ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags20g24
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_472371.1| Oryza sativa (japonica cultivar-group), predic... 208 1e-50
2dbj|AK069118.1| Oryza sativa (japonica cultivar-group) cDNA clon... 208 1e-50
3emb|AL606610.3|OSJN00045 Oryza sativa genomic DNA, chromosome 4,... 174 1e-40
4dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 174 1e-40
5dbj|AB196933.1| Glycine max Gm cnx-1 mRNA for calnexin, complete... 76 1e-10
6gb|U20502.1|GMU20502 Glycine max calnexin mRNA, complete cds 76 1e-10
7emb|Y17329.1|PSA17329 Pisum sativum mRNA for calnexin 52 0.001
8ref|NM_120816.2| Arabidopsis thaliana calcium ion binding AT5G07... 50 0.006
9gb|BT010385.1| Arabidopsis thaliana At5g07340 mRNA, complete cds 50 0.006
10gb|AY036607.1| Brassica napus putative papillar cell-specific ca... 50 0.006
11gb|BT001999.1| Arabidopsis thaliana calnexin homolog (At5g07340)... 50 0.006
12emb|AL163912.1|ATT2I1 Arabidopsis thaliana DNA chromosome 5, BAC... 50 0.006
13gb|U08315.1|ATU08315 Arabidopsis thaliana Columbia calnexin homo... 50 0.006
14gb|AY675086.1| Botryosphaeria parva microsatellite BotF19 sequence 46 0.090
15ref|XM_059689.5| PREDICTED: Homo sapiens similar to CG4502-PA (F... 46 0.090
16gb|AC093307.5| Homo sapiens chromosome 5 clone RP11-810C16, comp... 46 0.090
17dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.090
18dbj|AP003992.2| Oryza sativa (japonica cultivar-group) genomic D... 46 0.090
19dbj|AK070086.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.090
20dbj|AK063386.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.090
21gb|AY023081.1| Oryza sativa microsatellite MRG5406 containing (G... 44 0.35
22gb|AC135595.5| Oryza sativa chromosome 3 BAC OSJNBa0028F23 genom... 44 0.35
23gb|AC139847.3| Mus musculus BAC clone RP23-387P21 from chromosom... 44 0.35
24gb|AY350714.1| Olimarabidopsis pumila clone BAC Op37I22, complet... 44 0.35
25gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 44 0.35
26gb|AY242112.1| Sus scrofa EWB tyrosine hydroxylase (TH) gene, ex... 44 0.35
27gb|AY242111.1| Sus scrofa H205 tyrosine hydroxylase (TH) gene, e... 44 0.35
28gb|AY242110.1| Sus scrofa H254 tyrosine hydroxylase (TH) gene, e... 44 0.35
29gb|AY242109.1| Sus scrofa JWB tyrosine hydroxylase (TH) gene, ex... 44 0.35
30gb|AY242108.1| Sus scrofa LRJ tyrosine hydroxylase (TH) gene, ex... 44 0.35
31gb|AY242107.1| Sus scrofa LW1224 tyrosine hydroxylase (TH) gene,... 44 0.35
32gb|AY242106.1| Sus scrofa LW1461 tyrosine hydroxylase (TH) gene,... 44 0.35
33gb|AY242105.1| Sus scrofa LW197 tyrosine hydroxylase (TH) gene, ... 44 0.35
34gb|AY242104.1| Sus scrofa LW209 tyrosine hydroxylase (TH) gene, ... 44 0.35
35gb|AY242103.1| Sus scrofa LW3 tyrosine hydroxylase (TH) gene, ex... 44 0.35
36gb|AY242102.1| Sus scrofa LW33361 tyrosine hydroxylase (TH) gene... 44 0.35
37gb|AY242101.1| Sus scrofa LW419 tyrosine hydroxylase (TH) gene, ... 44 0.35
38gb|AY242100.1| Sus scrofa LW463 tyrosine hydroxylase (TH) gene, ... 44 0.35
39gb|AY242099.1| Sus scrofa M220 tyrosine hydroxylase (TH) gene, e... 44 0.35
40gb|AY242098.1| Sus scrofa P208 tyrosine hydroxylase (TH) gene, e... 44 0.35
41emb|AL008722.16|HS732E4 Human DNA sequence from clone CTA-732E4 ... 44 0.35
42emb|CR385056.20| Wallaby DNA sequence from clone GRWB-43E9, comp... 44 0.35
43gb|AY044828.1| Sus scrofa tyrosine hydroxylase gene, partial cds... 44 0.35
44gb|AC010561.7| Drosophila melanogaster 3L BAC RP98-21A2 (Roswell... 44 0.35
45gb|AC097725.2| Drosophila melanogaster 3L BAC RP98-48E19 (Roswel... 44 0.35
46gb|AC158506.9| Pan troglodytes clone rp43-145f17, complete sequence 44 0.35
47ref|NM_139508.2| Drosophila melanogaster CG32486-RD (CG32486), mRNA 44 0.35
48ref|NM_137992.1| Drosophila melanogaster CG5549-RA (CG5549), mRNA 44 0.35
49gb|AY052026.1| Drosophila melanogaster LD47625 full length cDNA 44 0.35
50gb|AC009182.4|AC009182 Drosophila melanogaster, chromosome 2R, r... 44 0.35
51dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.35
52dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.35
53gb|AY137200.1| Synthetic construct fiber protein DP1B mRNA, part... 44 0.35
54dbj|AP004792.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.35
55dbj|AP005874.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.35
56dbj|AK108973.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.35
57gb|AE003476.3| Drosophila melanogaster chromosome 3L, section 10... 44 0.35
58gb|AE003461.3| Drosophila melanogaster chromosome 2R, section 69... 44 0.35
59gb|U68060.1|CRU68060 Chlamydomonas reinhardtii actin-related pro... 44 0.35
60gb|U31782.1|HPU31782 Human papillomavirus type 24, complete genome 44 0.35
61ref|NM_189945.1| Oryza sativa (japonica cultivar-group), predic... 42 1.4
62gb|AY701834.1| Rattus fuscipes greyii clone RfgCTG1H microsatell... 42 1.4
63ref|XM_362100.1| Magnaporthe grisea 70-15 hypothetical protein (... 42 1.4
64gb|AC084296.12| Oryza sativa chromosome 3 BAC OSJNBb0024J04 geno... 42 1.4
65gb|AY210840.1| Priapulus caudatus 5.8S ribosomal RNA and 28S rib... 42 1.4
66gb|AC118545.20| Mus musculus strain C57BL/6J clone rp23-324o14 m... 42 1.4
67gb|AC135907.1| Genomic sequence for Oryza sativa, Nipponbare str... 42 1.4
68emb|CR661974.2|CNS0F9R0 Tetraodon nigroviridis full-length cDNA 42 1.4
69emb|AL590608.6| Human DNA sequence from clone RP11-363F12 on chr... 42 1.4
70gb|AC133340.4| Oryza sativa chromosome 3 BAC clone OSJNBb0024J17... 42 1.4
71emb|AL049553.20|HSJ402N21 Human DNA sequence from clone RP3-402N... 42 1.4
72emb|CR378665.1| Photobacterium profundum SS9; segment 3/12 42 1.4
73gb|AC129928.3| Homo sapiens chromosome 8, clone RP11-1112C19, co... 42 1.4
74gb|AC105101.8| Homo sapiens chromosome 18, clone RP11-246E12, co... 42 1.4
75gb|AC010664.7| Drosophila melanogaster 3L BAC RP98-2G4 (Roswell ... 42 1.4
76emb|BX537141.17| Zebrafish DNA sequence from clone DKEY-9E8 in l... 42 1.4
77gb|AC112727.4| Drosophila melanogaster 3L BAC RP98-15L14 (Roswel... 42 1.4
78gb|AC119747.1| Genomic sequence for Oryza sativa, Nipponbare str... 42 1.4
79gb|M22961.1|PPHDELCG Human papillomavirus type 5 DNA and natural... 42 1.4
80dbj|AB179042.1| Macaca fascicularis testis cDNA clone: QtsA-1200... 42 1.4
81dbj|AB169731.1| Macaca fascicularis brain cDNA, clone: QflA-1243... 42 1.4
82ref|NM_067236.3| Caenorhabditis elegans Y111B2A.8 (Y111B2A.8) mR... 42 1.4
83gb|AC011071.12|AC011071 Drosophila melanogaster, chromosome X, r... 42 1.4
84dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.4
85gb|AC010847.11|AC010847 Drosophila melanogaster, chromosome X, r... 42 1.4
86gb|AY898716.1| Mus musculus castaneus strain CTP isolate 2 invol... 42 1.4
87gb|M17463.1|PPH5CG Human papillomoavirus type 5, complete genome 42 1.4
88dbj|AP003451.4| Oryza sativa (japonica cultivar-group) genomic D... 42 1.4
89dbj|AP003433.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.4
90gb|AC137698.1| Genomic sequence for Oryza sativa, Nipponbare str... 42 1.4
91dbj|BA000011.4| Thermoplasma volcanium GSS1 DNA, complete genome 42 1.4
92dbj|AP003685.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.4
93emb|BX004783.13| Zebrafish DNA sequence from clone DKEY-14E1 in ... 42 1.4
94dbj|BS000117.1| Pan troglodytes chromosome 22 clone:RP43-027E03,... 42 1.4
95dbj|AB063285.1| Homo sapiens HLCS gene for holocarboxylase synth... 42 1.4
96dbj|AK119844.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.4
97ref|XM_314382.2| Anopheles gambiae str. PEST ENSANGP00000016013 ... 42 1.4
98dbj|AK109838.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.4
99dbj|AK102524.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.4
100emb|AL132904.5|CEY111B2A Caenorhabditis elegans YAC Y111B2A, com... 42 1.4
101gb|AE003512.3| Drosophila melanogaster chromosome X, section 64 ... 42 1.4
102gb|AE003483.4| Drosophila melanogaster chromosome 3L, section 17... 42 1.4
103dbj|AP001726.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 42 1.4
104gb|AC091484.8| Mus musculus strain C57BL/6J chromosome 17 clone ... 42 1.4
105gb|AC004687.1|AC004687 Homo sapiens chromosome 17, clone hRPC.11... 42 1.4
106gb|AC131795.3| Mus musculus BAC clone RP24-490N11 from 10, compl... 42 1.4
107gb|AC139848.4| Mus musculus BAC clone RP23-358O17 from 8, comple... 42 1.4
108dbj|AP005362.2| Homo sapiens genomic DNA, chromosome 8q23, clone... 42 1.4
109emb|AL672100.7| Mouse DNA sequence from clone RP23-125A1 on chro... 42 1.4
110gb|M72882.1|PPHE2A Human papillomavirus E2 protein (E2) gene seq... 42 1.4
111dbj|D90252.1|PPH5BCG Human papillomavirus type 5b complete genome 42 1.4
112dbj|AP000698.1| Homo sapiens genomic DNA, chromosome 21q22.2, co... 42 1.4
113gb|AF542529.2| Cryptococcus neoformans var. grubii strain H99 ma... 40 5.5
114gb|AC167918.2| Mycosphaerella graminicola clone JGIBBWB-5F7, com... 40 5.5
115gb|AC125407.4| Mus musculus BAC clone RP23-94F17 from chromosome... 40 5.5
116gb|AC164157.3| Mus musculus BAC clone RP24-297C1 from chromosome... 40 5.5
117ref|NM_195061.1| Oryza sativa (japonica cultivar-group) hypothet... 40 5.5
118ref|XM_468022.1| Oryza sativa (japonica cultivar-group), mRNA 40 5.5
119ref|XM_473025.1| Oryza sativa (japonica cultivar-group), predic... 40 5.5
120gb|AC078977.6| Oryza sativa (japonica cultivar-group) chromosome... 40 5.5
121gb|BT018771.1| Zea mays clone EL01N0525E08.d mRNA sequence 40 5.5
122gb|AC166150.2| Mus musculus chromosome 1, clone RP23-321N22, com... 40 5.5
123gb|AC093473.6| Mus musculus chromosome 5, clone RP23-54H12, comp... 40 5.5
124gb|AC164700.3| Mus musculus BAC clone RP24-548M16 from chromosom... 40 5.5
125gb|AC107679.19| Mus musculus chromosome 1, clone RP23-256H11, co... 40 5.5
126gb|AC150651.3| Bos taurus BAC CH240-451E16 (Children's Hospital... 40 5.5
127gb|AC010993.13| Drosophila melanogaster clone BACR27O05, complet... 40 5.5
128gb|BC073058.1| Xenopus laevis MGC82689 protein, mRNA (cDNA clone... 40 5.5
129ref|XM_359751.1| Magnaporthe grisea 70-15 hypothetical protein (... 40 5.5
130ref|XM_419093.1| PREDICTED: Gallus gallus similar to TRAF and TN... 40 5.5
131gb|AC127266.4| Mus musculus BAC clone RP24-347B12 from chromosom... 40 5.5
132gb|BC072384.1| Homo sapiens phospholipase C, delta 3, mRNA (cDNA... 40 5.5
133gb|BC055451.1| Mus musculus DEK oncogene (DNA binding), mRNA (cD... 40 5.5
134ref|XM_959012.1| Neurospora crassa OR74A hypothetical protein (N... 40 5.5
135gb|AC119952.12| Mus musculus chromosome 14, clone RP24-448F1, co... 40 5.5
136ref|XM_329300.1| Neurospora crassa OR74A hypothetical protein (N... 40 5.5
137ref|XM_590940.2| PREDICTED: Bos taurus similar to nuclear distri... 40 5.5
138ref|XM_878820.1| PREDICTED: Bos taurus similar to nuclear distri... 40 5.5
139ref|XM_878789.1| PREDICTED: Bos taurus similar to nuclear distri... 40 5.5
140gb|AC115028.17| Mus musculus chromosome 5, clone RP24-245G22, co... 40 5.5
141ref|NM_139227.2| Mus musculus ataxin 7 (Atxn7), mRNA 40 5.5
142ref|XM_716398.1| Candida albicans SC5314 hypothetical protein (C... 40 5.5
143ref|XM_716397.1| Candida albicans SC5314 cytosolic ribosomal aci... 40 5.5
144ref|XM_716126.1| Candida albicans SC5314 hypothetical protein (C... 40 5.5
145ref|XM_716125.1| Candida albicans SC5314 cytosolic ribosomal aci... 40 5.5
146ref|NM_133373.2| Homo sapiens phospholipase C, delta 3 (PLCD3), ... 40 5.5
147gb|AC159638.2| Mus musculus BAC clone RP24-78C16 from chromosome... 40 5.5
148gb|AC107531.8| Rattus norvegicus 1 BAC CH230-158N3 (Children's H... 40 5.5
149gb|BC088504.1| Xenopus tropicalis SMYD family member 5, mRNA (cD... 40 5.5
150gb|AC161346.7| Mus musculus chromosome 1, clone RP24-335G4, comp... 40 5.5
151gb|AC115911.14| Mus musculus chromosome 6, clone RP24-481I20, co... 40 5.5
152gb|AY622360.1| Psathyrostachys juncea clone RW-150 EST-SRR marke... 40 5.5
153gb|AC110235.13| Mus musculus chromosome 9, clone RP23-100M12, co... 40 5.5
154gb|AC185956.1| Populus trichocarpa clone Pop1-93N08, complete se... 40 5.5
155ref|XM_977523.1| PREDICTED: Mus musculus ataxin 7 (Atxn7), mRNA 40 5.5
156gb|AC132624.3| Mus musculus BAC clone RP23-77B21 from chromosome... 40 5.5
157emb|CR318625.10| Zebrafish DNA sequence from clone DKEY-119A7 in... 40 5.5
158ref|XM_742913.1| Aspergillus fumigatus Af293 hypothetical protei... 40 5.5
159emb|CR388121.11| Zebrafish DNA sequence from clone DKEY-161F5 in... 40 5.5
160ref|XM_845423.1| PREDICTED: Canis familiaris similar to protein ... 40 5.5
161gb|AC121844.2| Mus musculus BAC clone RP24-81L3 from chromosome ... 40 5.5
162gb|AC117227.3| Mus musculus BAC clone RP23-380C5 from 13, comple... 40 5.5
163emb|CR719663.2|CNS0GI8L Tetraodon nigroviridis full-length cDNA 40 5.5
164gb|AC123883.10| Mus musculus chromosome 3, clone RP23-461P7, com... 40 5.5
165emb|CR706472.2|CNS0G82C Tetraodon nigroviridis full-length cDNA 40 5.5
166ref|XM_536562.2| PREDICTED: Canis familiaris similar to platelet... 40 5.5
167emb|CR694686.2|CNS0FYYY Tetraodon nigroviridis full-length cDNA 40 5.5
168emb|CR690971.2|CNS0FW3R Tetraodon nigroviridis full-length cDNA 40 5.5
169emb|CR682491.2|CNS0FPK7 Tetraodon nigroviridis full-length cDNA 40 5.5
170ref|XM_733178.1| Plasmodium chabaudi chabaudi hypothetical prote... 40 5.5
171ref|XM_739283.1| Plasmodium chabaudi chabaudi hypothetical prote... 40 5.5
172gb|AC154171.5| Mus musculus BAC clone RP24-259F16 from chromosom... 40 5.5
173gb|AC121238.17| Medicago truncatula clone mth2-34p9, complete se... 40 5.5
174gb|BC010668.1| Homo sapiens phospholipase C, delta 3, mRNA (cDNA... 40 5.5
175gb|AC116479.14| Mus musculus, clone RP23-397F3, complete sequence 40 5.5
176gb|BC090742.1| Danio rerio im:6893299, mRNA (cDNA clone IMAGE:69... 40 5.5
177gb|AC058788.89| Mus musculus strain C57BL/6J clone rp23-284a9 ma... 40 5.5
178emb|CR762396.8| Zebrafish DNA sequence from clone DKEY-262O12 in... 40 5.5
179gb|AC115917.10| Mus musculus chromosome 1, clone RP24-488H6, com... 40 5.5
180emb|AL591503.9| Human DNA sequence from clone RP11-571E6 on chro... 40 5.5
181emb|AL512642.18| Human DNA sequence from clone RP11-469L23 on ch... 40 5.5
182emb|AL354693.6| Human DNA sequence from clone RP11-14E8 on chrom... 40 5.5
183emb|AL158154.28| Human DNA sequence from clone RP11-383M4 on chr... 40 5.5
184emb|AL160392.12| Human DNA sequence from clone RP11-121N13 on ch... 40 5.5
185gb|AY245422.1| Pteronotus parnellii alpha adrenergic receptor 2B... 40 5.5
186emb|BX855620.10| Zebrafish DNA sequence from clone DKEY-9M4 in l... 40 5.5
187emb|BX062907.1|CNS09KPB Single read from an extremity of a full-... 40 5.5
188emb|BX062906.1|CNS09KPA Single read from an extremity of a full-... 40 5.5
189emb|BX043455.1|CNS095OZ Single read from an extremity of a full-... 40 5.5
190emb|BX043454.1|CNS095OY Single read from an extremity of a full-... 40 5.5
191gb|AC112161.9| Mus Musculus chromosome 9 BAC clone MGS1-117K9 ES... 40 5.5
192emb|BX008116.1|CNS08EFC Single read from an extremity of a full-... 40 5.5
193emb|BX008115.1|CNS08EFB Single read from an extremity of a full-... 40 5.5
194emb|BX007425.1|CNS08DW5 Single read from an extremity of a full-... 40 5.5
195emb|X69816.1|RNP450AA R.norvegicus CYP17 gene 40 5.5
196emb|CR382398.1| Plasmodium falciparum chromosome 6, complete seq... 40 5.5
197emb|AL834392.1|HSM805471 Homo sapiens mRNA; cDNA DKFZp761F2423 (... 40 5.5
198emb|AL033497.1|CAC49C10 C.albicans cosmid Ca49C10 40 5.5
199gb|AC102586.14| Mus musculus chromosome 3, clone RP23-327I19, co... 40 5.5
200emb|AJ419811.1|DRO419811 Desmodus rotundus partial adra2b gene f... 40 5.5
201emb|AJ419810.1|EAT419810 Emballonura atrata partial adra2b gene ... 40 5.5
202emb|CR936832.1| Homo sapiens mRNA; cDNA DKFZp686O1425 (from clon... 40 5.5
203emb|CR759811.8| Zebrafish DNA sequence from clone CH211-190M18 i... 40 5.5
204emb|AJ720077.1| Gallus gallus mRNA for hypothetical protein, clo... 40 5.5
205emb|BX950184.7| Zebrafish DNA sequence from clone CH211-103O12 i... 40 5.5
206emb|AL845501.9| Mouse DNA sequence from clone RP23-194C12 on chr... 40 5.5
207emb|BX072580.4| Mouse DNA sequence from clone RP23-221P8 on chro... 40 5.5
208gb|AC113029.23| Mus musculus chromosome 5, clone RP23-206J17, co... 40 5.5
209emb|BX629343.11| Zebrafish DNA sequence from clone DKEY-66M17 in... 40 5.5
210gb|AC118670.2| Genomic sequence for Oryza sativa, Nipponbare sta... 40 5.5
211ref|NM_001006523.1| Gallus gallus excision repair cross-compleme... 40 5.5
212gb|AC120105.3| Homo sapiens 12 BAC RP11-743I10 (Roswell Park Can... 40 5.5
213gb|AC024563.6| Homo sapiens chromosome 19 clone CTC-451A6, compl... 40 5.5
214gb|AC011467.7| Homo sapiens chromosome 19 clone CTC-457E21, comp... 40 5.5
215dbj|AB207992.1| Oryzias latipes gene for hoxB3a, complete cds 40 5.5
216emb|BX569788.6| Zebrafish DNA sequence from clone CH211-161N19 i... 40 5.5
217emb|AL669896.7| Mouse DNA sequence from clone RP23-477F4 on chro... 40 5.5
218gb|AC023697.5| Drosophila melanogaster X BAC RP98-13N3 (Roswell ... 40 5.5
219dbj|AK127417.1| Homo sapiens cDNA FLJ45509 fis, clone BRTHA2020811 40 5.5
220ref|NM_167357.1| Drosophila melanogaster CG15745-RB, transcript ... 40 5.5
221dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ... 40 5.5
222dbj|AB232920.1| Oryzias latipes hox gene cluster, complete cds, ... 40 5.5
223dbj|AB218617.1| Rattus norvegicus genomic DNA, chromosome 4, clo... 40 5.5
224gb|AC104137.5| Homo sapiens BAC clone RP11-807H7 from 4, complet... 40 5.5
225gb|AF455111.1| Mus musculus ataxin-7 (Sca7) mRNA, complete cds 40 5.5
226ref|NM_132645.2| Drosophila melanogaster CG15745-RA, transcript ... 40 5.5
227gb|AC090488.3| Genomic sequence for Oryza sativa, Nipponbare str... 40 5.5
228gb|AF465311.1| Dictyostelium discoideum ABC transporter ABCA.9 (... 40 5.5
229dbj|AK154013.1| Mus musculus 2 days neonate thymus thymic cells ... 40 5.5
230ref|XM_938526.1| PREDICTED: Homo sapiens similar to Golgi autoan... 40 5.5
231ref|XM_496302.2| PREDICTED: Homo sapiens similar to Golgi autoan... 40 5.5
232ref|XM_943887.1| PREDICTED: Homo sapiens hypothetical protein LO... 40 5.5
233ref|XM_932529.1| PREDICTED: Homo sapiens hypothetical protein LO... 40 5.5
234ref|XM_702487.1| PREDICTED: Danio rerio similar to Proliferating... 40 5.5
235ref|XM_702486.1| PREDICTED: Danio rerio similar to Proliferating... 40 5.5
236ref|XM_702485.1| PREDICTED: Danio rerio similar to Proliferating... 40 5.5
237ref|XM_702484.1| PREDICTED: Danio rerio similar to Proliferating... 40 5.5
238ref|XM_679556.1| PREDICTED: Danio rerio similar to Proliferating... 40 5.5
239gb|AY061136.1| Drosophila melanogaster LD11831 full length cDNA 40 5.5
240gb|AC021753.7| Homo sapiens chromosome 15 clone RP11-129I12 map ... 40 5.5
241emb|BX119984.15| Zebrafish DNA sequence from clone DKEY-257N17 i... 40 5.5
242gb|AE016817.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 40 5.5
243gb|AC159643.2| Mus musculus BAC clone RP23-384H10 from chromosom... 40 5.5
244gb|AC159000.2| Mus musculus BAC clone RP24-207K16 from chromosom... 40 5.5
245gb|AC154693.2| Mus musculus BAC clone RP24-340P22 from chromosom... 40 5.5
246dbj|AK046679.1| Mus musculus 4 days neonate male adipose cDNA, R... 40 5.5
247gb|AC156602.2| Laccaria bicolor clone JGIAHZW-6X, complete sequence 40 5.5
248dbj|AK012877.1| Mus musculus 10, 11 days embryo whole body cDNA,... 40 5.5
249dbj|AK012615.1| Mus musculus 11 days embryo whole body cDNA, RIK... 40 5.5
250dbj|AK012315.1| Mus musculus 11 days embryo whole body cDNA, RIK... 40 5.5
251dbj|AK033451.1| Mus musculus adult male colon cDNA, RIKEN full-l... 40 5.5
252ref|XM_391967.2| PREDICTED: Apis mellifera similar to ENSANGP000... 40 5.5
253dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.5
254gb|AF350270.1|AF350270 Dolomedes tenebrosus fibroin 2 mRNA, part... 40 5.5
255dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.5
256dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.5
257dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.5
258dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.5
259gb|AC154515.2| Mus musculus BAC clone RP24-81I13 from chromosome... 40 5.5
260gb|AC078863.15|AC078863 Mus musculus BAC RP23-406N7 (Roswell Pa... 40 5.5
261gb|AF317659.1|AF317659 Candida albicans 60S acidic ribosomal pro... 40 5.5
262gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 40 5.5
263gb|AC002117.2| Homo sapiens chromosome 17, clone CTB-113F3, comp... 40 5.5
264dbj|AP006048.3| Oryza sativa (japonica cultivar-group) genomic D... 40 5.5
265dbj|AP005107.3| Oryza sativa (japonica cultivar-group) genomic D... 40 5.5
266dbj|AP003521.3| Oryza sativa (japonica cultivar-group) genomic D... 40 5.5
267dbj|AP004651.3| Oryza sativa (japonica cultivar-group) genomic D... 40 5.5
268dbj|AP006162.2| Oryza sativa (japonica cultivar-group) genomic D... 40 5.5
269dbj|AP006465.4| Oryza sativa (japonica cultivar-group) genomic D... 40 5.5
270gb|BC048844.1| Mus musculus DEK oncogene (DNA binding), mRNA (cD... 40 5.5
271dbj|AP006453.3| Oryza sativa (japonica cultivar-group) genomic D... 40 5.5
272dbj|AP005904.3| Oryza sativa (japonica cultivar-group) genomic D... 40 5.5
273emb|BX324200.5| Mouse DNA sequence from clone RP23-382H2 on chro... 40 5.5
274dbj|AP004068.3| Oryza sativa (japonica cultivar-group) genomic D... 40 5.5
275dbj|AP004058.3| Oryza sativa (japonica cultivar-group) genomic D... 40 5.5
276emb|AJ575098.1|TAE575098 Triticum aestivum partial mRNA for IAA1... 40 5.5
277gb|AY834406.1| Artibeus jamaicensis alpha adrenergic receptor 2B... 40 5.5
278dbj|AK074240.1| Homo sapiens cDNA FLJ23660 fis, clone HEP00931 40 5.5
279ref|XM_315562.2| Anopheles gambiae str. PEST ENSANGP00000017773 ... 40 5.5
280dbj|AK109540.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.5
281gb|AC007934.7|AC007934 Homo sapiens, clone RP11-29A1, complete s... 40 5.5
282ref|NM_209201.1| Eremothecium gossypii ADL248Cp (ADL248C), mRNA 40 5.5
283emb|BX120008.9| Zebrafish DNA sequence from clone CH211-215G18 i... 40 5.5
284dbj|AK067856.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.5
285dbj|AK067033.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.5
286emb|BX901933.15| Zebrafish DNA sequence from clone DKEY-114H6 in... 40 5.5
287emb|AL929231.3| Zebrafish DNA sequence from clone BUSM1-46P4, co... 40 5.5
288dbj|AK059807.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.5
289emb|AL928816.2| Zebrafish DNA sequence from clone BUSM1-265N4, c... 40 5.5
290emb|AJ303354.1|HVU303354 Hordeum vulgare cv. Haisa mRNA for MCB1... 40 5.5
291ref|NM_025900.1| Mus musculus DEK oncogene (DNA binding) (Dek), ... 40 5.5
292emb|CR391947.13| Zebrafish DNA sequence from clone DKEYP-88A4 in... 40 5.5
293gb|L24121.1|HUMIA2A Homo sapiens integrin alpha 2 subunit (ITGA2... 40 5.5
294gb|AE003492.3| Drosophila melanogaster chromosome X, section 44 ... 40 5.5
295gb|AF068847.1|AF068847 Xenopus laevis scaffold attachment factor... 40 5.5
296emb|CT486004.9| Mouse DNA sequence from clone RP23-424K3 on chro... 40 5.5
297gb|AC096628.14| Mus musculus strain C57BL/6J chromosome 13 clone... 40 5.5
298emb|AL844862.12| Mouse DNA sequence from clone RP23-355P22 on ch... 40 5.5
299gb|AC079959.25| Mus musculus strain C57BL/6J chromosome 12 clone... 40 5.5
300emb|BX927330.9| Zebrafish DNA sequence from clone DKEY-43B14 in ... 40 5.5
301gb|AC104548.6| Mus musculus chromosome 5, clone RP24-83N12, comp... 40 5.5
302gb|AC160641.2| Ornithorhynchus anatinus BAC clone OABb-469P24 fr... 40 5.5
303emb|AL929577.9| Mouse DNA sequence from clone RP23-455B1 on chro... 40 5.5
304gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 40 5.5
305gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 40 5.5
306gb|AC004062.1|AC004062 Homo sapiens chromosome 4 clone B316M24 m... 40 5.5
307emb|BX088567.6| Mouse DNA sequence from clone RP23-21L20 on chro... 40 5.5
308emb|AL731752.4|CNS08C81 Oryza sativa chromosome 12, . BAC OJ1536... 40 5.5
309emb|AL731751.4|CNS08C80 Oryza sativa chromosome 12, . BAC OJ1510... 40 5.5
310emb|AL732643.6|CNS08C9I Oryza sativa chromosome 12, . BAC OSJNBa... 40 5.5
311emb|AL606627.3|OSJN00052 Oryza sativa genomic DNA, chromosome 4,... 40 5.5
312emb|AL731761.3|CNS07YPV Oryza sativa chromosome 12, . BAC OJ1119... 40 5.5
313emb|AL954825.3|CNS08CD1 Oryza sativa chromosome 12, . BAC OJ2007... 40 5.5
314gb|AC149276.2| Mus musculus BAC clone RP24-316O8 from 6, complet... 40 5.5
315emb|AJ965495.1| Hordeum vulgare mcb1 gene, exons 1-5 40 5.5
316gb|BC035459.1| Mus musculus ataxin 7, mRNA (cDNA clone IMAGE:360... 40 5.5
317emb|AM162283.1| Oryza sativa mRNA for 4-alpha-L-fucosyltransfera... 40 5.5
318emb|CT030154.8| Mouse DNA sequence from clone RP23-387H3 on chro... 40 5.5
319emb|AL929186.7| Mouse DNA sequence from clone RP23-399K8 on chro... 40 5.5
320gb|AC171500.2| Mus musculus BAC clone RP24-67A10 from chromosome... 40 5.5
321emb|AL845298.5| Mouse DNA sequence from clone RP23-280N11 on chr... 40 5.5
322emb|AL808119.6| Mouse DNA sequence from clone RP23-70J9 on chrom... 40 5.5
323emb|AJ239062.1|TCR239062 Trypanosoma cruzi muc1 pseudogene 40 5.5
324dbj|AB075844.1| Homo sapiens mRNA for KIAA1964 protein 40 5.5

>ref|XM_472371.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1614

 Score =  208 bits (105), Expect = 1e-50
 Identities = 207/241 (85%)
 Strand = Plus / Plus

                                                                       
Query: 120 ccagatccacgcgtcggatccgttgttccacgagtccttcgacgagggcttcgaggggag 179
           |||||||| ||| || |||||| ||||| | ||| | ||||||||| |||||||||||||
Sbjct: 54  ccagatccgcgcctccgatccgctgttctatgagccgttcgacgagagcttcgaggggag 113

                                                                       
Query: 180 ctggatcgtctccggcaaggaagagtactcaggtgtatggaagcacgagaagagtgatgg 239
            ||| |  ||||||| ||||| || |||  |||||||||||||||||| |||||||||||
Sbjct: 114 gtgggttctctccgggaaggacgactacaaaggtgtatggaagcacgaaaagagtgatgg 173

                                                                       
Query: 240 ccatgaagactatggtctccttgttagcgagccagccaggaaatatgccatagtcaaaga 299
            |||||||||||||| || |||||||| |||   |||| ||||||||||||| |||| ||
Sbjct: 174 acatgaagactatggcctgcttgttagtgagaaggccaagaaatatgccataatcaagga 233

                                                                       
Query: 300 gcttgatagccctgttactttgaaggatgggacagttgtcctgcagttcgaagtgaggct 359
           |||||||   ||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 234 gcttgatgagcctgttactttgaaggatgggactgttgtcctgcagtttgaagtgaggct 293

            
Query: 360 t 360
           |
Sbjct: 294 t 294



to top

>dbj|AK069118.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023008D14, full
           insert sequence
          Length = 2059

 Score =  208 bits (105), Expect = 1e-50
 Identities = 207/241 (85%)
 Strand = Plus / Plus

                                                                       
Query: 120 ccagatccacgcgtcggatccgttgttccacgagtccttcgacgagggcttcgaggggag 179
           |||||||| ||| || |||||| ||||| | ||| | ||||||||| |||||||||||||
Sbjct: 160 ccagatccgcgcctccgatccgctgttctatgagccgttcgacgagagcttcgaggggag 219

                                                                       
Query: 180 ctggatcgtctccggcaaggaagagtactcaggtgtatggaagcacgagaagagtgatgg 239
            ||| |  ||||||| ||||| || |||  |||||||||||||||||| |||||||||||
Sbjct: 220 gtgggttctctccgggaaggacgactacaaaggtgtatggaagcacgaaaagagtgatgg 279

                                                                       
Query: 240 ccatgaagactatggtctccttgttagcgagccagccaggaaatatgccatagtcaaaga 299
            |||||||||||||| || |||||||| |||   |||| ||||||||||||| |||| ||
Sbjct: 280 acatgaagactatggcctgcttgttagtgagaaggccaagaaatatgccataatcaagga 339

                                                                       
Query: 300 gcttgatagccctgttactttgaaggatgggacagttgtcctgcagttcgaagtgaggct 359
           |||||||   ||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 340 gcttgatgagcctgttactttgaaggatgggactgttgtcctgcagtttgaagtgaggct 399

            
Query: 360 t 360
           |
Sbjct: 400 t 400



to top

>emb|AL606610.3|OSJN00045 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0012E08,
             complete sequence
          Length = 106975

 Score =  174 bits (88), Expect = 1e-40
 Identities = 136/152 (89%)
 Strand = Plus / Minus

                                                                         
Query: 209   caggtgtatggaagcacgagaagagtgatggccatgaagactatggtctccttgttagcg 268
             ||||||||||||||||||| ||||||||||| |||||||||||||| || |||||||| |
Sbjct: 78804 caggtgtatggaagcacgaaaagagtgatggacatgaagactatggcctgcttgttagtg 78745

                                                                         
Query: 269   agccagccaggaaatatgccatagtcaaagagcttgatagccctgttactttgaaggatg 328
             ||   |||| ||||||||||||| |||| |||||||||   |||||||||||||||||||
Sbjct: 78744 agaaggccaagaaatatgccataatcaaggagcttgatgagcctgttactttgaaggatg 78685

                                             
Query: 329   ggacagttgtcctgcagttcgaagtgaggctt 360
             |||| |||||||||||||| ||||||||||||
Sbjct: 78684 ggactgttgtcctgcagtttgaagtgaggctt 78653



 Score = 40.1 bits (20), Expect = 5.5
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                         
Query: 157   ttcgacgagggcttcgaggggagctggatcgtctccggcaagga 200
             ||||||||| ||||||||||||| ||| |  ||||||| |||||
Sbjct: 79801 ttcgacgagagcttcgaggggaggtgggttctctccgggaagga 79758



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  174 bits (88), Expect = 1e-40
 Identities = 136/152 (89%)
 Strand = Plus / Minus

                                                                            
Query: 209      caggtgtatggaagcacgagaagagtgatggccatgaagactatggtctccttgttagcg 268
                ||||||||||||||||||| ||||||||||| |||||||||||||| || |||||||| |
Sbjct: 19923996 caggtgtatggaagcacgaaaagagtgatggacatgaagactatggcctgcttgttagtg 19923937

                                                                            
Query: 269      agccagccaggaaatatgccatagtcaaagagcttgatagccctgttactttgaaggatg 328
                ||   |||| ||||||||||||| |||| |||||||||   |||||||||||||||||||
Sbjct: 19923936 agaaggccaagaaatatgccataatcaaggagcttgatgagcctgttactttgaaggatg 19923877

                                                
Query: 329      ggacagttgtcctgcagttcgaagtgaggctt 360
                |||| |||||||||||||| ||||||||||||
Sbjct: 19923876 ggactgttgtcctgcagtttgaagtgaggctt 19923845



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 37       gggtcggggaggaggaggagg 57
                |||||||||||||||||||||
Sbjct: 20203107 gggtcggggaggaggaggagg 20203127



 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 44       ggaggaggaggaggatgacg 63
                ||||||||||||||||||||
Sbjct: 24748054 ggaggaggaggaggatgacg 24748035



 Score = 40.1 bits (20), Expect = 5.5
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                            
Query: 157      ttcgacgagggcttcgaggggagctggatcgtctccggcaagga 200
                ||||||||| ||||||||||||| ||| |  ||||||| |||||
Sbjct: 19924993 ttcgacgagagcttcgaggggaggtgggttctctccgggaagga 19924950



to top

>dbj|AB196933.1| Glycine max Gm cnx-1 mRNA for calnexin, complete cds
          Length = 1786

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 80/94 (85%)
 Strand = Plus / Plus

                                                                       
Query: 211 ggtgtatggaagcacgagaagagtgatggccatgaagactatggtctccttgttagcgag 270
           ||||| |||||||| |  ||||||||||| ||||| || ||||| || |||||||| || 
Sbjct: 277 ggtgtctggaagcatgccaagagtgatgggcatgatgattatggacttcttgttagtgaa 336

                                             
Query: 271 ccagccaggaaatatgccatagtcaaagagcttg 304
           | ||||||||||||||| ||||||||||| ||||
Sbjct: 337 caagccaggaaatatgctatagtcaaagaacttg 370



to top

>gb|U20502.1|GMU20502 Glycine max calnexin mRNA, complete cds
          Length = 1919

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 80/94 (85%)
 Strand = Plus / Plus

                                                                       
Query: 211 ggtgtatggaagcacgagaagagtgatggccatgaagactatggtctccttgttagcgag 270
           ||||| |||||||| |  ||||||||||| ||||| || ||||| || |||||||| || 
Sbjct: 217 ggtgtctggaagcatgccaagagtgatgggcatgatgattatggacttcttgttagtgaa 276

                                             
Query: 271 ccagccaggaaatatgccatagtcaaagagcttg 304
           | ||||||||||||||| ||||||||||| ||||
Sbjct: 277 caagccaggaaatatgctatagtcaaagaacttg 310



to top

>emb|Y17329.1|PSA17329 Pisum sativum mRNA for calnexin
          Length = 1951

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 101/126 (80%)
 Strand = Plus / Plus

                                                                       
Query: 181 tggatcgtctccggcaaggaagagtactcaggtgtatggaagcacgagaagagtgatggc 240
           |||||||| || |||||||| || |||   ||||||||||||||    |||||||| || 
Sbjct: 190 tggatcgtatctggcaaggaggaatacaatggtgtatggaagcattcaaagagtgaaggg 249

                                                                       
Query: 241 catgaagactatggtctccttgttagcgagccagccaggaaatatgccatagtcaaagag 300
           ||||| || | ||| || ||||| || || ||||| ||||| ||||| ||||| ||||||
Sbjct: 250 catgatgattttggacttcttgtcagtgaaccagcaaggaagtatgctatagttaaagag 309

                 
Query: 301 cttgat 306
           ||||||
Sbjct: 310 cttgat 315



to top

>ref|NM_120816.2| Arabidopsis thaliana calcium ion binding AT5G07340 mRNA, complete
           cds
          Length = 1877

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 210 aggtgtatggaagcacgagaagagtgatggccatgaagactatgg 254
           |||||| |||||||||||||||||||| || ||||| || |||||
Sbjct: 243 aggtgtgtggaagcacgagaagagtgaagggcatgatgattatgg 287



to top

>gb|BT010385.1| Arabidopsis thaliana At5g07340 mRNA, complete cds
          Length = 1599

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 210 aggtgtatggaagcacgagaagagtgatggccatgaagactatgg 254
           |||||| |||||||||||||||||||| || ||||| || |||||
Sbjct: 156 aggtgtgtggaagcacgagaagagtgaagggcatgatgattatgg 200



to top

>gb|AY036607.1| Brassica napus putative papillar cell-specific calnexin mRNA,
           complete cds
          Length = 1907

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 210 aggtgtatggaagcacgagaagagtgatggccatgaagactatgg 254
           |||||| |||||||| ||||||||||| || ||||| ||||||||
Sbjct: 211 aggtgtgtggaagcatgagaagagtgagggacatgatgactatgg 255



to top

>gb|BT001999.1| Arabidopsis thaliana calnexin homolog (At5g07340) mRNA, complete
           cds
          Length = 1879

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 210 aggtgtatggaagcacgagaagagtgatggccatgaagactatgg 254
           |||||| |||||||||||||||||||| || ||||| || |||||
Sbjct: 245 aggtgtgtggaagcacgagaagagtgaagggcatgatgattatgg 289



to top

>emb|AL163912.1|ATT2I1 Arabidopsis thaliana DNA chromosome 5, BAC clone T2I1 (ESSA project)
          Length = 116763

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                          
Query: 210   aggtgtatggaagcacgagaagagtgatggccatgaagactatgg 254
             |||||| |||||||||||||||||||| || ||||| || |||||
Sbjct: 32943 aggtgtgtggaagcacgagaagagtgaagggcatgatgattatgg 32987



to top

>gb|U08315.1|ATU08315 Arabidopsis thaliana Columbia calnexin homolog gene, complete cds
          Length = 3144

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 210 aggtgtatggaagcacgagaagagtgatggccatgaagactatgg 254
           |||||| |||||||||||||||||||| || ||||| || |||||
Sbjct: 828 aggtgtgtggaagcacgagaagagtgaagggcatgatgattatgg 872



to top

>gb|AY675086.1| Botryosphaeria parva microsatellite BotF19 sequence
          Length = 241

 Score = 46.1 bits (23), Expect = 0.090
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 78  gctcttgctgccgctgctgctgg 100
           |||||||||||||||||||||||
Sbjct: 92  gctcttgctgccgctgctgctgg 114



to top

>ref|XM_059689.5| PREDICTED: Homo sapiens similar to CG4502-PA (FLJ25076), mRNA
          Length = 4406

 Score = 46.1 bits (23), Expect = 0.090
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 81  cttgctgccgctgctgctggtgg 103
           |||||||||||||||||||||||
Sbjct: 99  cttgctgccgctgctgctggtgg 77



to top

>gb|AC093307.5| Homo sapiens chromosome 5 clone RP11-810C16, complete sequence
          Length = 176199

 Score = 46.1 bits (23), Expect = 0.090
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 81     cttgctgccgctgctgctggtgg 103
              |||||||||||||||||||||||
Sbjct: 118697 cttgctgccgctgctgctggtgg 118675



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score = 46.1 bits (23), Expect = 0.090
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                          
Query: 73      gcggtgctcttgctgccgctgctgctg 99
               ||||||||| |||||||||||||||||
Sbjct: 4174930 gcggtgctcgtgctgccgctgctgctg 4174904



 Score = 44.1 bits (22), Expect = 0.35
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                              
Query: 38       ggtcggggaggaggaggaggatgacgggag 67
                |||||||| |||||||||||| ||||||||
Sbjct: 22935035 ggtcggggcggaggaggaggaggacgggag 22935064



 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 44       ggaggaggaggaggatgacg 63
                ||||||||||||||||||||
Sbjct: 32603242 ggaggaggaggaggatgacg 32603261



to top

>dbj|AP003992.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1077_E05
          Length = 116305

 Score = 46.1 bits (23), Expect = 0.090
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 73    gcggtgctcttgctgccgctgctgctg 99
             ||||||||| |||||||||||||||||
Sbjct: 84944 gcggtgctcgtgctgccgctgctgctg 84918



to top

>dbj|AK070086.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023040E15, full
           insert sequence
          Length = 2100

 Score = 46.1 bits (23), Expect = 0.090
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 73  gcggtgctcttgctgccgctgctgctg 99
           ||||||||| |||||||||||||||||
Sbjct: 281 gcggtgctcgtgctgccgctgctgctg 307



to top

>dbj|AK063386.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-114-G09, full
           insert sequence
          Length = 2760

 Score = 46.1 bits (23), Expect = 0.090
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 73  gcggtgctcttgctgccgctgctgctg 99
           ||||||||| |||||||||||||||||
Sbjct: 92  gcggtgctcgtgctgccgctgctgctg 118



to top

>gb|AY023081.1| Oryza sativa microsatellite MRG5406 containing (GAG)X8, closest to
           marker R1927, genomic sequence
          Length = 224

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 44  ggaggaggaggaggatgacggg 65
           ||||||||||||||||||||||
Sbjct: 112 ggaggaggaggaggatgacggg 133



to top

>gb|AC135595.5| Oryza sativa chromosome 3 BAC OSJNBa0028F23 genomic sequence, complete
              sequence
          Length = 166888

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 44     ggaggaggaggaggatgacggg 65
              ||||||||||||||||||||||
Sbjct: 114577 ggaggaggaggaggatgacggg 114598



to top

>gb|AC139847.3| Mus musculus BAC clone RP23-387P21 from chromosome 3, complete sequence
          Length = 203824

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 37    gggtcggggaggaggaggagga 58
             ||||||||||||||||||||||
Sbjct: 71150 gggtcggggaggaggaggagga 71129



to top

>gb|AY350714.1| Olimarabidopsis pumila clone BAC Op37I22, complete sequence
          Length = 84869

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                  
Query: 217  tggaagcacgagaagagtgatggccatgaagactatggtctccttgttagcgag 270
            |||||||| ||||||||||| || ||||| || ||||| || ||||| ||||||
Sbjct: 1915 tggaagcatgagaagagtgaagggcatgatgattatggacttcttgtgagcgag 1968



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 44       ggaggaggaggaggatgacggg 65
                ||||||||||||||||||||||
Sbjct: 33550503 ggaggaggaggaggatgacggg 33550482



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 45       gaggaggaggaggatgacgggaggg 69
                ||||||||||||||||| |||||||
Sbjct: 32359164 gaggaggaggaggatgatgggaggg 32359140



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 83       tgctgccgctgctgctggtggcctc 107
                |||||||||||||||| ||||||||
Sbjct: 13948360 tgctgccgctgctgctcgtggcctc 13948384



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 366     tggataaataaaaataataat 386
               |||||||||||||||||||||
Sbjct: 9296586 tggataaataaaaataataat 9296566



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 43      gggaggaggaggaggatgacg 63
               |||||||||||||||||||||
Sbjct: 1385849 gggaggaggaggaggatgacg 1385829



 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 45       gaggaggaggaggatgacgggagg 68
                |||||||||||||| |||||||||
Sbjct: 10317050 gaggaggaggaggaggacgggagg 10317073



to top

>gb|AY242112.1| Sus scrofa EWB tyrosine hydroxylase (TH) gene, exon 14 and partial cds;
             preproinsulin (INS) gene, complete cds; and insulin-like
             growth factor 2 preproprotein (IGF2) gene, complete cds,
             alternatively spliced
          Length = 28397

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 43    gggaggaggaggaggatgacgggagg 68
             |||||||||||||||| |||||||||
Sbjct: 26525 gggaggaggaggaggaagacgggagg 26500



to top

>gb|AY242111.1| Sus scrofa H205 tyrosine hydroxylase (TH) gene, exon 14; preproinsulin
             (INS) gene, complete cds; and insulin-like growth factor 2
             preproprotein (IGF2) gene, complete cds, alternatively
             spliced
          Length = 28190

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 43    gggaggaggaggaggatgacgggagg 68
             |||||||||||||||| |||||||||
Sbjct: 26351 gggaggaggaggaggaagacgggagg 26326



to top

>gb|AY242110.1| Sus scrofa H254 tyrosine hydroxylase (TH) gene, exon 14; preproinsulin
             (INS) gene, complete cds; and insulin-like growth factor 2
             preproprotein (IGF2) gene, complete cds, alternatively
             spliced
          Length = 28177

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 43    gggaggaggaggaggatgacgggagg 68
             |||||||||||||||| |||||||||
Sbjct: 26354 gggaggaggaggaggaagacgggagg 26329



to top

>gb|AY242109.1| Sus scrofa JWB tyrosine hydroxylase (TH) gene, exon 14; preproinsulin
             (INS) gene, complete cds; and insulin-like growth factor 2
             preproprotein (IGF2) gene, complete cds, alternatively
             spliced
          Length = 28188

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 43    gggaggaggaggaggatgacgggagg 68
             |||||||||||||||| |||||||||
Sbjct: 26381 gggaggaggaggaggaagacgggagg 26356



to top

>gb|AY242108.1| Sus scrofa LRJ tyrosine hydroxylase (TH) gene, exon 14 and partial cds;
             preproinsulin (INS) gene, complete cds; and insulin-like
             growth factor 2 preproprotein (IGF2) gene, complete cds,
             alternatively spliced
          Length = 28209

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 43    gggaggaggaggaggatgacgggagg 68
             |||||||||||||||| |||||||||
Sbjct: 26403 gggaggaggaggaggaagacgggagg 26378



to top

>gb|AY242107.1| Sus scrofa LW1224 tyrosine hydroxylase (TH) gene, exon 14 and partial
             cds; preproinsulin (INS) gene, complete cds; and
             insulin-like growth factor 2 preproprotein (IGF2) gene,
             complete cds, alternatively spliced
          Length = 28658

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 43    gggaggaggaggaggatgacgggagg 68
             |||||||||||||||| |||||||||
Sbjct: 26652 gggaggaggaggaggaagacgggagg 26627



to top

>gb|AY242106.1| Sus scrofa LW1461 tyrosine hydroxylase (TH) gene, exon 14 and partial
             cds; preproinsulin (INS) gene, complete cds; and
             insulin-like growth factor 2 preproprotein (IGF2) gene,
             complete cds, alternatively spliced
          Length = 28658

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 43    gggaggaggaggaggatgacgggagg 68
             |||||||||||||||| |||||||||
Sbjct: 26652 gggaggaggaggaggaagacgggagg 26627



to top

>gb|AY242105.1| Sus scrofa LW197 tyrosine hydroxylase (TH) gene, exon 14 and partial
             cds; preproinsulin (INS) gene, complete cds; and
             insulin-like growth factor 2 preproprotein (IGF2) gene,
             complete cds, alternatively spliced
          Length = 28267

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 43    gggaggaggaggaggatgacgggagg 68
             |||||||||||||||| |||||||||
Sbjct: 26436 gggaggaggaggaggaagacgggagg 26411



to top

>gb|AY242104.1| Sus scrofa LW209 tyrosine hydroxylase (TH) gene, exon 14 and partial
             cds; preproinsulin (INS) gene, complete cds; and
             insulin-like growth factor 2 preproprotein (IGF2) gene,
             complete cds, alternatively spliced
          Length = 28684

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 43    gggaggaggaggaggatgacgggagg 68
             |||||||||||||||| |||||||||
Sbjct: 26678 gggaggaggaggaggaagacgggagg 26653



to top

>gb|AY242103.1| Sus scrofa LW3 tyrosine hydroxylase (TH) gene, exon 14 and partial cds;
             preproinsulin (INS) gene, complete cds; and insulin-like
             growth factor 2 preproprotein (IGF2) gene, complete cds,
             alternatively spliced
          Length = 28376

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 43    gggaggaggaggaggatgacgggagg 68
             |||||||||||||||| |||||||||
Sbjct: 26503 gggaggaggaggaggaagacgggagg 26478



to top

>gb|AY242102.1| Sus scrofa LW33361 tyrosine hydroxylase (TH) gene, exon 14 and partial
             cds; preproinsulin (INS) gene, complete cds; and
             insulin-like growth factor 2 preproprotein (IGF2) gene,
             complete cds, alternatively spliced
          Length = 28661

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 43    gggaggaggaggaggatgacgggagg 68
             |||||||||||||||| |||||||||
Sbjct: 26655 gggaggaggaggaggaagacgggagg 26630



to top

>gb|AY242101.1| Sus scrofa LW419 tyrosine hydroxylase (TH) gene, exon 14 and partial
             cds; preproinsulin (INS) gene, complete cds; and
             insulin-like growth factor 2 preproprotein (IGF2) gene,
             complete cds, alternatively spliced
          Length = 28659

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 43    gggaggaggaggaggatgacgggagg 68
             |||||||||||||||| |||||||||
Sbjct: 26653 gggaggaggaggaggaagacgggagg 26628



to top

>gb|AY242100.1| Sus scrofa LW463 tyrosine hydroxylase (TH) gene, exon 14 and partial
             cds; preproinsulin (INS) gene, complete cds; and
             insulin-like growth factor 2 preproprotein (IGF2) gene,
             complete cds, alternatively spliced
          Length = 28649

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 43    gggaggaggaggaggatgacgggagg 68
             |||||||||||||||| |||||||||
Sbjct: 26642 gggaggaggaggaggaagacgggagg 26617



to top

>gb|AY242099.1| Sus scrofa M220 tyrosine hydroxylase (TH) gene, exon 14; preproinsulin
             (INS) gene, complete cds; and insulin-like growth factor 2
             preproprotein (IGF2) gene, complete cds, alternatively
             spliced
          Length = 28219

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 43    gggaggaggaggaggatgacgggagg 68
             |||||||||||||||| |||||||||
Sbjct: 26379 gggaggaggaggaggaagacgggagg 26354



to top

>gb|AY242098.1| Sus scrofa P208 tyrosine hydroxylase (TH) gene, exon 14 and partial
             cds; preproinsulin (INS) gene, complete cds; and
             insulin-like growth factor 2 preproprotein (IGF2) gene,
             complete cds, alternatively spliced
          Length = 28593

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 43    gggaggaggaggaggatgacgggagg 68
             |||||||||||||||| |||||||||
Sbjct: 26587 gggaggaggaggaggaagacgggagg 26562



to top

>emb|AL008722.16|HS732E4 Human DNA sequence from clone CTA-732E4 on chromosome 22q12.1 Contains
             ESTs, STSs and GSSs, complete sequence
          Length = 90497

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 42    ggggaggaggaggaggatgacg 63
             ||||||||||||||||||||||
Sbjct: 77653 ggggaggaggaggaggatgacg 77674



to top

>emb|CR385056.20| Wallaby DNA sequence from clone GRWB-43E9, complete sequence
          Length = 153276

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 37   gggtcggggaggaggaggagga 58
            ||||||||||||||||||||||
Sbjct: 1175 gggtcggggaggaggaggagga 1154



to top

>gb|AY044828.1| Sus scrofa tyrosine hydroxylase gene, partial cds; and preproinsulin
             (INS) and insulin-like-growth factor 2 preproprotein
             (IGF2) genes, complete cds, alternatively spliced
          Length = 32467

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 43    gggaggaggaggaggatgacgggagg 68
             |||||||||||||||| |||||||||
Sbjct: 28640 gggaggaggaggaggaagacgggagg 28615



to top

>gb|AC010561.7| Drosophila melanogaster 3L BAC RP98-21A2 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 171451

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 83     tgctgccgctgctgctggtggc 104
              ||||||||||||||||||||||
Sbjct: 159159 tgctgccgctgctgctggtggc 159180



to top

>gb|AC097725.2| Drosophila melanogaster 3L BAC RP98-48E19 (Roswell Park Cancer
             Institute Drosophila BAC Library) complete sequence
          Length = 176521

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 83    tgctgccgctgctgctggtggc 104
             ||||||||||||||||||||||
Sbjct: 13277 tgctgccgctgctgctggtggc 13298



to top

>gb|AC158506.9| Pan troglodytes clone rp43-145f17, complete sequence
          Length = 155707

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 42    ggggaggaggaggaggatgacg 63
             ||||||||||||||||||||||
Sbjct: 91662 ggggaggaggaggaggatgacg 91683



to top

>ref|NM_139508.2| Drosophila melanogaster CG32486-RD (CG32486), mRNA
          Length = 2360

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 83  tgctgccgctgctgctggtggc 104
           ||||||||||||||||||||||
Sbjct: 562 tgctgccgctgctgctggtggc 541



to top

>ref|NM_137992.1| Drosophila melanogaster CG5549-RA (CG5549), mRNA
          Length = 3606

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                          
Query: 75   ggtgctcttgctgccgctgctgctggtggc 104
            |||||| |||||||| ||||||||||||||
Sbjct: 2554 ggtgctgttgctgccactgctgctggtggc 2583



to top

>gb|AY052026.1| Drosophila melanogaster LD47625 full length cDNA
          Length = 2347

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 83  tgctgccgctgctgctggtggc 104
           ||||||||||||||||||||||
Sbjct: 535 tgctgccgctgctgctggtggc 514



to top

>gb|AC009182.4|AC009182 Drosophila melanogaster, chromosome 2R, region 60A2-60A3, BAC clone
             BACR05F24, complete sequence
          Length = 147086

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 75    ggtgctcttgctgccgctgctgctggtggc 104
             |||||| |||||||| ||||||||||||||
Sbjct: 60992 ggtgctgttgctgccactgctgctggtggc 61021



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 37       gggtcggggaggaggaggagga 58
                ||||||||||||||||||||||
Sbjct: 25252503 gggtcggggaggaggaggagga 25252482



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 37       gggtcggggaggaggaggagg 57
                |||||||||||||||||||||
Sbjct: 30350389 gggtcggggaggaggaggagg 30350369



 Score = 40.1 bits (20), Expect = 5.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                            
Query: 44       ggaggaggaggaggatgacgggagggcg 71
                ||||||||||||||| || |||||||||
Sbjct: 16876541 ggaggaggaggaggaggaggggagggcg 16876514



 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 44      ggaggaggaggaggatgacg 63
               ||||||||||||||||||||
Sbjct: 7817161 ggaggaggaggaggatgacg 7817142



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 44       ggaggaggaggaggatgacggg 65
                ||||||||||||||||||||||
Sbjct: 33640975 ggaggaggaggaggatgacggg 33640954



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 45       gaggaggaggaggatgacgggaggg 69
                ||||||||||||||||| |||||||
Sbjct: 32449674 gaggaggaggaggatgatgggaggg 32449650



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 83       tgctgccgctgctgctggtggcctc 107
                |||||||||||||||| ||||||||
Sbjct: 13943335 tgctgccgctgctgctcgtggcctc 13943359



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 366     tggataaataaaaataataat 386
               |||||||||||||||||||||
Sbjct: 9294419 tggataaataaaaataataat 9294399



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 43      gggaggaggaggaggatgacg 63
               |||||||||||||||||||||
Sbjct: 1385847 gggaggaggaggaggatgacg 1385827



 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 45       gaggaggaggaggatgacgggagg 68
                |||||||||||||| |||||||||
Sbjct: 10315151 gaggaggaggaggaggacgggagg 10315174



to top

>gb|AY137200.1| Synthetic construct fiber protein DP1B mRNA, partial cds
          Length = 303

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 83  tgctgccgctgctgctggtggc 104
           ||||||||||||||||||||||
Sbjct: 84  tgctgccgctgctgctggtggc 105



to top

>dbj|AP004792.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0505A04
          Length = 159241

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 37    gggtcggggaggaggaggagga 58
             ||||||||||||||||||||||
Sbjct: 71111 gggtcggggaggaggaggagga 71090



to top

>dbj|AP005874.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OSJNBa0016G10
          Length = 143211

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 38    ggtcggggaggaggaggaggatgacgggag 67
             |||||||| |||||||||||| ||||||||
Sbjct: 54837 ggtcggggcggaggaggaggaggacgggag 54866



to top

>dbj|AK108973.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-153-E03, full
           insert sequence
          Length = 2057

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 83  tgctgccgctgctgctggtggc 104
           ||||||||||||||||||||||
Sbjct: 409 tgctgccgctgctgctggtggc 388



to top

>gb|AE003476.3| Drosophila melanogaster chromosome 3L, section 10 of 83 of the complete
              sequence
          Length = 304419

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 83     tgctgccgctgctgctggtggc 104
              ||||||||||||||||||||||
Sbjct: 303758 tgctgccgctgctgctggtggc 303779



to top

>gb|AE003461.3| Drosophila melanogaster chromosome 2R, section 69 of 73 of the complete
              sequence
          Length = 598988

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 75     ggtgctcttgctgccgctgctgctggtggc 104
              |||||| |||||||| ||||||||||||||
Sbjct: 357477 ggtgctgttgctgccactgctgctggtggc 357506



to top

>gb|U68060.1|CRU68060 Chlamydomonas reinhardtii actin-related protein (ACT2) gene, complete
            cds
          Length = 4307

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                          
Query: 42   ggggaggaggaggaggatgacgggagggcg 71
            ||||||||||||||||| || |||||||||
Sbjct: 1175 ggggaggaggaggaggaggaggggagggcg 1204



to top

>gb|U31782.1|HPU31782 Human papillomavirus type 24, complete genome
          Length = 7452

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 37   gggtcggggaggaggaggaggatgac 62
            |||| |||||||||||||||||||||
Sbjct: 3666 gggtgggggaggaggaggaggatgac 3641



to top

>ref|NM_189945.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 423

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 38  ggtcggggaggaggaggagga 58
           |||||||||||||||||||||
Sbjct: 285 ggtcggggaggaggaggagga 305



to top

>gb|AY701834.1| Rattus fuscipes greyii clone RfgCTG1H microsatellite sequence
          Length = 212

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 83  tgctgccgctgctgctggtggcctc 107
           |||||| ||||||||||||||||||
Sbjct: 73  tgctgctgctgctgctggtggcctc 49



to top

>ref|XM_362100.1| Magnaporthe grisea 70-15 hypothetical protein (MG04545.4) partial
           cds
          Length = 1095

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 74  cggtgctcttgctgccgctgctgctggtg 102
           |||||| ||||| ||||||||||||||||
Sbjct: 180 cggtgcccttgccgccgctgctgctggtg 208



to top

>gb|AC084296.12| Oryza sativa chromosome 3 BAC OSJNBb0024J04 genomic sequence, complete
             sequence
          Length = 145507

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 45    gaggaggaggaggatgacgggaggg 69
             ||||||||||||||||| |||||||
Sbjct: 11292 gaggaggaggaggatgatgggaggg 11268



to top

>gb|AY210840.1| Priapulus caudatus 5.8S ribosomal RNA and 28S ribosomal RNA genes,
           partial sequence
          Length = 4271

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 75  ggtgctcttgctgccgctgctgctg 99
           |||||| ||||||||||||||||||
Sbjct: 518 ggtgctgttgctgccgctgctgctg 542



to top

>gb|AC118545.20| Mus musculus strain C57BL/6J clone rp23-324o14 map 17, complete sequence
          Length = 236365

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 40     tcggggaggaggaggaggatg 60
              |||||||||||||||||||||
Sbjct: 119402 tcggggaggaggaggaggatg 119422



to top

>gb|AC135907.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone OJ1057D12,
             from chromosome 3, complete sequence
          Length = 161676

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 83    tgctgccgctgctgctggtggcctc 107
             |||||||||||||||| ||||||||
Sbjct: 63122 tgctgccgctgctgctcgtggcctc 63098



to top

>emb|CR661974.2|CNS0F9R0 Tetraodon nigroviridis full-length cDNA
          Length = 1323

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 364  cttggataaataaaaataata 384
            |||||||||||||||||||||
Sbjct: 1079 cttggataaataaaaataata 1059



to top

>emb|AL590608.6| Human DNA sequence from clone RP11-363F12 on chromosome 6, complete
             sequence
          Length = 200337

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 366   tggataaataaaaataataat 386
             |||||||||||||||||||||
Sbjct: 75704 tggataaataaaaataataat 75724



to top

>gb|AC133340.4| Oryza sativa chromosome 3 BAC clone OSJNBb0024J17, complete sequence
          Length = 102751

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 45    gaggaggaggaggatgacgggaggg 69
             ||||||||||||||||| |||||||
Sbjct: 92931 gaggaggaggaggatgatgggaggg 92907



to top

>emb|AL049553.20|HSJ402N21 Human DNA sequence from clone RP3-402N21 on chromosome 6p21.1-21.31
              Contains the MDGA1 gene for MAM domain containing
              glycosylphosphatidylinositol anchor 1, the gene for a novel
              protein and four CpG islands, complete sequence
          Length = 170302

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 44     ggaggaggaggaggatgacgggagg 68
              ||||||||||||||||||| |||||
Sbjct: 118617 ggaggaggaggaggatgacaggagg 118593



to top

>emb|CR378665.1| Photobacterium profundum SS9; segment 3/12
          Length = 347213

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 366   tggataaataaaaataataat 386
             |||||||||||||||||||||
Sbjct: 55368 tggataaataaaaataataat 55388



to top

>gb|AC129928.3| Homo sapiens chromosome 8, clone RP11-1112C19, complete sequence
          Length = 141478

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 368    gataaataaaaataataattg 388
              |||||||||||||||||||||
Sbjct: 106394 gataaataaaaataataattg 106374



to top

>gb|AC105101.8| Homo sapiens chromosome 18, clone RP11-246E12, complete sequence
          Length = 172626

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 269    agccagccaggaaatatgcca 289
              |||||||||||||||||||||
Sbjct: 107495 agccagccaggaaatatgcca 107515



to top

>gb|AC010664.7| Drosophila melanogaster 3L BAC RP98-2G4 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 155615

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 82    ttgctgccgctgctgctggtg 102
             |||||||||||||||||||||
Sbjct: 45301 ttgctgccgctgctgctggtg 45281



to top

>emb|BX537141.17| Zebrafish DNA sequence from clone DKEY-9E8 in linkage group 2, complete
              sequence
          Length = 264534

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 362    tacttggataaataaaaataataat 386
              |||||| ||||||||||||||||||
Sbjct: 242584 tacttgaataaataaaaataataat 242608



to top

>gb|AC112727.4| Drosophila melanogaster 3L BAC RP98-15L14 (Roswell Park Cancer
             Institute Drosophila BAC Library) complete sequence
          Length = 157739

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 82    ttgctgccgctgctgctggtg 102
             |||||||||||||||||||||
Sbjct: 30843 ttgctgccgctgctgctggtg 30823



to top

>gb|AC119747.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone OJ1293G11,
             from chromosome 3, complete sequence
          Length = 147806

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 43    gggaggaggaggaggatgacg 63
             |||||||||||||||||||||
Sbjct: 47352 gggaggaggaggaggatgacg 47332



to top

>gb|M22961.1|PPHDELCG Human papillomavirus type 5 DNA and naturally occurring deletions in
            the late region of the virus
          Length = 7746

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 42   ggggaggaggaggaggatgac 62
            |||||||||||||||||||||
Sbjct: 3879 ggggaggaggaggaggatgac 3859



to top

>dbj|AB179042.1| Macaca fascicularis testis cDNA clone: QtsA-12004, similar to human
           nucleoporin 62kDa (NUP62), transcript variant 1, mRNA,
           RefSeq: NM_153719.2
          Length = 2110

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 83  tgctgccgctgctgctggtggcctcggcg 111
           |||||| |||||||||||||||| |||||
Sbjct: 857 tgctgctgctgctgctggtggccgcggcg 829



to top

>dbj|AB169731.1| Macaca fascicularis brain cDNA, clone: QflA-12431, similar to human
            nucleoporin 62kDa (NUP62), transcript variant 3, mRNA,
            RefSeq: NM_153718.2
          Length = 2493

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 83   tgctgccgctgctgctggtggcctcggcg 111
            |||||| |||||||||||||||| |||||
Sbjct: 1117 tgctgctgctgctgctggtggccgcggcg 1089



to top

>ref|NM_067236.3| Caenorhabditis elegans Y111B2A.8 (Y111B2A.8) mRNA, complete cds
          Length = 1908

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 41  cggggaggaggaggaggatga 61
           |||||||||||||||||||||
Sbjct: 395 cggggaggaggaggaggatga 415



to top

>gb|AC011071.12|AC011071 Drosophila melanogaster, chromosome X, region 18C-18D, BAC clone
              BACR27L16, complete sequence
          Length = 182623

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 44     ggaggaggaggaggatgacgg 64
              |||||||||||||||||||||
Sbjct: 140015 ggaggaggaggaggatgacgg 139995



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 38       ggtcggggaggaggaggagga 58
                |||||||||||||||||||||
Sbjct: 39952223 ggtcggggaggaggaggagga 39952243



to top

>gb|AC010847.11|AC010847 Drosophila melanogaster, chromosome X, region 18D-18D, BAC clone
             BACR10M08, complete sequence
          Length = 180213

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 44    ggaggaggaggaggatgacgg 64
             |||||||||||||||||||||
Sbjct: 78495 ggaggaggaggaggatgacgg 78475



to top

>gb|AY898716.1| Mus musculus castaneus strain CTP isolate 2 involucrin gene, exon 2
           and partial cds
          Length = 1284

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 79  ctcttgctgccgctgctgctg 99
           |||||||||||||||||||||
Sbjct: 201 ctcttgctgccgctgctgctg 181



to top

>gb|M17463.1|PPH5CG Human papillomoavirus type 5, complete genome
          Length = 7746

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 42   ggggaggaggaggaggatgac 62
            |||||||||||||||||||||
Sbjct: 3879 ggggaggaggaggaggatgac 3859



to top

>dbj|AP003451.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0413C03
          Length = 162161

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 38    ggtcggggaggaggaggagga 58
             |||||||||||||||||||||
Sbjct: 43674 ggtcggggaggaggaggagga 43694



to top

>dbj|AP003433.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0004D12
          Length = 138136

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 38     ggtcggggaggaggaggagga 58
              |||||||||||||||||||||
Sbjct: 132931 ggtcggggaggaggaggagga 132951



to top

>gb|AC137698.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBb0014A21, from chromosome 3, complete sequence
          Length = 134014

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 366   tggataaataaaaataataat 386
             |||||||||||||||||||||
Sbjct: 59667 tggataaataaaaataataat 59687



to top

>dbj|BA000011.4| Thermoplasma volcanium GSS1 DNA, complete genome
          Length = 1584804

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 370    taaataaaaataataattgaa 390
              |||||||||||||||||||||
Sbjct: 956458 taaataaaaataataattgaa 956438



to top

>dbj|AP003685.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0548E04
          Length = 138037

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 37    gggtcggggaggaggaggagg 57
             |||||||||||||||||||||
Sbjct: 96984 gggtcggggaggaggaggagg 96964



to top

>emb|BX004783.13| Zebrafish DNA sequence from clone DKEY-14E1 in linkage group 6,
             complete sequence
          Length = 204385

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 45    gaggaggaggaggatgacgggaggg 69
             ||||||||||||||||| |||||||
Sbjct: 38714 gaggaggaggaggatgaagggaggg 38690



to top

>dbj|BS000117.1| Pan troglodytes chromosome 22 clone:RP43-027E03, map 22, complete
             sequences
          Length = 155641

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 369   ataaataaaaataataattga 389
             |||||||||||||||||||||
Sbjct: 82492 ataaataaaaataataattga 82472



to top

>dbj|AB063285.1| Homo sapiens HLCS gene for holocarboxylase synthetase, complete cds
          Length = 250000

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 369    ataaataaaaataataattga 389
              |||||||||||||||||||||
Sbjct: 217210 ataaataaaaataataattga 217230



to top

>dbj|AK119844.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-178-D02, full
            insert sequence
          Length = 3048

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 83   tgctgccgctgctgctggtggcctc 107
            |||||| ||||||||||||||||||
Sbjct: 1255 tgctgctgctgctgctggtggcctc 1231



to top

>ref|XM_314382.2| Anopheles gambiae str. PEST ENSANGP00000016013
           (ENSANGG00000013524), partial mRNA
          Length = 1074

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 41  cggggaggaggaggaggatga 61
           |||||||||||||||||||||
Sbjct: 771 cggggaggaggaggaggatga 751



to top

>dbj|AK109838.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-148-D10, full
           insert sequence
          Length = 1550

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 45  gaggaggaggaggatgacgggaggg 69
           ||||||||||||||||| |||||||
Sbjct: 725 gaggaggaggaggatgatgggaggg 749



to top

>dbj|AK102524.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033096A14, full
           insert sequence
          Length = 2725

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 43  gggaggaggaggaggatgacg 63
           |||||||||||||||||||||
Sbjct: 101 gggaggaggaggaggatgacg 81



to top

>emb|AL132904.5|CEY111B2A Caenorhabditis elegans YAC Y111B2A, complete sequence
          Length = 257705

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 41    cggggaggaggaggaggatga 61
             |||||||||||||||||||||
Sbjct: 54798 cggggaggaggaggaggatga 54778



to top

>gb|AE003512.3| Drosophila melanogaster chromosome X, section 64 of 74 of the complete
              sequence
          Length = 346474

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 44     ggaggaggaggaggatgacgg 64
              |||||||||||||||||||||
Sbjct: 184261 ggaggaggaggaggatgacgg 184241



to top

>gb|AE003483.4| Drosophila melanogaster chromosome 3L, section 17 of 83 of the complete
             sequence
          Length = 175890

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 82    ttgctgccgctgctgctggtg 102
             |||||||||||||||||||||
Sbjct: 31609 ttgctgccgctgctgctggtg 31589



to top

>dbj|AP001726.1| Homo sapiens genomic DNA, chromosome 21q, section 70/105
          Length = 340000

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 369    ataaataaaaataataattga 389
              |||||||||||||||||||||
Sbjct: 335702 ataaataaaaataataattga 335682



to top

>gb|AC091484.8| Mus musculus strain C57BL/6J chromosome 17 clone rp23-386a1, complete
             sequence
          Length = 205343

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 40    tcggggaggaggaggaggatg 60
             |||||||||||||||||||||
Sbjct: 13410 tcggggaggaggaggaggatg 13430



to top

>gb|AC004687.1|AC004687 Homo sapiens chromosome 17, clone hRPC.1171_I_10, complete sequence
          Length = 175120

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 42    ggggaggaggaggaggatgacgggagggc 70
             ||||||||||||||||| || ||||||||
Sbjct: 84730 ggggaggaggaggaggaggaggggagggc 84758



to top

>gb|AC131795.3| Mus musculus BAC clone RP24-490N11 from 10, complete sequence
          Length = 181961

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 76    gtgctcttgctgccgctgctgctgg 100
             ||||||||||||| |||||||||||
Sbjct: 59952 gtgctcttgctgctgctgctgctgg 59928



to top

>gb|AC139848.4| Mus musculus BAC clone RP23-358O17 from 8, complete sequence
          Length = 241809

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 38    ggtcggggaggaggaggagga 58
             |||||||||||||||||||||
Sbjct: 89788 ggtcggggaggaggaggagga 89808



to top

>dbj|AP005362.2| Homo sapiens genomic DNA, chromosome 8q23, clone: KB1574E2, complete
              sequence
          Length = 219049

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 368    gataaataaaaataataattg 388
              |||||||||||||||||||||
Sbjct: 147506 gataaataaaaataataattg 147526



to top

>emb|AL672100.7| Mouse DNA sequence from clone RP23-125A1 on chromosome 2, complete
             sequence
          Length = 196421

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 41    cggggaggaggaggaggatgacggg 65
             |||||||||||||||||| ||||||
Sbjct: 19942 cggggaggaggaggaggaggacggg 19966



to top

>gb|M72882.1|PPHE2A Human papillomavirus E2 protein (E2) gene sequence
          Length = 396

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                               
Query: 42 ggggaggaggaggaggatgac 62
          |||||||||||||||||||||
Sbjct: 26 ggggaggaggaggaggatgac 6



to top

>dbj|D90252.1|PPH5BCG Human papillomavirus type 5b complete genome
          Length = 7779

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 42   ggggaggaggaggaggatgac 62
            |||||||||||||||||||||
Sbjct: 3887 ggggaggaggaggaggatgac 3867



to top

>dbj|AP000698.1| Homo sapiens genomic DNA, chromosome 21q22.2, cosmid clone:D8F6,
             CBR1-HLCS region
          Length = 39159

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 369   ataaataaaaataataattga 389
             |||||||||||||||||||||
Sbjct: 21366 ataaataaaaataataattga 21346



to top

>gb|AF542529.2| Cryptococcus neoformans var. grubii strain H99 mating type alpha locus,
             complete sequence
          Length = 124734

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 297   agagcttgatagccctgtta 316
             ||||||||||||||||||||
Sbjct: 42304 agagcttgatagccctgtta 42323



to top

>gb|AC167918.2| Mycosphaerella graminicola clone JGIBBWB-5F7, complete sequence
          Length = 32954

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 44    ggaggaggaggaggatgacg 63
             ||||||||||||||||||||
Sbjct: 21576 ggaggaggaggaggatgacg 21595



to top

>gb|AC125407.4| Mus musculus BAC clone RP23-94F17 from chromosome 5, complete sequence
          Length = 233082

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 42     ggggaggaggaggaggatgacgggaggg 69
              ||||||||||||||||| || |||||||
Sbjct: 212679 ggggaggaggaggaggaggaggggaggg 212706



to top

>gb|AC164157.3| Mus musculus BAC clone RP24-297C1 from chromosome 6, complete sequence
          Length = 176868

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 44    ggaggaggaggaggatgacg 63
             ||||||||||||||||||||
Sbjct: 61587 ggaggaggaggaggatgacg 61568



to top

>ref|NM_195061.1| Oryza sativa (japonica cultivar-group) hypothetical protein
           (OSJNBb0081F12.22), mRNA
          Length = 1803

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 42  ggggaggaggaggaggatga 61
           ||||||||||||||||||||
Sbjct: 849 ggggaggaggaggaggatga 830



to top

>ref|XM_468022.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 3042

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 44  ggaggaggaggaggatgacg 63
           ||||||||||||||||||||
Sbjct: 183 ggaggaggaggaggatgacg 202



to top

>ref|XM_473025.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1410

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 44  ggaggaggaggaggatgacg 63
           ||||||||||||||||||||
Sbjct: 531 ggaggaggaggaggatgacg 550



to top

>gb|AC078977.6| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0496H07,
              complete sequence
          Length = 164477

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 44     ggaggaggaggaggatgacg 63
              ||||||||||||||||||||
Sbjct: 125168 ggaggaggaggaggatgacg 125149



to top

>gb|BT018771.1| Zea mays clone EL01N0525E08.d mRNA sequence
          Length = 2227

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tgctgccgctgctgctggtg 102
           ||||||||||||||||||||
Sbjct: 326 tgctgccgctgctgctggtg 307



to top

>gb|AC166150.2| Mus musculus chromosome 1, clone RP23-321N22, complete sequence
          Length = 214765

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 44    ggaggaggaggaggatgacg 63
             ||||||||||||||||||||
Sbjct: 99380 ggaggaggaggaggatgacg 99399



to top

>gb|AC093473.6| Mus musculus chromosome 5, clone RP23-54H12, complete sequence
          Length = 208876

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Plus

                                          
Query: 42     ggggaggaggaggaggatgacgggaggg 69
              ||||||||||||||||| ||||||||||
Sbjct: 207748 ggggaggaggaggagga-gacgggaggg 207774



to top

>gb|AC164700.3| Mus musculus BAC clone RP24-548M16 from chromosome 5, complete sequence
          Length = 212172

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 42     ggggaggaggaggaggatga 61
              ||||||||||||||||||||
Sbjct: 131329 ggggaggaggaggaggatga 131348



to top

>gb|AC107679.19| Mus musculus chromosome 1, clone RP23-256H11, complete sequence
          Length = 168732

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 44     ggaggaggaggaggatgacg 63
              ||||||||||||||||||||
Sbjct: 111004 ggaggaggaggaggatgacg 110985



to top

>gb|AC150651.3| Bos taurus  BAC CH240-451E16 (Children's Hospital Oakland Research
             Institute Bovine BAC Library (male)) complete sequence
          Length = 174648

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 363   acttggataaataaaaataataat 386
             ||||| ||||||||||||||||||
Sbjct: 12387 acttgaataaataaaaataataat 12410



to top

>gb|AC010993.13| Drosophila melanogaster clone BACR27O05, complete sequence
          Length = 193526

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 44    ggaggaggaggaggatgacg 63
             ||||||||||||||||||||
Sbjct: 46609 ggaggaggaggaggatgacg 46628



to top

>gb|BC073058.1| Xenopus laevis MGC82689 protein, mRNA (cDNA clone MGC:82689
            IMAGE:5074183), complete cds
          Length = 1909

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 44   ggaggaggaggaggatgacg 63
            ||||||||||||||||||||
Sbjct: 1212 ggaggaggaggaggatgacg 1231



to top

>ref|XM_359751.1| Magnaporthe grisea 70-15 hypothetical protein (MG05026.4) partial
           mRNA
          Length = 459

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 44  ggaggaggaggaggatgacg 63
           ||||||||||||||||||||
Sbjct: 435 ggaggaggaggaggatgacg 454



to top

>ref|XM_419093.1| PREDICTED: Gallus gallus similar to TRAF and TNF
          receptor-associated protein; ETS1-associated protein 2
          (LOC421007), mRNA
          Length = 1456

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                              
Query: 42 ggggaggaggaggaggatga 61
          ||||||||||||||||||||
Sbjct: 63 ggggaggaggaggaggatga 82



to top

>gb|AC127266.4| Mus musculus BAC clone RP24-347B12 from chromosome 5, complete sequence
          Length = 185232

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Plus

                                          
Query: 42     ggggaggaggaggaggatgacgggaggg 69
              ||||||||||||||||| ||||||||||
Sbjct: 140648 ggggaggaggaggagga-gacgggaggg 140674



to top

>gb|BC072384.1| Homo sapiens phospholipase C, delta 3, mRNA (cDNA clone MGC:71172
            IMAGE:6378601), complete cds
          Length = 3445

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 44   ggaggaggaggaggatgacg 63
            ||||||||||||||||||||
Sbjct: 1585 ggaggaggaggaggatgacg 1604



to top

>gb|BC055451.1| Mus musculus DEK oncogene (DNA binding), mRNA (cDNA clone MGC:65340
           IMAGE:4164972), complete cds
          Length = 2547

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 44  ggaggaggaggaggatgacg 63
           ||||||||||||||||||||
Sbjct: 206 ggaggaggaggaggatgacg 225



to top

>ref|XM_959012.1| Neurospora crassa OR74A hypothetical protein (NCU02111.1) partial
            mRNA
          Length = 3708

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 42   ggggaggaggaggaggatgacggg 65
            ||||||||||||||||| ||||||
Sbjct: 3445 ggggaggaggaggaggaggacggg 3422



to top

>gb|AC119952.12| Mus musculus chromosome 14, clone RP24-448F1, complete sequence
          Length = 181695

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 76     gtgctcttgctgccgctgctgctggtgg 103
              ||||| ||||||| ||||||||||||||
Sbjct: 139998 gtgctgttgctgctgctgctgctggtgg 140025



to top

>ref|XM_329300.1| Neurospora crassa OR74A hypothetical protein (NCU02111.1) partial
            mRNA
          Length = 3708

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 42   ggggaggaggaggaggatgacggg 65
            ||||||||||||||||| ||||||
Sbjct: 3445 ggggaggaggaggaggaggacggg 3422



to top

>ref|XM_590940.2| PREDICTED: Bos taurus similar to nuclear distribution gene C
           homolog (A. nidulans), transcript variant 1 (LOC513277),
           mRNA
          Length = 1315

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 44  ggaggaggaggaggatgacg 63
           ||||||||||||||||||||
Sbjct: 539 ggaggaggaggaggatgacg 558



to top

>ref|XM_878820.1| PREDICTED: Bos taurus similar to nuclear distribution gene C
           homolog (A. nidulans), transcript variant 5 (LOC513277),
           mRNA
          Length = 1329

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 44  ggaggaggaggaggatgacg 63
           ||||||||||||||||||||
Sbjct: 553 ggaggaggaggaggatgacg 572



to top

>ref|XM_878789.1| PREDICTED: Bos taurus similar to nuclear distribution gene C
           homolog (A. nidulans), transcript variant 4 (LOC513277),
           mRNA
          Length = 1311

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 44  ggaggaggaggaggatgacg 63
           ||||||||||||||||||||
Sbjct: 535 ggaggaggaggaggatgacg 554



to top

>gb|AC115028.17| Mus musculus chromosome 5, clone RP24-245G22, complete sequence
          Length = 188423

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 42     ggggaggaggaggaggatgacgggaggg 69
              ||||||||||||||||| || |||||||
Sbjct: 176030 ggggaggaggaggaggaggaggggaggg 176003



to top

>ref|NM_139227.2| Mus musculus ataxin 7 (Atxn7), mRNA
          Length = 3612

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 44   ggaggaggaggaggatgacg 63
            ||||||||||||||||||||
Sbjct: 2390 ggaggaggaggaggatgacg 2371



to top

>ref|XM_716398.1| Candida albicans SC5314 hypothetical protein (CaO19_2993), mRNA
          Length = 315

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 84  gctgccgctgctgctggtgg 103
           ||||||||||||||||||||
Sbjct: 104 gctgccgctgctgctggtgg 85



to top

>ref|XM_716397.1| Candida albicans SC5314 cytosolic ribosomal acidic protein P1A
           (CaO19_2992), mRNA
          Length = 321

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 84  gctgccgctgctgctggtgg 103
           ||||||||||||||||||||
Sbjct: 196 gctgccgctgctgctggtgg 215



to top

>ref|XM_716126.1| Candida albicans SC5314 hypothetical protein (CaO19_10510), mRNA
          Length = 315

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 84  gctgccgctgctgctggtgg 103
           ||||||||||||||||||||
Sbjct: 104 gctgccgctgctgctggtgg 85



to top

>ref|XM_716125.1| Candida albicans SC5314 cytosolic ribosomal acidic protein P1A
           (CaO19_10509), mRNA
          Length = 321

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 84  gctgccgctgctgctggtgg 103
           ||||||||||||||||||||
Sbjct: 196 gctgccgctgctgctggtgg 215



to top

>ref|NM_133373.2| Homo sapiens phospholipase C, delta 3 (PLCD3), mRNA
          Length = 3445

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 44   ggaggaggaggaggatgacg 63
            ||||||||||||||||||||
Sbjct: 1585 ggaggaggaggaggatgacg 1604



to top

>gb|AC159638.2| Mus musculus BAC clone RP24-78C16 from chromosome 12, complete sequence
          Length = 190196

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 371   aaataaaaataataattgaa 390
             ||||||||||||||||||||
Sbjct: 37545 aaataaaaataataattgaa 37564



to top

>gb|AC107531.8| Rattus norvegicus 1 BAC CH230-158N3 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 173190

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 83     tgctgccgctgctgctggtg 102
              ||||||||||||||||||||
Sbjct: 169683 tgctgccgctgctgctggtg 169664



to top

>gb|BC088504.1| Xenopus tropicalis SMYD family member 5, mRNA (cDNA clone
            IMAGE:6977211), partial cds
          Length = 1923

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 44   ggaggaggaggaggatgacg 63
            ||||||||||||||||||||
Sbjct: 1187 ggaggaggaggaggatgacg 1206



to top

>gb|AC161346.7| Mus musculus chromosome 1, clone RP24-335G4, complete sequence
          Length = 191681

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 44    ggaggaggaggaggatgacg 63
             ||||||||||||||||||||
Sbjct: 81923 ggaggaggaggaggatgacg 81904



to top

>gb|AC115911.14| Mus musculus chromosome 6, clone RP24-481I20, complete sequence
          Length = 168641

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 44    ggaggaggaggaggatgacg 63
             ||||||||||||||||||||
Sbjct: 25077 ggaggaggaggaggatgacg 25096



to top

>gb|AY622360.1| Psathyrostachys juncea clone RW-150 EST-SRR marker sequence
          Length = 174

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 83  tgctgccgctgctgctggtg 102
           ||||||||||||||||||||
Sbjct: 50  tgctgccgctgctgctggtg 69



to top

>gb|AC110235.13| Mus musculus chromosome 9, clone RP23-100M12, complete sequence
          Length = 220755

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 44     ggaggaggaggaggatgacg 63
              ||||||||||||||||||||
Sbjct: 105161 ggaggaggaggaggatgacg 105142



to top

>gb|AC185956.1| Populus trichocarpa clone Pop1-93N08, complete sequence
          Length = 73786

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 368   gataaataaaaataataatt 387
             ||||||||||||||||||||
Sbjct: 35533 gataaataaaaataataatt 35552



to top

>ref|XM_977523.1| PREDICTED: Mus musculus ataxin 7 (Atxn7), mRNA
          Length = 5411

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 44   ggaggaggaggaggatgacg 63
            ||||||||||||||||||||
Sbjct: 1968 ggaggaggaggaggatgacg 1949



to top

>gb|AC132624.3| Mus musculus BAC clone RP23-77B21 from chromosome 18, complete sequence
          Length = 161099

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 37    gggtcggggaggaggaggaggatg 60
             |||| |||||||||||||||||||
Sbjct: 43375 gggtgggggaggaggaggaggatg 43398



to top

>emb|CR318625.10| Zebrafish DNA sequence from clone DKEY-119A7 in linkage group 17,
              complete sequence
          Length = 142057

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 371    aaataaaaataataattgaa 390
              ||||||||||||||||||||
Sbjct: 125070 aaataaaaataataattgaa 125089



to top

>ref|XM_742913.1| Aspergillus fumigatus Af293 hypothetical protein (Afu5g03370) partial
            mRNA
          Length = 4155

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 44   ggaggaggaggaggatgacg 63
            ||||||||||||||||||||
Sbjct: 2061 ggaggaggaggaggatgacg 2080



to top

>emb|CR388121.11| Zebrafish DNA sequence from clone DKEY-161F5 in linkage group 15,
             complete sequence
          Length = 179357

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 366   tggataaataaaaataataa 385
             ||||||||||||||||||||
Sbjct: 12165 tggataaataaaaataataa 12184



to top

>ref|XM_845423.1| PREDICTED: Canis familiaris similar to protein phosphatase 1,
           regulatory (inhibitor) subunit 1B isoform 1 (LOC608394),
           mRNA
          Length = 1777

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 44  ggaggaggaggaggatgacg 63
           ||||||||||||||||||||
Sbjct: 763 ggaggaggaggaggatgacg 782



to top

>gb|AC121844.2| Mus musculus BAC clone RP24-81L3 from chromosome 10, complete sequence
          Length = 187443

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 37    gggtcggggaggaggaggaggatg 60
             |||| |||||||||||||||||||
Sbjct: 75781 gggtgggggaggaggaggaggatg 75758



to top

>gb|AC117227.3| Mus musculus BAC clone RP23-380C5 from 13, complete sequence
          Length = 190816

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 44    ggaggaggaggaggatgacg 63
             ||||||||||||||||||||
Sbjct: 60576 ggaggaggaggaggatgacg 60595



to top

>emb|CR719663.2|CNS0GI8L Tetraodon nigroviridis full-length cDNA
          Length = 714

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 44  ggaggaggaggaggatgacg 63
           ||||||||||||||||||||
Sbjct: 601 ggaggaggaggaggatgacg 620



to top

>gb|AC123883.10| Mus musculus chromosome 3, clone RP23-461P7, complete sequence
          Length = 199554

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 83   tgctgccgctgctgctggtg 102
            ||||||||||||||||||||
Sbjct: 7020 tgctgccgctgctgctggtg 7039



to top

>emb|CR706472.2|CNS0G82C Tetraodon nigroviridis full-length cDNA
          Length = 870

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 44  ggaggaggaggaggatgacg 63
           ||||||||||||||||||||
Sbjct: 382 ggaggaggaggaggatgacg 401



to top

>ref|XM_536562.2| PREDICTED: Canis familiaris similar to platelet-activating factor
           acetylhydrolase, isoform Ib, beta subunit 30kDa
           (LOC479425), mRNA
          Length = 2177

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 83  tgctgccgctgctgctggtg 102
           ||||||||||||||||||||
Sbjct: 947 tgctgccgctgctgctggtg 966



to top

>emb|CR694686.2|CNS0FYYY Tetraodon nigroviridis full-length cDNA
          Length = 715

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 44  ggaggaggaggaggatgacg 63
           ||||||||||||||||||||
Sbjct: 602 ggaggaggaggaggatgacg 621



to top

>emb|CR690971.2|CNS0FW3R Tetraodon nigroviridis full-length cDNA
          Length = 791

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 85  ctgccgctgctgctggtggcctcg 108
           |||| |||||||||||||||||||
Sbjct: 82  ctgctgctgctgctggtggcctcg 105



to top

>emb|CR682491.2|CNS0FPK7 Tetraodon nigroviridis full-length cDNA
          Length = 714

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 44  ggaggaggaggaggatgacg 63
           ||||||||||||||||||||
Sbjct: 601 ggaggaggaggaggatgacg 620



to top

>ref|XM_733178.1| Plasmodium chabaudi chabaudi hypothetical protein (PC000260.02.0)
           partial mRNA
          Length = 234

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 368 gataaataaaaataataatt 387
           ||||||||||||||||||||
Sbjct: 213 gataaataaaaataataatt 232



to top

>ref|XM_739283.1| Plasmodium chabaudi chabaudi hypothetical protein (PC000521.03.0)
           partial mRNA
          Length = 471

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 369 ataaataaaaataataattgaaca 392
           ||||||||||||||||||| ||||
Sbjct: 133 ataaataaaaataataatttaaca 156



to top

>gb|AC154171.5| Mus musculus BAC clone RP24-259F16 from chromosome 13, complete sequence
          Length = 173300

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 44     ggaggaggaggaggatgacg 63
              ||||||||||||||||||||
Sbjct: 127332 ggaggaggaggaggatgacg 127351



to top

>gb|AC121238.17| Medicago truncatula clone mth2-34p9, complete sequence
          Length = 104878

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 367   ggataaataaaaataataat 386
             ||||||||||||||||||||
Sbjct: 98138 ggataaataaaaataataat 98119



to top

>gb|BC010668.1| Homo sapiens phospholipase C, delta 3, mRNA (cDNA clone
            IMAGE:3854215), partial cds
          Length = 2840

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 44   ggaggaggaggaggatgacg 63
            ||||||||||||||||||||
Sbjct: 982  ggaggaggaggaggatgacg 1001



to top

>gb|AC116479.14| Mus musculus, clone RP23-397F3, complete sequence
          Length = 225423

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 44    ggaggaggaggaggatgacg 63
             ||||||||||||||||||||
Sbjct: 22560 ggaggaggaggaggatgacg 22579



to top

>gb|BC090742.1| Danio rerio im:6893299, mRNA (cDNA clone IMAGE:6909257), partial
           cds
          Length = 2145

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 44  ggaggaggaggaggatgacg 63
           ||||||||||||||||||||
Sbjct: 698 ggaggaggaggaggatgacg 717



to top

>gb|AC058788.89| Mus musculus strain C57BL/6J clone rp23-284a9 map 5, complete sequence
          Length = 200015

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 42    ggggaggaggaggaggatga 61
             ||||||||||||||||||||
Sbjct: 57886 ggggaggaggaggaggatga 57905



to top

>emb|CR762396.8| Zebrafish DNA sequence from clone DKEY-262O12 in linkage group 1,
              complete sequence
          Length = 163635

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 371    aaataaaaataataattgaa 390
              ||||||||||||||||||||
Sbjct: 118284 aaataaaaataataattgaa 118265



to top

>gb|AC115917.10| Mus musculus chromosome 1, clone RP24-488H6, complete sequence
          Length = 186588

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 42    ggggaggaggaggaggatga 61
             ||||||||||||||||||||
Sbjct: 60644 ggggaggaggaggaggatga 60663



to top

>emb|AL591503.9| Human DNA sequence from clone RP11-571E6 on chromosome Xp11.22-11.3
              Contains a nicolin 1 (NICN1) pseudogene, a novel gene, the
              5'end of the ZNF157 gene for zinc finger protein 157
              (HZF22) and a UBX domain containing 2 (UBXD2) pseudogene,
              complete sequence
          Length = 152659

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 369    ataaataaaaataataattg 388
              ||||||||||||||||||||
Sbjct: 121341 ataaataaaaataataattg 121322



to top

>emb|AL512642.18| Human DNA sequence from clone RP11-469L23 on chromosome 13 Contains the
             ALOX5AP gene for arachidonate 5-lipoxygenase-activating
             protein (FLAP) and a novel gene, complete sequence
          Length = 139255

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 42    ggggaggaggaggaggatga 61
             ||||||||||||||||||||
Sbjct: 84884 ggggaggaggaggaggatga 84865



to top

>emb|AL354693.6| Human DNA sequence from clone RP11-14E8 on chromosome 1 Contains the
             part of the EDARADD gene for EDAR-associated death domain
             and two CpG islands, complete sequence
          Length = 78986

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 32    agatcgggtcggggaggagg 51
             ||||||||||||||||||||
Sbjct: 24100 agatcgggtcggggaggagg 24119



to top

>emb|AL158154.28| Human DNA sequence from clone RP11-383M4 on chromosome 9 Contains two
             novel genes and three putative novel pseudogenes, complete
             sequence
          Length = 189319

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 270   gccagccaggaaatatgcca 289
             ||||||||||||||||||||
Sbjct: 16003 gccagccaggaaatatgcca 15984



to top

>emb|AL160392.12| Human DNA sequence from clone RP11-121N13 on chromosome 13 Contains the
             5' end of the DCAMKL1 gene for doublecortin and CaM
             kinase-like 1 (DCLK KIAA0369), a novel gene and two CpG
             islands, complete sequence
          Length = 106585

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 44    ggaggaggaggaggatgacgggagggcg 71
             ||||||||||||||  ||||||||||||
Sbjct: 13612 ggaggaggaggagggagacgggagggcg 13585



to top

>gb|AY245422.1| Pteronotus parnellii alpha adrenergic receptor 2B (adra2b) gene,
           partial cds
          Length = 1177

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 44  ggaggaggaggaggatgacg 63
           ||||||||||||||||||||
Sbjct: 858 ggaggaggaggaggatgacg 877



to top

>emb|BX855620.10| Zebrafish DNA sequence from clone DKEY-9M4 in linkage group 15,
             complete sequence
          Length = 33169

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 368   gataaataaaaataataatt 387
             ||||||||||||||||||||
Sbjct: 19967 gataaataaaaataataatt 19986



to top

>emb|BX062907.1|CNS09KPB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44BF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 939

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 80  tcttgctgccgctgctgctg 99
           ||||||||||||||||||||
Sbjct: 344 tcttgctgccgctgctgctg 363



to top

>emb|BX062906.1|CNS09KPA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44BF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 842

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 80  tcttgctgccgctgctgctg 99
           ||||||||||||||||||||
Sbjct: 784 tcttgctgccgctgctgctg 765



to top

>emb|BX043455.1|CNS095OZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC16AC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 991

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 80  tcttgctgccgctgctgctg 99
           ||||||||||||||||||||
Sbjct: 320 tcttgctgccgctgctgctg 339



to top

>emb|BX043454.1|CNS095OY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC16AC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 972

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 80  tcttgctgccgctgctgctg 99
           ||||||||||||||||||||
Sbjct: 785 tcttgctgccgctgctgctg 766



to top

>gb|AC112161.9| Mus Musculus chromosome 9 BAC clone MGS1-117K9 ES cell line, Complete
             Sequence, complete sequence
          Length = 115135

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 44    ggaggaggaggaggatgacg 63
             ||||||||||||||||||||
Sbjct: 18588 ggaggaggaggaggatgacg 18607



to top

>emb|BX008116.1|CNS08EFC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA13BG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 80  tcttgctgccgctgctgctg 99
           ||||||||||||||||||||
Sbjct: 335 tcttgctgccgctgctgctg 354



to top

>emb|BX008115.1|CNS08EFB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13BG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 981

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 80  tcttgctgccgctgctgctg 99
           ||||||||||||||||||||
Sbjct: 653 tcttgctgccgctgctgctg 634



to top

>emb|BX007425.1|CNS08DW5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA12BF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 978

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 80  tcttgctgccgctgctgctg 99
           ||||||||||||||||||||
Sbjct: 337 tcttgctgccgctgctgctg 356



to top

>emb|X69816.1|RNP450AA R.norvegicus CYP17 gene
          Length = 7556

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 42   ggggaggaggaggaggatga 61
            ||||||||||||||||||||
Sbjct: 3120 ggggaggaggaggaggatga 3101



to top

>emb|CR382398.1| Plasmodium falciparum chromosome 6, complete sequence; segment 1/5
          Length = 349418

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 371    aaataaaaataataattgaa 390
              ||||||||||||||||||||
Sbjct: 132210 aaataaaaataataattgaa 132191



to top

>emb|AL834392.1|HSM805471 Homo sapiens mRNA; cDNA DKFZp761F2423 (from clone DKFZp761F2423)
          Length = 3321

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 44   ggaggaggaggaggatgacg 63
            ||||||||||||||||||||
Sbjct: 1462 ggaggaggaggaggatgacg 1481



to top

>emb|AL033497.1|CAC49C10 C.albicans cosmid Ca49C10
          Length = 37825

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 84   gctgccgctgctgctggtgg 103
            ||||||||||||||||||||
Sbjct: 3547 gctgccgctgctgctggtgg 3528



to top

>gb|AC102586.14| Mus musculus chromosome 3, clone RP23-327I19, complete sequence
          Length = 194959

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 83   tgctgccgctgctgctggtg 102
            ||||||||||||||||||||
Sbjct: 9015 tgctgccgctgctgctggtg 8996



to top

>emb|AJ419811.1|DRO419811 Desmodus rotundus partial adra2b gene for alpha 2B adrenergic
           receptor
          Length = 1183

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 44  ggaggaggaggaggatgacg 63
           ||||||||||||||||||||
Sbjct: 867 ggaggaggaggaggatgacg 886



to top

>emb|AJ419810.1|EAT419810 Emballonura atrata partial adra2b gene for alpha 2B adrenergic
           receptor
          Length = 1173

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 44  ggaggaggaggaggatgacg 63
           ||||||||||||||||||||
Sbjct: 855 ggaggaggaggaggatgacg 874



to top

>emb|CR936832.1| Homo sapiens mRNA; cDNA DKFZp686O1425 (from clone DKFZp686O1425)
          Length = 2143

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 42   ggggaggaggaggaggatga 61
            ||||||||||||||||||||
Sbjct: 1112 ggggaggaggaggaggatga 1131



to top

>emb|CR759811.8| Zebrafish DNA sequence from clone CH211-190M18 in linkage group 13,
             complete sequence
          Length = 132853

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 44    ggaggaggaggaggatgacgggagggcg 71
             |||||||||||||||||| | |||||||
Sbjct: 31660 ggaggaggaggaggatgaagagagggcg 31633



to top

>emb|AJ720077.1| Gallus gallus mRNA for hypothetical protein, clone 10e8
          Length = 3066

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 44  ggaggaggaggaggatgacg 63
           ||||||||||||||||||||
Sbjct: 87  ggaggaggaggaggatgacg 106



to top

>emb|BX950184.7| Zebrafish DNA sequence from clone CH211-103O12 in linkage group 12,
             complete sequence
          Length = 150475

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 373   ataaaaataataattgaaca 392
             ||||||||||||||||||||
Sbjct: 97223 ataaaaataataattgaaca 97242



to top

>emb|AL845501.9| Mouse DNA sequence from clone RP23-194C12 on chromosome 4 Contains a
            ribosomal protein S18 (Rps18) pseudogene, complete
            sequence
          Length = 156572

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 42   ggggaggaggaggaggatga 61
            ||||||||||||||||||||
Sbjct: 1889 ggggaggaggaggaggatga 1908



to top

>emb|BX072580.4| Mouse DNA sequence from clone RP23-221P8 on chromosome 4, complete
             sequence
          Length = 15001

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 42    ggggaggaggaggaggatga 61
             ||||||||||||||||||||
Sbjct: 14890 ggggaggaggaggaggatga 14909



to top

>gb|AC113029.23| Mus musculus chromosome 5, clone RP23-206J17, complete sequence
          Length = 223809

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 44    ggaggaggaggaggatgacg 63
             ||||||||||||||||||||
Sbjct: 92724 ggaggaggaggaggatgacg 92705



to top

>emb|BX629343.11| Zebrafish DNA sequence from clone DKEY-66M17 in linkage group 13,
             complete sequence
          Length = 207677

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 44    ggaggaggaggaggatgacgggagggcg 71
             |||||||||||||||||| | |||||||
Sbjct: 84669 ggaggaggaggaggatgaagagagggcg 84642



to top

>gb|AC118670.2| Genomic sequence for Oryza sativa, Nipponbare stain, clone
             OSJNBb0036D03, from chromosome 3, complete sequence
          Length = 125800

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 45    gaggaggaggaggatgacgggagg 68
             |||||||||||||| |||||||||
Sbjct: 30516 gaggaggaggaggaggacgggagg 30539



to top

>ref|NM_001006523.1| Gallus gallus excision repair cross-complementing rodent repair
           deficiency, complementation group 3 (xeroderma
           pigmentosum group B complementing) (ERCC3), mRNA
          Length = 3066

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 44  ggaggaggaggaggatgacg 63
           ||||||||||||||||||||
Sbjct: 87  ggaggaggaggaggatgacg 106



to top

>gb|AC120105.3| Homo sapiens 12 BAC RP11-743I10 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 90000

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 42    ggggaggaggaggaggatga 61
             ||||||||||||||||||||
Sbjct: 60368 ggggaggaggaggaggatga 60349



to top

>gb|AC024563.6| Homo sapiens chromosome 19 clone CTC-451A6, complete sequence
          Length = 158541

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 42   ggggaggaggaggaggatga 61
            ||||||||||||||||||||
Sbjct: 5975 ggggaggaggaggaggatga 5994



to top

>gb|AC011467.7| Homo sapiens chromosome 19 clone CTC-457E21, complete sequence
          Length = 187888

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 42    ggggaggaggaggaggatga 61
             ||||||||||||||||||||
Sbjct: 84530 ggggaggaggaggaggatga 84511



to top

>dbj|AB207992.1| Oryzias latipes gene for hoxB3a, complete cds
          Length = 4430

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 44  ggaggaggaggaggatgacg 63
           ||||||||||||||||||||
Sbjct: 474 ggaggaggaggaggatgacg 455



to top

>emb|BX569788.6| Zebrafish DNA sequence from clone CH211-161N19 in linkage group 10,
             complete sequence
          Length = 162115

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 370   taaataaaaataataattga 389
             ||||||||||||||||||||
Sbjct: 25566 taaataaaaataataattga 25547



to top

>emb|AL669896.7| Mouse DNA sequence from clone RP23-477F4 on chromosome 2, complete
             sequence
          Length = 163577

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 42    ggggaggaggaggaggatga 61
             ||||||||||||||||||||
Sbjct: 76507 ggggaggaggaggaggatga 76488



to top

>gb|AC023697.5| Drosophila melanogaster X BAC RP98-13N3 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 171751

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 44     ggaggaggaggaggatgacg 63
              ||||||||||||||||||||
Sbjct: 155595 ggaggaggaggaggatgacg 155614



to top

>dbj|AK127417.1| Homo sapiens cDNA FLJ45509 fis, clone BRTHA2020811
          Length = 2048

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 41  cggggaggaggaggaggatg 60
           ||||||||||||||||||||
Sbjct: 625 cggggaggaggaggaggatg 644



to top

>ref|NM_167357.1| Drosophila melanogaster CG15745-RB, transcript variant B (CG15745),
            mRNA
          Length = 2097

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 44   ggaggaggaggaggatgacg 63
            ||||||||||||||||||||
Sbjct: 1464 ggaggaggaggaggatgacg 1483



to top

>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome
          Length = 4967148

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 83     tgctgccgctgctgctggtggcct 106
              |||||||||||||||||| |||||
Sbjct: 890832 tgctgccgctgctgctgggggcct 890809



 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 85     ctgccgctgctgctggtggc 104
              ||||||||||||||||||||
Sbjct: 168146 ctgccgctgctgctggtggc 168127



to top

>dbj|AB232920.1| Oryzias latipes hox gene cluster, complete cds, contains hoxBa, evx
             homologue on hoxBa
          Length = 235883

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 44    ggaggaggaggaggatgacg 63
             ||||||||||||||||||||
Sbjct: 27230 ggaggaggaggaggatgacg 27249



to top

>dbj|AB218617.1| Rattus norvegicus genomic DNA, chromosome 4, clone: CH230-65K18,
             complete sequence
          Length = 193613

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 44    ggaggaggaggaggatgacg 63
             ||||||||||||||||||||
Sbjct: 96897 ggaggaggaggaggatgacg 96878



to top

>gb|AC104137.5| Homo sapiens BAC clone RP11-807H7 from 4, complete sequence
          Length = 195930

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 368    gataaataaaaataataatt 387
              ||||||||||||||||||||
Sbjct: 126460 gataaataaaaataataatt 126479



to top

>gb|AF455111.1| Mus musculus ataxin-7 (Sca7) mRNA, complete cds
          Length = 3039

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 44   ggaggaggaggaggatgacg 63
            ||||||||||||||||||||
Sbjct: 2129 ggaggaggaggaggatgacg 2110



to top

>ref|NM_132645.2| Drosophila melanogaster CG15745-RA, transcript variant A (CG15745),
            mRNA
          Length = 1876

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 44   ggaggaggaggaggatgacg 63
            ||||||||||||||||||||
Sbjct: 1243 ggaggaggaggaggatgacg 1262



to top

>gb|AC090488.3| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBb0081F12
              from chromosome 10, complete sequence
          Length = 128388

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 42     ggggaggaggaggaggatga 61
              ||||||||||||||||||||
Sbjct: 104002 ggggaggaggaggaggatga 104021



to top

>gb|AF465311.1| Dictyostelium discoideum ABC transporter ABCA.9 (abca9) gene, partial
            cds
          Length = 4234

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 371  aaataaaaataataattgaa 390
            ||||||||||||||||||||
Sbjct: 4024 aaataaaaataataattgaa 4043



to top

>dbj|AK154013.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
           full-length enriched library, clone:E430022K17
           product:DEK oncogene (DNA binding), full insert sequence
          Length = 746

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 44  ggaggaggaggaggatgacg 63
           ||||||||||||||||||||
Sbjct: 242 ggaggaggaggaggatgacg 261



to top

>ref|XM_938526.1| PREDICTED: Homo sapiens similar to Golgi autoantigen, golgin
            subfamily a, 2 (LOC440518), mRNA
          Length = 1997

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 42   ggggaggaggaggaggatga 61
            ||||||||||||||||||||
Sbjct: 1104 ggggaggaggaggaggatga 1123



to top

>ref|XM_496302.2| PREDICTED: Homo sapiens similar to Golgi autoantigen, golgin
            subfamily a, 2 (LOC440518), mRNA
          Length = 1997

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 42   ggggaggaggaggaggatga 61
            ||||||||||||||||||||
Sbjct: 1104 ggggaggaggaggaggatga 1123



to top

>ref|XM_943887.1| PREDICTED: Homo sapiens hypothetical protein LOC649744 (LOC649744),
           mRNA
          Length = 2034

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 41  cggggaggaggaggaggatg 60
           ||||||||||||||||||||
Sbjct: 619 cggggaggaggaggaggatg 638



to top

>ref|XM_932529.1| PREDICTED: Homo sapiens hypothetical protein LOC644949 (LOC644949),
           mRNA
          Length = 2034

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 41  cggggaggaggaggaggatg 60
           ||||||||||||||||||||
Sbjct: 619 cggggaggaggaggaggatg 638



to top

>ref|XM_702487.1| PREDICTED: Danio rerio similar to Proliferating-cell nucleolar
           antigen p120 (Proliferation-associated nucleolar protein
           p120), transcript variant 5 (LOC561261), mRNA
          Length = 2725

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 44  ggaggaggaggaggatgacg 63
           ||||||||||||||||||||
Sbjct: 709 ggaggaggaggaggatgacg 728



to top

>ref|XM_702486.1| PREDICTED: Danio rerio similar to Proliferating-cell nucleolar
           antigen p120 (Proliferation-associated nucleolar protein
           p120), transcript variant 4 (LOC561261), mRNA
          Length = 2701

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 44  ggaggaggaggaggatgacg 63
           ||||||||||||||||||||
Sbjct: 709 ggaggaggaggaggatgacg 728



to top

>ref|XM_702485.1| PREDICTED: Danio rerio similar to Proliferating-cell nucleolar
           antigen p120 (Proliferation-associated nucleolar protein
           p120), transcript variant 3 (LOC561261), mRNA
          Length = 2728

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 44  ggaggaggaggaggatgacg 63
           ||||||||||||||||||||
Sbjct: 709 ggaggaggaggaggatgacg 728



to top

>ref|XM_702484.1| PREDICTED: Danio rerio similar to Proliferating-cell nucleolar
           antigen p120 (Proliferation-associated nucleolar protein
           p120), transcript variant 2 (LOC561261), mRNA
          Length = 2746

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 44  ggaggaggaggaggatgacg 63
           ||||||||||||||||||||
Sbjct: 709 ggaggaggaggaggatgacg 728



to top

>ref|XM_679556.1| PREDICTED: Danio rerio similar to Proliferating-cell nucleolar
           antigen p120 (Proliferation-associated nucleolar protein
           p120), transcript variant 1 (LOC561261), mRNA
          Length = 2740

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 44  ggaggaggaggaggatgacg 63
           ||||||||||||||||||||
Sbjct: 709 ggaggaggaggaggatgacg 728



to top

>gb|AY061136.1| Drosophila melanogaster LD11831 full length cDNA
          Length = 1839

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 44   ggaggaggaggaggatgacg 63
            ||||||||||||||||||||
Sbjct: 1206 ggaggaggaggaggatgacg 1225



to top

>gb|AC021753.7| Homo sapiens chromosome 15 clone RP11-129I12 map 15q15, complete sequence
          Length = 167996

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 41     cggggaggaggaggaggatg 60
              ||||||||||||||||||||
Sbjct: 123366 cggggaggaggaggaggatg 123385



to top

>emb|BX119984.15| Zebrafish DNA sequence from clone DKEY-257N17 in linkage group 1,
             complete sequence
          Length = 163978

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 373   ataaaaataataattgaaca 392
             ||||||||||||||||||||
Sbjct: 15750 ataaaaataataattgaaca 15731



to top

>gb|AE016817.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome IV,
              complete sequence
          Length = 1466886

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 44     ggaggaggaggaggatgacg 63
              ||||||||||||||||||||
Sbjct: 264317 ggaggaggaggaggatgacg 264298



to top

>gb|AC159643.2| Mus musculus BAC clone RP23-384H10 from chromosome 12, complete sequence
          Length = 200939

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 44     ggaggaggaggaggatgacg 63
              ||||||||||||||||||||
Sbjct: 199566 ggaggaggaggaggatgacg 199547



to top

>gb|AC159000.2| Mus musculus BAC clone RP24-207K16 from chromosome 9, complete sequence
          Length = 152872

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 42     ggggaggaggaggaggatgacgggaggg 69
              ||||||||||||||||| || |||||||
Sbjct: 138099 ggggaggaggaggaggaggaggggaggg 138126



to top

>gb|AC154693.2| Mus musculus BAC clone RP24-340P22 from chromosome 14, complete
             sequence
          Length = 182996

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 360   tgtacttggataaataaaaataataatt 387
             |||||||||| || ||||||||||||||
Sbjct: 98088 tgtacttggaaaattaaaaataataatt 98061



to top

>dbj|AK046679.1| Mus musculus 4 days neonate male adipose cDNA, RIKEN full-length
            enriched library, clone:B430307M20 product:similar to
            ATAXIN 7 (SPINOCEREBELLAR ATAXIA TYPE 7 PROTEIN) [Homo
            sapiens], full insert sequence
          Length = 3612

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 44   ggaggaggaggaggatgacg 63
            ||||||||||||||||||||
Sbjct: 2390 ggaggaggaggaggatgacg 2371



to top

>gb|AC156602.2| Laccaria bicolor clone JGIAHZW-6X, complete sequence
          Length = 42288

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 44    ggaggaggaggaggatgacg 63
             ||||||||||||||||||||
Sbjct: 13402 ggaggaggaggaggatgacg 13383



to top

>dbj|AK012877.1| Mus musculus 10, 11 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2810037P09 product:similar to 5'
           of DEK PROTEIN [Homo sapiens], full insert sequence
          Length = 875

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 44  ggaggaggaggaggatgacg 63
           ||||||||||||||||||||
Sbjct: 195 ggaggaggaggaggatgacg 214



to top

>dbj|AK012615.1| Mus musculus 11 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2700095O07 product:similar to 5'
           of DEK PROTEIN [Homo sapiens], full insert sequence
          Length = 894

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 44  ggaggaggaggaggatgacg 63
           ||||||||||||||||||||
Sbjct: 201 ggaggaggaggaggatgacg 220



to top

>dbj|AK012315.1| Mus musculus 11 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2700033E24 product:hypothetical
           Treacher Collins syndrome protein Treacle containing
           protein, full insert sequence
          Length = 258

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 44  ggaggaggaggaggatgacg 63
           ||||||||||||||||||||
Sbjct: 215 ggaggaggaggaggatgacg 234


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,505,847
Number of Sequences: 3902068
Number of extensions: 5505847
Number of successful extensions: 576235
Number of sequences better than 10.0: 324
Number of HSP's better than 10.0 without gapping: 339
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 567808
Number of HSP's gapped (non-prelim): 8343
length of query: 413
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 391
effective length of database: 17,147,199,772
effective search space: 6704555110852
effective search space used: 6704555110852
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top