 426
                | |||| ||||||||||||| | |||||| |||||||||||| |||||||||||||||||
Sbjct: 12438771 ctatgtcacctggattcaagtcttatattaagcaggtcaaggccaatgctgttgcccttg 12438712

                                                                            
Query: 427      gaaaccatctcatgagtaagggctacaagttggttactgatggaacagagaaccaccttg 486
                | |||||| | ||||||||||||||||| ||||||||||| |||||||||||||| ||||
Sbjct: 12438711 gtaaccatttgatgagtaagggctacaaattggttactgacggaacagagaaccatcttg 12438652

                                                    
Query: 487      ttctctgggatcttcgccctcttggcttgtctggta 522
                ||||||||||||| ||||||||||||||| ||||||
Sbjct: 12438651 ttctctgggatctgcgccctcttggcttgactggta 12438616



 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 70/78 (89%)
 Strand = Plus / Minus

                                                                            
Query: 519      ggtaacaaagtcgagaaagtatgtgatctgagcagcattacactcaacaaaaatgctgtc 578
                ||||||||||| ||||| || |||||| || ||||||||||||| |||||||||||||||
Sbjct: 12438538 ggtaacaaagttgagaaggtctgtgatttgtgcagcattacactgaacaaaaatgctgtc 12438479

                                  
Query: 579      tttggtgacagcagtgca 596
                ||||| || |||||||||
Sbjct: 12438478 tttggggatagcagtgca 12438461



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 91/105 (86%), Gaps = 1/105 (0%)
 Strand = Plus / Minus

                                                                            
Query: 5        atctgtggcgggagcgcgtacccacgggnactgggattatgccaggcttagggccatcgc 64
                ||||| ||||||||||||||||| |||| | |||||||| |||||| | |||||||||||
Sbjct: 12440118 atctgcggcgggagcgcgtacccgcggg-attgggattacgccaggttcagggccatcgc 12440060

                                                             
Query: 65       ggacaagtgtggggccatgttgctgtgtgacatggcccatatcag 109
                ||| ||||| || ||||||||||| || |||||||| || |||||
Sbjct: 12440059 ggataagtgcggcgccatgttgctctgcgacatggctcacatcag 12440015

---

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  436 bits (220), Expect = e-119
 Identities = 352/396 (88%)
 Strand = Plus / Minus

                                                                            
Query: 127      aggaggctacgaatccgtttgagtactctgatgtggttaccaccaccacccacaagagtc 186
                |||||||| | ||||| ||| | || ||||||||||||||||||||||||||||||||||
Sbjct: 12393381 aggaggctgcaaatccttttcaatattctgatgtggttaccaccaccacccacaagagtc 12393322

                                                                            
Query: 187      tccgagggccaaggtctggtatgatattctacaggaagggcccgaagcctcccaaaaaag 246
                ||||||||||||| ||||||||||| |||||||||||||||| |||||||||||| ||||
Sbjct: 12393321 tccgagggccaagatctggtatgatcttctacaggaagggcctgaagcctcccaagaaag 12393262

                                                                            
Query: 247      gccagcccgagggtgctctgtacgattatgaggacaagatcaactttgcagtgtttccat 306
                ||||||| ||||| |||||||| || || ||||||| ||||||||| ||||||||||| |
Sbjct: 12393261 gccagcctgagggcgctctgtatgactacgaggacaggatcaacttcgcagtgtttccgt 12393202

                                                                            
Query: 307      cacttcagggcggccctcacaaccaccagattgctgccctggcagttggccttaagcagg 366
                | || || || ||||||||||||||||| |||||||| || || |||||  | |||||| 
Sbjct: 12393201 cgctccaagggggccctcacaaccaccaaattgctgcgctagcggttggtttgaagcaga 12393142

                                                                            
Query: 367      ccatgttacctggattcaaggcatatattcagcaggtcaaggtcaatgctgttgcccttg 426
                | |||| ||||||||||||| | |||||| |||||||||||| |||||||||||||||||
Sbjct: 12393141 ctatgtcacctggattcaagtcttatattaagcaggtcaaggccaatgctgttgcccttg 12393082

                                                                            
Query: 427      gaaaccatctcatgagtaagggctacaagttggttactgatggaacagagaaccaccttg 486
                | |||||| | ||||||||||||||||| ||||||||||| |||||||||||||| ||||
Sbjct: 12393081 gtaaccatttgatgagtaagggctacaaattggttactgacggaacagagaaccatcttg 12393022

                                                    
Query: 487      ttctctgggatcttcgccctcttggcttgtctggta 522
                ||||||||||||| ||||||||||||||| ||||||
Sbjct: 12393021 ttctctgggatctgcgccctcttggcttgactggta 12392986



 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 70/78 (89%)
 Strand = Plus / Minus

                                                                            
Query: 519      ggtaacaaagtcgagaaagtatgtgatctgagcagcattacactcaacaaaaatgctgtc 578
                ||||||||||| ||||| || |||||| || ||||||||||||| |||||||||||||||
Sbjct: 12392908 ggtaacaaagttgagaaggtctgtgatttgtgcagcattacactgaacaaaaatgctgtc 12392849

                                  
Query: 579      tttggtgacagcagtgca 596
                ||||| || |||||||||
Sbjct: 12392848 tttggggatagcagtgca 12392831



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 91/105 (86%), Gaps = 1/105 (0%)
 Strand = Plus / Minus

                                                                            
Query: 5        atctgtggcgggagcgcgtacccacgggnactgggattatgccaggcttagggccatcgc 64
                ||||| ||||||||||||||||| |||| | |||||||| |||||| | |||||||||||
Sbjct: 12394488 atctgcggcgggagcgcgtacccgcggg-attgggattacgccaggttcagggccatcgc 12394430

                                                             
Query: 65       ggacaagtgtggggccatgttgctgtgtgacatggcccatatcag 109
                ||| ||||| || ||||||||||| || |||||||| || |||||
Sbjct: 12394429 ggataagtgcggcgccatgttgctctgcgacatggctcacatcag 12394385

---

>emb|AL713942.4|CNS07YPB Oryza sativa chromosome 12, . BAC OSJNBa0009F05 of library OSJNBa from
              chromosome 12 of cultivar Nipponbare of ssp. japonica of
              Oryza sativa (rice), complete sequence
          Length = 163702

 Score =  436 bits (220), Expect = e-119
 Identities = 352/396 (88%)
 Strand = Plus / Minus

                                                                          
Query: 127    aggaggctacgaatccgtttgagtactctgatgtggttaccaccaccacccacaagagtc 186
              |||||||| | ||||| ||| | || ||||||||||||||||||||||||||||||||||
Sbjct: 153376 aggaggctgcaaatccttttcaatattctgatgtggttaccaccaccacccacaagagtc 153317

                                                                          
Query: 187    tccgagggccaaggtctggtatgatattctacaggaagggcccgaagcctcccaaaaaag 246
              ||||||||||||| ||||||||||| |||||||||||||||| |||||||||||| ||||
Sbjct: 153316 tccgagggccaagatctggtatgatcttctacaggaagggcctgaagcctcccaagaaag 153257

                                                                          
Query: 247    gccagcccgagggtgctctgtacgattatgaggacaagatcaactttgcagtgtttccat 306
              ||||||| ||||| |||||||| || || ||||||| ||||||||| ||||||||||| |
Sbjct: 153256 gccagcctgagggcgctctgtatgactacgaggacaggatcaacttcgcagtgtttccgt 153197

                                                                          
Query: 307    cacttcagggcggccctcacaaccaccagattgctgccctggcagttggccttaagcagg 366
              | || || || ||||||||||||||||| |||||||| || || |||||  | |||||| 
Sbjct: 153196 cgctccaagggggccctcacaaccaccaaattgctgcgctagcggttggtttgaagcaga 153137

                                                                          
Query: 367    ccatgttacctggattcaaggcatatattcagcaggtcaaggtcaatgctgttgcccttg 426
              | |||| ||||||||||||| | |||||| |||||||||||| |||||||||||||||||
Sbjct: 153136 ctatgtcacctggattcaagtcttatattaagcaggtcaaggccaatgctgttgcccttg 153077

                                                                          
Query: 427    gaaaccatctcatgagtaagggctacaagttggttactgatggaacagagaaccaccttg 486
              | |||||| | ||||||||||||||||| ||||||||||| |||||||||||||| ||||
Sbjct: 153076 gtaaccatttgatgagtaagggctacaaattggttactgacggaacagagaaccatcttg 153017

                                                  
Query: 487    ttctctgggatcttcgccctcttggcttgtctggta 522
              ||||||||||||| ||||||||||||||| ||||||
Sbjct: 153016 ttctctgggatctgcgccctcttggcttgactggta 152981



 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 70/78 (89%)
 Strand = Plus / Minus

                                                                          
Query: 519    ggtaacaaagtcgagaaagtatgtgatctgagcagcattacactcaacaaaaatgctgtc 578
              ||||||||||| ||||| || |||||| || ||||||||||||| |||||||||||||||
Sbjct: 152903 ggtaacaaagttgagaaggtctgtgatttgtgcagcattacactgaacaaaaatgctgtc 152844

                                
Query: 579    tttggtgacagcagtgca 596
              ||||| || |||||||||
Sbjct: 152843 tttggggatagcagtgca 152826



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 91/105 (86%), Gaps = 1/105 (0%)
 Strand = Plus / Minus

                                                                          
Query: 5      atctgtggcgggagcgcgtacccacgggnactgggattatgccaggcttagggccatcgc 64
              ||||| ||||||||||||||||| |||| | |||||||| |||||| | |||||||||||
Sbjct: 154483 atctgcggcgggagcgcgtacccgcggg-attgggattacgccaggttcagggccatcgc 154425

                                                           
Query: 65     ggacaagtgtggggccatgttgctgtgtgacatggcccatatcag 109
              ||| ||||| || ||||||||||| || |||||||| || |||||
Sbjct: 154424 ggataagtgcggcgccatgttgctctgcgacatggctcacatcag 154380

---

>emb|AL954826.3|CNS08CD2 Oryza sativa chromosome 12, . BAC OSJNBb0080P14 of library OSJNBb from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 132241

 Score =  436 bits (220), Expect = e-119
 Identities = 352/396 (88%)
 Strand = Plus / Minus

                                                                         
Query: 127   aggaggctacgaatccgtttgagtactctgatgtggttaccaccaccacccacaagagtc 186
             |||||||| | ||||| ||| | || ||||||||||||||||||||||||||||||||||
Sbjct: 40489 aggaggctgcaaatccttttcaatattctgatgtggttaccaccaccacccacaagagtc 40430

                                                                         
Query: 187   tccgagggccaaggtctggtatgatattctacaggaagggcccgaagcctcccaaaaaag 246
             ||||||||||||| ||||||||||| |||||||||||||||| |||||||||||| ||||
Sbjct: 40429 tccgagggccaagatctggtatgatcttctacaggaagggcctgaagcctcccaagaaag 40370

                                                                         
Query: 247   gccagcccgagggtgctctgtacgattatgaggacaagatcaactttgcagtgtttccat 306
             ||||||| ||||| |||||||| || || ||||||| ||||||||| ||||||||||| |
Sbjct: 40369 gccagcctgagggcgctctgtatgactacgaggacaggatcaacttcgcagtgtttccgt 40310

                                                                         
Query: 307   cacttcagggcggccctcacaaccaccagattgctgccctggcagttggccttaagcagg 366
             | || || || ||||||||||||||||| |||||||| || || |||||  | |||||| 
Sbjct: 40309 cgctccaagggggccctcacaaccaccaaattgctgcgctagcggttggtttgaagcaga 40250

                                                                         
Query: 367   ccatgttacctggattcaaggcatatattcagcaggtcaaggtcaatgctgttgcccttg 426
             | |||| ||||||||||||| | |||||| |||||||||||| |||||||||||||||||
Sbjct: 40249 ctatgtcacctggattcaagtcttatattaagcaggtcaaggccaatgctgttgcccttg 40190

                                                                         
Query: 427   gaaaccatctcatgagtaagggctacaagttggttactgatggaacagagaaccaccttg 486
             | |||||| | ||||||||||||||||| ||||||||||| |||||||||||||| ||||
Sbjct: 40189 gtaaccatttgatgagtaagggctacaaattggttactgacggaacagagaaccatcttg 40130

                                                 
Query: 487   ttctctgggatcttcgccctcttggcttgtctggta 522
             ||||||||||||| ||||||||||||||| ||||||
Sbjct: 40129 ttctctgggatctgcgccctcttggcttgactggta 40094



 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 70/78 (89%)
 Strand = Plus / Minus

                                                                         
Query: 519   ggtaacaaagtcgagaaagtatgtgatctgagcagcattacactcaacaaaaatgctgtc 578
             ||||||||||| ||||| || |||||| || ||||||||||||| |||||||||||||||
Sbjct: 40016 ggtaacaaagttgagaaggtctgtgatttgtgcagcattacactgaacaaaaatgctgtc 39957

                               
Query: 579   tttggtgacagcagtgca 596
             ||||| || |||||||||
Sbjct: 39956 tttggggatagcagtgca 39939



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 91/105 (86%), Gaps = 1/105 (0%)
 Strand = Plus / Minus

                                                                         
Query: 5     atctgtggcgggagcgcgtacccacgggnactgggattatgccaggcttagggccatcgc 64
             ||||| ||||||||||||||||| |||| | |||||||| |||||| | |||||||||||
Sbjct: 41596 atctgcggcgggagcgcgtacccgcggg-attgggattacgccaggttcagggccatcgc 41538

                                                          
Query: 65    ggacaagtgtggggccatgttgctgtgtgacatggcccatatcag 109
             ||| ||||| || ||||||||||| || |||||||| || |||||
Sbjct: 41537 ggataagtgcggcgccatgttgctctgcgacatggctcacatcag 41493

---

>dbj|AK105983.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-205-G03, full
           insert sequence
          Length = 1153

 Score =  398 bits (201), Expect = e-108
 Identities = 499/597 (83%), Gaps = 1/597 (0%)
 Strand = Plus / Plus

                                                                       
Query: 5   atctgtggcgggagcgcgtacccacgggnactgggattatgccaggcttagggccatcgc 64
           ||||| ||||| |||||||||||  ||| ||||||| || |||| ||| |||||| ||||
Sbjct: 2   atctgcggcggcagcgcgtacccgaggg-actgggactacgccaagctcagggccgtcgc 60

                                                                       
Query: 65  ggacaagtgtggggccatgttgctgtgtgacatggcccatatcagcggtctcgttgctgc 124
            ||||||   |||||  || | || || |||||||| || |||||||| ||||| || ||
Sbjct: 61  cgacaaggtcggggcgctgctcctctgcgacatggcgcacatcagcggcctcgtcgccgc 120

                                                                       
Query: 125 tcaggaggctacgaatccgtttgagtactctgatgtggttaccaccaccacccacaagag 184
            ||||| ||| | ||||| |||||||||| ||||||||||||||||||||| ||||||  
Sbjct: 121 gcaggaagctgcaaatccttttgagtactgtgatgtggttaccaccaccacgcacaagtc 180

                                                                       
Query: 185 tctccgagggccaaggtctggtatgatattctacaggaagggcccgaagcctcccaaaaa 244
            |||||||| |||||  |||| ||||| ||||||||||||||||| ||||||||||| ||
Sbjct: 181 cctccgaggaccaagagctggcatgatcttctacaggaagggccctaagcctcccaagaa 240

                                                                       
Query: 245 aggccagcccgagggtgctctgtacgattatgaggacaagatcaactttgcagtgtttcc 304
            |||||||| ||||||||| | || || || ||||||||||||||||| |||||||| ||
Sbjct: 241 gggccagcctgagggtgctgtctatgactacgaggacaagatcaacttcgcagtgttccc 300

                                                                       
Query: 305 atcacttcagggcggccctcacaaccaccagattgctgccctggcagttggccttaagca 364
            ||||| || || || |||||||||||||||||||| ||||| || ||||  ||  ||||
Sbjct: 301 gtcactgcaaggtggtcctcacaaccaccagattgcagcccttgctgttgctctgcagca 360

                                                                       
Query: 365 ggccatgttacctggattcaaggcatatattcagcaggtcaaggtcaatgctgttgccct 424
             |||||  ||||||||||||||| ||     |||||||||||| ||| ||||| ||| |
Sbjct: 361 aaccatgacacctggattcaaggcctacgcaaagcaggtcaaggccaacgctgtcgccat 420

                                                                       
Query: 425 tggaaaccatctcatgagtaagggctacaagttggttactgatggaacagagaaccacct 484
           ||| ||  |||| ||||| |||||||||||  |||| ||||||||||| |||||||||||
Sbjct: 421 tggcaagtatcttatgagcaagggctacaaaatggtgactgatggaactgagaaccacct 480

                                                                       
Query: 485 tgttctctgggatcttcgccctcttggcttgtctggtaacaaagtcgagaaagtatgtga 544
           ||||||||||||||||||||||||||||||| |||| ||||| || |||||  | |||||
Sbjct: 481 tgttctctgggatcttcgccctcttggcttgactggcaacaaggttgagaagatgtgtga 540

                                                                    
Query: 545 tctgagcagcattacactcaacaaaaatgctgtctttggtgacagcagtgcattggc 601
            ||  ||||||||||||| ||||| ||||||||||||||||||||||||||||||||
Sbjct: 541 cctttgcagcattacacttaacaagaatgctgtctttggtgacagcagtgcattggc 597

---

>dbj|AK105624.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-200-C10, full
            insert sequence
          Length = 1811

 Score =  398 bits (201), Expect = e-108
 Identities = 499/597 (83%), Gaps = 1/597 (0%)
 Strand = Plus / Plus

                                                                        
Query: 5    atctgtggcgggagcgcgtacccacgggnactgggattatgccaggcttagggccatcgc 64
            ||||| ||||| |||||||||||  ||| ||||||| || |||| ||| |||||| ||||
Sbjct: 636  atctgcggcggcagcgcgtacccgaggg-actgggactacgccaagctcagggccgtcgc 694

                                                                        
Query: 65   ggacaagtgtggggccatgttgctgtgtgacatggcccatatcagcggtctcgttgctgc 124
             ||||||   |||||  || | || || |||||||| || |||||||| ||||| || ||
Sbjct: 695  cgacaaggtcggggcgctgctcctctgcgacatggcgcacatcagcggcctcgtcgccgc 754

                                                                        
Query: 125  tcaggaggctacgaatccgtttgagtactctgatgtggttaccaccaccacccacaagag 184
             ||||| ||| | ||||| |||||||||| ||||||||||||||||||||| ||||||  
Sbjct: 755  gcaggaagctgcaaatccttttgagtactgtgatgtggttaccaccaccacgcacaagtc 814

                                                                        
Query: 185  tctccgagggccaaggtctggtatgatattctacaggaagggcccgaagcctcccaaaaa 244
             |||||||| |||||  |||| ||||| ||||||||||||||||| ||||||||||| ||
Sbjct: 815  cctccgaggaccaagagctggcatgatcttctacaggaagggccctaagcctcccaagaa 874

                                                                        
Query: 245  aggccagcccgagggtgctctgtacgattatgaggacaagatcaactttgcagtgtttcc 304
             |||||||| ||||||||| | || || || ||||||||||||||||| |||||||| ||
Sbjct: 875  gggccagcctgagggtgctgtctatgactacgaggacaagatcaacttcgcagtgttccc 934

                                                                        
Query: 305  atcacttcagggcggccctcacaaccaccagattgctgccctggcagttggccttaagca 364
             ||||| || || || |||||||||||||||||||| ||||| || ||||  ||  ||||
Sbjct: 935  gtcactgcaaggtggtcctcacaaccaccagattgcagcccttgctgttgctctgcagca 994

                                                                        
Query: 365  ggccatgttacctggattcaaggcatatattcagcaggtcaaggtcaatgctgttgccct 424
              |||||  ||||||||||||||| ||     |||||||||||| ||| ||||| ||| |
Sbjct: 995  aaccatgacacctggattcaaggcctacgcaaagcaggtcaaggccaacgctgtcgccat 1054

                                                                        
Query: 425  tggaaaccatctcatgagtaagggctacaagttggttactgatggaacagagaaccacct 484
            ||| ||  |||| ||||| |||||||||||  |||| ||||||||||| |||||||||||
Sbjct: 1055 tggcaagtatcttatgagcaagggctacaaaatggtgactgatggaactgagaaccacct 1114

                                                                        
Query: 485  tgttctctgggatcttcgccctcttggcttgtctggtaacaaagtcgagaaagtatgtga 544
            ||||||||||||||||||||||||||||||| |||| ||||| || |||||  | |||||
Sbjct: 1115 tgttctctgggatcttcgccctcttggcttgactggcaacaaggttgagaagatgtgtga 1174

                                                                     
Query: 545  tctgagcagcattacactcaacaaaaatgctgtctttggtgacagcagtgcattggc 601
             ||  ||||||||||||| ||||| ||||||||||||||||||||||||||||||||
Sbjct: 1175 cctttgcagcattacacttaacaagaatgctgtctttggtgacagcagtgcattggc 1231

---

>dbj|AK101450.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033039N02, full
            insert sequence
          Length = 1896

 Score =  398 bits (201), Expect = e-108
 Identities = 499/597 (83%), Gaps = 1/597 (0%)
 Strand = Plus / Plus

                                                                        
Query: 5    atctgtggcgggagcgcgtacccacgggnactgggattatgccaggcttagggccatcgc 64
            ||||| ||||| |||||||||||  ||| ||||||| || |||| ||| |||||| ||||
Sbjct: 637  atctgcggcggcagcgcgtacccgaggg-actgggactacgccaagctcagggccgtcgc 695

                                                                        
Query: 65   ggacaagtgtggggccatgttgctgtgtgacatggcccatatcagcggtctcgttgctgc 124
             ||||||   |||||  || | || || |||||||| || |||||||| ||||| || ||
Sbjct: 696  cgacaaggtcggggcgctgctcctctgcgacatggcgcacatcagcggcctcgtcgccgc 755

                                                                        
Query: 125  tcaggaggctacgaatccgtttgagtactctgatgtggttaccaccaccacccacaagag 184
             ||||| ||| | ||||| |||||||||| ||||||||||||||||||||| ||||||  
Sbjct: 756  gcaggaagctgcaaatccttttgagtactgtgatgtggttaccaccaccacgcacaagtc 815

                                                                        
Query: 185  tctccgagggccaaggtctggtatgatattctacaggaagggcccgaagcctcccaaaaa 244
             |||||||| |||||  |||| ||||| ||||||||||||||||| ||||||||||| ||
Sbjct: 816  cctccgaggaccaagagctggcatgatcttctacaggaagggccctaagcctcccaagaa 875

                                                                        
Query: 245  aggccagcccgagggtgctctgtacgattatgaggacaagatcaactttgcagtgtttcc 304
             |||||||| ||||||||| | || || || ||||||||||||||||| |||||||| ||
Sbjct: 876  gggccagcctgagggtgctgtctatgactacgaggacaagatcaacttcgcagtgttccc 935

                                                                        
Query: 305  atcacttcagggcggccctcacaaccaccagattgctgccctggcagttggccttaagca 364
             ||||| || || || |||||||||||||||||||| ||||| || ||||  ||  ||||
Sbjct: 936  gtcactgcaaggtggtcctcacaaccaccagattgcagcccttgctgttgctctgcagca 995

                                                                        
Query: 365  ggccatgttacctggattcaaggcatatattcagcaggtcaaggtcaatgctgttgccct 424
              |||||  ||||||||||||||| ||     |||||||||||| ||| ||||| ||| |
Sbjct: 996  aaccatgacacctggattcaaggcctacgcaaagcaggtcaaggccaacgctgtcgccat 1055

                                                                        
Query: 425  tggaaaccatctcatgagtaagggctacaagttggttactgatggaacagagaaccacct 484
            ||| ||  |||| ||||| |||||||||||  |||| ||||||||||| |||||||||||
Sbjct: 1056 tggcaagtatcttatgagcaagggctacaaaatggtgactgatggaactgagaaccacct 1115

                                                                        
Query: 485  tgttctctgggatcttcgccctcttggcttgtctggtaacaaagtcgagaaagtatgtga 544
            ||||||||||||||||||||||||||||||| |||| ||||| || |||||  | |||||
Sbjct: 1116 tgttctctgggatcttcgccctcttggcttgactggcaacaaggttgagaagatgtgtga 1175

                                                                     
Query: 545  tctgagcagcattacactcaacaaaaatgctgtctttggtgacagcagtgcattggc 601
             ||  ||||||||||||| ||||| ||||||||||||||||||||||||||||||||
Sbjct: 1176 cctttgcagcattacacttaacaagaatgctgtctttggtgacagcagtgcattggc 1232

---

>dbj|AK071541.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023100I04, full
            insert sequence
          Length = 1811

 Score =  398 bits (201), Expect = e-108
 Identities = 499/597 (83%), Gaps = 1/597 (0%)
 Strand = Plus / Plus

                                                                        
Query: 5    atctgtggcgggagcgcgtacccacgggnactgggattatgccaggcttagggccatcgc 64
            ||||| ||||| |||||||||||  ||| ||||||| || |||| ||| |||||| ||||
Sbjct: 637  atctgcggcggcagcgcgtacccgaggg-actgggactacgccaagctcagggccgtcgc 695

                                                                        
Query: 65   ggacaagtgtggggccatgttgctgtgtgacatggcccatatcagcggtctcgttgctgc 124
             ||||||   |||||  || | || || |||||||| || |||||||| ||||| || ||
Sbjct: 696  cgacaaggtcggggcgctgctcctctgcgacatggcgcacatcagcggcctcgtcgccgc 755

                                                                        
Query: 125  tcaggaggctacgaatccgtttgagtactctgatgtggttaccaccaccacccacaagag 184
             ||||| ||| | ||||| |||||||||| ||||||||||||||||||||| ||||||  
Sbjct: 756  gcaggaagctgcaaatccttttgagtactgtgatgtggttaccaccaccacgcacaagtc 815

                                                                        
Query: 185  tctccgagggccaaggtctggtatgatattctacaggaagggcccgaagcctcccaaaaa 244
             |||||||| |||||  |||| ||||| ||||||||||||||||| ||||||||||| ||
Sbjct: 816  cctccgaggaccaagagctggcatgatcttctacaggaagggccctaagcctcccaagaa 875

                                                                        
Query: 245  aggccagcccgagggtgctctgtacgattatgaggacaagatcaactttgcagtgtttcc 304
             |||||||| ||||||||| | || || || ||||||||||||||||| |||||||| ||
Sbjct: 876  gggccagcctgagggtgctgtctatgactacgaggacaagatcaacttcgcagtgttccc 935

                                                                        
Query: 305  atcacttcagggcggccctcacaaccaccagattgctgccctggcagttggccttaagca 364
             ||||| || || || |||||||||||||||||||| ||||| || ||||  ||  ||||
Sbjct: 936  gtcactgcaaggtggtcctcacaaccaccagattgcagcccttgctgttgctctgcagca 995

                                                                        
Query: 365  ggccatgttacctggattcaaggcatatattcagcaggtcaaggtcaatgctgttgccct 424
              |||||  ||||||||||||||| ||     |||||||||||| ||| ||||| ||| |
Sbjct: 996  aaccatgacacctggattcaaggcctacgcaaagcaggtcaaggccaacgctgtcgccat 1055

                                                                        
Query: 425  tggaaaccatctcatgagtaagggctacaagttggttactgatggaacagagaaccacct 484
            ||| ||  |||| ||||| |||||||||||  |||| ||||||||||| |||||||||||
Sbjct: 1056 tggcaagtatcttatgagcaagggctacaaaatggtgactgatggaactgagaaccacct 1115

                                                                        
Query: 485  tgttctctgggatcttcgccctcttggcttgtctggtaacaaagtcgagaaagtatgtga 544
            ||||||||||||||||||||||||||||||| |||| ||||| || |||||  | |||||
Sbjct: 1116 tgttctctgggatcttcgccctcttggcttgactggcaacaaggttgagaagatgtgtga 1175

                                                                     
Query: 545  tctgagcagcattacactcaacaaaaatgctgtctttggtgacagcagtgcattggc 601
             ||  ||||||||||||| ||||| ||||||||||||||||||||||||||||||||
Sbjct: 1176 cctttgcagcattacacttaacaagaatgctgtctttggtgacagcagtgcattggc 1232

---

>gb|AY105338.1| Zea mays PCO102700 mRNA sequence
          Length = 1951

 Score =  369 bits (186), Expect = 7e-99
 Identities = 471/566 (83%)
 Strand = Plus / Plus

                                                                        
Query: 34   actgggattatgccaggcttagggccatcgcggacaagtgtggggccatgttgctgtgtg 93
            |||||||||| |||| ||| |||||| |||| ||||||   |||||| || |||| || |
Sbjct: 792  actgggattacgccaagctcagggccgtcgccgacaaggtcggggccctgctgctctgcg 851

                                                                        
Query: 94   acatggcccatatcagcggtctcgttgctgctcaggaggctacgaatccgtttgagtact 153
            ||||||| || |||||||| ||||| || || ||||| ||| | ||||| ||||| || |
Sbjct: 852  acatggcgcacatcagcgggctcgtcgccgcgcaggaagctgcaaatccttttgaatatt 911

                                                                        
Query: 154  ctgatgtggttaccaccaccacccacaagagtctccgagggccaaggtctggtatgatat 213
             ||||||||||||||| ||||| ||||||   ||| ||||||||||| |||| ||||| |
Sbjct: 912  gtgatgtggttaccacaaccacgcacaagtccctcagagggccaagggctggcatgatct 971

                                                                        
Query: 214  tctacaggaagggcccgaagcctcccaaaaaaggccagcccgagggtgctctgtacgatt 273
            |||||||||| ||||| ||||| ||||| || |||||||| ||||||||| | || ||||
Sbjct: 972  tctacaggaaaggccctaagccccccaagaagggccagcctgagggtgctgtttatgatt 1031

                                                                        
Query: 274  atgaggacaagatcaactttgcagtgtttccatcacttcagggcggccctcacaaccacc 333
            | || ||||||||||||||||||||||| ||||| || || || ||||||||||||||||
Sbjct: 1032 acgaagacaagatcaactttgcagtgttcccatctctccaaggtggccctcacaaccacc 1091

                                                                        
Query: 334  agattgctgccctggcagttggccttaagcaggccatgttacctggattcaaggcatata 393
            |||||||||| || || ||||  ||  ||||  | ||||  ||||| |||||||| ||| 
Sbjct: 1092 agattgctgcacttgctgttgctctacagcaaactatgtcgcctggcttcaaggcctatg 1151

                                                                        
Query: 394  ttcagcaggtcaaggtcaatgctgttgcccttggaaaccatctcatgagtaagggctaca 453
               |||| || |||| ||||||||||||  |||||||| |||||||||| ||||||||||
Sbjct: 1152 caaagcaagtgaaggccaatgctgttgcaattggaaactatctcatgagcaagggctaca 1211

                                                                        
Query: 454  agttggttactgatggaacagagaaccaccttgttctctgggatcttcgccctcttggct 513
            || |||| ||||||||||| |||||||||||||||||||||||||| ||||| |||||||
Sbjct: 1212 agatggtgactgatggaactgagaaccaccttgttctctgggatctccgcccccttggct 1271

                                                                        
Query: 514  tgtctggtaacaaagtcgagaaagtatgtgatctgagcagcattacactcaacaaaaatg 573
            || |||| ||||| ||||| ||  ||||||||||  ||  ||| ||| | ||||| ||||
Sbjct: 1272 tgactggaaacaaggtcgaaaagctatgtgatctttgccacatcacattgaacaagaatg 1331

                                      
Query: 574  ctgtctttggtgacagcagtgcattg 599
            ||||||| ||||||||||||||||||
Sbjct: 1332 ctgtcttcggtgacagcagtgcattg 1357

---

>gb|AC137752.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0041C22, complete sequence
          Length = 161172

 Score =  303 bits (153), Expect = 4e-79
 Identities = 327/385 (84%)
 Strand = Plus / Plus

                                                                         
Query: 138   aatccgtttgagtactctgatgtggttaccaccaccacccacaagagtctccgagggcca 197
             ||||| |||||||||| ||||||||||||||||||||| ||||||   |||||||| |||
Sbjct: 85660 aatccttttgagtactgtgatgtggttaccaccaccacgcacaagtccctccgaggacca 85719

                                                                         
Query: 198   aggtctggtatgatattctacaggaagggcccgaagcctcccaaaaaaggccagcccgag 257
             ||  |||| ||||| ||||||||||||||||| ||||||||||| || |||||||| |||
Sbjct: 85720 agagctggcatgatcttctacaggaagggccctaagcctcccaagaagggccagcctgag 85779

                                                                         
Query: 258   ggtgctctgtacgattatgaggacaagatcaactttgcagtgtttccatcacttcagggc 317
             |||||| | || || || ||||||||||||||||| |||||||| || ||||| || || 
Sbjct: 85780 ggtgctgtctatgactacgaggacaagatcaacttcgcagtgttcccgtcactgcaaggt 85839

                                                                         
Query: 318   ggccctcacaaccaccagattgctgccctggcagttggccttaagcaggccatgttacct 377
             || |||||||||||||||||||| ||||| || ||||  ||  ||||  |||||  ||||
Sbjct: 85840 ggtcctcacaaccaccagattgcagcccttgctgttgctctgcagcaaaccatgacacct 85899

                                                                         
Query: 378   ggattcaaggcatatattcagcaggtcaaggtcaatgctgttgcccttggaaaccatctc 437
             ||||||||||| ||     |||||||||||| ||| ||||| ||| |||| ||  |||| 
Sbjct: 85900 ggattcaaggcctacgcaaagcaggtcaaggccaacgctgtcgccattggcaagtatctt 85959

                                                                         
Query: 438   atgagtaagggctacaagttggttactgatggaacagagaaccaccttgttctctgggat 497
             ||||| |||||||||||  |||| ||||||||||| ||||||||||||||||||||||||
Sbjct: 85960 atgagcaagggctacaaaatggtgactgatggaactgagaaccaccttgttctctgggat 86019

                                      
Query: 498   cttcgccctcttggcttgtctggta 522
             |||||||||||||||||| ||||||
Sbjct: 86020 cttcgccctcttggcttgactggta 86044



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 50/52 (96%)
 Strand = Plus / Plus

                                                                 
Query: 550   gcagcattacactcaacaaaaatgctgtctttggtgacagcagtgcattggc 601
             ||||||||||||| ||||| ||||||||||||||||||||||||||||||||
Sbjct: 86165 gcagcattacacttaacaagaatgctgtctttggtgacagcagtgcattggc 86216

---

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score =  303 bits (153), Expect = 4e-79
 Identities = 327/385 (84%)
 Strand = Plus / Plus

                                                                            
Query: 138      aatccgtttgagtactctgatgtggttaccaccaccacccacaagagtctccgagggcca 197
                ||||| |||||||||| ||||||||||||||||||||| ||||||   |||||||| |||
Sbjct: 14862594 aatccttttgagtactgtgatgtggttaccaccaccacgcacaagtccctccgaggacca 14862653

                                                                            
Query: 198      aggtctggtatgatattctacaggaagggcccgaagcctcccaaaaaaggccagcccgag 257
                ||  |||| ||||| ||||||||||||||||| ||||||||||| || |||||||| |||
Sbjct: 14862654 agagctggcatgatcttctacaggaagggccctaagcctcccaagaagggccagcctgag 14862713

                                                                            
Query: 258      ggtgctctgtacgattatgaggacaagatcaactttgcagtgtttccatcacttcagggc 317
                |||||| | || || || ||||||||||||||||| |||||||| || ||||| || || 
Sbjct: 14862714 ggtgctgtctatgactacgaggacaagatcaacttcgcagtgttcccgtcactgcaaggt 14862773

                                                                            
Query: 318      ggccctcacaaccaccagattgctgccctggcagttggccttaagcaggccatgttacct 377
                || |||||||||||||||||||| ||||| || ||||  ||  ||||  |||||  ||||
Sbjct: 14862774 ggtcctcacaaccaccagattgcagcccttgctgttgctctgcagcaaaccatgacacct 14862833

                                                                            
Query: 378      ggattcaaggcatatattcagcaggtcaaggtcaatgctgttgcccttggaaaccatctc 437
                ||||||||||| ||     |||||||||||| ||| ||||| ||| |||| ||  |||| 
Sbjct: 14862834 ggattcaaggcctacgcaaagcaggtcaaggccaacgctgtcgccattggcaagtatctt 14862893

                                                                            
Query: 438      atgagtaagggctacaagttggttactgatggaacagagaaccaccttgttctctgggat 497
                ||||| |||||||||||  |||| ||||||||||| ||||||||||||||||||||||||
Sbjct: 14862894 atgagcaagggctacaaaatggtgactgatggaactgagaaccaccttgttctctgggat 14862953

                                         
Query: 498      cttcgccctcttggcttgtctggta 522
                |||||||||||||||||| ||||||
Sbjct: 14862954 cttcgccctcttggcttgactggta 14862978



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 50/52 (96%)
 Strand = Plus / Plus

                                                                    
Query: 550      gcagcattacactcaacaaaaatgctgtctttggtgacagcagtgcattggc 601
                ||||||||||||| ||||| ||||||||||||||||||||||||||||||||
Sbjct: 14863099 gcagcattacacttaacaagaatgctgtctttggtgacagcagtgcattggc 14863150

---

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  303 bits (153), Expect = 4e-79
 Identities = 327/385 (84%)
 Strand = Plus / Plus

                                                                            
Query: 138      aatccgtttgagtactctgatgtggttaccaccaccacccacaagagtctccgagggcca 197
                ||||| |||||||||| ||||||||||||||||||||| ||||||   |||||||| |||
Sbjct: 14942561 aatccttttgagtactgtgatgtggttaccaccaccacgcacaagtccctccgaggacca 14942620

                                                                            
Query: 198      aggtctggtatgatattctacaggaagggcccgaagcctcccaaaaaaggccagcccgag 257
                ||  |||| ||||| ||||||||||||||||| ||||||||||| || |||||||| |||
Sbjct: 14942621 agagctggcatgatcttctacaggaagggccctaagcctcccaagaagggccagcctgag 14942680

                                                                            
Query: 258      ggtgctctgtacgattatgaggacaagatcaactttgcagtgtttccatcacttcagggc 317
                |||||| | || || || ||||||||||||||||| |||||||| || ||||| || || 
Sbjct: 14942681 ggtgctgtctatgactacgaggacaagatcaacttcgcagtgttcccgtcactgcaaggt 14942740

                                                                            
Query: 318      ggccctcacaaccaccagattgctgccctggcagttggccttaagcaggccatgttacct 377
                || |||||||||||||||||||| ||||| || ||||  ||  ||||  |||||  ||||
Sbjct: 14942741 ggtcctcacaaccaccagattgcagcccttgctgttgctctgcagcaaaccatgacacct 14942800

                                                                            
Query: 378      ggattcaaggcatatattcagcaggtcaaggtcaatgctgttgcccttggaaaccatctc 437
                ||||||||||| ||     |||||||||||| ||| ||||| ||| |||| ||  |||| 
Sbjct: 14942801 ggattcaaggcctacgcaaagcaggtcaaggccaacgctgtcgccattggcaagtatctt 14942860

                                                                            
Query: 438      atgagtaagggctacaagttggttactgatggaacagagaaccaccttgttctctgggat 497
                ||||| |||||||||||  |||| ||||||||||| ||||||||||||||||||||||||
Sbjct: 14942861 atgagcaagggctacaaaatggtgactgatggaactgagaaccaccttgttctctgggat 14942920

                                         
Query: 498      cttcgccctcttggcttgtctggta 522
                |||||||||||||||||| ||||||
Sbjct: 14942921 cttcgccctcttggcttgactggta 14942945



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 50/52 (96%)
 Strand = Plus / Plus

                                                                    
Query: 550      gcagcattacactcaacaaaaatgctgtctttggtgacagcagtgcattggc 601
                ||||||||||||| ||||| ||||||||||||||||||||||||||||||||
Sbjct: 14943066 gcagcattacacttaacaagaatgctgtctttggtgacagcagtgcattggc 14943117

---

>gb|AY224188.1| Medicago truncatula adenosylhomocysteinase (AHC1) gene, complete cds
          Length = 99431

 Score =  163 bits (82), Expect = 8e-37
 Identities = 262/322 (81%)
 Strand = Plus / Plus

                                                                         
Query: 202   ctggtatgatattctacaggaagggcccgaagcctcccaaaaaaggccagcccgagggtg 261
             |||||||||| |||||||||||||| || || || ||||| || |||||||| |||  ||
Sbjct: 62494 ctggtatgatcttctacaggaagggacctaaaccacccaagaagggccagcctgagaatg 62553

                                                                         
Query: 262   ctctgtacgattatgaggacaagatcaactttgcagtgtttccatcacttcagggcggcc 321
             |  | ||||||| |||||||||||||||||||||||| || || || ||||| || || |
Sbjct: 62554 cagtttacgattttgaggacaagatcaactttgcagttttcccttcccttcaaggtggtc 62613

                                                                         
Query: 322   ctcacaaccaccagattgctgccctggcagttggccttaagcaggccatgttacctggat 381
             ||||||| |||||||||| |||||| || |||| | | || |||||||||| |||||| |
Sbjct: 62614 ctcacaatcaccagattggtgcccttgctgttgccttgaaacaggccatgtcacctgggt 62673

                                                                         
Query: 382   tcaaggcatatattcagcaggtcaaggtcaatgctgttgcccttggaaaccatctcatga 441
             |||||||||||    |||| || |||| |||||| |||||| |||||||  |  | ||||
Sbjct: 62674 tcaaggcatatgccaagcaagttaaggccaatgcagttgccattggaaattacttgatga 62733

                                                                         
Query: 442   gtaagggctacaagttggttactgatggaacagagaaccaccttgttctctgggatcttc 501
             | ||||| ||||   | || |||| |||||| |||||||| |||||  | ||||||||||
Sbjct: 62734 gcaagggatacagtcttgtcactggtggaactgagaaccatcttgtgttgtgggatcttc 62793

                                   
Query: 502   gccctcttggcttgtctggtaa 523
             |||||||||| ||| |||||||
Sbjct: 62794 gccctcttggattgactggtaa 62815



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                   
Query: 564   aacaaaaatgctgtctttggtgacagcagtgcattggc 601
             |||||||||||||| ||||| || |||||||| |||||
Sbjct: 62948 aacaaaaatgctgtttttggcgatagcagtgccttggc 62985

---

>ref|NM_117467.2| Arabidopsis thaliana SHM4 (SERINE HYDROXYMETHYLTRANSFERASE 4);
           glycine hydroxymethyltransferase AT4G13930 (SHM4) mRNA,
           complete cds
          Length = 1810

 Score =  135 bits (68), Expect = 2e-28
 Identities = 209/256 (81%)
 Strand = Plus / Plus

                                                                       
Query: 84  ttgctgtgtgacatggcccatatcagcggtctcgttgctgctcaggaggctacgaatccg 143
           ||||| ||||||||||| || ||||| |||||||||||||||||||| ||| | || || 
Sbjct: 719 ttgctttgtgacatggctcacatcagtggtctcgttgctgctcaggaagctgcaaaccca 778

                                                                       
Query: 144 tttgagtactctgatgtggttaccaccaccacccacaagagtctccgagggccaaggtct 203
           |||||||||| ||| || || || ||||| |||||||||||| |  | || |||||| ||
Sbjct: 779 tttgagtactgtgacgttgtgacaaccacaacccacaagagtttgaggggtccaagggct 838

                                                                       
Query: 204 ggtatgatattctacaggaagggcccgaagcctcccaaaaaaggccagcccgagggtgct 263
           |||||||| |||||||||||||| || || || || || || || || ||||||||||| 
Sbjct: 839 ggtatgattttctacaggaagggtccaaaaccaccaaagaagggtcaacccgagggtgca 898

                                                                       
Query: 264 ctgtacgattatgaggacaagatcaactttgcagtgtttccatcacttcagggcggccct 323
            | || |||| ||||||||| ||||||||||| || || ||  | ||||| || || |||
Sbjct: 899 gtctatgattttgaggacaaaatcaactttgctgtattccctgcgcttcaaggtggtcct 958

                           
Query: 324 cacaaccaccagattg 339
           ||||| ||||||||||
Sbjct: 959 cacaatcaccagattg 974



 Score =  123 bits (62), Expect = 7e-25
 Identities = 155/186 (83%)
 Strand = Plus / Plus

                                                                        
Query: 410  caatgctgttgcccttggaaaccatctcatgagtaagggctacaagttggttactgatgg 469
            |||||||||||||||||||||| | || ||||| ||||| ||| || | || ||  ||||
Sbjct: 1045 caatgctgttgcccttggaaactacctaatgagcaagggttaccagattgtgaccaatgg 1104

                                                                        
Query: 470  aacagagaaccaccttgttctctgggatcttcgccctcttggcttgtctggtaacaaagt 529
            ||| |||||||||||||||||||||||||||||||||||||| ||| | || ||||| ||
Sbjct: 1105 aactgagaaccaccttgttctctgggatcttcgccctcttggattgaccggaaacaaggt 1164

                                                                        
Query: 530  cgagaaagtatgtgatctgagcagcattacactcaacaaaaatgctgtctttggtgacag 589
             |||||  | || |||||| ||||||||||| | ||||| || || || ||||| |||||
Sbjct: 1165 tgagaagctctgcgatctgtgcagcattacattgaacaagaacgcagtatttggagacag 1224

                  
Query: 590  cagtgc 595
             |||||
Sbjct: 1225 tagtgc 1230

---

>gb|AY142551.1| Arabidopsis thaliana clone RAFL08-14-N15 (R11225) mRNA sequence
          Length = 3755

 Score =  135 bits (68), Expect = 2e-28
 Identities = 209/256 (81%)
 Strand = Plus / Plus

                                                                       
Query: 84  ttgctgtgtgacatggcccatatcagcggtctcgttgctgctcaggaggctacgaatccg 143
           ||||| ||||||||||| || ||||| |||||||||||||||||||| ||| | || || 
Sbjct: 704 ttgctttgtgacatggctcacatcagtggtctcgttgctgctcaggaagctgcaaaccca 763

                                                                       
Query: 144 tttgagtactctgatgtggttaccaccaccacccacaagagtctccgagggccaaggtct 203
           |||||||||| ||| || || || ||||| |||||||||||| |  | || |||||| ||
Sbjct: 764 tttgagtactgtgacgttgtgacaaccacaacccacaagagtttgaggggtccaagggct 823

                                                                       
Query: 204 ggtatgatattctacaggaagggcccgaagcctcccaaaaaaggccagcccgagggtgct 263
           |||||||| |||||||||||||| || || || || || || || || ||||||||||| 
Sbjct: 824 ggtatgattttctacaggaagggtccaaaaccaccaaagaagggtcaacccgagggtgca 883

                                                                       
Query: 264 ctgtacgattatgaggacaagatcaactttgcagtgtttccatcacttcagggcggccct 323
            | || |||| ||||||||| ||||||||||| || || ||  | ||||| || || |||
Sbjct: 884 gtctatgattttgaggacaaaatcaactttgctgtattccctgcgcttcaaggtggtcct 943

                           
Query: 324 cacaaccaccagattg 339
           ||||| ||||||||||
Sbjct: 944 cacaatcaccagattg 959



 Score =  123 bits (62), Expect = 7e-25
 Identities = 155/186 (83%)
 Strand = Plus / Plus

                                                                        
Query: 410  caatgctgttgcccttggaaaccatctcatgagtaagggctacaagttggttactgatgg 469
            |||||||||||||||||||||| | || ||||| ||||| ||| || | || ||  ||||
Sbjct: 1030 caatgctgttgcccttggaaactacctaatgagcaagggttaccagattgtgaccaatgg 1089

                                                                        
Query: 470  aacagagaaccaccttgttctctgggatcttcgccctcttggcttgtctggtaacaaagt 529
            ||| |||||||||||||||||||||||||||||||||||||| ||| | || ||||| ||
Sbjct: 1090 aactgagaaccaccttgttctctgggatcttcgccctcttggattgaccggaaacaaggt 1149

                                                                        
Query: 530  cgagaaagtatgtgatctgagcagcattacactcaacaaaaatgctgtctttggtgacag 589
             |||||  | || |||||| ||||||||||| | ||||| || || || ||||| |||||
Sbjct: 1150 tgagaagctctgcgatctgtgcagcattacattgaacaagaacgcagtatttggagacag 1209

                  
Query: 590  cagtgc 595
             |||||
Sbjct: 1210 tagtgc 1215

---

>gb|AY093987.1| Arabidopsis thaliana AT4g13930/dl3005c mRNA, complete cds
          Length = 1416

 Score =  135 bits (68), Expect = 2e-28
 Identities = 209/256 (81%)
 Strand = Plus / Plus

                                                                       
Query: 84  ttgctgtgtgacatggcccatatcagcggtctcgttgctgctcaggaggctacgaatccg 143
           ||||| ||||||||||| || ||||| |||||||||||||||||||| ||| | || || 
Sbjct: 634 ttgctttgtgacatggctcacatcagtggtctcgttgctgctcaggaagctgcaaaccca 693

                                                                       
Query: 144 tttgagtactctgatgtggttaccaccaccacccacaagagtctccgagggccaaggtct 203
           |||||||||| ||| || || || ||||| |||||||||||| |  | || |||||| ||
Sbjct: 694 tttgagtactgtgacgttgtgacaaccacaacccacaagagtttgaggggtccaagggct 753

                                                                       
Query: 204 ggtatgatattctacaggaagggcccgaagcctcccaaaaaaggccagcccgagggtgct 263
           |||||||| |||||||||||||| || || || || || || || || ||||||||||| 
Sbjct: 754 ggtatgattttctacaggaagggtccaaaaccaccaaagaagggtcaacccgagggtgca 813

                                                                       
Query: 264 ctgtacgattatgaggacaagatcaactttgcagtgtttccatcacttcagggcggccct 323
            | || |||| ||||||||| ||||||||||| || || ||  | ||||| || || |||
Sbjct: 814 gtctatgattttgaggacaaaatcaactttgctgtattccctgcgcttcaaggtggtcct 873

                           
Query: 324 cacaaccaccagattg 339
           ||||| ||||||||||
Sbjct: 874 cacaatcaccagattg 889



 Score =  123 bits (62), Expect = 7e-25
 Identities = 155/186 (83%)
 Strand = Plus / Plus

                                                                        
Query: 410  caatgctgttgcccttggaaaccatctcatgagtaagggctacaagttggttactgatgg 469
            |||||||||||||||||||||| | || ||||| ||||| ||| || | || ||  ||||
Sbjct: 960  caatgctgttgcccttggaaactacctaatgagcaagggttaccagattgtgaccaatgg 1019

                                                                        
Query: 470  aacagagaaccaccttgttctctgggatcttcgccctcttggcttgtctggtaacaaagt 529
            ||| |||||||||||||||||||||||||||||||||||||| ||| | || ||||| ||
Sbjct: 1020 aactgagaaccaccttgttctctgggatcttcgccctcttggattgaccggaaacaaggt 1079

                                                                        
Query: 530  cgagaaagtatgtgatctgagcagcattacactcaacaaaaatgctgtctttggtgacag 589
             |||||  | || |||||| ||||||||||| | ||||| || || || ||||| |||||
Sbjct: 1080 tgagaagctctgcgatctgtgcagcattacattgaacaagaacgcagtatttggagacag 1139

                  
Query: 590  cagtgc 595
             |||||
Sbjct: 1140 tagtgc 1145

---

>gb|AF361589.1| Arabidopsis thaliana AT4g13930/dl3005c mRNA, complete cds
          Length = 1712

 Score =  135 bits (68), Expect = 2e-28
 Identities = 209/256 (81%)
 Strand = Plus / Plus

                                                                       
Query: 84  ttgctgtgtgacatggcccatatcagcggtctcgttgctgctcaggaggctacgaatccg 143
           ||||| ||||||||||| || ||||| |||||||||||||||||||| ||| | || || 
Sbjct: 697 ttgctttgtgacatggctcacatcagtggtctcgttgctgctcaggaagctgcaaaccca 756

                                                                       
Query: 144 tttgagtactctgatgtggttaccaccaccacccacaagagtctccgagggccaaggtct 203
           |||||||||| ||| || || || ||||| |||||||||||| |  | || |||||| ||
Sbjct: 757 tttgagtactgtgacgttgtgacaaccacaacccacaagagtttgaggggtccaagggct 816

                                                                       
Query: 204 ggtatgatattctacaggaagggcccgaagcctcccaaaaaaggccagcccgagggtgct 263
           |||||||| |||||||||||||| || || || || || || || || ||||||||||| 
Sbjct: 817 ggtatgattttctacaggaagggtccaaaaccaccaaagaagggtcaacccgagggtgca 876

                                                                       
Query: 264 ctgtacgattatgaggacaagatcaactttgcagtgtttccatcacttcagggcggccct 323
            | || |||| ||||||||| ||||||||||| || || ||  | ||||| || || |||
Sbjct: 877 gtctatgattttgaggacaaaatcaactttgctgtattccctgcgcttcaaggtggtcct 936

                           
Query: 324 cacaaccaccagattg 339
           ||||| ||||||||||
Sbjct: 937 cacaatcaccagattg 952



 Score =  123 bits (62), Expect = 7e-25
 Identities = 155/186 (83%)
 Strand = Plus / Plus

                                                                        
Query: 410  caatgctgttgcccttggaaaccatctcatgagtaagggctacaagttggttactgatgg 469
            |||||||||||||||||||||| | || ||||| ||||| ||| || | || ||  ||||
Sbjct: 1023 caatgctgttgcccttggaaactacctaatgagcaagggttaccagattgtgaccaatgg 1082

                                                                        
Query: 470  aacagagaaccaccttgttctctgggatcttcgccctcttggcttgtctggtaacaaagt 529
            ||| |||||||||||||||||||||||||||||||||||||| ||| | || ||||| ||
Sbjct: 1083 aactgagaaccaccttgttctctgggatcttcgccctcttggattgaccggaaacaaggt 1142

                                                                        
Query: 530  cgagaaagtatgtgatctgagcagcattacactcaacaaaaatgctgtctttggtgacag 589
             |||||  | || |||||| ||||||||||| | ||||| || || || ||||| |||||
Sbjct: 1143 tgagaagctctgcgatctgtgcagcattacattgaacaagaacgcagtatttggagacag 1202

                  
Query: 590  cagtgc 595
             |||||
Sbjct: 1203 tagtgc 1208

---

>gb|AF324991.2|AF324991 Arabidopsis thaliana AT4g13930 (AT4g13930/dl3005c) mRNA, complete
           cds
          Length = 1716

 Score =  135 bits (68), Expect = 2e-28
 Identities = 209/256 (81%)
 Strand = Plus / Plus

                                                                       
Query: 84  ttgctgtgtgacatggcccatatcagcggtctcgttgctgctcaggaggctacgaatccg 143
           ||||| ||||||||||| || ||||| |||||||||||||||||||| ||| | || || 
Sbjct: 701 ttgctttgtgacatggctcacatcagtggtctcgttgctgctcaggaagctgcaaaccca 760

                                                                       
Query: 144 tttgagtactctgatgtggttaccaccaccacccacaagagtctccgagggccaaggtct 203
           |||||||||| ||| || || || ||||| |||||||||||| |  | || |||||| ||
Sbjct: 761 tttgagtactgtgacgttgtgacaaccacaacccacaagagtttgaggggtccaagggct 820

                                                                       
Query: 204 ggtatgatattctacaggaagggcccgaagcctcccaaaaaaggccagcccgagggtgct 263
           |||||||| |||||||||||||| || || || || || || || || ||||||||||| 
Sbjct: 821 ggtatgattttctacaggaagggtccaaaaccaccaaagaagggtcaacccgagggtgca 880

                                                                       
Query: 264 ctgtacgattatgaggacaagatcaactttgcagtgtttccatcacttcagggcggccct 323
            | || |||| ||||||||| ||||||||||| || || ||  | ||||| || || |||
Sbjct: 881 gtctatgattttgaggacaaaatcaactttgctgtattccctgcgcttcaaggtggtcct 940

                           
Query: 324 cacaaccaccagattg 339
           ||||| ||||||||||
Sbjct: 941 cacaatcaccagattg 956



 Score =  123 bits (62), Expect = 7e-25
 Identities = 155/186 (83%)
 Strand = Plus / Plus

                                                                        
Query: 410  caatgctgttgcccttggaaaccatctcatgagtaagggctacaagttggttactgatgg 469
            |||||||||||||||||||||| | || ||||| ||||| ||| || | || ||  ||||
Sbjct: 1027 caatgctgttgcccttggaaactacctaatgagcaagggttaccagattgtgaccaatgg 1086

                                                                        
Query: 470  aacagagaaccaccttgttctctgggatcttcgccctcttggcttgtctggtaacaaagt 529
            ||| |||||||||||||||||||||||||||||||||||||| ||| | || ||||| ||
Sbjct: 1087 aactgagaaccaccttgttctctgggatcttcgccctcttggattgaccggaaacaaggt 1146

                                                                        
Query: 530  cgagaaagtatgtgatctgagcagcattacactcaacaaaaatgctgtctttggtgacag 589
             |||||  | || |||||| ||||||||||| | ||||| || || || ||||| |||||
Sbjct: 1147 tgagaagctctgcgatctgtgcagcattacattgaacaagaacgcagtatttggagacag 1206

                  
Query: 590  cagtgc 595
             |||||
Sbjct: 1207 tagtgc 1212

---

>emb|BX827403.1|CNS0A2GP Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS50ZE10 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1624

 Score =  135 bits (68), Expect = 2e-28
 Identities = 209/256 (81%)
 Strand = Plus / Plus

                                                                       
Query: 84  ttgctgtgtgacatggcccatatcagcggtctcgttgctgctcaggaggctacgaatccg 143
           ||||| ||||||||||| || ||||| |||||||||||||||||||| ||| | || || 
Sbjct: 692 ttgctttgtgacatggctcacatcagtggtctcgttgctgctcaggaagctgcaaaccca 751

                                                                       
Query: 144 tttgagtactctgatgtggttaccaccaccacccacaagagtctccgagggccaaggtct 203
           |||||||||| ||| || || || ||||| |||||||||||| |  | || |||||| ||
Sbjct: 752 tttgagtactgtgacgttgtgacaaccacaacccacaagagtttgaggggtccaagggct 811

                                                                       
Query: 204 ggtatgatattctacaggaagggcccgaagcctcccaaaaaaggccagcccgagggtgct 263
           |||||||| |||||||||||||| || || || || || || || || ||||||||||| 
Sbjct: 812 ggtatgattttctacaggaagggtccaaaaccaccaaagaagggtcaacccgagggtgca 871

                                                                       
Query: 264 ctgtacgattatgaggacaagatcaactttgcagtgtttccatcacttcagggcggccct 323
            | || |||| ||||||||| ||||||||||| || || ||  | ||||| || || |||
Sbjct: 872 gtctatgattttgaggacaaaatcaactttgctgtattccctgcgcttcaaggtggtcct 931

                           
Query: 324 cacaaccaccagattg 339
           ||||| ||||||||||
Sbjct: 932 cacaatcaccagattg 947



 Score =  123 bits (62), Expect = 7e-25
 Identities = 155/186 (83%)
 Strand = Plus / Plus

                                                                        
Query: 410  caatgctgttgcccttggaaaccatctcatgagtaagggctacaagttggttactgatgg 469
            |||||||||||||||||||||| | || ||||| ||||| ||| || | || ||  ||||
Sbjct: 1018 caatgctgttgcccttggaaactacctaatgagcaagggttaccagattgtgaccaatgg 1077

                                                                        
Query: 470  aacagagaaccaccttgttctctgggatcttcgccctcttggcttgtctggtaacaaagt 529
            ||| |||||||||||||||||||||||||||||||||||||| ||| | || ||||| ||
Sbjct: 1078 aactgagaaccaccttgttctctgggatcttcgccctcttggattgaccggaaacaaggt 1137

                                                                        
Query: 530  cgagaaagtatgtgatctgagcagcattacactcaacaaaaatgctgtctttggtgacag 589
             |||||  | || |||||| ||||||||||| | ||||| || || || ||||| |||||
Sbjct: 1138 tgagaagctctgcgatctgtgcagcattacattgaacaagaacgcagtatttggagacag 1197

                  
Query: 590  cagtgc 595
             |||||
Sbjct: 1198 tagtgc 1203

---

>gb|AY086929.1| Arabidopsis thaliana clone 29662 mRNA, complete sequence
          Length = 1723

 Score =  135 bits (68), Expect = 2e-28
 Identities = 209/256 (81%)
 Strand = Plus / Plus

                                                                       
Query: 84  ttgctgtgtgacatggcccatatcagcggtctcgttgctgctcaggaggctacgaatccg 143
           ||||| ||||||||||| || ||||| |||||||||||||||||||| ||| | || || 
Sbjct: 713 ttgctttgtgacatggctcacatcagtggtctcgttgctgctcaggaagctgcaaaccca 772

                                                                       
Query: 144 tttgagtactctgatgtggttaccaccaccacccacaagagtctccgagggccaaggtct 203
           |||||||||| ||| || || || ||||| |||||||||||| |  | || |||||| ||
Sbjct: 773 tttgagtactgtgacgttgtgacaaccacaacccacaagagtttgaggggtccaagggct 832

                                                                       
Query: 204 ggtatgatattctacaggaagggcccgaagcctcccaaaaaaggccagcccgagggtgct 263
           |||||||| |||||||||||||| || || || || || || || || ||||||||||| 
Sbjct: 833 ggtatgattttctacaggaagggtccaaaaccaccaaagaagggtcaacccgagggtgca 892

                                                                       
Query: 264 ctgtacgattatgaggacaagatcaactttgcagtgtttccatcacttcagggcggccct 323
            | || |||| ||||||||| ||||||||||| || || ||  | ||||| || || |||
Sbjct: 893 gtctatgattttgaggacaaaatcaactttgctgtattccctgcgcttcaaggtggtcct 952

                           
Query: 324 cacaaccaccagattg 339
           ||||| ||||||||||
Sbjct: 953 cacaatcaccagattg 968



 Score =  123 bits (62), Expect = 7e-25
 Identities = 155/186 (83%)
 Strand = Plus / Plus

                                                                        
Query: 410  caatgctgttgcccttggaaaccatctcatgagtaagggctacaagttggttactgatgg 469
            |||||||||||||||||||||| | || ||||| ||||| ||| || | || ||  ||||
Sbjct: 1039 caatgctgttgcccttggaaactacctaatgagcaagggttaccagattgtgaccaatgg 1098

                                                                        
Query: 470  aacagagaaccaccttgttctctgggatcttcgccctcttggcttgtctggtaacaaagt 529
            ||| |||||||||||||||||||||||||||||||||||||| ||| | || ||||| ||
Sbjct: 1099 aactgagaaccaccttgttctctgggatcttcgccctcttggattgaccggaaacaaggt 1158

                                                                        
Query: 530  cgagaaagtatgtgatctgagcagcattacactcaacaaaaatgctgtctttggtgacag 589
             |||||  | || |||||| ||||||||||| | ||||| || || || ||||| |||||
Sbjct: 1159 tgagaagctctgcgatctgtgcagcattacattgaacaagaacgcagtatttggagacag 1218

                  
Query: 590  cagtgc 595
             |||||
Sbjct: 1219 tagtgc 1224

---

>dbj|AB154528.1| Cucumis melo 6F11 mRNA for hypothetical protein, partial cds
          Length = 963

 Score =  111 bits (56), Expect = 3e-21
 Identities = 311/396 (78%)
 Strand = Plus / Plus

                                                                       
Query: 204 ggtatgatattctacaggaagggcccgaagcctcccaaaaaaggccagcccgagggtgct 263
           |||||||| ||||| |||||||| || ||||| || || || || |||||||| | ||||
Sbjct: 312 ggtatgatcttctataggaagggtccaaagccacctaagaagggtcagcccgaagatgct 371

                                                                       
Query: 264 ctgtacgattatgaggacaagatcaactttgcagtgtttccatcacttcagggcggccct 323
            | || || ||||| ||||||||||||||  | || || ||  | ||||||||||| |||
Sbjct: 372 gtttatgactatgaagacaagatcaacttctctgtcttcccggcccttcagggcggtcct 431

                                                                       
Query: 324 cacaaccaccagattgctgccctggcagttggccttaagcaggccatgttacctggattc 383
           ||||| ||||| |||| |||  | || |||| | | |||||||| ||||  ||||| |||
Sbjct: 432 cacaatcaccaaattggtgctttagctgttgccttgaagcaggctatgtcccctgggttc 491

                                                                       
Query: 384 aaggcatatattcagcaggtcaaggtcaatgctgttgcccttggaaaccatctcatgagt 443
           ||||| |||  | | || || |||| |||||| || ||||| |||||  | || ||||  
Sbjct: 492 aaggcctatgctaaacaagttaaggccaatgccgtggccctcggaaattacctgatgaac 551

                                                                       
Query: 444 aagggctacaagttggttactgatggaacagagaaccaccttgttctctgggatcttcgc 503
           ||||| |||||| | |||||||  ||||| ||||||||||||||||||||||||||||| 
Sbjct: 552 aagggttacaagcttgttactggaggaaccgagaaccaccttgttctctgggatcttcgt 611

                                                                       
Query: 504 cctcttggcttgtctggtaacaaagtcgagaaagtatgtgatctgagcagcattacactc 563
           ||| | || ||| |||| ||||| || |||||  | || ||  || ||| ||| ||  | 
Sbjct: 612 cctttgggattgactggcaacaaggttgagaagctgtgcgacttgtgcaacatcaccgta 671

                                               
Query: 564 aacaaaaatgctgtctttggtgacagcagtgcattg 599
           |||||||| || || |||||||||||||||||||||
Sbjct: 672 aacaaaaacgcagtgtttggtgacagcagtgcattg 707

---

>emb|Z97335.2|ATFCA0 Arabidopsis thaliana DNA chromosome 4, ESSA I FCA contig fragment No.
            0
          Length = 200576

 Score =  107 bits (54), Expect = 4e-20
 Identities = 90/102 (88%)
 Strand = Plus / Minus

                                                                        
Query: 410  caatgctgttgcccttggaaaccatctcatgagtaagggctacaagttggttactgatgg 469
            |||||||||||||||||||||| | || ||||| ||||| ||| || | || ||  ||||
Sbjct: 6545 caatgctgttgcccttggaaactacctaatgagcaagggttaccagattgtgaccaatgg 6486

                                                      
Query: 470  aacagagaaccaccttgttctctgggatcttcgccctcttgg 511
            ||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 6485 aactgagaaccaccttgttctctgggatcttcgccctcttgg 6444



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 158/196 (80%)
 Strand = Plus / Minus

                                                                        
Query: 144  tttgagtactctgatgtggttaccaccaccacccacaagagtctccgagggccaaggtct 203
            |||||||||| ||| || || || ||||| |||||||||||| |  | || |||||| ||
Sbjct: 6811 tttgagtactgtgacgttgtgacaaccacaacccacaagagtttgaggggtccaagggct 6752

                                                                        
Query: 204  ggtatgatattctacaggaagggcccgaagcctcccaaaaaaggccagcccgagggtgct 263
            |||||||| |||||||||||||| || || || || || || || || ||||||||||| 
Sbjct: 6751 ggtatgattttctacaggaagggtccaaaaccaccaaagaagggtcaacccgagggtgca 6692

                                                                        
Query: 264  ctgtacgattatgaggacaagatcaactttgcagtgtttccatcacttcagggcggccct 323
             | || |||| ||||||||| ||||||||||| || || ||  | ||||| || || |||
Sbjct: 6691 gtctatgattttgaggacaaaatcaactttgctgtattccctgcgcttcaaggtggtcct 6632

                            
Query: 324  cacaaccaccagattg 339
            ||||| ||||||||||
Sbjct: 6631 cacaatcaccagattg 6616



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                          
Query: 84   ttgctgtgtgacatggcccatatcagcggtctcgttgctgctcagg 129
            ||||| ||||||||||| || ||||| |||||||||||||||||||
Sbjct: 7280 ttgctttgtgacatggctcacatcagtggtctcgttgctgctcagg 7235

---

>emb|AL161537.2|ATCHRIV37 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 37
          Length = 199667

 Score =  107 bits (54), Expect = 4e-20
 Identities = 90/102 (88%)
 Strand = Plus / Minus

                                                                          
Query: 410    caatgctgttgcccttggaaaccatctcatgagtaagggctacaagttggttactgatgg 469
              |||||||||||||||||||||| | || ||||| ||||| ||| || | || ||  ||||
Sbjct: 140760 caatgctgttgcccttggaaactacctaatgagcaagggttaccagattgtgaccaatgg 140701

                                                        
Query: 470    aacagagaaccaccttgttctctgggatcttcgccctcttgg 511
              ||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 140700 aactgagaaccaccttgttctctgggatcttcgccctcttgg 140659



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 158/196 (80%)
 Strand = Plus / Minus

                                                                          
Query: 144    tttgagtactctgatgtggttaccaccaccacccacaagagtctccgagggccaaggtct 203
              |||||||||| ||| || || || ||||| |||||||||||| |  | || |||||| ||
Sbjct: 141026 tttgagtactgtgacgttgtgacaaccacaacccacaagagtttgaggggtccaagggct 140967

                                                                          
Query: 204    ggtatgatattctacaggaagggcccgaagcctcccaaaaaaggccagcccgagggtgct 263
              |||||||| |||||||||||||| || || || || || || || || ||||||||||| 
Sbjct: 140966 ggtatgattttctacaggaagggtccaaaaccaccaaagaagggtcaacccgagggtgca 140907

                                                                          
Query: 264    ctgtacgattatgaggacaagatcaactttgcagtgtttccatcacttcagggcggccct 323
               | || |||| ||||||||| ||||||||||| || || ||  | ||||| || || |||
Sbjct: 140906 gtctatgattttgaggacaaaatcaactttgctgtattccctgcgcttcaaggtggtcct 140847

                              
Query: 324    cacaaccaccagattg 339
              ||||| ||||||||||
Sbjct: 140846 cacaatcaccagattg 140831



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                             
Query: 465    gatggaacagagaaccaccttgttctctgggatcttcgccctcttgg 511
              |||||||| || ||||||||| |||| ||||||||||||||||||||
Sbjct: 124812 gatggaactgataaccaccttattctttgggatcttcgccctcttgg 124766



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                            
Query: 84     ttgctgtgtgacatggcccatatcagcggtctcgttgctgctcagg 129
              ||||| ||||||||||| || ||||| |||||||||||||||||||
Sbjct: 141495 ttgctttgtgacatggctcacatcagtggtctcgttgctgctcagg 141450

---

>dbj|AK109000.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-153-G10, full
            insert sequence
          Length = 2504

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 62/69 (89%)
 Strand = Plus / Plus

                                                                        
Query: 281  caagatcaactttgcagtgtttccatcacttcagggcggccctcacaaccaccagattgc 340
            ||||||| ||||||||||||| ||||| || ||||||||||| |||||||||||||| ||
Sbjct: 932  caagatcgactttgcagtgttcccatcgctgcagggcggcccccacaaccaccagatcgc 991

                     
Query: 341  tgccctggc 349
             ||||||||
Sbjct: 992  agccctggc 1000

---

>ref|NM_117463.2| Arabidopsis thaliana glycine hydroxymethyltransferase AT4G13890 mRNA,
            complete cds
          Length = 1592

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Plus

                                                                        
Query: 465  gatggaacagagaaccaccttgttctctgggatcttcgccctcttggcttgtctggtaac 524
            |||||||| || ||||||||| |||| |||||||||||||||||||| ||| | ||||||
Sbjct: 1020 gatggaactgataaccaccttattctttgggatcttcgccctcttggattgaccggtaac 1079

                                
Query: 525  aaagtcgagaaagtatgtga 544
            || || ||||| || |||||
Sbjct: 1080 aaggttgagaaggtttgtga 1099

---

>emb|AJ000226.1|HVJ000226 Hordeum vulgare mRNA for expressed sequence tag
          Length = 334

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                           
Query: 552 agcattacactcaacaaaaatgctgtctttggtgacagcagtgcattg 599
           ||||||||| | ||||| ||||||||||| ||||||||||||||||||
Sbjct: 25  agcattacattgaacaagaatgctgtcttcggtgacagcagtgcattg 72

---

>gb|AY224189.1| Medicago truncatula adenosylhomocysteinase (AHC2) gene, complete cds
          Length = 68460

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 110/136 (80%)
 Strand = Plus / Minus

                                                                         
Query: 204   ggtatgatattctacaggaagggcccgaagcctcccaaaaaaggccagcccgagggtgct 263
             |||||||| || ||| ||||||| || ||||| ||||| || || ||||| |||  ||| 
Sbjct: 21732 ggtatgatcttttaccggaagggacctaagccacccaagaagggtcagccagagaatgca 21673

                                                                         
Query: 264   ctgtacgattatgaggacaagatcaactttgcagtgtttccatcacttcagggcggccct 323
              | || |||| ||| ||||| ||||||||||| || || || || |||||||| || |||
Sbjct: 21672 gtttatgattttgaagacaaaatcaactttgctgttttcccctcccttcagggtggtcct 21613

                             
Query: 324   cacaaccaccagattg 339
             ||||||||||||||||
Sbjct: 21612 cacaaccaccagattg 21597



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 492   tgggatcttcgccctcttggcttg 515
             |||||||| |||||||||||||||
Sbjct: 21444 tgggatctccgccctcttggcttg 21421

---

>emb|AL035528.2|ATF18A5 Arabidopsis thaliana DNA chromosome 4, BAC clone F18A5 (ESSA project)
          Length = 118718

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                             
Query: 465    gatggaacagagaaccaccttgttctctgggatcttcgccctcttgg 511
              |||||||| || ||||||||| |||| ||||||||||||||||||||
Sbjct: 103720 gatggaactgataaccaccttattctttgggatcttcgccctcttgg 103674

---

>gb|AY189738.1| Leishmania donovani serine hydroxymethyltransferase (SHMT) gene,
           complete cds
          Length = 1443

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 64/76 (84%)
 Strand = Plus / Plus

                                                                       
Query: 141 ccgtttgagtactctgatgtggttaccaccaccacccacaagagtctccgagggccaagg 200
           |||||||||||| | ||||| || |||||||||||||||||||  || || |||||  ||
Sbjct: 739 ccgtttgagtacgccgatgtcgtgaccaccaccacccacaagacgctgcgcgggcctcgg 798

                           
Query: 201 tctggtatgatattct 216
           ||||| ||||| ||||
Sbjct: 799 tctggcatgatcttct 814

---

>ref|XM_779683.1| PREDICTED: Strongylocentrotus purpuratus similar to serine
           hydroxymethyltransferase 2 (mitochondrial) (LOC579575),
           mRNA
          Length = 1847

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 63/75 (84%)
 Strand = Plus / Plus

                                                                       
Query: 144 tttgagtactctgatgtggttaccaccaccacccacaagagtctccgagggccaaggtct 203
           |||||| | ||||| || || |||||||| || |||||||  |||||||| |||||||||
Sbjct: 839 tttgagcattctgacgttgtgaccaccacaactcacaagaccctccgaggaccaaggtct 898

                          
Query: 204 ggtatgatattctac 218
           || ||||| ||||||
Sbjct: 899 ggaatgatcttctac 913



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 84  ttgctgtgtgacatggcccatatcagcggtctcgttgc 121
           ||||||| ||||||||||||||||  |||||| |||||
Sbjct: 779 ttgctgtctgacatggcccatatcgccggtctggttgc 816

---

>emb|X91902.1|OCSERHMTF O.cuniculus mRNA for serine hydroxymethyltransferase
          Length = 1862

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                         
Query: 165 accaccaccacccacaagagtctccgaggg 194
           ||||||||||||||||||| ||||||||||
Sbjct: 861 accaccaccacccacaagactctccgaggg 890

---

>emb|BX569689.1| Synechococcus sp. WH8102 complete genome; segment 1/7
          Length = 348764

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                           
Query: 155    tgatgtggttaccaccaccacccacaaga 183
              ||||||||| |||||||||||||||||||
Sbjct: 259440 tgatgtggtcaccaccaccacccacaaga 259468

---

>gb|CP000110.1| Synechococcus sp. CC9605, complete genome
          Length = 2510659

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 156    gatgtggttaccaccaccacccacaaga 183
              |||||||| |||||||||||||||||||
Sbjct: 260786 gatgtggtgaccaccaccacccacaaga 260813

---

>ref|XM_844151.1| PREDICTED: Canis familiaris similar to serine
            hydroxymethyltransferase 2 (mitochondrial), transcript
            variant 2 (LOC607458), mRNA
          Length = 2150

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                        
Query: 285  atcaactttgcagtgtttccatcacttcagggcggccctcacaaccaccagattgctgcc 344
            ||||||||||| ||||| ||||| || |||||||| || ||||||||    |||||||||
Sbjct: 959  atcaactttgctgtgttcccatccctgcagggcgggccccacaaccatgccattgctgcc 1018

                                    
Query: 345  ctggcagttggccttaagcaggcc 368
             |||| || | ||| |||||||||
Sbjct: 1019 gtggctgtggccctaaagcaggcc 1042

---

>gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome
          Length = 3046682

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                           
Query: 156     gatgtggttaccaccaccacccacaaga 183
               |||||||| |||||||||||||||||||
Sbjct: 2912681 gatgtggtgaccaccaccacccacaaga 2912708

---

>gb|CP000239.1| Synechococcus sp. JA-3-3Ab, complete genome
          Length = 2932766

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                           
Query: 156     gatgtggttaccaccaccacccacaaga 183
               |||||||| |||||||||||||||||||
Sbjct: 2032094 gatgtggtcaccaccaccacccacaaga 2032121

---

>dbj|AK055053.1| Homo sapiens cDNA FLJ30491 fis, clone BRAWH2000177, moderately
            similar to SERINE HYDROXYMETHYLTRANSFERASE, MITOCHONDRIAL
            PRECURSOR (EC 2.1.2.1)
          Length = 3412

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 285  atcaactttgcagtgtttccatcacttcagggcggccctcacaa 328
            ||||||||||| ||||| ||||| |||||||| ||||| |||||
Sbjct: 2135 atcaactttgccgtgttcccatcccttcaggggggcccccacaa 2178

---

>gb|L11932.1|HUMSHMTB Human nuclear-encoded mitochondrial serine hydroxymethyltransferase
           (SHMT) mRNA, 3' end
          Length = 1792

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 285 atcaactttgcagtgtttccatcacttcagggcggccctcacaa 328
           ||||||||||| ||||| ||||| |||||||| ||||| |||||
Sbjct: 854 atcaactttgccgtgttcccatcccttcaggggggcccccacaa 897

---

>ref|XM_853209.1| PREDICTED: Canis familiaris similar to serine
            hydroxymethyltransferase 2 (mitochondrial), transcript
            variant 4 (LOC607458), mRNA
          Length = 2068

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                           
Query: 285  atcaactttgcagtgtttccatcacttcagggcggccctcacaacca 331
            ||||||||||| ||||| ||||| || |||||||| || ||||||||
Sbjct: 959  atcaactttgctgtgttcccatccctgcagggcgggccccacaacca 1005

---

>gb|BC103242.1| Bos taurus serine hydroxymethyltransferase 2 (mitochondrial), mRNA
            (cDNA clone MGC:128707 IMAGE:7987768), complete cds
          Length = 2117

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                           
Query: 285  atcaactttgcagtgtttccatcacttcagggcggccctcacaacca 331
            ||||||||||| ||||| ||||| || ||||| ||||| ||||||||
Sbjct: 987  atcaactttgctgtgttcccatccctgcaggggggcccccacaacca 1033

---

>ref|NM_001034282.1| Bos taurus serine hydroxymethyltransferase 2 (mitochondrial) (SHMT2),
            mRNA
          Length = 2117

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                           
Query: 285  atcaactttgcagtgtttccatcacttcagggcggccctcacaacca 331
            ||||||||||| ||||| ||||| || ||||| ||||| ||||||||
Sbjct: 987  atcaactttgctgtgttcccatccctgcaggggggcccccacaacca 1033

---

>gb|AC108318.8| Rattus norvegicus 2 BAC CH230-256E18 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 210322

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 460   ttactgatggaacagagaacca 481
             ||||||||||||||||||||||
Sbjct: 83207 ttactgatggaacagagaacca 83186

---

>gb|DQ445126.1| Striga asiatica isolate St484 hydroxymethyltransferase mRNA,
           partial cds
          Length = 510

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 52/62 (83%)
 Strand = Plus / Plus

                                                                       
Query: 63  gcggacaagtgtggggccatgttgctgtgtgacatggcccatatcagcggtctcgttgct 122
           ||||| |||||||| ||  ||||| ||||||||||||| || || |||||||| || |||
Sbjct: 289 gcggataagtgtggtgcggtgttgttgtgtgacatggctcagattagcggtcttgtagct 348

             
Query: 123 gc 124
           ||
Sbjct: 349 gc 350

---

>emb|CR522870.1| Desulfotalea psychrophila LSv54 chromosome
          Length = 3523383

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                         
Query: 156     gatgtggttaccaccaccacccacaa 181
               ||||| ||||||||||||||||||||
Sbjct: 2108922 gatgtagttaccaccaccacccacaa 2108897

---

>gb|AC177808.2| Pan troglodytes BAC clone CH251-703A9 from chromosome unknown, complete
             sequence
          Length = 207792

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 366   gccatgttacctggattcaagg 387
             ||||||||||||||||||||||
Sbjct: 33708 gccatgttacctggattcaagg 33729

---

>ref|NM_106662.3| Arabidopsis thaliana unknown protein AT1G80130 mRNA, complete cds
          Length = 1373

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 165 accaccaccacccacaagagtctcc 189
           ||||||||||| |||||||||||||
Sbjct: 570 accaccaccactcacaagagtctcc 546

---

>ref|NM_009171.2| Mus musculus serine hydroxymethyl transferase 1 (soluble) (Shmt1),
            mRNA
          Length = 2074

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 202  ctggtatgatattctacaggaaggg 226
            ||||||||||||||||||| |||||
Sbjct: 1154 ctggtatgatattctacagaaaggg 1178

---

>ref|XM_386466.1| Gibberella zeae PH-1 chromosome 3 GLYC_NEUCR Serine
           hydroxymethyltransferase, cytosolic (Serine methylase)
           (Glycine hydroxymethyltransferase) (SHMT) (FG06290.1)
           partial mRNA
          Length = 1476

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 162 gttaccaccaccacccacaag 182
           |||||||||||||||||||||
Sbjct: 760 gttaccaccaccacccacaag 780

---

>gb|AY383687.1| Rattus norvegicus LRRGT00032 mRNA, complete cds
          Length = 2046

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 202  ctggtatgatattctacaggaaggg 226
            ||||||||||||||||||| |||||
Sbjct: 1382 ctggtatgatattctacagaaaggg 1406



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 312  cagggcggccctcacaacca 331
            ||||||||||||||||||||
Sbjct: 1492 cagggcggccctcacaacca 1511

---

>gb|AY063018.1| Arabidopsis thaliana unknown protein (At1g80130) mRNA, complete cds
          Length = 949

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 165 accaccaccacccacaagagtctcc 189
           ||||||||||| |||||||||||||
Sbjct: 402 accaccaccactcacaagagtctcc 378

---

>gb|AY034991.1| Arabidopsis thaliana unknown protein (At1g80130) mRNA, complete cds
          Length = 1173

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 165 accaccaccacccacaagagtctcc 189
           ||||||||||| |||||||||||||
Sbjct: 484 accaccaccactcacaagagtctcc 460

---

>emb|AL596215.7| Mouse DNA sequence from clone RP23-278I21 on chromosome 11, complete
             sequence
          Length = 203117

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 202   ctggtatgatattctacaggaaggg 226
             ||||||||||||||||||| |||||
Sbjct: 89164 ctggtatgatattctacagaaaggg 89188

---

>emb|BX294164.13| Zebrafish DNA sequence from clone CH211-266D19 in linkage group 24,
             complete sequence
          Length = 177516

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 289   actttgcagtgtttccatcac 309
             |||||||||||||||||||||
Sbjct: 32929 actttgcagtgtttccatcac 32949

---

>gb|BC099219.1| Rattus norvegicus cDNA clone IMAGE:7385410, partial cds
          Length = 1327

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 202 ctggtatgatattctacaggaaggg 226
           ||||||||||||||||||| |||||
Sbjct: 396 ctggtatgatattctacagaaaggg 420



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 312 cagggcggccctcacaacca 331
           ||||||||||||||||||||
Sbjct: 506 cagggcggccctcacaacca 525

---

>dbj|AK132342.1| Mus musculus 15 days embryo head cDNA, RIKEN full-length enriched
            library, clone:4022425K22 product:serine hydroxymethyl
            transferase 1 (soluble), full insert sequence
          Length = 2728

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 202  ctggtatgatattctacaggaaggg 226
            ||||||||||||||||||| |||||
Sbjct: 1025 ctggtatgatattctacagaaaggg 1049

---

>gb|BC026055.1| Mus musculus serine hydroxymethyl transferase 1 (soluble), mRNA (cDNA
            clone MGC:14007 IMAGE:4160579), complete cds
          Length = 2721

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 202  ctggtatgatattctacaggaaggg 226
            ||||||||||||||||||| |||||
Sbjct: 1019 ctggtatgatattctacagaaaggg 1043

---

>dbj|AK010439.1| Mus musculus ES cells cDNA, RIKEN full-length enriched library,
            clone:2410007I02 product:serine hydroxymethyl transferase
            1 (soluble), full insert sequence
          Length = 1961

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 202  ctggtatgatattctacaggaaggg 226
            ||||||||||||||||||| |||||
Sbjct: 1050 ctggtatgatattctacagaaaggg 1074

---

>emb|BX821717.1|CNS0AA2F Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL68ZA04 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 755

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 165 accaccaccacccacaagagtctcc 189
           ||||||||||| |||||||||||||
Sbjct: 186 accaccaccactcacaagagtctcc 210

---

>gb|AF237702.1|AF237702 Mus musculus serine hydroxymethyltransferase mRNA, complete cds
          Length = 1771

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 202  ctggtatgatattctacaggaaggg 226
            ||||||||||||||||||| |||||
Sbjct: 980  ctggtatgatattctacagaaaggg 1004

---

>gb|AE004954.1| Pseudomonas aeruginosa PAO1, section 515 of 529 of the complete
            genome
          Length = 10058

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 159  gtggttaccaccaccacccacaaga 183
            ||||| |||||||||||||||||||
Sbjct: 1594 gtggtcaccaccaccacccacaaga 1618

---

>gb|AE004874.1| Pseudomonas aeruginosa PAO1, section 435 of 529 of the complete
            genome
          Length = 10602

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 159  gtggttaccaccaccacccacaaga 183
            ||||| |||||||||||||||||||
Sbjct: 5951 gtggtcaccaccaccacccacaaga 5975

---

>gb|AE004671.1| Pseudomonas aeruginosa PAO1, section 232 of 529 of the complete
            genome
          Length = 10746

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 159  gtggttaccaccaccacccacaaga 183
            ||||| |||||||||||||||||||
Sbjct: 9979 gtggtcaccaccaccacccacaaga 9955

---

>gb|AY087456.1| Arabidopsis thaliana clone 35675 mRNA, complete sequence
          Length = 1288

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 165 accaccaccacccacaagagtctcc 189
           ||||||||||| |||||||||||||
Sbjct: 485 accaccaccactcacaagagtctcc 461

---

>ref|XM_213324.3| PREDICTED: Rattus norvegicus serine hydroxymethyl transferase 1
            (soluble) (predicted) (Shmt1_predicted), mRNA
          Length = 3491

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 202  ctggtatgatattctacaggaaggg 226
            ||||||||||||||||||| |||||
Sbjct: 1382 ctggtatgatattctacagaaaggg 1406



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 312  cagggcggccctcacaacca 331
            ||||||||||||||||||||
Sbjct: 1492 cagggcggccctcacaacca 1511

---

>dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome
          Length = 4659019

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 159     gtggttaccaccaccacccacaaga 183
               ||||| |||||||||||||||||||
Sbjct: 4602543 gtggtcaccaccaccacccacaaga 4602567

---

>emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,complete sequence
          Length = 5888780

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 159     gtggttaccaccaccacccacaaga 183
               ||||| |||||||||||||||||||
Sbjct: 5488369 gtggtcaccaccaccacccacaaga 5488345



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 159    gtggttaccaccaccacccacaaga 183
              ||||| |||||||||||||||||||
Sbjct: 838794 gtggtcaccaccaccacccacaaga 838770

---

>gb|AC009322.1|AC009322 Arabidopsis thaliana chromosome I BAC F18B13 genomic sequence, complete
             sequence
          Length = 116905

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 165   accaccaccacccacaagagtctcc 189
             ||||||||||| |||||||||||||
Sbjct: 78840 accaccaccactcacaagagtctcc 78864

---

>gb|AE015451.1| Pseudomonas putida KT2440 complete genome
          Length = 6181863

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 159    gtggttaccaccaccacccacaaga 183
              ||||| |||||||||||||||||||
Sbjct: 781180 gtggtcaccaccaccacccacaaga 781156

---

>gb|CP000159.1| Salinibacter ruber DSM 13855, complete genome
          Length = 3551823

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 159    gtggttaccaccaccacccacaaga 183
              ||||| |||||||||||||||||||
Sbjct: 987565 gtggtgaccaccaccacccacaaga 987589

---

>dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, complete genome
          Length = 3566135

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 159     gtggttaccaccaccacccacaaga 183
               ||||| |||||||||||||||||||
Sbjct: 2060693 gtggtcaccaccaccacccacaaga 2060669

---

>emb|X94479.1|MMSHMT2 M.musculus mRNA for hydroxymethyltransferase (mSHMT2)
          Length = 1155

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 202  ctggtatgatattctacaggaaggg 226
            ||||||||||||||||||| |||||
Sbjct: 980  ctggtatgatattctacagaaaggg 1004

---

>emb|X94478.1|MMSHMT1 M.musculus mRNA for hydroxymethyltransferase (mSHMT1)
          Length = 1284

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 202  ctggtatgatattctacaggaaggg 226
            ||||||||||||||||||| |||||
Sbjct: 980  ctggtatgatattctacagaaaggg 1004

---

>ref|NM_103323.2| Arabidopsis thaliana glycine hydroxymethyltransferase AT1G36370 mRNA,
            complete cds
          Length = 2058

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 276  gaggacaagatcaactttgcagtgtttccatc 307
            ||||| |||||||||||||| || ||||||||
Sbjct: 1282 gaggaaaagatcaactttgctgtttttccatc 1313

---

>ref|XM_509157.1| PREDICTED: Pan troglodytes serine hydroxymethyltransferase 2
            (mitochondrial) (LOC452007), mRNA
          Length = 1461

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                        
Query: 285  atcaactttgcagtgtttccatcacttcagggcggccctcacaa 328
            ||||||||||| ||||| ||||| || ||||| ||||| |||||
Sbjct: 991  atcaactttgccgtgttcccatccctacaggggggcccccacaa 1034

---

>ref|NM_201034.1| Danio rerio zgc:63600 (zgc:63600), mRNA
          Length = 1734

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 462  actgatggaacagagaacca 481
            ||||||||||||||||||||
Sbjct: 1124 actgatggaacagagaacca 1105

---

>ref|NM_178081.2| Mus musculus RIKEN cDNA 2210010L05 gene (2210010L05Rik), transcript
            variant 2, mRNA
          Length = 3350

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 401  ggtcaaggtcaatgctgttg 420
            ||||||||||||||||||||
Sbjct: 1020 ggtcaaggtcaatgctgttg 1001

---

>ref|NM_133829.1| Mus musculus RIKEN cDNA 2210010L05 gene (2210010L05Rik), transcript
           variant 1, mRNA
          Length = 2744

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 401 ggtcaaggtcaatgctgttg 420
           ||||||||||||||||||||
Sbjct: 128 ggtcaaggtcaatgctgttg 109

---

>gb|BC017534.1| Mus musculus RIKEN cDNA 2210010L05 gene, mRNA (cDNA clone MGC:28783
           IMAGE:4488390), complete cds
          Length = 2744

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 401 ggtcaaggtcaatgctgttg 420
           ||||||||||||||||||||
Sbjct: 128 ggtcaaggtcaatgctgttg 109

---

>ref|XM_414824.1| PREDICTED: Gallus gallus similar to Shmt1-prov protein (LOC416520),
            mRNA
          Length = 2991

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 93   gacatggcccatatcagcgg 112
            ||||||||||||||||||||
Sbjct: 1663 gacatggcccatatcagcgg 1682

---

>gb|BC055159.1| Danio rerio zgc:63600, mRNA (cDNA clone MGC:63600 IMAGE:5413394),
            complete cds
          Length = 1734

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 462  actgatggaacagagaacca 481
            ||||||||||||||||||||
Sbjct: 1124 actgatggaacagagaacca 1105

---

>gb|BC013677.2| Homo sapiens serine hydroxymethyltransferase 2 (mitochondrial), mRNA
            (cDNA clone MGC:9375 IMAGE:3863368), complete cds
          Length = 1972

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                        
Query: 285  atcaactttgcagtgtttccatcacttcagggcggccctcacaa 328
            ||||||||||| ||||| ||||| || ||||| ||||| |||||
Sbjct: 1013 atcaactttgccgtgttcccatccctgcaggggggcccccacaa 1056

---

>gb|BC004825.1| Mus musculus serine hydroxymethyl transferase 2 (mitochondrial),
           mRNA (cDNA clone MGC:6459 IMAGE:2615850), complete cds
          Length = 2085

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 156 gatgtggttaccaccaccacccacaaga 183
           ||||| |||||||||||||| |||||||
Sbjct: 897 gatgttgttaccaccaccactcacaaga 924

---

>ref|NM_028230.2| Mus musculus serine hydroxymethyl transferase 2 (mitochondrial)
           (Shmt2), mRNA
          Length = 2280

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 156 gatgtggttaccaccaccacccacaaga 183
           ||||| |||||||||||||| |||||||
Sbjct: 929 gatgttgttaccaccaccactcacaaga 956

---

>gb|AE016853.1| Pseudomonas syringae pv. tomato str. DC3000 complete genome
          Length = 6397126

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 156    gatgtggttaccaccaccacccacaaga 183
              |||||||| ||||||||||| |||||||
Sbjct: 505998 gatgtggtcaccaccaccacgcacaaga 505971

---

>gb|AC167719.2| Mus musculus BAC clone RP24-285I8 from chromosome 10, complete sequence
          Length = 180573

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 156    gatgtggttaccaccaccacccacaaga 183
              ||||| |||||||||||||| |||||||
Sbjct: 135746 gatgttgttaccaccaccactcacaaga 135719

---

>gb|CP000058.1| Pseudomonas syringae pv. phaseolicola 1448A, complete genome
          Length = 5928787

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 156     gatgtggttaccaccaccacccacaaga 183
               |||||||| ||||||||||| |||||||
Sbjct: 5393272 gatgtggtcaccaccaccacgcacaaga 5393299

---

>gb|CP000352.1| Ralstonia metallidurans CH34, complete genome
          Length = 3928089

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 165     accaccaccacccacaagag 184
               ||||||||||||||||||||
Sbjct: 2913834 accaccaccacccacaagag 2913853

---

>gb|AC132302.3| Mus musculus BAC clone RP24-279N5 from chromosome 3, complete sequence
          Length = 157307

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 474   gagaaccaccttgttctctg 493
             ||||||||||||||||||||
Sbjct: 76250 gagaaccaccttgttctctg 76231

---

>gb|AC133190.2| Mus musculus BAC clone RP23-375H9 from chromosome 10, complete sequence
          Length = 151273

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 156   gatgtggttaccaccaccacccacaaga 183
             ||||| |||||||||||||| |||||||
Sbjct: 52701 gatgttgttaccaccaccactcacaaga 52674

---

>gb|BC025355.1| Homo sapiens serine hydroxymethyltransferase 2 (mitochondrial),
           mRNA (cDNA clone IMAGE:4905540)
          Length = 1492

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 285 atcaactttgcagtgtttccatcacttcagggcggccctcacaa 328
           ||||||||||| ||||| ||||| || ||||| ||||| |||||
Sbjct: 536 atcaactttgccgtgttcccatccctgcaggggggcccccacaa 579

---

>gb|BC032584.1| Homo sapiens serine hydroxymethyltransferase 2 (mitochondrial), mRNA
            (cDNA clone MGC:45240 IMAGE:5499481), complete cds
          Length = 1945

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                        
Query: 285  atcaactttgcagtgtttccatcacttcagggcggccctcacaa 328
            ||||||||||| ||||| ||||| || ||||| ||||| |||||
Sbjct: 992  atcaactttgccgtgttcccatccctgcaggggggcccccacaa 1035

---

>gb|AC126007.16| Medicago truncatula clone mth2-11o4, complete sequence
          Length = 106747

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 508   ttggcttgtctggtaacaaa 527
             ||||||||||||||||||||
Sbjct: 47890 ttggcttgtctggtaacaaa 47909

---

>gb|BC008711.1| Homo sapiens serine hydroxymethyltransferase 2 (mitochondrial), mRNA
            (cDNA clone IMAGE:3530697), partial cds
          Length = 2364

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                        
Query: 285  atcaactttgcagtgtttccatcacttcagggcggccctcacaa 328
            ||||||||||| ||||| ||||| || ||||| ||||| |||||
Sbjct: 1159 atcaactttgccgtgttcccatccctgcaggggggcccccacaa 1202

---

>ref|NM_005412.4| Homo sapiens serine hydroxymethyltransferase 2 (mitochondrial)
           (SHMT2), mRNA
          Length = 2113

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 285 atcaactttgcagtgtttccatcacttcagggcggccctcacaa 328
           ||||||||||| ||||| ||||| || ||||| ||||| |||||
Sbjct: 953 atcaactttgccgtgttcccatccctgcaggggggcccccacaa 996

---

>emb|BX647711.1|HSM807857 Homo sapiens mRNA; cDNA DKFZp686P09201 (from clone DKFZp686P09201)
          Length = 2066

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                        
Query: 285  atcaactttgcagtgtttccatcacttcagggcggccctcacaa 328
            ||||||||||| ||||| ||||| || ||||| ||||| |||||
Sbjct: 1070 atcaactttgccgtgttcccatccctgcaggggggcccccacaa 1113

---

>emb|AL162755.2|NMA4Z2491 Neisseria meningitidis serogroup A strain Z2491 complete genome; segment
              4/7
          Length = 331801

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 162    gttaccaccaccacccacaa 181
              ||||||||||||||||||||
Sbjct: 181436 gttaccaccaccacccacaa 181417

---

>gb|AY080702.1| Arabidopsis thaliana At1g36370 mRNA sequence
          Length = 2487

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 276  gaggacaagatcaactttgcagtgtttccatc 307
            ||||| |||||||||||||| || ||||||||
Sbjct: 1654 gaggaaaagatcaactttgctgtttttccatc 1685

---

>emb|AJ242841.1|NME242841 Neisseria meningitidis DNA for opcA region, strain Z2491
          Length = 12348

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 162  gttaccaccaccacccacaa 181
            ||||||||||||||||||||
Sbjct: 1016 gttaccaccaccacccacaa 1035

---

>gb|BT008088.1| Synthetic construct Homo sapiens serine hydroxymethyltransferase 2
           (mitochondrial) mRNA, partial cds
          Length = 1515

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 285 atcaactttgcagtgtttccatcacttcagggcggccctcacaa 328
           ||||||||||| ||||| ||||| || ||||| ||||| |||||
Sbjct: 943 atcaactttgccgtgttcccatccctgcaggggggcccccacaa 986

---

>gb|BT006866.1| Homo sapiens serine hydroxymethyltransferase 2 (mitochondrial)
           mRNA, complete cds
          Length = 1515

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 285 atcaactttgcagtgtttccatcacttcagggcggccctcacaa 328
           ||||||||||| ||||| ||||| || ||||| ||||| |||||
Sbjct: 943 atcaactttgccgtgttcccatccctgcaggggggcccccacaa 986

---

>gb|BC044211.1| Homo sapiens serine hydroxymethyltransferase 2 (mitochondrial), mRNA
            (cDNA clone MGC:49833 IMAGE:5521082), complete cds
          Length = 1942

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                        
Query: 285  atcaactttgcagtgtttccatcacttcagggcggccctcacaa 328
            ||||||||||| ||||| ||||| || ||||| ||||| |||||
Sbjct: 989  atcaactttgccgtgttcccatccctgcaggggggcccccacaa 1032

---

>emb|AJ276903.1|NME276903 Neisseria meningitidis glyA gene, partial insertion sequence
            IS1106A10 and insertion sequence IS1106A3, strain Z3906
          Length = 2811

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 162  gttaccaccaccacccacaa 181
            ||||||||||||||||||||
Sbjct: 1014 gttaccaccaccacccacaa 1033

---

>gb|AC156615.7| Mus musculus chromosome 3, clone RP23-1B20, complete sequence
          Length = 210003

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 474    gagaaccaccttgttctctg 493
              ||||||||||||||||||||
Sbjct: 157473 gagaaccaccttgttctctg 157454

---

>emb|CR613033.1| full-length cDNA clone CS0DA011YK08 of Neuroblastoma of Homo sapiens
            (human)
          Length = 2152

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                        
Query: 285  atcaactttgcagtgtttccatcacttcagggcggccctcacaa 328
            ||||||||||| ||||| ||||| || ||||| ||||| |||||
Sbjct: 1215 atcaactttgccgtgttcccatccctgcaggggggcccccacaa 1258

---

>gb|AC025264.16| Homo sapiens 12 BAC RP11-704P17 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 193626

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 482   ccttgttctctgggatcttc 501
             ||||||||||||||||||||
Sbjct: 72053 ccttgttctctgggatcttc 72034

---

>gb|AC058822.6| Homo sapiens BAC clone RP11-809N18 from 4, complete sequence
          Length = 170212

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 366    gccatgttacctggattcaa 385
              ||||||||||||||||||||
Sbjct: 120982 gccatgttacctggattcaa 121001

---

>dbj|AK162421.1| Mus musculus 12 days embryo embryonic body between diaphragm region
           and neck cDNA, RIKEN full-length enriched library,
           clone:9430002B06 product:serine hydroxymethyl
           transferase 2 (mitochondrial), full insert sequence
          Length = 2113

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 156 gatgtggttaccaccaccacccacaaga 183
           ||||| |||||||||||||| |||||||
Sbjct: 939 gatgttgttaccaccaccactcacaaga 966

---

>ref|XM_683458.1| PREDICTED: Danio rerio similar to Spermidine synthase (Putrescine
           aminopropyltransferase) (SPDSY) (LOC572986), mRNA
          Length = 486

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 462 actgatggaacagagaacca 481
           ||||||||||||||||||||
Sbjct: 474 actgatggaacagagaacca 455

---

>dbj|AK171946.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
            library, clone:F830021C15 product:hypothetical
            Threonine-rich region profile containing protein, full
            insert sequence
          Length = 2884

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 401  ggtcaaggtcaatgctgttg 420
            ||||||||||||||||||||
Sbjct: 1060 ggtcaaggtcaatgctgttg 1041

---

>dbj|AK169192.1| Mus musculus 17 days embryo kidney cDNA, RIKEN full-length enriched
           library, clone:I920089B02 product:serine hydroxymethyl
           transferase 2 (mitochondrial), full insert sequence
          Length = 2239

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 156 gatgtggttaccaccaccacccacaaga 183
           ||||| |||||||||||||| |||||||
Sbjct: 872 gatgttgttaccaccaccactcacaaga 899

---

>gb|U23143.1|HSU23143 Human mitochondrial serine hydroxymethyltransferase gene, nuclear
            encoded mitochondrion protein, complete cds
          Length = 3869

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                        
Query: 285  atcaactttgcagtgtttccatcacttcagggcggccctcacaa 328
            ||||||||||| ||||| ||||| || ||||| ||||| |||||
Sbjct: 2626 atcaactttgccgtgttcccatccctgcaggggggcccccacaa 2669

---

>dbj|AK046866.1| Mus musculus 10 days neonate medulla oblongata cDNA, RIKEN
            full-length enriched library, clone:B830038L24
            product:hypothetical protein, full insert sequence
          Length = 2864

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 401  ggtcaaggtcaatgctgttg 420
            ||||||||||||||||||||
Sbjct: 1163 ggtcaaggtcaatgctgttg 1144

---

>dbj|AK035995.1| Mus musculus 16 days neonate cerebellum cDNA, RIKEN full-length
            enriched library, clone:9630025I22 product:hypothetical
            protein, full insert sequence
          Length = 3350

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 401  ggtcaaggtcaatgctgttg 420
            ||||||||||||||||||||
Sbjct: 1020 ggtcaaggtcaatgctgttg 1001

---

>dbj|AK051207.1| Mus musculus 12 days embryo spinal ganglion cDNA, RIKEN full-length
           enriched library, clone:D130016H13 product:SERINE
           HYDROXYMETHYLTRANSFERASE (EC 2.1.2.1) (SERINE METHYLASE)
           (GLYCINE HYDROXYMETHYLTRANSFERASE) (SHMT), full insert
           sequence
          Length = 2280

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 156 gatgtggttaccaccaccacccacaaga 183
           ||||| |||||||||||||| |||||||
Sbjct: 929 gatgttgttaccaccaccactcacaaga 956

---

>dbj|AK012355.1| Mus musculus 11 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2700043D08 product:SERINE
           HYDROXYMETHYLTRANSFERASE (EC 2.1.2.1) (SERINE METHYLASE)
           (GLYCINE HYDROXYMETHYLTRANSFERASE) (SHMT) homolog [Mus
           musculus], full insert sequence
          Length = 2054

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 156 gatgtggttaccaccaccacccacaaga 183
           ||||| |||||||||||||| |||||||
Sbjct: 883 gatgttgttaccaccaccactcacaaga 910

---

>dbj|AK037339.1| Mus musculus 16 days neonate thymus cDNA, RIKEN full-length
           enriched library, clone:A130008G10 product:SERINE
           HYDROXYMETHYLTRANSFERASE (EC 2.1.2.1) (SERINE METHYLASE)
           (GLYCINE HYDROXYMETHYLTRANSFERASE) (SHMT), full insert
           sequence
          Length = 2065

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 156 gatgtggttaccaccaccacccacaaga 183
           ||||| |||||||||||||| |||||||
Sbjct: 892 gatgttgttaccaccaccactcacaaga 919

---

>emb|BX813338.1|CNS0ADJ9 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTFB10ZA08 of Flowers and buds of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1960

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 276  gaggacaagatcaactttgcagtgtttccatc 307
            ||||| |||||||||||||| || ||||||||
Sbjct: 1257 gaggaaaagatcaactttgctgtttttccatc 1288

---

>dbj|AK223555.1| Homo sapiens mRNA for serine hydroxymethyltransferase 2
            (mitochondrial) variant, clone: FCC127B09
          Length = 1964

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                        
Query: 285  atcaactttgcagtgtttccatcacttcagggcggccctcacaa 328
            ||||||||||| ||||| ||||| || ||||| ||||| |||||
Sbjct: 1011 atcaactttgccgtgttcccatccctgcaggggggcccccacaa 1054

---

>gb|AC021199.7|AC021199 Arabidopsis thaliana chromosome 1 BAC F7F23 genomic sequence, complete
             sequence
          Length = 73252

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 276   gaggacaagatcaactttgcagtgtttccatc 307
             ||||| |||||||||||||| || ||||||||
Sbjct: 48070 gaggaaaagatcaactttgctgtttttccatc 48039

---

>gb|AC137834.9| Homo sapiens 12 BAC RP11-123K3 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 109523

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                         
Query: 285   atcaactttgcagtgtttccatcacttcagggcggccctcacaa 328
             ||||||||||| ||||| ||||| || ||||| ||||| |||||
Sbjct: 59144 atcaactttgccgtgttcccatccctgcaggggggcccccacaa 59101

---

>gb|AY084945.1| Arabidopsis thaliana clone 122515 mRNA, complete sequence
          Length = 2000

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 276  gaggacaagatcaactttgcagtgtttccatc 307
            ||||| |||||||||||||| || ||||||||
Sbjct: 1226 gaggaaaagatcaactttgctgtttttccatc 1257

---

>ref|XM_237146.2| PREDICTED: Rattus norvegicus similar to expressed sequence AW212394
           (LOC301388), mRNA
          Length = 2593

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 401 ggtcaaggtcaatgctgttg 420
           ||||||||||||||||||||
Sbjct: 727 ggtcaaggtcaatgctgttg 708

---

>gb|BT002738.1| Arabidopsis thaliana clone C105220 putative hydroxymethyltransferase
            (At1g36370) mRNA, complete cds
          Length = 1828

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 276  gaggacaagatcaactttgcagtgtttccatc 307
            ||||| |||||||||||||| || ||||||||
Sbjct: 1219 gaggaaaagatcaactttgctgtttttccatc 1250

---

>gb|BC091501.1| Homo sapiens serine hydroxymethyltransferase 2 (mitochondrial),
           mRNA (cDNA clone IMAGE:30378499), partial cds
          Length = 2103

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 285 atcaactttgcagtgtttccatcacttcagggcggccctcacaa 328
           ||||||||||| ||||| ||||| || ||||| ||||| |||||
Sbjct: 873 atcaactttgccgtgttcccatccctgcaggggggcccccacaa 916

---

>emb|BX276083.4| Zebrafish DNA sequence from clone CH211-165N1 in linkage group 17,
             complete sequence
          Length = 133128

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 557   tacactcaacaaaaatgctgtctt 580
             ||||||||| ||||||||||||||
Sbjct: 81353 tacactcaaaaaaaatgctgtctt 81376

---

>gb|AY892794.1| Synthetic construct Homo sapiens clone FLH024514.01L mitochondrial
           serine hydroxymethyltransferase 2 (SHMT2) mRNA, partial
           cds
          Length = 1515

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 285 atcaactttgcagtgtttccatcacttcagggcggccctcacaa 328
           ||||||||||| ||||| ||||| || ||||| ||||| |||||
Sbjct: 943 atcaactttgccgtgttcccatccctgcaggggggcccccacaa 986

---

>gb|AY890325.1| Synthetic construct Homo sapiens clone FLH024518.01X serine
           hydroxymethyltransferase 2 (SHMT2) mRNA, complete cds
          Length = 1515

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 285 atcaactttgcagtgtttccatcacttcagggcggccctcacaa 328
           ||||||||||| ||||| ||||| || ||||| ||||| |||||
Sbjct: 943 atcaactttgccgtgttcccatccctgcaggggggcccccacaa 986

---

>gb|AY890324.1| Synthetic construct Homo sapiens clone FLH024517.01X serine
           hydroxymethyltransferase 2 (SHMT2) mRNA, complete cds
          Length = 1515

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 285 atcaactttgcagtgtttccatcacttcagggcggccctcacaa 328
           ||||||||||| ||||| ||||| || ||||| ||||| |||||
Sbjct: 943 atcaactttgccgtgttcccatccctgcaggggggcccccacaa 986

---

>emb|BX648847.1|HSM808998 Homo sapiens mRNA; cDNA DKFZp686P05153 (from clone DKFZp686P05153)
          Length = 1506

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 285 atcaactttgcagtgtttccatcacttcagggcggccctcacaa 328
           ||||||||||| ||||| ||||| || ||||| ||||| |||||
Sbjct: 551 atcaactttgccgtgttcccatccctgcaggggggcccccacaa 594

---

>emb|AJ276902.1|NME276902 Neisseria meningitidis glyA gene for putative serine
            hydroxymethyltransferase and insertion sequence IS1106A4
          Length = 3349

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 162  gttaccaccaccacccacaa 181
            ||||||||||||||||||||
Sbjct: 1033 gttaccaccaccacccacaa 1052

---

>emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome complete sequence
          Length = 3716413

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 165    accaccaccacccacaagag 184
              ||||||||||||||||||||
Sbjct: 777122 accaccaccacccacaagag 777103

---

>gb|BC011911.2| Homo sapiens serine hydroxymethyltransferase 2 (mitochondrial),
           mRNA (cDNA clone MGC:20325 IMAGE:4139001), complete cds
          Length = 2113

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 285 atcaactttgcagtgtttccatcacttcagggcggccctcacaa 328
           ||||||||||| ||||| ||||| || ||||| ||||| |||||
Sbjct: 953 atcaactttgccgtgttcccatccctgcaggggggcccccacaa 996

---

>gb|AC133936.5| Mus musculus BAC clone RP24-399H1 from chromosome 6, complete sequence
          Length = 177971

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 152    ctctgatgtggttaccacca 171
              ||||||||||||||||||||
Sbjct: 113011 ctctgatgtggttaccacca 113030

---

>gb|BC029324.1| Mus musculus RIKEN cDNA 2210010L05 gene, mRNA (cDNA clone
           IMAGE:3986860)
          Length = 2995

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 401 ggtcaaggtcaatgctgttg 420
           ||||||||||||||||||||
Sbjct: 376 ggtcaaggtcaatgctgttg 357

---

>gb|BC008066.2| Homo sapiens cDNA clone IMAGE:3010445, containing frame-shift errors
          Length = 1922

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                        
Query: 285  atcaactttgcagtgtttccatcacttcagggcggccctcacaa 328
            ||||||||||| ||||| ||||| || ||||| ||||| |||||
Sbjct: 967  atcaactttgccgtgttcccatccctgcaggggggcccccacaa 1010

---

>gb|BC051396.1| Mus musculus serine hydroxymethyl transferase 2 (mitochondrial),
           mRNA (cDNA clone MGC:58993 IMAGE:5132676), complete cds
          Length = 1774

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 156 gatgtggttaccaccaccacccacaaga 183
           ||||| |||||||||||||| |||||||
Sbjct: 860 gatgttgttaccaccaccactcacaaga 887

---

>gb|AC139299.3| Mus musculus BAC clone RP23-335D20 from 1, complete sequence
          Length = 204848

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 401    ggtcaaggtcaatgctgttg 420
              ||||||||||||||||||||
Sbjct: 166455 ggtcaaggtcaatgctgttg 166474

---

>emb|CT009684.7| Mouse DNA sequence from clone RP23-127L21 on chromosome 13, complete
             sequence
          Length = 205067

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 35    ctgggattatgccaggcttagggc 58
             ||||||||||||||||||| ||||
Sbjct: 15821 ctgggattatgccaggctttgggc 15798

---

>gb|AC160762.4| Mus musculus BAC clone RP24-330E8 from chromosome 1, complete sequence
          Length = 149232

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 401   ggtcaaggtcaatgctgttg 420
             ||||||||||||||||||||
Sbjct: 16412 ggtcaaggtcaatgctgttg 16431


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,581,769
Number of Sequences: 3902068
Number of extensions: 5581769
Number of successful extensions: 145001
Number of sequences better than 10.0: 140
Number of HSP's better than 10.0 without gapping: 141
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 144367
Number of HSP's gapped (non-prelim): 616
length of query: 603
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 580
effective length of database: 17,143,297,704
effective search space: 9943112668320
effective search space used: 9943112668320
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---