Clone Name	bags20f07
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|M27303.1|BLYCAMA Barley cam gene encoding calmodulin, complet...	216	1e-53
2	gb|U49104.1|TAU49104 Triticum aestivum calmodulin TaCaM3-3 mRNA,...	208	3e-51
3	gb|U48693.1|TAU48693 Triticum aestivum calmodulin TaCaM3-1 mRNA,...	200	8e-49
4	gb|U49103.1|TAU49103 Triticum aestivum calmodulin TaCaM3-2 mRNA,...	192	2e-46
5	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	137	1e-29
6	gb|AC119748.1| Genomic sequence for Oryza sativa, Nipponbare str...	137	1e-29
7	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	137	1e-29
8	dbj|AK070090.1| Oryza sativa (japonica cultivar-group) cDNA clon...	137	1e-29
9	dbj|AK059756.1| Oryza sativa (japonica cultivar-group) cDNA clon...	137	1e-29
10	gb|AF042840.1|AF042840 Oryza sativa clone F14605 calmodulin (CaM...	137	1e-29
11	gb|U49105.1|TAU49105 Triticum aestivum calmodulin TaCaM4-1 mRNA,...	129	2e-27
12	gb|AY104071.1| Zea mays PCO074293 mRNA sequence	127	1e-26
13	gb|BT017532.1| Zea mays clone EL01N0421H06.c mRNA sequence	119	2e-24
14	gb|BT017909.1| Zea mays clone EL01N0517D03.c mRNA sequence	113	1e-22
15	emb|X77396.1|ZMCAM1 Z.mays CaM1 mRNA for calmodulin	113	1e-22
16	ref|XM_479602.1| Oryza sativa (japonica cultivar-group), mRNA	107	9e-21
17	emb|Z12827.1|OSCALMOD1 O.sativa gene encoding calmodulin	107	9e-21
18	emb|AJ271913.1|OSA271913 Oryza sativa partial mRNA for putative ...	107	9e-21
19	gb|AF441191.1|AF441191 Oryza sativa clone 15079 calmodulin (CaM)...	107	9e-21
20	dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D...	107	9e-21
21	dbj|AP003813.4| Oryza sativa (japonica cultivar-group) genomic D...	107	9e-21
22	dbj|AP003818.2| Oryza sativa (japonica cultivar-group) genomic D...	107	9e-21
23	dbj|AK104031.1| Oryza sativa (japonica cultivar-group) cDNA clon...	107	9e-21
24	dbj|AK071852.1| Oryza sativa (japonica cultivar-group) cDNA clon...	107	9e-21
25	gb|L18913.1|RICCALMODU Oryza sativa calmodulin gene, complete cds	107	9e-21
26	gb|AF007889.1|AF007889 Symbiodinium microadriaticum calmodulin (...	105	4e-20
27	gb|AF085344.1|AF085344 Pythium splendens calmodulin mRNA, comple...	103	1e-19
28	gb|AY103899.1| Zea mays PCO074294 mRNA sequence	103	1e-19
29	ref|NM_105312.2| Arabidopsis thaliana CAM4 (CALMODULIN 4); calci...	101	6e-19
30	emb|Z12022.1|ATCMACAM4 A.thaliana mRNA (clone ACaM4) for calmodulin	101	6e-19
31	gb|AY113902.1| Arabidopsis thaliana putative calmodulin-4 protei...	101	6e-19
32	emb|X65016.1|OSCALM O.sativa mRNA for calmodulin	101	6e-19
33	gb|AF370293.1| Arabidopsis thaliana putative calmodulin-4 protei...	101	6e-19
34	emb|BX813969.1|CNS0ADRS Arabidopsis thaliana Full-length cDNA Co...	101	6e-19
35	gb|AC020665.6|AC020665 Arabidopsis thaliana chromosome 1 BAC T27...	101	6e-19
36	gb|AC074025.1|AC074025 Arabidopsis thaliana chromosome 1 BAC F28...	101	6e-19
37	gb|AY088476.1| Arabidopsis thaliana clone 6982 mRNA, complete se...	101	6e-19
38	gb|U48689.1|TAU48689 Triticum aestivum calmodulin TaCaM1-3 mRNA,...	101	6e-19
39	gb|AF020781.1|AF020781 Symbiodinium microadriaticum calmodulin (...	100	2e-18
40	gb|M20729.1|CRECAM C.reinhardtii calmodulin gene, complete cds	100	2e-18
41	gb|M83535.1|PHTCALPIA P.infestans calmodulin (calA) gene, comple...	100	2e-18
42	gb|U10150.1|BNU10150 Brassica napus Naehan calmodulin (bcm1) mRN...	100	2e-18
43	gb|BC054805.1| Mus musculus calmodulin 1, mRNA (cDNA clone MGC:6...	98	9e-18
44	emb|CR715454.1|CNS0GEZU Tetraodon nigroviridis full-length cDNA	98	9e-18
45	emb|X85091.1|MPCAM M.pyrifera mRNA for calmodulin	98	9e-18
46	emb|X61432.1|MMCALMOD M.musculus mRNA for calmodulin	98	9e-18
47	dbj|AK151001.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	98	9e-18
48	dbj|AK150978.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	98	9e-18
49	dbj|AK151992.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	98	9e-18
50	dbj|AK151923.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	98	9e-18
51	dbj|AK153004.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	98	9e-18
52	dbj|AK151784.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	98	9e-18
53	dbj|AK145841.1| Mus musculus 12 days pregnant adult female place...	98	9e-18
54	dbj|AK152897.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	98	9e-18
55	dbj|AK152850.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	98	9e-18
56	dbj|AK152719.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	98	9e-18
57	dbj|AK152715.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	98	9e-18
58	dbj|AK151552.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	98	9e-18
59	dbj|AK161302.1| Mus musculus adult male testis cDNA, RIKEN full-...	98	9e-18
60	dbj|AK153546.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	98	9e-18
61	dbj|AK162314.1| Mus musculus adult male colon cDNA, RIKEN full-l...	98	9e-18
62	dbj|AK153426.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	98	9e-18
63	dbj|AK153348.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	98	9e-18
64	dbj|AK165568.1| Mus musculus nullipotent stem cell CRL-2070 NE c...	98	9e-18
65	dbj|AK152148.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	98	9e-18
66	dbj|AK150288.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	98	9e-18
67	dbj|AK160057.1| Mus musculus osteoclast-like cell cDNA, RIKEN fu...	98	9e-18
68	dbj|AK168803.1| Mus musculus 16 days embryo kidney cDNA, RIKEN f...	98	9e-18
69	dbj|AK168663.1| Mus musculus 17 days pregnant adult female amnio...	98	9e-18
70	dbj|AK159762.1| Mus musculus osteoclast-like cell cDNA, RIKEN fu...	98	9e-18
71	dbj|AK167353.1| Mus musculus 13 days pregnant adult female place...	98	9e-18
72	dbj|AK166308.1| Mus musculus mammary gland RCB-0526 Jyg-MC(A) cD...	98	9e-18
73	dbj|AK160508.1| Mus musculus adult male tongue cDNA, RIKEN full-...	98	9e-18
74	dbj|AK168002.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-...	98	9e-18
75	dbj|AK169055.1| Mus musculus 17 days embryo stomach cDNA, RIKEN ...	98	9e-18
76	dbj|AK169027.1| Mus musculus 17 days pregnant adult female amnio...	98	9e-18
77	dbj|AK013695.1| Mus musculus adult male hippocampus cDNA, RIKEN ...	98	9e-18
78	dbj|AK088141.1| Mus musculus 2 days neonate thymus thymic cells ...	98	9e-18
79	ref|NM_009790.3| Mus musculus calmodulin 1 (Calm1), mRNA	98	9e-18
80	dbj|AK004673.1| Mus musculus adult male lung cDNA, RIKEN full-le...	98	9e-18
81	dbj|AK062496.1| Oryza sativa (japonica cultivar-group) cDNA clon...	98	9e-18
82	gb|AY656699.1| Carassius auratus calmodulin short form mRNA, com...	96	3e-17
83	gb|DQ226765.1| Boechera divaricarpa isolate SLW-D-B04 mRNA sequence	96	3e-17
84	gb|AY517931.1| Arachis hypogaea calmodulin (CaM2) mRNA, complete...	96	3e-17
85	gb|AF466266.1| Sonneratia paracaseolaris calmodulin gene, comple...	96	3e-17
86	emb|X60738.1|MDCAMR M.domestica CaM mRNA for calmodulin	96	3e-17
87	emb|X60737.1|MDCAMG M.domestica CaM gene for calmodulin	96	3e-17
88	gb|AY281363.1| Epinephelus akaara calmodulin (CAL1) mRNA, comple...	96	3e-17
89	dbj|AK168241.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-...	96	3e-17
90	gb|AC136471.1| Solanum demissum chromosome 11 BAC PGEC561 genomi...	94	1e-16
91	ref|NM_182967.1| Danio rerio calmodulin 3a (phosphorylase kinase...	94	1e-16
92	gb|BT013612.1| Lycopersicon esculentum clone 132384F, mRNA sequence	94	1e-16
93	emb|AJ005040.1|NPAJ5040 Nicotiana plumbaginifolia mRNA for calmo...	94	1e-16
94	gb|AF085250.1|AF085250 Perca flavescens calmodulin (CAL1) mRNA, ...	94	1e-16
95	gb|BC045298.1| Danio rerio calmodulin 2, gamma, mRNA (cDNA clone...	94	1e-16
96	gb|U48688.1|TAU48688 Triticum aestivum calmodulin TaCaM1-2 mRNA,...	94	1e-16
97	gb|U48242.1|TAU48242 Triticum aestivum calmodulin TaCaM1-1 mRNA,...	94	1e-16
98	gb|BC071404.1| Danio rerio calmodulin 2, gamma, mRNA (cDNA clone...	94	1e-16
99	gb|L01430.1|SOYSCAM1X Soybean calmodulin (SCaM-1) mRNA, complete...	94	1e-16
100	gb|BC053150.1| Danio rerio zgc:63926, mRNA (cDNA clone MGC:63926...	92	5e-16
101	gb|BC097062.1| Danio rerio zgc:63926, mRNA (cDNA clone MGC:11398...	92	5e-16
102	ref|NM_213351.1| Danio rerio zgc:63926 (zgc:63926), mRNA	92	5e-16
103	gb|AY741753.1| Penicillium fellutanum strain NRRL 746 calmodulin...	92	5e-16
104	gb|AY741751.1| Penicillium fellutanum strain NRRL 3760 calmoduli...	92	5e-16
105	gb|AY741731.1| Penicillium fellutanum strain NRRL 29654 calmodul...	92	5e-16
106	gb|AY741730.1| Penicillium fellutanum strain NRRL 25658 calmodul...	92	5e-16
107	ref|NM_012518.2| Rattus norvegicus calmodulin 3 (Calm3), mRNA	90	2e-15
108	gb|DQ186610.1| Catharanthus roseus calmodulin 2 mRNA, complete cds	90	2e-15
109	emb|AJ291615.1|LRU291615 Lumbricus rubellus mRNA for calmodulin ...	90	2e-15
110	gb|BC063187.1| Rattus norvegicus calmodulin 3, mRNA (cDNA clone ...	90	2e-15
111	dbj|AK152754.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	90	2e-15
112	dbj|AK151610.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	90	2e-15
113	dbj|AK153179.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	90	2e-15
114	dbj|AK169640.1| Mus musculus 2 days neonate thymus thymic cells ...	90	2e-15
115	gb|AY752882.1| Aegiceras corniculatum calmodulin mRNA, complete cds	90	2e-15
116	ref|NM_007590.2| Mus musculus calmodulin 3 (Calm3), mRNA	90	2e-15
117	gb|BC050926.1| Mus musculus calmodulin 3, mRNA (cDNA clone MGC:6...	90	2e-15
118	emb|X13817.1|RSPRCM4 R.norvegicus mRNA for calmodulin	90	2e-15
119	gb|M88307.1|BNACALM Brassica juncea calmodulin mRNA, complete cds	90	2e-15
120	gb|M19381.1|MUSCALMDB Mouse calmodulin (Cam I) mRNA, complete cds	90	2e-15
121	gb|M19380.1|MUSCALMDA Mouse calmodulin (Cam III) mRNA, complete cds	90	2e-15
122	gb|M16659.1|RATCAMB Rat calmodulin mRNA, complete cds, clone prCM79	90	2e-15
123	gb|L01432.1|SOYSCAM3X Soybean calmodulin (SCaM-3) mRNA, complete...	90	2e-15
124	dbj|D10364.1|ORZCAMB O. latipes (killifish) mRNA for calmodulin,...	90	2e-15
125	emb|BX927291.8| Zebrafish DNA sequence from clone CH211-261A10 i...	88	8e-15
126	gb|AY106452.1| Zea mays PCO074292 mRNA sequence	88	8e-15
127	gb|AY741728.1| Penicillium chermesinum strain NRRL 2048 calmodul...	88	8e-15
128	dbj|AB063183.1| Metridium senile CaM gene for calmodulin, comple...	88	8e-15
129	dbj|AB063181.1| Metridium senile CaM mRNA for calmodulin, comple...	88	8e-15
130	dbj|AB050843.1| Nicotiana tabacum mRNA for calmodulin NtCaM7, co...	88	8e-15
131	ref|XM_475464.1| Oryza sativa (japonica cultivar-group), predic...	86	3e-14
132	gb|AC129718.2| Oryza sativa (japonica cultivar-group) chromosome...	86	3e-14
133	emb|AJ971805.1| Aspergillus ibericus partial cdl gene for calmod...	86	3e-14
134	emb|AJ582715.2|ACA582715 Aspergillus carbonarius partial cdl gen...	86	3e-14
135	emb|AJ582714.2|ACA582714 Aspergillus carbonarius partial cdl gen...	86	3e-14
136	gb|DQ398935.1| Vigna unguiculata calmodulin mRNA, complete cds	86	3e-14
137	dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D...	86	3e-14
138	dbj|AK121606.1| Oryza sativa (japonica cultivar-group) cDNA clon...	86	3e-14
139	dbj|AK119167.1| Oryza sativa (japonica cultivar-group) cDNA clon...	86	3e-14
140	dbj|AK059534.1| Oryza sativa (japonica cultivar-group) cDNA clon...	86	3e-14
141	gb|AF042839.1|AF042839 Oryza sativa calmodulin (CaM2) mRNA, comp...	86	3e-14
142	emb|AJ964873.2| Aspergillus carbonarius partial cdl gene for cal...	86	3e-14
143	dbj|AB050844.1| Nicotiana tabacum mRNA for calmodulin NtCaM8, co...	86	3e-14
144	dbj|AB050842.1| Nicotiana tabacum mRNA for calmodulin NtCaM6, co...	86	3e-14
145	dbj|AB050841.1| Nicotiana tabacum mRNA for calmodulin NtCaM5, co...	86	3e-14
146	gb|AY456265.1| Nicotiana attenuata calmodulin mRNA, complete cds	84	1e-13
147	ref|NM_188123.1| Oryza sativa (japonica cultivar-group), Ozsa855...	84	1e-13
148	emb|Z12828.1|OSCALMOD2 O.sativa gene encoding calmodulin	84	1e-13
149	emb|Z12839.1|LLCALMOD L.longiflorum mRNA encoding calmodulin	84	1e-13
150	gb|DQ122882.1| Chlamydomonas incerta calmodulin mRNA, complete cds	84	1e-13
151	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	84	1e-13
152	dbj|AP000815.1| Oryza sativa (japonica cultivar-group) genomic D...	84	1e-13
153	dbj|AK058646.1| Oryza sativa (japonica cultivar-group) cDNA clon...	84	1e-13
154	gb|U91643.1|POU91643 Pleurotus ostreatus calmodulin (CaM) gene, ...	84	1e-13
155	gb|AY741754.1| Penicillium charlesii strain NRRL 778 calmodulin ...	84	1e-13
156	gb|AY741752.1| Penicillium charlesii strain NRRL 6208 calmodulin...	84	1e-13
157	gb|AY741745.1| Penicillium charlesii strain NRRL 3464 calmodulin...	84	1e-13
158	gb|AY741742.1| Penicillium thiersii strain NRRL 32383 calmodulin...	84	1e-13
159	gb|AY741741.1| Penicillium thiersii strain NRRL 31609 calmodulin...	84	1e-13
160	gb|AY741727.1| Penicillium charlesii strain NRRL 1887 calmodulin...	84	1e-13
161	gb|AY741726.1| Penicillium thiersii strain NRRL 28162 calmodulin...	84	1e-13
162	gb|L18914.1|RICCALMODL Oryza sativa calmodulin gene, complete cds	84	1e-13
163	gb|L18912.1|LILCALMODU Lilium longiflorum calmodulin mRNA, compl...	84	1e-13
164	dbj|AB063184.1| Halichondria okadai CaM gene for calmodulin, com...	84	1e-13
165	dbj|AB063182.1| Halichondria okadai CaM mRNA for calmodulin, com...	84	1e-13
166	gb|L14071.1|BYNCALMOD Bryonia dioica calmodulin (Bc329) mRNA, co...	84	1e-13
167	dbj|AB050846.1| Nicotiana tabacum mRNA for calmodulin NtCaM10, c...	84	1e-13
168	dbj|AB050845.1| Nicotiana tabacum mRNA for calmodulin NtCaM9, co...	84	1e-13
169	gb|AY656700.1| Carassius auratus calmodulin long form mRNA, comp...	82	5e-13
170	ref|XM_382067.1| Gibberella zeae PH-1 chromosome 1 CALM_NEUCR Ca...	82	5e-13
171	emb|AJ971806.1| Aspergillus ibericus partial cdl gene for calmod...	82	5e-13
172	emb|CR717313.2|CNS0GGFB Tetraodon nigroviridis full-length cDNA	82	5e-13
173	ref|XM_776612.1| PREDICTED: Strongylocentrotus purpuratus simila...	82	5e-13
174	emb|X90560.1|PPCAMPROT Physcomitrella patens mRNA for calmodulin	82	5e-13
175	gb|AF031482.1|AF031482 Zea mays calmodulin (Zmrcalm) mRNA, compl...	82	5e-13
176	dbj|AB081568.1| Strongylocentrotus intermedius CaM mRNA for calm...	82	5e-13
177	dbj|AB081567.1| Strongylocentrotus intermedius exCaM mRNA for ca...	82	5e-13
178	gb|AY725775.1| Cylindrocladiella peruviana strain CPC 5614 calmo...	80	2e-12
179	gb|AY830129.1| Hevea brasiliensis calmodulin (CaM) gene, complet...	80	2e-12
180	gb|AY830128.1| Hevea brasiliensis calmodulin (CaM) mRNA, complet...	80	2e-12
181	gb|BC068339.1| Danio rerio calmodulin 2, delta, mRNA (cDNA clone...	80	2e-12
182	gb|BC059427.1| Danio rerio calmodulin 2, delta, mRNA (cDNA clone...	80	2e-12
183	gb|DQ191657.1| Solanum tuberosum calmodulin 5/6/7/8-like protein...	80	2e-12
184	ref|NM_001032461.1| Ciona intestinalis calmodulin homologue (CaM...	80	2e-12
185	gb|AF494219.1| Medicago truncatula calmodulin 1 mRNA, complete cds	80	2e-12
186	gb|BC049483.1| Danio rerio mRNA similar to NMDA receptor-regulat...	80	2e-12
187	emb|Y13974.1|ZMCALMODU Zea mays mRNA for calmodulin	80	2e-12
188	emb|Y13578.1|CICAM Ciona intestinalis mRNA for calmodulin	80	2e-12
189	emb|X77397.1|ZMCAM2 Z.mays CaM2 mRNA for calmodulin	80	2e-12
190	emb|AJ318520.1|SCO318520 Solanum commersonii mRNA for putative c...	80	2e-12
191	ref|NM_199996.2| Danio rerio calmodulin 2, delta (calm2d), mRNA	80	2e-12
192	gb|AY831536.1| Phoma sp. WAC 7977 calmodulin gene, partial cds	80	2e-12
193	gb|AY831531.1| Phoma sp. OMT 5 calmodulin gene, partial cds	80	2e-12
194	dbj|AB076905.1| Ciona intestinalis Ci-CaM mRNA for calmodulin ho...	80	2e-12
195	gb|U48692.1|TAU48692 Triticum aestivum calmodulin TaCaM2-3 mRNA,...	80	2e-12
196	gb|U48691.1|TAU48691 Triticum aestivum calmodulin TaCaM2-2 mRNA,...	80	2e-12
197	gb|U48690.1|TAU48690 Triticum aestivum calmodulin TaCaM2-1 mRNA,...	80	2e-12
198	emb|AL928712.8| Zebrafish DNA sequence from clone CH211-220O11 i...	80	2e-12
199	gb|U20295.1|STU20295 Solanum tuberosum clone PCM6 calmodulin mRN...	80	2e-12
200	dbj|D10365.1|ORZCAMC O. latipes (killifish) mRNA for calmodulin,...	80	2e-12
201	ref|NM_031969.1| Rattus norvegicus calmodulin 1 (Calm1), mRNA	78	8e-12
202	gb|AY542983.1| Bigelowiella natans calmodulin mRNA, complete cds	78	8e-12
203	gb|DQ457005.1| Synthetic construct plasmid pN1-4neo-GCaMP1.6 His...	78	8e-12
204	gb|AY513748.1| Oreochromis mossambicus calmodulin mRNA, complete...	78	8e-12
205	gb|AY459341.1| Oryza sativa (japonica cultivar-group) clone CL03...	78	8e-12
206	ref|XM_800150.1| Trypanosoma cruzi strain CL Brener calmodulin (...	78	8e-12
207	ref|XM_800151.1| Trypanosoma cruzi strain CL Brener calmodulin (...	78	8e-12
208	ref|XM_802996.1| Trypanosoma cruzi strain CL Brener calmodulin (...	78	8e-12
209	ref|XM_803000.1| Trypanosoma cruzi strain CL Brener calmodulin (...	78	8e-12
210	ref|XM_803589.1| Trypanosoma cruzi strain CL Brener calmodulin (...	78	8e-12
211	gb|BC058485.1| Rattus norvegicus calmodulin 2, mRNA (cDNA clone ...	78	8e-12
212	gb|BC062085.1| Rattus norvegicus cDNA clone IMAGE:5599826, **** ...	78	8e-12
213	emb|X52096.1|TCCALB2 Trypanosoma cruzi CalA2 calmodulin gene	78	8e-12
214	gb|DQ381402.1| Synthetic construct G-CaMP2 mRNA, complete cds	78	8e-12
215	gb|AF441190.1|AF441190 Oryza sativa clone 15295 calmodulin (CaM)...	78	8e-12
216	gb|AF030032.1| Phaseolus vulgaris calmodulin (CaM) mRNA, PvCaM-1...	78	8e-12
217	ref|XM_579543.1| PREDICTED: Rattus norvegicus calmodulin 1 (Calm...	78	8e-12
218	gb|AF178845.1|AF178845 Rattus norvegicus calmodulin mRNA, comple...	78	8e-12
219	emb|X13933.1|RNRCM1 R.norvegicus mRNA for calmodulin (pRCM1)	78	8e-12
220	emb|X13835.1|RNCAMII3 R.norvegicus CaMII gene, exons 3,4 & 5	78	8e-12
221	emb|AJ550759.1|RNO550759 Synthetic construct pN1-G-CaMP gene for...	78	8e-12
222	gb|U20297.1|STU20297 Solanum tuberosum clone PCM8 calmodulin gen...	78	8e-12
223	gb|U20293.1|STU20293 Solanum tuberosum clone PCM4 calmodulin gen...	78	8e-12
224	gb|U20291.1|STU20291 Solanum tuberosum clone PCM2 calmodulin gen...	78	8e-12
225	gb|M17069.1|RATCAMA Rat calmodulin (RCM3) mRNA, complete cds	78	8e-12
226	gb|M19312.1|RATCAM Rat calmodulin mRNA, complete cds	78	8e-12
227	gb|M80831.1|PETCALPRO Petunia hybrida CAM53 mRNA, complete cds	78	8e-12
228	ref|NM_017326.1| Rattus norvegicus calmodulin 2 (Calm2), mRNA	78	8e-12
229	dbj|D10366.1|ORZCAMD O. latipes (killifish) mRNA for calmodulin,...	78	8e-12
230	ref|NM_180529.2| Arabidopsis thaliana CAM6 (CALMODULIN 6); calci...	76	3e-11
231	gb|DQ207852.1| Solanum tuberosum clone 075A11 calmodulin-like mR...	76	3e-11
232	ref|XM_414988.1| PREDICTED: Gallus gallus similar to calmodulin,...	76	3e-11
233	gb|AY180259.1| Stachybotrys kampalensis strain UAMH 7746 calmodu...	76	3e-11
234	gb|DQ450840.1| Solanum chacoense calmodulin (CAM1) mRNA, complet...	76	3e-11
235	emb|Z12024.1|ATCMACAM6 A.thaliana mRNA (clone ACaM6) for calmodulin	76	3e-11
236	emb|Y09853.1|CACAM Cicer arietinum mRNA for CaM protein	76	3e-11
237	emb|AJ843112.1| Quercus petraea mRNA for calmodulin (caM-2 gene)	76	3e-11
238	gb|AY094037.1| Arabidopsis thaliana AT3g43810/T28A8_100 mRNA, co...	76	3e-11
239	gb|AY050350.1| Arabidopsis thaliana AT3g43810/T28A8_100 mRNA, co...	76	3e-11
240	gb|L20507.1|VIRCALMODU Vigna radiata calmodulin mRNA, complete cds	76	3e-11
241	emb|BX824041.1|CNS0A7BJ Arabidopsis thaliana Full-length cDNA Co...	76	3e-11
242	emb|BX822955.1|CNS0A7H5 Arabidopsis thaliana Full-length cDNA Co...	76	3e-11
243	emb|BX825155.1|CNS0A68K Arabidopsis thaliana Full-length cDNA Co...	76	3e-11
244	gb|AC140977.1| Arabidopsis thaliana chromosome 5 BAC F13M11 geno...	76	3e-11
245	gb|AC171018.2| Gallus gallus BAC clone CH261-11F14 from chromoso...	76	3e-11
246	gb|U91642.1|POU91642 Pleurotus ostreatus calmodulin mRNA, comple...	76	3e-11
247	gb|U20294.1|STU20294 Solanum tuberosum clone PCM5 calmodulin gen...	76	3e-11
248	gb|J05116.1|ACKCAL A.klebsiana calmodulin gene, complete cds	76	3e-11
249	gb|AY725755.1| Cylindrocladium hongkongense strain CBS 114828 ca...	74	1e-10
250	gb|AY725754.1| Cylindrocladium hongkongense strain CBS 114711 ca...	74	1e-10
251	gb|AY725753.1| Calonectria kyotensis strain CBS 114552 calmoduli...	74	1e-10
252	gb|AY725752.1| Calonectria kyotensis strain CBS 413.67 calmoduli...	74	1e-10
253	gb|AY725751.1| Calonectria kyotensis strain ATCC 18882 calmoduli...	74	1e-10
254	gb|AY725750.1| Calonectria kyotensis strain ATCC 18834 calmoduli...	74	1e-10
255	gb|AY752230.1| Cercospora beticola strain CPC 5128 calmodulin (c...	74	1e-10
256	gb|AY752228.1| Cercospora beticola strain CBS 122.31 calmodulin ...	74	1e-10
257	gb|AY752227.1| Cercospora beticola strain CBS 116.47 calmodulin ...	74	1e-10
258	gb|AY752224.1| Davidiella tassiana strain ATCC 66670 calmodulin ...	74	1e-10
259	gb|AY752223.1| Cladosporium cladosporioides strain ATCC 66669 ca...	74	1e-10
260	ref|NM_188025.1| Oryza sativa (japonica cultivar-group), Ozsa844...	74	1e-10
261	ref|NM_205005.1| Gallus gallus calmodulin 2 (phosphorylase kinas...	74	1e-10
262	gb|BT018042.1| Zea mays clone EL01N0531A07.c mRNA sequence	74	1e-10
263	ref|XM_598515.2| PREDICTED: Bos taurus similar to calmodulin 1 (...	74	1e-10
264	gb|AY341376.1| Pinctada fucata calmodulin mRNA, complete cds	74	1e-10
265	ref|NM_200082.1| Danio rerio calmodulin 1b (calm1b), mRNA	74	1e-10
266	gb|BC059500.1| Danio rerio calmodulin 1b, mRNA (cDNA clone MGC:7...	74	1e-10
267	ref|XM_323459.1| Neurospora crassa OR74A hypothetical protein ( ...	74	1e-10
268	ref|XM_956183.1| Neurospora crassa OR74A hypothetical protein ( ...	74	1e-10
269	gb|BC105380.1| Bos taurus calmodulin 1 (phosphorylase kinase, de...	74	1e-10
270	gb|AY072054.1| Prorocentrum minimum calmodulin mRNA, partial cds	74	1e-10
271	gb|AY180258.1| Stachybotrys chartarum strain ATCC 16026 calmodul...	74	1e-10
272	gb|AY180257.1| Stachybotrys chartarum strain UAMH 6715 calmoduli...	74	1e-10
273	gb|AY180256.1| Stachybotrys chartarum strain ATCC 26303 calmodul...	74	1e-10
274	gb|AY095963.1| Stachybotrys chartarum strain B6 calmodulin (Cal)...	74	1e-10
275	gb|AY095962.1| Stachybotrys chartarum strain B18 calmodulin (Cal...	74	1e-10
276	gb|AY095961.1| Stachybotrys chartarum strain J1 calmodulin (Cal)...	74	1e-10
277	gb|AY095960.1| Stachybotrys chartarum strain B14 calmodulin (Cal...	74	1e-10
278	emb|X80231.1|LTCAMA L.tarentolae CAM A gene for calmodulin	74	1e-10
279	emb|X97558.1|CACAM1 C.annuum mRNA for calmodulin-1	74	1e-10
280	emb|X70923.1|NCCALMOE N.crassa mRNA for calmodulin	74	1e-10
281	emb|AJ843113.1| Quercus petraea mRNA for calmodulin (caM-3 gene)	74	1e-10
282	gb|BC065426.1| Danio rerio calmodulin 1b, mRNA (cDNA clone MGC:7...	74	1e-10
283	emb|AJ720728.1| Gallus gallus mRNA for hypothetical protein, clo...	74	1e-10
284	dbj|AK169630.1| Mus musculus 2 days neonate thymus thymic cells ...	74	1e-10
285	gb|AC055817.12| Mus musculus, clone RP23-154I7, complete sequence	74	1e-10
286	dbj|AP000969.1| Oryza sativa (japonica cultivar-group) genomic D...	74	1e-10
287	emb|AL935145.12| Zebrafish DNA sequence from clone CH211-173B9 i...	74	1e-10
288	gb|AY831541.1| Phoma medicaginis strain CBS 316.90 calmodulin ge...	74	1e-10
289	gb|AY831539.1| Phoma sp. WAC 4736 calmodulin gene, partial cds	74	1e-10
290	gb|AY831538.1| Phoma sp. WAC 4738 calmodulin gene, partial cds	74	1e-10
291	gb|AY831537.1| Phoma sp. WAC 4741 calmodulin gene, partial cds	74	1e-10
292	gb|AY831534.1| Phoma sp. WAC 7980 calmodulin gene, partial cds	74	1e-10
293	gb|AY109837.1| Zea mays CL1769_2 mRNA sequence	74	1e-10
294	gb|AF034964.1|AF034964 Glomerella cingulata calmodulin (cam) mRN...	74	1e-10
295	gb|AF081672.1|AF081672 Gallus gallus calmodulin mRNA, complete cds	74	1e-10
296	emb|AL714010.11| Mouse DNA sequence from clone RP23-455F14 on ch...	74	1e-10
297	gb|AY840433.1| Cercospora beticola strain CPC 10197 calmodulin (...	74	1e-10
298	gb|AY840432.1| Cercospora beticola strain CPC 10171 calmodulin (...	74	1e-10
299	gb|AY840431.1| Cercospora beticola strain CPC 10168 calmodulin (...	74	1e-10
300	gb|AY840430.1| Cercospora beticola strain CBS 116506 calmodulin ...	74	1e-10
301	gb|AY840429.1| Cercospora beticola strain CBS 116505 calmodulin ...	74	1e-10
302	gb|AY840428.1| Cercospora beticola strain CBS 116503 calmodulin ...	74	1e-10
303	gb|AY840427.1| Cercospora beticola strain CBS 116502 calmodulin ...	74	1e-10
304	gb|AY840426.1| Cercospora beticola strain CBS 116501 calmodulin ...	74	1e-10
305	gb|AY840425.1| Cercospora beticola strain CBS 116456 calmodulin ...	74	1e-10
306	gb|AY840424.1| Cercospora beticola strain CBS 116454 calmodulin ...	74	1e-10
307	gb|AY840423.1| Cercospora beticola strain CBS 126.31 calmodulin ...	74	1e-10
308	gb|AY840422.1| Cercospora beticola strain CBS 125.31 calmodulin ...	74	1e-10
309	gb|AY840421.1| Cercospora beticola strain CBS 124.31 calmodulin ...	74	1e-10
310	gb|AY840420.1| Cercospora beticola strain CBS 123.31 calmodulin ...	74	1e-10
311	gb|AY840419.1| Cercospora apii strain CBS 116507 calmodulin (cmd...	74	1e-10
312	gb|AY840418.1| Cercospora apii strain CBS 116504 calmodulin (cmd...	74	1e-10
313	gb|AY840417.1| Cercospora apii strain CBS 116455 calmodulin (cmd...	74	1e-10
314	gb|AY840416.1| Cercospora apii strain CBS 114485 calmodulin (cmd...	74	1e-10
315	gb|AY840415.1| Cercospora apii strain CBS 114418 calmodulin (cmd...	74	1e-10
316	gb|AY840414.1| Cercospora apii strain CBS 114416 calmodulin (cmd...	74	1e-10
317	gb|AY840413.1| Cercospora apii strain CBS 152.52 calmodulin (cmd...	74	1e-10
318	gb|AY840412.1| Cercospora apii strain CBS 127.31 calmodulin (cmd...	74	1e-10
319	gb|AY840411.1| Cercospora apii strain CBS 121.31 calmodulin (cmd...	74	1e-10
320	gb|AY840410.1| Cercospora apii strain CBS 119.25 calmodulin (cmd...	74	1e-10
321	gb|M36167.1|CHKCALMA Chicken calmodulin mRNA, complete cds	74	1e-10
322	dbj|AB055386.1| Clemmys japonica CaM-C III mRNA for calmodulin, ...	74	1e-10
323	dbj|AB081569.1| Strongylocentrotus intermedius CaM gene for calm...	74	1e-10
324	ref|NM_123137.2| Arabidopsis thaliana CAM1 (CALMODULIN 1); calci...	72	5e-10
325	gb|DQ200375.1| Solanum tuberosum clone 060G04 putative calmoduli...	72	5e-10
326	emb|CR733384.2|CNS0GSOC Tetraodon nigroviridis full-length cDNA	72	5e-10
327	emb|CR730244.2|CNS0GQEH Tetraodon nigroviridis full-length cDNA	72	5e-10
328	gb|AY232217.1| Drosophila yakuba clone yak-ad_Cam mRNA sequence	72	5e-10
329	emb|CR718886.2|CNS0GHN0 Tetraodon nigroviridis full-length cDNA	72	5e-10
330	emb|CR712586.2|CNS0GCS6 Tetraodon nigroviridis full-length cDNA	72	5e-10
331	emb|CR710310.2|CNS0GB0Y Tetraodon nigroviridis full-length cDNA	72	5e-10
332	emb|CR705969.2|CNS0G7OD Tetraodon nigroviridis full-length cDNA	72	5e-10
333	emb|CR705827.2|CNS0G7KF Tetraodon nigroviridis full-length cDNA	72	5e-10
334	emb|CR681462.2|CNS0FORM Tetraodon nigroviridis full-length cDNA	72	5e-10
335	emb|X74490.1|ZMRNCAL Z.mays mRNA for calmodulin	72	5e-10
336	gb|AF430094.1| Orchidantha sp. nov. 'serinsim' calmodulin gene, ...	72	5e-10
337	gb|AF430093.1| Orchidantha sp. nov. 'railway' calmodulin gene, i...	72	5e-10
338	gb|AF430092.1| Orchidantha suratii calmodulin gene, intron and p...	72	5e-10
339	gb|AF430091.1| Orchidantha suratii calmodulin gene, intron and p...	72	5e-10
340	gb|AF430090.1| Orchidantha suratii calmodulin gene, intron and p...	72	5e-10
341	gb|AF430089.1| Orchidantha sabahensis calmodulin gene, intron an...	72	5e-10
342	gb|AF430088.1| Orchidantha quadricolor calmodulin gene, intron a...	72	5e-10
343	gb|AF430087.1| Orchidantha maxillarioides calmodulin gene, intro...	72	5e-10
344	gb|AF430086.1| Orchidantha longiflora calmodulin gene, intron an...	72	5e-10
345	gb|AF430085.1| Orchidantha inouei calmodulin gene, intron and pa...	72	5e-10
346	gb|AF430084.1| Orchidantha holttumii calmodulin gene, intron and...	72	5e-10
347	gb|AF430083.1| Orchidantha grandiflora calmodulin gene, intron a...	72	5e-10
348	gb|AF430082.1| Orchidantha chinensis calmodulin gene, intron and...	72	5e-10
349	gb|AF430080.1| Orchidantha cf. borneensis Nagamasu 6689 calmodul...	72	5e-10
350	gb|AY072520.1| Arabidopsis thaliana unknown protein mRNA, comple...	72	5e-10
351	gb|AY072628.1| Arabidopsis thaliana AT5g37780/K22F20_20 mRNA, co...	72	5e-10
352	gb|AY059809.1| Arabidopsis thaliana Unknown protein mRNA, comple...	72	5e-10
353	gb|AY048276.1| Arabidopsis thaliana AT5g37780/K22F20_20 mRNA, co...	72	5e-10
354	emb|BX832026.1|CNS0A24Z Arabidopsis thaliana Full-length cDNA Co...	72	5e-10
355	emb|BX830458.1|CNS0A1LN Arabidopsis thaliana Full-length cDNA Co...	72	5e-10
356	gb|AF292108.1|AF292108 Prunus avium calmodulin mRNA, complete cds	72	5e-10
357	dbj|AB016873.1| Arabidopsis thaliana genomic DNA, chromosome 5, ...	72	5e-10
358	gb|U20296.1|STU20296 Solanum tuberosum clone PCM7 calmodulin gen...	72	5e-10
359	gb|K00510.1|CHKCM11 Chicken cCM1 gene coding for a calmodulin-li...	72	5e-10
360	gb|M38379.1|ATHCAM1 A.thaliana calmodulin-1 (cam1) mRNA, complet...	72	5e-10
361	dbj|AB050847.1| Nicotiana tabacum mRNA for calmodulin NtCaM11, c...	72	5e-10
362	gb|AY725761.1| Cylindrocladium multiphialidicum strain CBS 11267...	70	2e-09
363	ref|XM_790588.1| PREDICTED: Strongylocentrotus purpuratus simila...	70	2e-09
364	ref|XM_775769.1| PREDICTED: Strongylocentrotus purpuratus simila...	70	2e-09
365	emb|X98404.1|CACAM2 C.annuum mRNA for calmodulin-2	70	2e-09
366	emb|AJ133486.1|BLA133486 Branchiostoma lanceolatum mRNA for calm...	70	2e-09
367	gb|AF108889.1|AF108889 Capsicum annuum calmodulin mRNA, complete...	70	2e-09
368	emb|X05117.1|RNCAMI3 R.norvegicus CaMI gene, exons 3-6	70	2e-09
369	gb|U83402.1|CAU83402 Capsicum annuum calmodulin mRNA, complete cds	70	2e-09
370	gb|U20292.1|STU20292 Solanum tuberosum clone PCM3 calmodulin gen...	70	2e-09
371	gb|J00931.1|ELCCAMEEL E.electricus calmodulin mRNA	70	2e-09
372	gb|M36168.1|ELCCALMA E.electricus calmodulin mRNA, complete cds	70	2e-09
373	gb|M80836.1|PETCAM81 Petunia hybrida CAM81 mRNA,	70	2e-09
374	gb|AY725774.1| Cylindrocladiella lageniformis strain CPC 5607 ca...	68	8e-09
375	gb|AY725760.1| Cylindrocladium malesianum strain CBS 112752 calm...	68	8e-09
376	emb|Y14765.1|LEY14765 Lycopersicon esculentum mRNA for calmoduli...	68	8e-09
377	emb|AL807366.1|NC94C8 Neurospora crassa DNA linkage group V cosm...	68	8e-09
378	emb|AJ843114.1| Plantago major mRNA for calmodulin (cam1 gene)	68	8e-09
379	gb|DQ381953.1| Trichoderma austrokoningii calmodulin (cal) gene,...	68	8e-09
380	gb|DQ367666.1| Trichoderma dingleyeae strain GJS 99-203 calmodul...	68	8e-09
381	gb|DQ379006.1| Trichoderma austrokoningii strain GJS 00-73 calmo...	68	8e-09
382	gb|DQ379004.1| Trichoderma austrokoningii strain GJS 99-116 calm...	68	8e-09
383	gb|DQ379003.1| Trichoderma austrokoningii strain CTR 85-57 calmo...	68	8e-09
384	gb|DQ379001.1| Trichoderma austrokoningii strain GJS 99-146 calm...	68	8e-09
385	gb|DQ379000.1| Trichoderma austrokoningii strain GJS 99-147 calm...	68	8e-09
386	gb|DQ378997.1| Trichoderma austrokoningii strain GJS 96-163 calm...	68	8e-09
387	gb|DQ370461.1| Trichoderma dingleyeae strain GJS 02-50 calmoduli...	68	8e-09
388	gb|DQ370458.1| Hypocrea koningii strain GJS 92-18 calmodulin (ca...	68	8e-09
389	gb|AF368285.1|AF368285 Capsicum annuum calmodulin-like protein m...	68	8e-09
390	gb|AY586021.1| Paxillus involutus strain Nau calmodulin (calA) g...	68	8e-09
391	gb|AY586020.1| Paxillus involutus strain Maj calmodulin (calA) g...	68	8e-09
392	gb|L02964.1|NEUCALMDLN Neurospora crassa calmodulin gene, comple...	68	8e-09
393	gb|AY752237.1| Mycosphaerella citri isolate X126 calmodulin (cmd...	66	3e-08
394	gb|AY752229.1| Cercospora beticola strain CPC 5125 calmodulin (c...	66	3e-08
395	gb|AY752226.1| Cercospora apii strain CPC 5123 calmodulin (cmdA)...	66	3e-08
396	gb|AY752225.1| Cercospora apii strain CBS 536.71 calmodulin (cmd...	66	3e-08
397	ref|NM_115539.2| Arabidopsis thaliana CAM3 (CALMODULIN 3); calci...	66	3e-08
398	gb|AC161597.7| Mus musculus BAC clone RP23-387P23 from chromosom...	66	3e-08
399	ref|XM_592316.2| PREDICTED: Bos taurus similar to calmodulin 1 (...	66	3e-08
400	gb|DQ122171.1| Trichoderma asperellum strain GJS 99-6 calmodulin...	66	3e-08
401	gb|DQ122153.1| Trichoderma pubescens strain DAOM 166162 calmodul...	66	3e-08
402	gb|BC051444.1| Mus musculus calmodulin 2, mRNA (cDNA clone MGC:6...	66	3e-08
403	ref|XM_869284.1| PREDICTED: Bos taurus similar to calmodulin 1 (...	66	3e-08
404	gb|BC021347.1| Mus musculus calmodulin 2, mRNA (cDNA clone MGC:2...	66	3e-08
405	ref|NM_007589.4| Mus musculus calmodulin 2 (Calm2), mRNA	66	3e-08
406	ref|XR_003132.1| PREDICTED: Mus musculus similar to calmodulin 1...	66	3e-08
407	ref|XM_985185.1| PREDICTED: Mus musculus similar to calmodulin 1...	66	3e-08
408	ref|XM_990939.1| PREDICTED: Mus musculus similar to calmodulin 1...	66	3e-08
409	ref|XM_980136.1| PREDICTED: Mus musculus similar to calmodulin 1...	66	3e-08
410	ref|XM_917767.2| PREDICTED: Mus musculus similar to calmodulin 1...	66	3e-08
411	ref|XM_916230.2| PREDICTED: Mus musculus similar to calmodulin 1...	66	3e-08
412	ref|XM_754964.1| Ustilago maydis 521 calmodulin (UM03910.1) part...	66	3e-08
413	gb|AC117234.4| Mus musculus BAC clone RP23-410J2 from chromosome...	66	3e-08
414	gb|AC122478.3| Mus musculus BAC clone RP24-337D11 from chromosom...	66	3e-08
415	gb|AC084383.1| Mus musculus BAC clone RP23-10B20 from 17, comple...	66	3e-08
416	ref|XM_533635.2| PREDICTED: Canis familiaris similar to calmodul...	66	3e-08
417	gb|AY180255.1| Stachybotrys chartarum strain ATCC 9182 calmoduli...	66	3e-08
418	gb|AY180254.1| Stachybotrys chartarum strain UAMH 3228 calmoduli...	66	3e-08
419	gb|AY180253.1| Stachybotrys chartarum strain CBS 109285 calmodul...	66	3e-08
420	gb|AY095966.1| Stachybotrys chartarum strain D13 calmodulin (Cal...	66	3e-08
421	gb|AY095965.1| Stachybotrys chartarum strain B27 calmodulin (Cal...	66	3e-08
422	gb|AY095964.1| Stachybotrys chartarum strain B9 calmodulin (Cal)...	66	3e-08
423	gb|AY091301.1| Arabidopsis thaliana putative calmodulin-3 protei...	66	3e-08
424	gb|AY046048.1| Arabidopsis thaliana putative calmodulin-3 protei...	66	3e-08
425	gb|AY966899.1| Cercospora agavicola isolate CBS 117292 calmoduli...	66	3e-08
426	emb|AL390921.1|ATT8M16 Arabidopsis thaliana DNA chromosome 3, BA...	66	3e-08
427	emb|AJ427338.1|BOL427338 Brassica oleracea mRNA for calmodulin 2...	66	3e-08
428	gb|AF396030.1| Magnaporthe salvinii calmodulin (cal) gene, parti...	66	3e-08
429	gb|DQ399023.1| Ictalurus punctatus clone SRA06 calmodulin 1 mRNA...	66	3e-08
430	dbj|AK152303.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	66	3e-08
431	dbj|AK161268.1| Mus musculus adult male testis cDNA, RIKEN full-...	66	3e-08
432	dbj|AK168741.1| Mus musculus 13 days embryo liver cDNA, RIKEN fu...	66	3e-08
433	dbj|AK161984.1| Mus musculus 12 days embryo female ovary cDNA, R...	66	3e-08
434	dbj|AK160636.1| Mus musculus 11 days embryo whole body cDNA, RIK...	66	3e-08
435	gb|AY057567.1| Arabidopsis thaliana AT3g56800/T8M16_130 mRNA, co...	66	3e-08
436	gb|DQ379002.1| Trichoderma asperellum strain GJS 04-217 calmodul...	66	3e-08
437	dbj|AK013068.1| Mus musculus 10, 11 days embryo whole body cDNA,...	66	3e-08
438	dbj|AK012564.1| Mus musculus 11 days embryo whole body cDNA, RIK...	66	3e-08
439	dbj|AK012247.1| Mus musculus 11 days embryo whole body cDNA, RIK...	66	3e-08
440	gb|AF264065.1|AF264065 Blastocladiella emersonii calmodulin (CaM...	66	3e-08
441	emb|BX822741.1|CNS0A78I Arabidopsis thaliana Full-length cDNA Co...	66	3e-08
442	emb|BX823583.1|CNS0A6LJ Arabidopsis thaliana Full-length cDNA Co...	66	3e-08
443	gb|AF295637.1|AF295637 Elaeis guineensis calmodulin mRNA, comple...	66	3e-08
444	gb|AY085660.1| Arabidopsis thaliana clone 16715 mRNA, complete s...	66	3e-08
445	gb|AY902353.1| Mus musculus strain CAST/EiJ calmodulin 2 (Calm2)...	66	3e-08
446	gb|AY831540.1| Phoma pinodella strain CBS 318.90 calmodulin gene...	66	3e-08
447	gb|AY831535.1| Phoma pinodella strain WAC 7978 calmodulin gene, ...	66	3e-08
448	gb|AY831532.1| Ascochyta lentis strain SAT AL calmodulin gene, p...	66	3e-08
449	gb|BC100301.1| Mus musculus calmodulin 2, mRNA (cDNA clone MGC:1...	66	3e-08
450	gb|AY741744.1| Penicillium indicum strain NRRL 3387 calmodulin g...	66	3e-08
451	gb|AC148987.3| Mus musculus BAC clone RP24-322F4 from 6, complet...	66	3e-08
452	gb|AY720812.1| Wuestneia molokaiensis strain CBS 114877 calmodul...	66	3e-08
453	gb|AY720810.1| Harknessia eucalyptorum strain CPC 85 calmodulin ...	66	3e-08
454	gb|AY720809.1| Harknessia eucalyptorum strain CBS 113620 calmodu...	66	3e-08
455	gb|AY720808.1| Harknessia eucalypti strain CBS 342.97 calmodulin...	66	3e-08
456	gb|AY720807.1| Harknessia weresubiae strain CPC 5109 calmodulin ...	66	3e-08
457	gb|AY720806.1| Harknessia weresubiae strain CPC 5108 calmodulin ...	66	3e-08
458	gb|AY720805.1| Harknessia weresubiae strain CPC 5107 calmodulin ...	66	3e-08
459	gb|AY720804.1| Harknessia weresubiae strain CBS 113075 calmoduli...	66	3e-08
460	gb|AY720802.1| Harknessia uromycoides strain CPC 108 calmodulin ...	66	3e-08
461	gb|AY720800.1| Harknessia renispora strain CBS 153.71 calmodulin...	66	3e-08
462	gb|AY720799.1| Harknessia protearum strain CBS 111831 calmodulin...	66	3e-08
463	gb|AY720798.1| Harknessia protearum strain CBS 111830 calmodulin...	66	3e-08
464	gb|AY720797.1| Harknessia protearum strain CBS 112616 calmodulin...	66	3e-08
465	gb|AY720796.1| Harknessia protearum strain CBS 112617 calmodulin...	66	3e-08
466	gb|AY720795.1| Harknessia protearum strain CBS 112618 calmodulin...	66	3e-08
467	gb|AY720794.1| Harknessia leucospermi strain CBS 112619 calmodul...	66	3e-08
468	gb|AY720793.1| Harknessia leucospermi strain CBS 112620 calmodul...	66	3e-08
469	gb|AY720792.1| Harknessia leucospermi strain CPC 5400 calmodulin...	66	3e-08
470	gb|AY720791.1| Harknessia leucospermi strain CPC 2849 calmodulin...	66	3e-08
471	gb|AY720790.1| Harknessia leucospermi strain CBS 775.97 calmodul...	66	3e-08
472	gb|AY720789.1| Harknessia hawaiiensis strain CBS 111122 calmodul...	66	3e-08
473	gb|AY720788.1| Harknessia hawaiiensis strain CBS 110728 calmodul...	66	3e-08
474	gb|AY720787.1| Harknessia hawaiiensis strain CBS 115650 calmodul...	66	3e-08
475	gb|AY720786.1| Harknessia hawaiiensis strain CBS 114811 calmodul...	66	3e-08
476	gb|AY720785.1| Harknessia globispora strain CBS 111578 calmoduli...	66	3e-08
477	gb|AY720784.1| Harknessia fusiformis strain CPC 295 calmodulin (...	66	3e-08
478	gb|AY720783.1| Harknessia fusiformis strain CPC 10488 calmodulin...	66	3e-08
479	gb|AY720782.1| Harknessia capensis strain CBS 111829 calmodulin ...	66	3e-08
480	gb|AY720781.1| Harknessia capensis strain CBS 115061 calmodulin ...	66	3e-08
481	gb|L31642.1|MUSCAMC Mus musculus calmodulin (CamC) mRNA, 5' end	66	3e-08
482	gb|M27844.1|MUSCAM Mus musculus calmodulin synthesis (CaM) cDNA,...	66	3e-08
483	gb|L02963.1|NEUCLMDLN Neurospora crassa calmodulin mRNA, complet...	66	3e-08
484	gb|M73712.1|ATHCAM3COL Arabidopsis thaliana calmodulin-3 mRNA, 3...	66	3e-08
485	gb|M73711.1|ATHCAM3 Arabidopsis thaliana cam-3 gene, complete cds	66	3e-08
486	gb|AY752253.1| Mycosphaerella thailandica isolate X58 calmodulin...	64	1e-07
487	gb|AY752252.1| Mycosphaerella thailandica isolate X51 calmodulin...	64	1e-07
488	gb|AY752251.1| Mycosphaerella thailandica strain CPC 10621 calmo...	64	1e-07
489	gb|AY752250.1| Mycosphaerella thailandica strain CPC 10549 calmo...	64	1e-07
490	gb|AY752249.1| Mycosphaerella thailandica strain CPC 10548 calmo...	64	1e-07
491	gb|AY752248.1| Mycosphaerella thailandica strain CPC 10547 calmo...	64	1e-07
492	gb|AY752242.1| Mycosphaerella colombiensis strain CBS 110969 cal...	64	1e-07
493	gb|AY752241.1| Mycosphaerella colombiensis strain CBS 110968 cal...	64	1e-07
494	gb|AY752240.1| Mycosphaerella colombiensis strain CBS 110967 cal...	64	1e-07
495	ref|XM_510117.1| PREDICTED: Pan troglodytes similar to calmoduli...	64	1e-07
496	ref|NM_191034.1| Oryza sativa (japonica cultivar-group), predic...	64	1e-07
497	gb|AY627883.1| Ctenopharyngodon idella calmodulin mRNA, complete...	64	1e-07
498	ref|NM_006888.3| Homo sapiens calmodulin 1 (phosphorylase kinase...	64	1e-07
499	gb|BC094079.1| Xenopus laevis calmodulin 2-like, mRNA (cDNA clon...	64	1e-07
500	gb|AY189287.1| Homo sapiens LP7057 protein mRNA, complete cds	64	1e-07

---

>gb|M27303.1|BLYCAMA Barley cam gene encoding calmodulin, complete cds
          Length = 1086

 Score =  216 bits (109), Expect = 1e-53
 Identities = 118/120 (98%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 344 ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 403

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           ||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||
Sbjct: 404 aggacatgatcaatgaagtcgacgctgatggcaacggcaccattg-acttcccagagttc 462

---

>gb|U49104.1|TAU49104 Triticum aestivum calmodulin TaCaM3-3 mRNA, complete cds
          Length = 846

 Score =  208 bits (105), Expect = 3e-51
 Identities = 117/120 (97%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 193 ccaaggagctgggaacagtcatgcgttcgctggggcagaacccaacggaggctgagctcc 252

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           ||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||
Sbjct: 253 aggacatgatcaatgaagtcgacgctgatggcaacggcaccattg-acttcccagagttc 311

---

>gb|U48693.1|TAU48693 Triticum aestivum calmodulin TaCaM3-1 mRNA, complete cds
          Length = 1529

 Score =  200 bits (101), Expect = 8e-49
 Identities = 116/120 (96%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                        
Query: 28   ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
            ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 959  ccaaggagctgggaacagtcatgcgttcgctggggcagaacccaacggaggctgagctcc 1018

                                                                        
Query: 88   aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
            ||||||||||||||||||||||||||| |||||| |||||||||| ||||||||||||||
Sbjct: 1019 aggacatgatcaatgaagtcgacgctgatggcaatggcaccattg-acttcccagagttc 1077

---

>gb|U49103.1|TAU49103 Triticum aestivum calmodulin TaCaM3-2 mRNA, complete cds
          Length = 811

 Score =  192 bits (97), Expect = 2e-46
 Identities = 115/120 (95%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||
Sbjct: 191 ccaaggagctgggaacagttatgcgttcgctggggcagaacccaacggaggctgagctcc 250

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||||||||||||||||||||| |||| ||||||||||||||||| ||||||||||||||
Sbjct: 251 aggacatgatcaatgaagtcgatgctgatggcaacggcaccattg-acttcccagagttc 309

---

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  137 bits (69), Expect = 1e-29
 Identities = 108/120 (90%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                            
Query: 28       ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
                |||||||||||||||| || ||||| |||||||||||||||||||||||||| |||||||
Sbjct: 11496854 ccaaggagctgggaaccgtgatgcgttcgctggggcagaacccaacggaggccgagctcc 11496913

                                                                            
Query: 88       aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
                ||||||||||||| || |||||||| |  |||||||||||||| | ||||||| ||||||
Sbjct: 11496914 aggacatgatcaacgaggtcgacgcggacggcaacggcaccatcg-acttcccggagttc 11496972

---

>gb|AC119748.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBa0042L15, from chromosome 3, complete sequence
          Length = 172475

 Score =  137 bits (69), Expect = 1e-29
 Identities = 108/120 (90%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                         
Query: 28    ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
             |||||||||||||||| || ||||| |||||||||||||||||||||||||| |||||||
Sbjct: 47426 ccaaggagctgggaaccgtgatgcgttcgctggggcagaacccaacggaggccgagctcc 47485

                                                                         
Query: 88    aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
             ||||||||||||| || |||||||| |  |||||||||||||| | ||||||| ||||||
Sbjct: 47486 aggacatgatcaacgaggtcgacgcggacggcaacggcaccatcg-acttcccggagttc 47544

---

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  137 bits (69), Expect = 1e-29
 Identities = 108/120 (90%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                            
Query: 28       ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
                |||||||||||||||| || ||||| |||||||||||||||||||||||||| |||||||
Sbjct: 11493617 ccaaggagctgggaaccgtgatgcgttcgctggggcagaacccaacggaggccgagctcc 11493676

                                                                            
Query: 88       aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
                ||||||||||||| || |||||||| |  |||||||||||||| | ||||||| ||||||
Sbjct: 11493677 aggacatgatcaacgaggtcgacgcggacggcaacggcaccatcg-acttcccggagttc 11493735

---

>dbj|AK070090.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023040P16, full
           insert sequence
          Length = 851

 Score =  137 bits (69), Expect = 1e-29
 Identities = 108/120 (90%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||||||||||| || ||||| |||||||||||||||||||||||||| |||||||
Sbjct: 224 ccaaggagctgggaaccgtgatgcgttcgctggggcagaacccaacggaggccgagctcc 283

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           ||||||||||||| || |||||||| |  |||||||||||||| | ||||||| ||||||
Sbjct: 284 aggacatgatcaacgaggtcgacgcggacggcaacggcaccatcg-acttcccggagttc 342

---

>dbj|AK059756.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-C05, full
           insert sequence
          Length = 948

 Score =  137 bits (69), Expect = 1e-29
 Identities = 108/120 (90%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||||||||||| || ||||| |||||||||||||||||||||||||| |||||||
Sbjct: 220 ccaaggagctgggaaccgtgatgcgttcgctggggcagaacccaacggaggccgagctcc 279

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           ||||||||||||| || |||||||| |  |||||||||||||| | ||||||| ||||||
Sbjct: 280 aggacatgatcaacgaggtcgacgcggacggcaacggcaccatcg-acttcccggagttc 338

---

>gb|AF042840.1|AF042840 Oryza sativa clone F14605 calmodulin (CaM1) mRNA, complete cds
          Length = 824

 Score =  137 bits (69), Expect = 1e-29
 Identities = 108/120 (90%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||||||||||| || ||||| |||||||||||||||||||||||||| |||||||
Sbjct: 204 ccaaggagctgggaaccgtgatgcgttcgctggggcagaacccaacggaggccgagctcc 263

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           ||||||||||||| || |||||||| |  |||||||||||||| | ||||||| ||||||
Sbjct: 264 aggacatgatcaacgaggtcgacgcggacggcaacggcaccatcg-acttcccggagttc 322

---

>gb|U49105.1|TAU49105 Triticum aestivum calmodulin TaCaM4-1 mRNA, complete cds
          Length = 841

 Score =  129 bits (65), Expect = 2e-27
 Identities = 107/120 (89%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||||||||||||||| ||||| |||||||| ||||||||||||||||| |||||||
Sbjct: 201 ccaaggagctgggaacagtgatgcgttcgctgggacagaacccaacggaggcagagctcc 260

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           ||||||||||||| || || ||||| |  |||||||||||||| | ||||||| ||||||
Sbjct: 261 aggacatgatcaacgaggtggacgcggacggcaacggcaccatcg-acttcccggagttc 319

---

>gb|AY104071.1| Zea mays PCO074293 mRNA sequence
          Length = 1001

 Score =  127 bits (64), Expect = 1e-26
 Identities = 93/103 (90%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||||||||| || |||||||||||||||||||| || || || |||||||||||||
Sbjct: 264 ccaaggagctgggcactgtcatgcgctcgctggggcaaaatcctacagaggctgagctcc 323

                                                      
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccat 130
           ||||||||||||| || ||||| |||| |||||||||||||||
Sbjct: 324 aggacatgatcaacgaggtcgatgctgatggcaacggcaccat 366

---

>gb|BT017532.1| Zea mays clone EL01N0421H06.c mRNA sequence
          Length = 843

 Score =  119 bits (60), Expect = 2e-24
 Identities = 92/103 (89%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||||||||| || |||||||||||| ||||||| || || || |||||||||||||
Sbjct: 145 ccaaggagctgggcactgtcatgcgctcggtggggcaaaatcctacagaggctgagctcc 204

                                                      
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccat 130
           ||||||||||||| || ||||| |||| |||||||||||||||
Sbjct: 205 aggacatgatcaacgaggtcgatgctgatggcaacggcaccat 247

---

>gb|BT017909.1| Zea mays clone EL01N0517D03.c mRNA sequence
          Length = 924

 Score =  113 bits (57), Expect = 1e-22
 Identities = 105/120 (87%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||||| ||||| |||||||| || ||||| ||||||||||| |||||||||||||
Sbjct: 184 ccaaggagctcggaactgtcatgcgatcactgggtcagaacccaaccgaggctgagctcc 243

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           ||||||||||||| || ||||| || |  |||||||||||||| | ||||||| ||||||
Sbjct: 244 aggacatgatcaacgaggtcgatgcggacggcaacggcaccatcg-acttcccggagttc 302

---

>emb|X77396.1|ZMCAM1 Z.mays CaM1 mRNA for calmodulin
          Length = 942

 Score =  113 bits (57), Expect = 1e-22
 Identities = 105/120 (87%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||||| ||||| |||||||| || ||||| ||||||||||| |||||||||||||
Sbjct: 219 ccaaggagctcggaactgtcatgcgatcactgggtcagaacccaaccgaggctgagctcc 278

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           ||||||||||||| || ||||| || |  |||||||||||||| | ||||||| ||||||
Sbjct: 279 aggacatgatcaacgaggtcgatgcggacggcaacggcaccatcg-acttcccggagttc 337

---

>ref|XM_479602.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 732

 Score =  107 bits (54), Expect = 9e-21
 Identities = 92/105 (87%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||| ||||||| |||||||| || || ||||||||||||||||| ||||||||||
Sbjct: 103 ccaaggagttgggaactgtcatgcgttcactagggcagaacccaacggaagctgagctcc 162

                                                        
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattg 132
           ||||||||||||| || || || |||| |||||| || |||||||
Sbjct: 163 aggacatgatcaacgaggttgatgctgatggcaatggaaccattg 207

---

>emb|Z12827.1|OSCALMOD1 O.sativa gene encoding calmodulin
          Length = 450

 Score =  107 bits (54), Expect = 9e-21
 Identities = 92/105 (87%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||| ||||||| |||||||| || || ||||||||||||||||| ||||||||||
Sbjct: 89  ccaaggagttgggaactgtcatgcgttcactagggcagaacccaacggaagctgagctcc 148

                                                        
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattg 132
           ||||||||||||| || || || |||| |||||| || |||||||
Sbjct: 149 aggacatgatcaacgaggttgatgctgatggcaatggaaccattg 193

---

>emb|AJ271913.1|OSA271913 Oryza sativa partial mRNA for putative calmodulin (caM gene)
          Length = 406

 Score =  107 bits (54), Expect = 9e-21
 Identities = 92/105 (87%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||| ||||||| |||||||| || || |||||||||||||| |||||||||||||
Sbjct: 66  ccaaggagttgggaactgtcatgcgttcactagggcagaacccaactgaggctgagctcc 125

                                                        
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattg 132
           ||||||||||||| || || || |||| |||||| || |||||||
Sbjct: 126 aggacatgatcaacgaggttgatgctgatggcaatggaaccattg 170

---

>gb|AF441191.1|AF441191 Oryza sativa clone 15079 calmodulin (CaM) mRNA, complete cds
          Length = 813

 Score =  107 bits (54), Expect = 9e-21
 Identities = 92/105 (87%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||| ||||||| |||||||| || || ||||||||||||||||| ||||||||||
Sbjct: 169 ccaaggagttgggaactgtcatgcgttcactagggcagaacccaacggaagctgagctcc 228

                                                        
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattg 132
           ||||||||||||| || || || |||| |||||| || |||||||
Sbjct: 229 aggacatgatcaacgaggttgatgctgatggcaatggaaccattg 273

---

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  107 bits (54), Expect = 9e-21
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                            
Query: 28       ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
                |||||||| ||||||| |||||||| || || ||||||||||||||||| ||||||||||
Sbjct: 29144832 ccaaggagttgggaactgtcatgcgttcactagggcagaacccaacggaagctgagctcc 29144773

                                                             
Query: 88       aggacatgatcaatgaagtcgacgctgntggcaacggcaccattg 132
                ||||||||||||| || || || |||| |||||| || |||||||
Sbjct: 29144772 aggacatgatcaacgaggttgatgctgatggcaatggaaccattg 29144728

---

>dbj|AP003813.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1150_E04
          Length = 130973

 Score =  107 bits (54), Expect = 9e-21
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                         
Query: 28    ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
             |||||||| ||||||| |||||||| || || ||||||||||||||||| ||||||||||
Sbjct: 79950 ccaaggagttgggaactgtcatgcgttcactagggcagaacccaacggaagctgagctcc 79891

                                                          
Query: 88    aggacatgatcaatgaagtcgacgctgntggcaacggcaccattg 132
             ||||||||||||| || || || |||| |||||| || |||||||
Sbjct: 79890 aggacatgatcaacgaggttgatgctgatggcaatggaaccattg 79846

---

>dbj|AP003818.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1200_C08
          Length = 106214

 Score =  107 bits (54), Expect = 9e-21
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                         
Query: 28    ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
             |||||||| ||||||| |||||||| || || ||||||||||||||||| ||||||||||
Sbjct: 92789 ccaaggagttgggaactgtcatgcgttcactagggcagaacccaacggaagctgagctcc 92730

                                                          
Query: 88    aggacatgatcaatgaagtcgacgctgntggcaacggcaccattg 132
             ||||||||||||| || || || |||| |||||| || |||||||
Sbjct: 92729 aggacatgatcaacgaggttgatgctgatggcaatggaaccattg 92685

---

>dbj|AK104031.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-020-D10, full
           insert sequence
          Length = 634

 Score =  107 bits (54), Expect = 9e-21
 Identities = 92/105 (87%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||| ||||||| |||||||| || || ||||||||||||||||| ||||||||||
Sbjct: 5   ccaaggagttgggaactgtcatgcgttcactagggcagaacccaacggaagctgagctcc 64

                                                        
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattg 132
           ||||||||||||| || || || |||| |||||| || |||||||
Sbjct: 65  aggacatgatcaacgaggttgatgctgatggcaatggaaccattg 109

---

>dbj|AK071852.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023117O08, full
           insert sequence
          Length = 731

 Score =  107 bits (54), Expect = 9e-21
 Identities = 92/105 (87%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||| ||||||| |||||||| || || ||||||||||||||||| ||||||||||
Sbjct: 102 ccaaggagttgggaactgtcatgcgttcactagggcagaacccaacggaagctgagctcc 161

                                                        
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattg 132
           ||||||||||||| || || || |||| |||||| || |||||||
Sbjct: 162 aggacatgatcaacgaggttgatgctgatggcaatggaaccattg 206

---

>gb|L18913.1|RICCALMODU Oryza sativa calmodulin gene, complete cds
          Length = 450

 Score =  107 bits (54), Expect = 9e-21
 Identities = 92/105 (87%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||| ||||||| |||||||| || || ||||||||||||||||| ||||||||||
Sbjct: 89  ccaaggagttgggaactgtcatgcgttcactagggcagaacccaacggaagctgagctcc 148

                                                        
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattg 132
           ||||||||||||| || || || |||| |||||| || |||||||
Sbjct: 149 aggacatgatcaacgaggttgatgctgatggcaatggaaccattg 193

---

>gb|AF007889.1|AF007889 Symbiodinium microadriaticum calmodulin (SMCaM1) mRNA, partial cds
          Length = 542

 Score =  105 bits (53), Expect = 4e-20
 Identities = 104/120 (86%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||||||||| || || |||||||| ||||| |||||||| |||||||| ||| | |
Sbjct: 56  ccaaggagctgggcaccgtgatgcgctctctgggccagaacccgacggaggccgagttgc 115

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           ||||||||||||| || |||||||| | ||| ||||||||||||| ||||||| ||||||
Sbjct: 116 aggacatgatcaacgaggtcgacgccgatggaaacggcaccattg-acttccccgagttc 174

---

>gb|AF085344.1|AF085344 Pythium splendens calmodulin mRNA, complete cds
          Length = 633

 Score =  103 bits (52), Expect = 1e-19
 Identities = 75/83 (90%)
 Strand = Plus / Plus

                                                                       
Query: 45  gtcatgcgctcgctggggcagaacccaacggaggctgagctccaggacatgatcaatgaa 104
           |||||||||||||| || ||||||||||||||||| || ||||||||||||||||| |||
Sbjct: 133 gtcatgcgctcgcttggtcagaacccaacggaggccgaactccaggacatgatcaacgaa 192

                                  
Query: 105 gtcgacgctgntggcaacggcac 127
           |||||||| |  |||||||||||
Sbjct: 193 gtcgacgcggacggcaacggcac 215

---

>gb|AY103899.1| Zea mays PCO074294 mRNA sequence
          Length = 1076

 Score =  103 bits (52), Expect = 1e-19
 Identities = 70/76 (92%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||||| ||||| |||||||| || ||||| |||||||||||||||||||| ||||
Sbjct: 331 ccaaggagcttggaactgtcatgcgttcactgggtcagaacccaacggaggctgaactcc 390

                           
Query: 88  aggacatgatcaatga 103
           ||||||||||||||||
Sbjct: 391 aggacatgatcaatga 406

---

>ref|NM_105312.2| Arabidopsis thaliana CAM4 (CALMODULIN 4); calcium ion binding
           AT1G66410 (CAM4) mRNA, complete cds
          Length = 732

 Score =  101 bits (51), Expect = 6e-19
 Identities = 102/118 (86%), Gaps = 1/118 (0%)
 Strand = Plus / Plus

                                                                       
Query: 30  aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
           ||||||||||||||||| ||||| || || |||||||||||||| || |||||||| || 
Sbjct: 159 aaggagctgggaacagtgatgcggtcactagggcagaacccaacagaagctgagctacaa 218

                                                                     
Query: 90  gacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           ||||||||||| || || ||||||| ||| ||||| ||||||| ||||||| ||||||
Sbjct: 219 gacatgatcaacgaggttgacgctgatggaaacggaaccattg-acttccctgagttc 275

---

>emb|Z12022.1|ATCMACAM4 A.thaliana mRNA (clone ACaM4) for calmodulin
          Length = 743

 Score =  101 bits (51), Expect = 6e-19
 Identities = 102/118 (86%), Gaps = 1/118 (0%)
 Strand = Plus / Plus

                                                                       
Query: 30  aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
           ||||||||||||||||| ||||| || || |||||||||||||| || |||||||| || 
Sbjct: 161 aaggagctgggaacagtgatgcggtcactagggcagaacccaacagaagctgagctacaa 220

                                                                     
Query: 90  gacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           ||||||||||| || || ||||||| ||| ||||| ||||||| ||||||| ||||||
Sbjct: 221 gacatgatcaacgaggttgacgctgatggaaacggaaccattg-acttccctgagttc 277

---

>gb|AY113902.1| Arabidopsis thaliana putative calmodulin-4 protein (At1g66410)
           mRNA, complete cds
          Length = 481

 Score =  101 bits (51), Expect = 6e-19
 Identities = 102/118 (86%), Gaps = 1/118 (0%)
 Strand = Plus / Plus

                                                                       
Query: 30  aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
           ||||||||||||||||| ||||| || || |||||||||||||| || |||||||| || 
Sbjct: 91  aaggagctgggaacagtgatgcggtcactagggcagaacccaacagaagctgagctacaa 150

                                                                     
Query: 90  gacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           ||||||||||| || || ||||||| ||| ||||| ||||||| ||||||| ||||||
Sbjct: 151 gacatgatcaacgaggttgacgctgatggaaacggaaccattg-acttccctgagttc 207

---

>emb|X65016.1|OSCALM O.sativa mRNA for calmodulin
          Length = 453

 Score =  101 bits (51), Expect = 6e-19
 Identities = 102/118 (86%), Gaps = 1/118 (0%)
 Strand = Plus / Plus

                                                                       
Query: 30  aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
           |||||||| ||||| || ||||| || || || ||||||||||| |||||||||||||||
Sbjct: 94  aaggagcttggaactgtgatgcggtcccttggtcagaacccaactgaggctgagctccag 153

                                                                     
Query: 90  gacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           ||||||||||| || || || |||| |||||| || ||||||| ||||||||||||||
Sbjct: 154 gacatgatcaacgaggttgatgctgatggcaatgggaccattg-acttcccagagttc 210

---

>gb|AF370293.1| Arabidopsis thaliana putative calmodulin-4 protein (At1g66410)
           mRNA, complete cds
          Length = 729

 Score =  101 bits (51), Expect = 6e-19
 Identities = 102/118 (86%), Gaps = 1/118 (0%)
 Strand = Plus / Plus

                                                                       
Query: 30  aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
           ||||||||||||||||| ||||| || || |||||||||||||| || |||||||| || 
Sbjct: 142 aaggagctgggaacagtgatgcggtcactagggcagaacccaacagaagctgagctacaa 201

                                                                     
Query: 90  gacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           ||||||||||| || || ||||||| ||| ||||| ||||||| ||||||| ||||||
Sbjct: 202 gacatgatcaacgaggttgacgctgatggaaacggaaccattg-acttccctgagttc 258

---

>emb|BX813969.1|CNS0ADRS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB50ZA04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 677

 Score =  101 bits (51), Expect = 6e-19
 Identities = 102/118 (86%), Gaps = 1/118 (0%)
 Strand = Plus / Plus

                                                                       
Query: 30  aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
           ||||||||||||||||| ||||| || || |||||||||||||| || |||||||| || 
Sbjct: 147 aaggagctgggaacagtgatgcggtcactagggcagaacccaacagaagctgagctacaa 206

                                                                     
Query: 90  gacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           ||||||||||| || || ||||||| ||| ||||| ||||||| ||||||| ||||||
Sbjct: 207 gacatgatcaacgaggttgacgctgatggaaacggaaccattg-acttccctgagttc 263

---

>gb|AC020665.6|AC020665 Arabidopsis thaliana chromosome 1 BAC T27F4 genomic sequence, complete
             sequence
          Length = 85702

 Score =  101 bits (51), Expect = 6e-19
 Identities = 102/118 (86%), Gaps = 1/118 (0%)
 Strand = Plus / Minus

                                                                         
Query: 30    aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
             ||||||||||||||||| ||||| || || |||||||||||||| || |||||||| || 
Sbjct: 76437 aaggagctgggaacagtgatgcggtcactagggcagaacccaacagaagctgagctacaa 76378

                                                                       
Query: 90    gacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
             ||||||||||| || || ||||||| ||| ||||| ||||||| ||||||| ||||||
Sbjct: 76377 gacatgatcaacgaggttgacgctgatggaaacggaaccattg-acttccctgagttc 76321

---

>gb|AC074025.1|AC074025 Arabidopsis thaliana chromosome 1 BAC F28G11 genomic sequence, complete
             sequence
          Length = 63773

 Score =  101 bits (51), Expect = 6e-19
 Identities = 102/118 (86%), Gaps = 1/118 (0%)
 Strand = Plus / Plus

                                                                         
Query: 30    aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
             ||||||||||||||||| ||||| || || |||||||||||||| || |||||||| || 
Sbjct: 61225 aaggagctgggaacagtgatgcggtcactagggcagaacccaacagaagctgagctacaa 61284

                                                                       
Query: 90    gacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
             ||||||||||| || || ||||||| ||| ||||| ||||||| ||||||| ||||||
Sbjct: 61285 gacatgatcaacgaggttgacgctgatggaaacggaaccattg-acttccctgagttc 61341

---

>gb|AY088476.1| Arabidopsis thaliana clone 6982 mRNA, complete sequence
          Length = 719

 Score =  101 bits (51), Expect = 6e-19
 Identities = 102/118 (86%), Gaps = 1/118 (0%)
 Strand = Plus / Plus

                                                                       
Query: 30  aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
           ||||||||||||||||| ||||| || || |||||||||||||| || |||||||| || 
Sbjct: 148 aaggagctgggaacagtgatgcggtcactagggcagaacccaacagaagctgagctacaa 207

                                                                     
Query: 90  gacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           ||||||||||| || || ||||||| ||| ||||| ||||||| ||||||| ||||||
Sbjct: 208 gacatgatcaacgaggttgacgctgatggaaacggaaccattg-acttccctgagttc 264

---

>gb|U48689.1|TAU48689 Triticum aestivum calmodulin TaCaM1-3 mRNA, complete cds
          Length = 779

 Score =  101 bits (51), Expect = 6e-19
 Identities = 83/94 (88%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||||| ||||| || ||||||||||||||||||||||| || ||||| ||||| |
Sbjct: 111 ccaaggagcttggaactgtgatgcgctcgctggggcagaaccccactgaggcagagcttc 170

                                             
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaa 121
           |||| |||||||||||||| || |||| ||||||
Sbjct: 171 aggatatgatcaatgaagtggatgctgatggcaa 204

---

>gb|AF020781.1|AF020781 Symbiodinium microadriaticum calmodulin (SmCaM1) gene, partial cds
          Length = 717

 Score = 99.6 bits (50), Expect = 2e-18
 Identities = 101/117 (86%), Gaps = 1/117 (0%)
 Strand = Plus / Plus

                                                                       
Query: 31  aggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccagg 90
           |||||||||| || || |||||||| ||||| |||||||| |||||||| ||| | ||||
Sbjct: 139 aggagctgggcaccgtgatgcgctctctgggccagaacccgacggaggccgagttgcagg 198

                                                                    
Query: 91  acatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||||||||| || |||||||| | ||| ||||||||||||| ||||||| ||||||
Sbjct: 199 acatgatcaacgaggtcgacgccgatggaaacggcaccattg-acttccccgagttc 254

---

>gb|M20729.1|CRECAM C.reinhardtii calmodulin gene, complete cds
          Length = 2230

 Score = 99.6 bits (50), Expect = 2e-18
 Identities = 91/105 (86%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||||||||| || ||||||||||||||||| |||||||| || ||||||||||| |
Sbjct: 734 ccaaggagctggggacggtcatgcgctcgctgggccagaaccccaccgaggctgagctgc 793

                                                        
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattg 132
           | ||||||||||  || || ||||| |  ||||||||||||||||
Sbjct: 794 aagacatgatcagcgaggtggacgccgacggcaacggcaccattg 838

---

>gb|M83535.1|PHTCALPIA P.infestans calmodulin (calA) gene, complete cds
          Length = 1358

 Score = 99.6 bits (50), Expect = 2e-18
 Identities = 91/105 (86%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||||| || || ||||||||||| ||||| |||||||| |||||||| ||||| |
Sbjct: 809 ccaaggagcttggcacggtcatgcgctctctgggccagaaccccacggaggccgagctgc 868

                                                        
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattg 132
           ||||||||||||| || ||||||||||  || |||||||| ||||
Sbjct: 869 aggacatgatcaacgaggtcgacgctgacggaaacggcacgattg 913

---

>gb|U10150.1|BNU10150 Brassica napus Naehan calmodulin (bcm1) mRNA, complete cds
          Length = 637

 Score = 99.6 bits (50), Expect = 2e-18
 Identities = 91/105 (86%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||||||||||| || ||||| || || || ||||| ||||| || ||||||||||
Sbjct: 164 ccaaggagctgggaactgtgatgcgttctctcggacagaatccaaccgaagctgagctcc 223

                                                        
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattg 132
           | ||||||||||||||||| |||||||  || |||||||||||||
Sbjct: 224 aagacatgatcaatgaagttgacgctgacggtaacggcaccattg 268

---

>gb|BC054805.1| Mus musculus calmodulin 1, mRNA (cDNA clone MGC:64720
           IMAGE:6838207), complete cds
          Length = 4021

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 103/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||| ||||| || |||||||| || ||||| ||||||||||| || || ||||| |
Sbjct: 262 ccaaggaactggggaccgtcatgcggtcactgggtcagaacccaacagaagccgagctgc 321

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||| |||||||| ||||| || |||| |||||| |||||||||| ||||||||||||||
Sbjct: 322 aggatatgatcaacgaagtggatgctgatggcaatggcaccattg-acttcccagagttc 380

---

>emb|CR715454.1|CNS0GEZU Tetraodon nigroviridis full-length cDNA
          Length = 661

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 103/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||| |||||||| ||||||||| | |||||||| |||||||| || ||||| ||||| |
Sbjct: 204 ccaaagagctgggcacagtcatgaggtcgctgggccagaacccgacagaggcggagctgc 263

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           ||||||||||||| || || ||||||| ||| ||||| ||||| | ||||||||||||||
Sbjct: 264 aggacatgatcaacgaggtggacgctgatggtaacggaaccatcg-acttcccagagttc 322

---

>emb|X85091.1|MPCAM M.pyrifera mRNA for calmodulin
          Length = 1519

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 103/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||||||||| || || ||||||||| |||| |||||||| || ||||| ||||| |
Sbjct: 783 ccaaggagctgggcactgtgatgcgctcgttgggccagaacccgactgaggccgagctgc 842

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           ||||||||||||| || || |||||||  |||||||||||||| | ||||||| ||||||
Sbjct: 843 aggacatgatcaacgaggttgacgctgacggcaacggcaccatcg-acttcccggagttc 901

---

>emb|X61432.1|MMCALMOD M.musculus mRNA for calmodulin
          Length = 1361

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 103/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||| ||||| || |||||||| || ||||| ||||||||||| || || ||||| |
Sbjct: 115 ccaaggaactggggaccgtcatgcggtcactgggtcagaacccaacagaagccgagctgc 174

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||| |||||||| ||||| || |||| |||||| |||||||||| ||||||||||||||
Sbjct: 175 aggatatgatcaacgaagtggatgctgatggcaatggcaccattg-acttcccagagttc 233

---

>dbj|AK151001.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830019P05 product:calmodulin 1,
           full insert sequence
          Length = 698

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 103/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||| ||||| || |||||||| || ||||| ||||||||||| || || ||||| |
Sbjct: 272 ccaaggaactggggaccgtcatgcggtcactgggtcagaacccaacagaagccgagctgc 331

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||| |||||||| ||||| || |||| |||||| |||||||||| ||||||||||||||
Sbjct: 332 aggatatgatcaacgaagtggatgctgatggcaatggcaccattg-acttcccagagttc 390

---

>dbj|AK150978.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830019A03 product:calmodulin 1,
           full insert sequence
          Length = 1521

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 103/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||| ||||| || |||||||| || ||||| ||||||||||| || || ||||| |
Sbjct: 277 ccaaggaactggggaccgtcatgcggtcactgggtcagaacccaacagaagccgagctgc 336

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||| |||||||| ||||| || |||| |||||| |||||||||| ||||||||||||||
Sbjct: 337 aggatatgatcaacgaagtggatgctgatggcaatggcaccattg-acttcccagagttc 395

---

>dbj|AK151992.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830044L06 product:calmodulin 1,
           full insert sequence
          Length = 1521

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 103/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||| ||||| || |||||||| || ||||| ||||||||||| || || ||||| |
Sbjct: 277 ccaaggaactggggaccgtcatgcggtcactgggtcagaacccaacagaagccgagctgc 336

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||| |||||||| ||||| || |||| |||||| |||||||||| ||||||||||||||
Sbjct: 337 aggatatgatcaacgaagtggatgctgatggcaatggcaccattg-acttcccagagttc 395

---

>dbj|AK151923.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830043F10 product:calmodulin 1,
           full insert sequence
          Length = 1519

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 103/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||| ||||| || |||||||| || ||||| ||||||||||| || || ||||| |
Sbjct: 275 ccaaggaactggggaccgtcatgcggtcactgggtcagaacccaacagaagccgagctgc 334

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||| |||||||| ||||| || |||| |||||| |||||||||| ||||||||||||||
Sbjct: 335 aggatatgatcaacgaagtggatgctgatggcaatggcaccattg-acttcccagagttc 393

---

>dbj|AK153004.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830111O22 product:calmodulin 1,
           full insert sequence
          Length = 1515

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 103/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||| ||||| || |||||||| || ||||| ||||||||||| || || ||||| |
Sbjct: 271 ccaaggaactggggaccgtcatgcggtcactgggtcagaacccaacagaagccgagctgc 330

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||| |||||||| ||||| || |||| |||||| |||||||||| ||||||||||||||
Sbjct: 331 aggatatgatcaacgaagtggatgctgatggcaatggcaccattg-acttcccagagttc 389

---

>dbj|AK151784.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830037H11 product:calmodulin 1,
           full insert sequence
          Length = 703

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 103/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||| ||||| || |||||||| || ||||| ||||||||||| || || ||||| |
Sbjct: 277 ccaaggaactggggaccgtcatgcggtcactgggtcagaacccaacagaagccgagctgc 336

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||| |||||||| ||||| || |||| |||||| |||||||||| ||||||||||||||
Sbjct: 337 aggatatgatcaacgaagtggatgctgatggcaatggcaccattg-acttcccagagttc 395

---

>dbj|AK145841.1| Mus musculus 12 days pregnant adult female placenta cDNA, RIKEN
           full-length enriched library, clone:I530005B05
           product:calmodulin 1, full insert sequence
          Length = 1493

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 103/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||| ||||| || |||||||| || ||||| ||||||||||| || || ||||| |
Sbjct: 249 ccaaggaactggggaccgtcatgcggtcactgggtcagaacccaacagaagccgagctgc 308

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||| |||||||| ||||| || |||| |||||| |||||||||| ||||||||||||||
Sbjct: 309 aggatatgatcaacgaagtggatgctgatggcaatggcaccattg-acttcccagagttc 367

---

>dbj|AK152897.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830089K04 product:calmodulin 1,
           full insert sequence
          Length = 1515

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 103/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||| ||||| || |||||||| || ||||| ||||||||||| || || ||||| |
Sbjct: 272 ccaaggaactggggaccgtcatgcggtcactgggtcagaacccaacagaagccgagctgc 331

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||| |||||||| ||||| || |||| |||||| |||||||||| ||||||||||||||
Sbjct: 332 aggatatgatcaacgaagtggatgctgatggcaatggcaccattg-acttcccagagttc 390

---

>dbj|AK152850.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830087J19 product:calmodulin 1,
           full insert sequence
          Length = 1517

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 103/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||| ||||| || |||||||| || ||||| ||||||||||| || || ||||| |
Sbjct: 275 ccaaggaactggggaccgtcatgcggtcactgggtcagaacccaacagaagccgagctgc 334

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||| |||||||| ||||| || |||| |||||| |||||||||| ||||||||||||||
Sbjct: 335 aggatatgatcaacgaagtggatgctgatggcaatggcaccattg-acttcccagagttc 393

---

>dbj|AK152719.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830083B20 product:calmodulin 1,
           full insert sequence
          Length = 1516

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 103/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||| ||||| || |||||||| || ||||| ||||||||||| || || ||||| |
Sbjct: 272 ccaaggaactggggaccgtcatgcggtcactgggtcagaacccaacagaagccgagctgc 331

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||| |||||||| ||||| || |||| |||||| |||||||||| ||||||||||||||
Sbjct: 332 aggatatgatcaacgaagtggatgctgatggcaatggcaccattg-acttcccagagttc 390

---

>dbj|AK152715.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830083B06 product:calmodulin 1,
           full insert sequence
          Length = 1515

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 103/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||| ||||| || |||||||| || ||||| ||||||||||| || || ||||| |
Sbjct: 271 ccaaggaactggggaccgtcatgcggtcactgggtcagaacccaacagaagccgagctgc 330

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||| |||||||| ||||| || |||| |||||| |||||||||| ||||||||||||||
Sbjct: 331 aggatatgatcaacgaagtggatgctgatggcaatggcaccattg-acttcccagagttc 389

---

>dbj|AK151552.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830031K10 product:calmodulin 1,
           full insert sequence
          Length = 1516

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 103/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||| ||||| || |||||||| || ||||| ||||||||||| || || ||||| |
Sbjct: 272 ccaaggaactggggaccgtcatgcggtcactgggtcagaacccaacagaagccgagctgc 331

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||| |||||||| ||||| || |||| |||||| |||||||||| ||||||||||||||
Sbjct: 332 aggatatgatcaacgaagtggatgctgatggcaatggcaccattg-acttcccagagttc 390

---

>dbj|AK161302.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:4922505K07 product:calmodulin 1, full
           insert sequence
          Length = 1476

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 103/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||| ||||| || |||||||| || ||||| ||||||||||| || || ||||| |
Sbjct: 233 ccaaggaactggggaccgtcatgcggtcactgggtcagaacccaacagaagccgagctgc 292

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||| |||||||| ||||| || |||| |||||| |||||||||| ||||||||||||||
Sbjct: 293 aggatatgatcaacgaagtggatgctgatggcaatggcaccattg-acttcccagagttc 351

---

>dbj|AK153546.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830174G14 product:calmodulin 1,
           full insert sequence
          Length = 1519

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 103/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||| ||||| || |||||||| || ||||| ||||||||||| || || ||||| |
Sbjct: 275 ccaaggaactggggaccgtcatgcggtcactgggtcagaacccaacagaagccgagctgc 334

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||| |||||||| ||||| || |||| |||||| |||||||||| ||||||||||||||
Sbjct: 335 aggatatgatcaacgaagtggatgctgatggcaatggcaccattg-acttcccagagttc 393

---

>dbj|AK162314.1| Mus musculus adult male colon cDNA, RIKEN full-length enriched
           library, clone:9030622O18 product:calmodulin 1, full
           insert sequence
          Length = 1523

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 103/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||| ||||| || |||||||| || ||||| ||||||||||| || || ||||| |
Sbjct: 279 ccaaggaactggggaccgtcatgcggtcactgggtcagaacccaacagaagccgagctgc 338

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||| |||||||| ||||| || |||| |||||| |||||||||| ||||||||||||||
Sbjct: 339 aggatatgatcaacgaagtggatgctgatggcaatggcaccattg-acttcccagagttc 397

---

>dbj|AK153426.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830160B06 product:calmodulin 1,
           full insert sequence
          Length = 1519

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 103/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||| ||||| || |||||||| || ||||| ||||||||||| || || ||||| |
Sbjct: 275 ccaaggaactggggaccgtcatgcggtcactgggtcagaacccaacagaagccgagctgc 334

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||| |||||||| ||||| || |||| |||||| |||||||||| ||||||||||||||
Sbjct: 335 aggatatgatcaacgaagtggatgctgatggcaatggcaccattg-acttcccagagttc 393

---

>dbj|AK153348.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830144G06 product:calmodulin 1,
           full insert sequence
          Length = 1519

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 103/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||| ||||| || |||||||| || ||||| ||||||||||| || || ||||| |
Sbjct: 275 ccaaggaactggggaccgtcatgcggtcactgggtcagaacccaacagaagccgagctgc 334

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||| |||||||| ||||| || |||| |||||| |||||||||| ||||||||||||||
Sbjct: 335 aggatatgatcaacgaagtggatgctgatggcaatggcaccattg-acttcccagagttc 393

---

>dbj|AK165568.1| Mus musculus nullipotent stem cell CRL-2070 NE cDNA, RIKEN
           full-length enriched library, clone:G430009L06
           product:calmodulin 2, full insert sequence
          Length = 2142

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 103/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||||||||| || || ||| | ||||||||||||||||| || ||||| ||||| |
Sbjct: 215 ccaaggagctggggactgtgatgagatcgctggggcagaaccccactgaggcggagctgc 274

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||||||||| ||||| || || |||| |||||| || ||||||| ||||||||||||||
Sbjct: 275 aggacatgattaatgaggtggatgctgatggcaatgggaccattg-acttcccagagttc 333

---

>dbj|AK152148.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830050J16 product:calmodulin 1,
           full insert sequence
          Length = 1519

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 103/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||| ||||| || |||||||| || ||||| ||||||||||| || || ||||| |
Sbjct: 275 ccaaggaactggggaccgtcatgcggtcactgggtcagaacccaacagaagccgagctgc 334

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||| |||||||| ||||| || |||| |||||| |||||||||| ||||||||||||||
Sbjct: 335 aggatatgatcaacgaagtggatgctgatggcaatggcaccattg-acttcccagagttc 393

---

>dbj|AK150288.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830001J10 product:calmodulin 1,
           full insert sequence
          Length = 698

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 103/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||| ||||| || |||||||| || ||||| ||||||||||| || || ||||| |
Sbjct: 272 ccaaggaactggggaccgtcatgcggtcactgggtcagaacccaacagaagccgagctgc 331

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||| |||||||| ||||| || |||| |||||| |||||||||| ||||||||||||||
Sbjct: 332 aggatatgatcaacgaagtggatgctgatggcaatggcaccattg-acttcccagagttc 390

---

>dbj|AK160057.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched
           library, clone:I420047D09 product:calmodulin 1, full
           insert sequence
          Length = 1523

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 103/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||| ||||| || |||||||| || ||||| ||||||||||| || || ||||| |
Sbjct: 278 ccaaggaactggggaccgtcatgcggtcactgggtcagaacccaacagaagccgagctgc 337

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||| |||||||| ||||| || |||| |||||| |||||||||| ||||||||||||||
Sbjct: 338 aggatatgatcaacgaagtggatgctgatggcaatggcaccattg-acttcccagagttc 396

---

>dbj|AK168803.1| Mus musculus 16 days embryo kidney cDNA, RIKEN full-length enriched
           library, clone:I920055O09 product:calmodulin 1, full
           insert sequence
          Length = 1519

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 103/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||| ||||| || |||||||| || ||||| ||||||||||| || || ||||| |
Sbjct: 275 ccaaggaactggggaccgtcatgcggtcactgggtcagaacccaacagaagccgagctgc 334

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||| |||||||| ||||| || |||| |||||| |||||||||| ||||||||||||||
Sbjct: 335 aggatatgatcaacgaagtggatgctgatggcaatggcaccattg-acttcccagagttc 393

---

>dbj|AK168663.1| Mus musculus 17 days pregnant adult female amnion cDNA, RIKEN
           full-length enriched library, clone:I920042L23
           product:calmodulin 1, full insert sequence
          Length = 1514

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 103/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||| ||||| || |||||||| || ||||| ||||||||||| || || ||||| |
Sbjct: 271 ccaaggaactggggaccgtcatgcggtcactgggtcagaacccaacagaagccgagctgc 330

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||| |||||||| ||||| || |||| |||||| |||||||||| ||||||||||||||
Sbjct: 331 aggatatgatcaacgaagtggatgctgatggcaatggcaccattg-acttcccagagttc 389

---

>dbj|AK159762.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched
           library, clone:I420030G23 product:calmodulin 1, full
           insert sequence
          Length = 1523

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 103/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||| ||||| || |||||||| || ||||| ||||||||||| || || ||||| |
Sbjct: 278 ccaaggaactggggaccgtcatgcggtcactgggtcagaacccaacagaagccgagctgc 337

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||| |||||||| ||||| || |||| |||||| |||||||||| ||||||||||||||
Sbjct: 338 aggatatgatcaacgaagtggatgctgatggcaatggcaccattg-acttcccagagttc 396

---

>dbj|AK167353.1| Mus musculus 13 days pregnant adult female placenta cDNA, RIKEN
           full-length enriched library, clone:I530008D05
           product:calmodulin 1, full insert sequence
          Length = 1521

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 103/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||| ||||| || |||||||| || ||||| ||||||||||| || || ||||| |
Sbjct: 277 ccaaggaactggggaccgtcatgcggtcactgggtcagaacccaacagaagccgagctgc 336

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||| |||||||| ||||| || |||| |||||| |||||||||| ||||||||||||||
Sbjct: 337 aggatatgatcaacgaagtggatgctgatggcaatggcaccattg-acttcccagagttc 395

---

>dbj|AK166308.1| Mus musculus mammary gland RCB-0526 Jyg-MC(A) cDNA, RIKEN
           full-length enriched library, clone:G830034G02
           product:calmodulin 1, full insert sequence
          Length = 1516

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 103/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||| ||||| || |||||||| || ||||| ||||||||||| || || ||||| |
Sbjct: 272 ccaaggaactggggaccgtcatgcggtcactgggtcagaacccaacagaagccgagctgc 331

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||| |||||||| ||||| || |||| |||||| |||||||||| ||||||||||||||
Sbjct: 332 aggatatgatcaacgaagtggatgctgatggcaatggcaccattg-acttcccagagttc 390

---

>dbj|AK160508.1| Mus musculus adult male tongue cDNA, RIKEN full-length enriched
           library, clone:2310026B11 product:calmodulin 1, full
           insert sequence
          Length = 1517

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 103/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||| ||||| || |||||||| || ||||| ||||||||||| || || ||||| |
Sbjct: 277 ccaaggaactggggaccgtcatgcggtcactgggtcagaacccaacagaagccgagctgc 336

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||| |||||||| ||||| || |||| |||||| |||||||||| ||||||||||||||
Sbjct: 337 aggatatgatcaacgaagtggatgctgatggcaatggcaccattg-acttcccagagttc 395

---

>dbj|AK168002.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-length enriched
           library, clone:I730046I02 product:calmodulin 1, full
           insert sequence
          Length = 1518

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 103/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||| ||||| || |||||||| || ||||| ||||||||||| || || ||||| |
Sbjct: 275 ccaaggaactggggaccgtcatgcggtcactgggtcagaacccaacagaagccgagctgc 334

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||| |||||||| ||||| || |||| |||||| |||||||||| ||||||||||||||
Sbjct: 335 aggatatgatcaacgaagtggatgctgatggcaatggcaccattg-acttcccagagttc 393

---

>dbj|AK169055.1| Mus musculus 17 days embryo stomach cDNA, RIKEN full-length
           enriched library, clone:I920077G15 product:calmodulin 1,
           full insert sequence
          Length = 1520

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 103/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||| ||||| || |||||||| || ||||| ||||||||||| || || ||||| |
Sbjct: 275 ccaaggaactggggaccgtcatgcggtcactgggtcagaacccaacagaagccgagctgc 334

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||| |||||||| ||||| || |||| |||||| |||||||||| ||||||||||||||
Sbjct: 335 aggatatgatcaacgaagtggatgctgatggcaatggcaccattg-acttcccagagttc 393

---

>dbj|AK169027.1| Mus musculus 17 days pregnant adult female amnion cDNA, RIKEN
           full-length enriched library, clone:I920075L03
           product:calmodulin 1, full insert sequence
          Length = 1521

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 103/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||| ||||| || |||||||| || ||||| ||||||||||| || || ||||| |
Sbjct: 277 ccaaggaactggggaccgtcatgcggtcactgggtcagaacccaacagaagccgagctgc 336

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||| |||||||| ||||| || |||| |||||| |||||||||| ||||||||||||||
Sbjct: 337 aggatatgatcaacgaagtggatgctgatggcaatggcaccattg-acttcccagagttc 395

---

>dbj|AK013695.1| Mus musculus adult male hippocampus cDNA, RIKEN full-length
           enriched library, clone:2900055D23 product:calmodulin 1,
           full insert sequence
          Length = 697

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 103/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||| ||||| || |||||||| || ||||| ||||||||||| || || ||||| |
Sbjct: 271 ccaaggaactggggaccgtcatgcggtcactgggtcagaacccaacagaagccgagctgc 330

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||| |||||||| ||||| || |||| |||||| |||||||||| ||||||||||||||
Sbjct: 331 aggatatgatcaacgaagtggatgctgatggcaatggcaccattg-acttcccagagttc 389

---

>dbj|AK088141.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
           full-length enriched library, clone:E430004P19
           product:calmodulin 1, full insert sequence
          Length = 700

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 103/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||| ||||| || |||||||| || ||||| ||||||||||| || || ||||| |
Sbjct: 272 ccaaggaactggggaccgtcatgcggtcactgggtcagaacccaacagaagccgagctgc 331

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||| |||||||| ||||| || |||| |||||| |||||||||| ||||||||||||||
Sbjct: 332 aggatatgatcaacgaagtggatgctgatggcaatggcaccattg-acttcccagagttc 390

---

>ref|NM_009790.3| Mus musculus calmodulin 1 (Calm1), mRNA
          Length = 4021

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 103/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||| ||||| || |||||||| || ||||| ||||||||||| || || ||||| |
Sbjct: 262 ccaaggaactggggaccgtcatgcggtcactgggtcagaacccaacagaagccgagctgc 321

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||| |||||||| ||||| || |||| |||||| |||||||||| ||||||||||||||
Sbjct: 322 aggatatgatcaacgaagtggatgctgatggcaatggcaccattg-acttcccagagttc 380

---

>dbj|AK004673.1| Mus musculus adult male lung cDNA, RIKEN full-length enriched
           library, clone:1200009I03 product:calmodulin 1, full
           insert sequence
          Length = 1520

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 103/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||| ||||| || |||||||| || ||||| ||||||||||| || || ||||| |
Sbjct: 276 ccaaggaactggggaccgtcatgcggtcactgggtcagaacccaacagaagccgagctgc 335

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||| |||||||| ||||| || |||| |||||| |||||||||| ||||||||||||||
Sbjct: 336 aggatatgatcaacgaagtggatgctgatggcaatggcaccattg-acttcccagagttc 394

---

>dbj|AK062496.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-104-A02, full
           insert sequence
          Length = 740

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 87/100 (87%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||||| || || ||||||||||||||||| |||||||| |||||||| |||||||
Sbjct: 129 ccaaggagctcggcacggtcatgcgctcgctgggccagaaccccacggaggccgagctcc 188

                                                   
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcac 127
           ||||||||||||| || || || || |  |||||||||||
Sbjct: 189 aggacatgatcaacgaggtggatgccgacggcaacggcac 228

---

>gb|AY656699.1| Carassius auratus calmodulin short form mRNA, complete cds
          Length = 722

 Score = 95.6 bits (48), Expect = 3e-17
 Identities = 102/119 (85%), Gaps = 1/119 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||| |||||||| ||||| |||||||| || ||||||||||| |||||||||||||| |
Sbjct: 173 ccaaagagctgggcacagtgatgcgctcacttgggcagaaccccacggaggctgagctgc 232

                                                                      
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagtt 146
           ||||||||||||| || || || |||| ||| || || ||||||| |||| ||||||||
Sbjct: 233 aggacatgatcaacgaggtggatgctgatggtaatggaaccattg-actttccagagtt 290

---

>gb|DQ226765.1| Boechera divaricarpa isolate SLW-D-B04 mRNA sequence
          Length = 736

 Score = 95.6 bits (48), Expect = 3e-17
 Identities = 89/103 (86%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||| |||||||| ||||| ||||| ||||| ||||| |||||||| |||||||||||||
Sbjct: 149 ccaaagagctgggtacagttatgcgttcgctagggcaaaacccaacagaggctgagctcc 208

                                                      
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccat 130
           | |||||||||||||| || || || | ||| |||||||||||
Sbjct: 209 aagacatgatcaatgaggttgatgcagatggaaacggcaccat 251

---

>gb|AY517931.1| Arachis hypogaea calmodulin (CaM2) mRNA, complete cds
          Length = 447

 Score = 95.6 bits (48), Expect = 3e-17
 Identities = 102/119 (85%), Gaps = 1/119 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||||| ||| | || | ||| ||||| || ||||||||||| ||||| |||||||
Sbjct: 89  ccaaggagcttggagctgttacgcggtcgctaggacagaacccaaccgaggcagagctcc 148

                                                                      
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagtt 146
           | ||||||||||||||||| || || | ||||||||||||||||| ||||||| |||||
Sbjct: 149 aagacatgatcaatgaagtagatgccgatggcaacggcaccattg-acttccccgagtt 206

---

>gb|AF466266.1| Sonneratia paracaseolaris calmodulin gene, complete cds
          Length = 1299

 Score = 95.6 bits (48), Expect = 3e-17
 Identities = 69/76 (90%)
 Strand = Plus / Plus

                                                                        
Query: 28   ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
            |||||||||| ||||| || ||||| || ||||||||||||||||||||||| ||||| |
Sbjct: 935  ccaaggagcttggaactgttatgcggtcactggggcagaacccaacggaggcagagcttc 994

                            
Query: 88   aggacatgatcaatga 103
            ||||||||||||||||
Sbjct: 995  aggacatgatcaatga 1010

---

>emb|X60738.1|MDCAMR M.domestica CaM mRNA for calmodulin
          Length = 665

 Score = 95.6 bits (48), Expect = 3e-17
 Identities = 68/75 (90%)
 Strand = Plus / Plus

                                                                       
Query: 58  tggggcagaacccaacggaggctgagctccaggacatgatcaatgaagtcgacgctgntg 117
           ||||||||||||| || ||||||||||||||||||||||||||||||||||| |||| ||
Sbjct: 167 tggggcagaacccgactgaggctgagctccaggacatgatcaatgaagtcgatgctgatg 226

                          
Query: 118 gcaacggcaccattg 132
           | || || |||||||
Sbjct: 227 gtaatgggaccattg 241

---

>emb|X60737.1|MDCAMG M.domestica CaM gene for calmodulin
          Length = 2458

 Score = 95.6 bits (48), Expect = 3e-17
 Identities = 68/75 (90%)
 Strand = Plus / Plus

                                                                        
Query: 58   tggggcagaacccaacggaggctgagctccaggacatgatcaatgaagtcgacgctgntg 117
            ||||||||||||| || ||||||||||||||||||||||||||||||||||| |||| ||
Sbjct: 1960 tggggcagaacccgactgaggctgagctccaggacatgatcaatgaagtcgatgctgatg 2019

                           
Query: 118  gcaacggcaccattg 132
            | || || |||||||
Sbjct: 2020 gtaatgggaccattg 2034

---

>gb|AY281363.1| Epinephelus akaara calmodulin (CAL1) mRNA, complete cds
          Length = 582

 Score = 95.6 bits (48), Expect = 3e-17
 Identities = 89/103 (86%)
 Strand = Plus / Plus

                                                                       
Query: 30  aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
           ||||||||||| || |||||| | || ||||| || |||||||| |||||||| || |||
Sbjct: 165 aaggagctgggcactgtcatgaggtcactgggtcaaaacccaactgaggctgaactacag 224

                                                      
Query: 90  gacatgatcaatgaagtcgacgctgntggcaacggcaccattg 132
           |||||||||||||| || ||||||| ||||||||| |||||||
Sbjct: 225 gacatgatcaatgaggtggacgctgatggcaacgggaccattg 267

---

>dbj|AK168241.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-length enriched
           library, clone:I730070I07 product:calmodulin 1, full
           insert sequence
          Length = 1474

 Score = 95.6 bits (48), Expect = 3e-17
 Identities = 102/119 (85%), Gaps = 1/119 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||| ||||| || |||||||| || ||||| ||||||||||| || || ||||| |
Sbjct: 231 ccaaggaactggggaccgtcatgcggtcactgggtcagaacccaacagaagccgagctgc 290

                                                                      
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagtt 146
           |||| |||||||| ||||| || |||| |||||| |||||||||| |||||||||||||
Sbjct: 291 aggatatgatcaacgaagtggatgctgatggcaatggcaccattg-acttcccagagtt 348

---

>gb|AC136471.1| Solanum demissum chromosome 11 BAC PGEC561 genomic sequence, complete
             sequence
          Length = 123428

 Score = 93.7 bits (47), Expect = 1e-16
 Identities = 101/118 (85%), Gaps = 1/118 (0%)
 Strand = Plus / Minus

                                                                         
Query: 30    aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
             |||||||| ||||| || ||||| ||  |||||||||||||||| ||||||||||| || 
Sbjct: 52520 aaggagcttggaaccgtgatgcggtcattggggcagaacccaactgaggctgagcttcaa 52461

                                                                       
Query: 90    gacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
             ||||||||||||||||| || |||| ||| || || ||||||| ||||||| ||||||
Sbjct: 52460 gacatgatcaatgaagttgatgctgatgggaatgggaccattg-acttccctgagttc 52404

---

>ref|NM_182967.1| Danio rerio calmodulin 3a (phosphorylase kinase, delta) (calm3a),
           mRNA
          Length = 2180

 Score = 93.7 bits (47), Expect = 1e-16
 Identities = 82/94 (87%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||||||||| ||||| ||||||||  |||| |||||||| || || |||||||| |
Sbjct: 201 ccaaggagctgggcacagtgatgcgctcattgggtcagaacccgactgaagctgagctgc 260

                                             
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaa 121
           ||||||||||||| || |||||||||| ||||||
Sbjct: 261 aggacatgatcaacgaggtcgacgctgatggcaa 294

---

>gb|BT013612.1| Lycopersicon esculentum clone 132384F, mRNA sequence
          Length = 826

 Score = 93.7 bits (47), Expect = 1e-16
 Identities = 101/118 (85%), Gaps = 1/118 (0%)
 Strand = Plus / Plus

                                                                       
Query: 30  aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
           ||||| || |||||||| ||||| ||  |||||||||||||||| ||||||||||| || 
Sbjct: 164 aaggaacttggaacagtaatgcggtcattggggcagaacccaaccgaggctgagcttcaa 223

                                                                     
Query: 90  gacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           ||||||||||||||||| || |||| ||| || || ||||||| | ||||||||||||
Sbjct: 224 gacatgatcaatgaagttgatgctgatggaaatgggaccattg-atttcccagagttc 280

---

>emb|AJ005040.1|NPAJ5040 Nicotiana plumbaginifolia mRNA for calmodulin-2, partial
          Length = 723

 Score = 93.7 bits (47), Expect = 1e-16
 Identities = 101/118 (85%), Gaps = 1/118 (0%)
 Strand = Plus / Plus

                                                                       
Query: 30  aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
           |||||||| ||||| || ||||| ||  |||||||||||||||| ||||||||||| || 
Sbjct: 12  aaggagcttggaactgtaatgcggtcattggggcagaacccaaccgaggctgagcttcaa 71

                                                                     
Query: 90  gacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           ||||||||||||||||| || |||| ||| || || ||||||| | ||||||||||||
Sbjct: 72  gacatgatcaatgaagttgatgctgatgggaatgggaccattg-atttcccagagttc 128

---

>gb|AF085250.1|AF085250 Perca flavescens calmodulin (CAL1) mRNA, complete cds
          Length = 1644

 Score = 93.7 bits (47), Expect = 1e-16
 Identities = 101/118 (85%), Gaps = 1/118 (0%)
 Strand = Plus / Plus

                                                                       
Query: 30  aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
           ||||||||||| || |||||| | || ||||| || |||||||| ||||| |||||||||
Sbjct: 130 aaggagctgggcactgtcatgaggtcactgggtcaaaacccaactgaggccgagctccag 189

                                                                     
Query: 90  gacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||||||||||||| || ||||| | ||||||||| || |||| ||||||| ||||||
Sbjct: 190 gacatgatcaatgaggtggacgcagatggcaacgggacaattg-acttccctgagttc 246

---

>gb|BC045298.1| Danio rerio calmodulin 2, gamma, mRNA (cDNA clone MGC:55296
           IMAGE:2600247), complete cds
          Length = 2180

 Score = 93.7 bits (47), Expect = 1e-16
 Identities = 82/94 (87%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||||||||| ||||| ||||||||  |||| |||||||| || || |||||||| |
Sbjct: 201 ccaaggagctgggcacagtgatgcgctcattgggtcagaacccgactgaagctgagctgc 260

                                             
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaa 121
           ||||||||||||| || |||||||||| ||||||
Sbjct: 261 aggacatgatcaacgaggtcgacgctgatggcaa 294

---

>gb|U48688.1|TAU48688 Triticum aestivum calmodulin TaCaM1-2 mRNA, complete cds
          Length = 796

 Score = 93.7 bits (47), Expect = 1e-16
 Identities = 82/94 (87%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||| || ||||| || ||||||||||||||||||||||| || ||||| ||||| |
Sbjct: 217 ccaaggaacttggaactgtgatgcgctcgctggggcagaaccccactgaggcagagcttc 276

                                             
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaa 121
           |||| |||||||||||||| || |||| ||||||
Sbjct: 277 aggatatgatcaatgaagtggatgctgatggcaa 310

---

>gb|U48242.1|TAU48242 Triticum aestivum calmodulin TaCaM1-1 mRNA, complete cds
          Length = 816

 Score = 93.7 bits (47), Expect = 1e-16
 Identities = 82/94 (87%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||| || ||||| || ||||||||||||||||||||||| || ||||| ||||| |
Sbjct: 213 ccaaggaacttggaactgtgatgcgctcgctggggcagaaccccactgaggcagagcttc 272

                                             
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaa 121
           |||| |||||||||||||| || |||| ||||||
Sbjct: 273 aggatatgatcaatgaagtggatgctgatggcaa 306

---

>gb|BC071404.1| Danio rerio calmodulin 2, gamma, mRNA (cDNA clone MGC:86728
           IMAGE:6897628), complete cds
          Length = 787

 Score = 93.7 bits (47), Expect = 1e-16
 Identities = 82/94 (87%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||||||||| ||||| ||||||||  |||| |||||||| || || |||||||| |
Sbjct: 227 ccaaggagctgggcacagtgatgcgctcattgggtcagaacccgactgaagctgagctgc 286

                                             
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaa 121
           ||||||||||||| || |||||||||| ||||||
Sbjct: 287 aggacatgatcaacgaggtcgacgctgatggcaa 320

---

>gb|L01430.1|SOYSCAM1X Soybean calmodulin (SCaM-1) mRNA, complete cds
          Length = 795

 Score = 93.7 bits (47), Expect = 1e-16
 Identities = 101/118 (85%), Gaps = 1/118 (0%)
 Strand = Plus / Plus

                                                                       
Query: 30  aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
           |||||||| || || || ||||| ||| |||| ||||| ||||| |||||||||||||| 
Sbjct: 169 aaggagcttgggactgttatgcgttcgttgggtcagaatccaacagaggctgagctccaa 228

                                                                     
Query: 90  gacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           ||||||||||||||||| || |||| ||| || |||||||||| ||||||| ||||||
Sbjct: 229 gacatgatcaatgaagtagatgctgatgggaatggcaccattg-acttccctgagttc 285

---

>gb|BC053150.1| Danio rerio zgc:63926, mRNA (cDNA clone MGC:63926 IMAGE:6790866),
           complete cds
          Length = 1597

 Score = 91.7 bits (46), Expect = 5e-16
 Identities = 90/105 (85%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||||||||| ||||| ||||||||||| || |||||||| || || ||||| ||||
Sbjct: 155 ccaaggagctgggcacagtgatgcgctcgctcggacagaaccccacagaagctgaactcc 214

                                                        
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattg 132
           |||||||||| || || || ||||||| ||| ||||| |||||||
Sbjct: 215 aggacatgataaacgaggtggacgctgatggtaacggaaccattg 259

---

>gb|BC097062.1| Danio rerio zgc:63926, mRNA (cDNA clone MGC:113986 IMAGE:7075025),
           complete cds
          Length = 589

 Score = 91.7 bits (46), Expect = 5e-16
 Identities = 90/105 (85%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||||||||| ||||| ||||||||||| || |||||||| || || ||||| ||||
Sbjct: 177 ccaaggagctgggcacagtgatgcgctcgctcggacagaaccccacagaagctgaactcc 236

                                                        
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattg 132
           |||||||||| || || || ||||||| ||| ||||| |||||||
Sbjct: 237 aggacatgataaacgaggtggacgctgatggtaacggaaccattg 281

---

>ref|NM_213351.1| Danio rerio zgc:63926 (zgc:63926), mRNA
          Length = 1597

 Score = 91.7 bits (46), Expect = 5e-16
 Identities = 90/105 (85%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||||||||| ||||| ||||||||||| || |||||||| || || ||||| ||||
Sbjct: 155 ccaaggagctgggcacagtgatgcgctcgctcggacagaaccccacagaagctgaactcc 214

                                                        
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattg 132
           |||||||||| || || || ||||||| ||| ||||| |||||||
Sbjct: 215 aggacatgataaacgaggtggacgctgatggtaacggaaccattg 259

---

>gb|AY741753.1| Penicillium fellutanum strain NRRL 746 calmodulin gene, partial cds
          Length = 704

 Score = 91.7 bits (46), Expect = 5e-16
 Identities = 90/105 (85%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||||| || || |||||||||||||| || ||||||||  | ||| ||||||| |
Sbjct: 197 ccaaggagcttggcactgtcatgcgctcgcttggccagaacccctccgagtctgagctgc 256

                                                        
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattg 132
           ||||||||||||| ||||||||||| | |  ||||||||||||||
Sbjct: 257 aggacatgatcaacgaagtcgacgccgataacaacggcaccattg 301

---

>gb|AY741751.1| Penicillium fellutanum strain NRRL 3760 calmodulin gene, partial
           cds
          Length = 704

 Score = 91.7 bits (46), Expect = 5e-16
 Identities = 90/105 (85%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||||| || || |||||||||||||| || ||||||||  | ||| ||||||| |
Sbjct: 197 ccaaggagcttggcactgtcatgcgctcgcttggccagaacccctccgagtctgagctgc 256

                                                        
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattg 132
           ||||||||||||| ||||||||||| | |  ||||||||||||||
Sbjct: 257 aggacatgatcaacgaagtcgacgccgataacaacggcaccattg 301

---

>gb|AY741731.1| Penicillium fellutanum strain NRRL 29654 calmodulin gene, partial
           cds
          Length = 704

 Score = 91.7 bits (46), Expect = 5e-16
 Identities = 90/105 (85%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||||| || || |||||||||||||| || ||||||||  | ||| ||||||| |
Sbjct: 197 ccaaggagcttggcactgtcatgcgctcgcttggccagaacccctccgagtctgagctgc 256

                                                        
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattg 132
           ||||||||||||| ||||||||||| | |  ||||||||||||||
Sbjct: 257 aggacatgatcaacgaagtcgacgccgataacaacggcaccattg 301

---

>gb|AY741730.1| Penicillium fellutanum strain NRRL 25658 calmodulin gene, partial
           cds
          Length = 704

 Score = 91.7 bits (46), Expect = 5e-16
 Identities = 90/105 (85%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||||| || || |||||||||||||| || ||||||||  | ||| ||||||| |
Sbjct: 197 ccaaggagcttggcactgtcatgcgctcgcttggccagaacccctccgagtctgagctgc 256

                                                        
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattg 132
           ||||||||||||| ||||||||||| | |  ||||||||||||||
Sbjct: 257 aggacatgatcaacgaagtcgacgccgataacaacggcaccattg 301

---

>ref|NM_012518.2| Rattus norvegicus calmodulin 3 (Calm3), mRNA
          Length = 1145

 Score = 89.7 bits (45), Expect = 2e-15
 Identities = 102/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||||||||| || || ||| | ||||||||||| ||||| || ||||| || || |
Sbjct: 194 ccaaggagctggggactgtgatgagatcgctggggcaaaaccccactgaggcggaactgc 253

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||||||||||||||| || || |||| |||||| || ||||||| ||||||||||||||
Sbjct: 254 aggacatgatcaatgaggtggatgctgatggcaatgggaccattg-acttcccagagttc 312

---

>gb|DQ186610.1| Catharanthus roseus calmodulin 2 mRNA, complete cds
          Length = 741

 Score = 89.7 bits (45), Expect = 2e-15
 Identities = 102/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||||| || ||||| ||| | || ||||| || ||||| || ||||||||||| |
Sbjct: 183 ccaaggagcttgggacagtgatgaggtcactgggacaaaaccctactgaggctgagcttc 242

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||| ||||||||||||||||| |||| |||||| || || |||| ||||||||||||||
Sbjct: 243 aggatatgatcaatgaagtcgatgctgatggcaatggaacaattg-acttcccagagttc 301

---

>emb|AJ291615.1|LRU291615 Lumbricus rubellus mRNA for calmodulin (calmodulin gene)
          Length = 1322

 Score = 89.7 bits (45), Expect = 2e-15
 Identities = 102/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||| |||||||| || ||| | ||||| || |||||||||||||||||||| || |
Sbjct: 165 ccaaggaactgggaacggtgatgaggtcgctaggtcagaacccaacggaggctgaacttc 224

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||| |||||||||||||| || |||| |||||| || ||||| | ||||||| ||||||
Sbjct: 225 aggatatgatcaatgaagttgatgctgatggcaatggaaccatcg-acttccctgagttc 283

---

>gb|BC063187.1| Rattus norvegicus calmodulin 3, mRNA (cDNA clone MGC:73021
           IMAGE:6890866), complete cds
          Length = 1145

 Score = 89.7 bits (45), Expect = 2e-15
 Identities = 102/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||||||||| || || ||| | ||||||||||| ||||| || ||||| || || |
Sbjct: 194 ccaaggagctggggactgtgatgagatcgctggggcaaaaccccactgaggcggaactgc 253

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||||||||||||||| || || |||| |||||| || ||||||| ||||||||||||||
Sbjct: 254 aggacatgatcaatgaggtggatgctgatggcaatgggaccattg-acttcccagagttc 312

---

>dbj|AK152754.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830083N02 product:calmodulin 3,
           full insert sequence
          Length = 727

 Score = 89.7 bits (45), Expect = 2e-15
 Identities = 102/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||||||||| || || ||| | |||||||| |||||||| || ||||| ||||| |
Sbjct: 227 ccaaggagctggggactgtgatgagatcgctgggacagaaccccactgaggcggagctgc 286

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||||||||| ||||| || || |||| |||||| || ||||||| ||||||||||||||
Sbjct: 287 aggacatgattaatgaggtggatgctgatggcaatgggaccattg-acttcccagagttc 345

---

>dbj|AK151610.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830032D08 product:calmodulin 2,
           full insert sequence
          Length = 2172

 Score = 89.7 bits (45), Expect = 2e-15
 Identities = 102/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||||||||| || || ||| | |||||||| |||||||| || ||||| ||||| |
Sbjct: 242 ccaaggagctggggactgtgatgagatcgctgggacagaaccccactgaggcggagctgc 301

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||||||||| ||||| || || |||| |||||| || ||||||| ||||||||||||||
Sbjct: 302 aggacatgattaatgaggtggatgctgatggcaatgggaccattg-acttcccagagttc 360

---

>dbj|AK153179.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830126L24 product:calmodulin 2,
           full insert sequence
          Length = 715

 Score = 89.7 bits (45), Expect = 2e-15
 Identities = 102/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||||||||| || || ||| | |||||||| |||||||| || ||||| ||||| |
Sbjct: 215 ccaaggagctggggactgtgatgagatcgctgggacagaaccccactgaggcggagctgc 274

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||||||||| ||||| || || |||| |||||| || ||||||| ||||||||||||||
Sbjct: 275 aggacatgattaatgaggtggatgctgatggcaatgggaccattg-acttcccagagttc 333

---

>dbj|AK169640.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
           full-length enriched library, clone:E430003L06
           product:calmodulin 1, full insert sequence
          Length = 1520

 Score = 89.7 bits (45), Expect = 2e-15
 Identities = 102/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||| ||||| || |||||||| || ||||| ||||||||||| || || ||||| |
Sbjct: 277 ccaaggaactggggaccgtcatgcggtcactgggtcagaacccaacagaagccgagctgc 336

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||| |||||||| | ||| || |||| |||||| |||||||||| ||||||||||||||
Sbjct: 337 aggatatgatcaacgtagtggatgctgatggcaatggcaccattg-acttcccagagttc 395

---

>gb|AY752882.1| Aegiceras corniculatum calmodulin mRNA, complete cds
          Length = 655

 Score = 89.7 bits (45), Expect = 2e-15
 Identities = 102/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||| ||||||||||| || ||| | ||| ||||||| |||||||| ||||| |||||||
Sbjct: 139 ccaaagagctgggaactgtgatgaggtcgttggggcaaaacccaactgaggcagagctcc 198

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||||||||||||||| || || |||| ||| || |||||||| | ||||||| ||||||
Sbjct: 199 aggacatgatcaatgaggtggatgctgatgggaatggcaccatag-acttccctgagttc 257

---

>ref|NM_007590.2| Mus musculus calmodulin 3 (Calm3), mRNA
          Length = 2155

 Score = 89.7 bits (45), Expect = 2e-15
 Identities = 102/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||||||||| || || ||| | |||||||| |||||||| || ||||| ||||| |
Sbjct: 200 ccaaggagctggggactgtgatgagatcgctgggacagaaccccactgaggcggagctgc 259

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||||||||| ||||| || || |||| |||||| || ||||||| ||||||||||||||
Sbjct: 260 aggacatgattaatgaggtggatgctgatggcaatgggaccattg-acttcccagagttc 318

---

>gb|BC050926.1| Mus musculus calmodulin 3, mRNA (cDNA clone MGC:61409
           IMAGE:6411878), complete cds
          Length = 2155

 Score = 89.7 bits (45), Expect = 2e-15
 Identities = 102/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||||||||| || || ||| | |||||||| |||||||| || ||||| ||||| |
Sbjct: 200 ccaaggagctggggactgtgatgagatcgctgggacagaaccccactgaggcggagctgc 259

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||||||||| ||||| || || |||| |||||| || ||||||| ||||||||||||||
Sbjct: 260 aggacatgattaatgaggtggatgctgatggcaatgggaccattg-acttcccagagttc 318

---

>emb|X13817.1|RSPRCM4 R.norvegicus mRNA for calmodulin
          Length = 691

 Score = 89.7 bits (45), Expect = 2e-15
 Identities = 102/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||||||||| || || ||| | ||||||||||| ||||| || ||||| || || |
Sbjct: 191 ccaaggagctggggactgtgatgagatcgctggggcaaaaccccactgaggcggaactgc 250

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||||||||||||||| || || |||| |||||| || ||||||| ||||||||||||||
Sbjct: 251 aggacatgatcaatgaggtggatgctgatggcaatgggaccattg-acttcccagagttc 309

---

>gb|M88307.1|BNACALM Brassica juncea calmodulin mRNA, complete cds
          Length = 834

 Score = 89.7 bits (45), Expect = 2e-15
 Identities = 86/100 (86%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||||||||||| || ||||| || || || ||||||||||| || || ||||| |
Sbjct: 136 ccaaggagctgggaactgtgatgcgttctctaggacagaacccaaccgaagcagagcttc 195

                                                   
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcac 127
           | ||||||||||||||||| ||||||| ||| ||||||||
Sbjct: 196 aagacatgatcaatgaagttgacgctgatggtaacggcac 235

---

>gb|M19381.1|MUSCALMDB Mouse calmodulin (Cam I) mRNA, complete cds
          Length = 798

 Score = 89.7 bits (45), Expect = 2e-15
 Identities = 102/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||| ||||| || |||||||| || || || ||||||||||| || || ||||| |
Sbjct: 275 ccaaggaactgggtaccgtcatgcgttcacttggtcagaacccaacagaagccgagctgc 334

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||| |||||||| ||||| || |||| |||||| |||||||||| ||||||||||||||
Sbjct: 335 aggatatgatcaacgaagtggatgctgatggcaatggcaccattg-acttcccagagttc 393

---

>gb|M19380.1|MUSCALMDA Mouse calmodulin (Cam III) mRNA, complete cds
          Length = 722

 Score = 89.7 bits (45), Expect = 2e-15
 Identities = 102/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||||||||| || || ||| | |||||||| |||||||| || ||||| ||||| |
Sbjct: 198 ccaaggagctggggactgtgatgagatcgctgggacagaaccccactgaggcggagctgc 257

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||||||||| ||||| || || |||| |||||| || ||||||| ||||||||||||||
Sbjct: 258 aggacatgattaatgaggtggatgctgatggcaatgggaccattg-acttcccagagttc 316

---

>gb|M16659.1|RATCAMB Rat calmodulin mRNA, complete cds, clone prCM79
          Length = 599

 Score = 89.7 bits (45), Expect = 2e-15
 Identities = 102/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||||||||| || || ||| | ||||||||||| ||||| || ||||| || || |
Sbjct: 99  ccaaggagctggggactgtgatgagatcgctggggcaaaaccccactgaggcggaactgc 158

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||||||||||||||| || || |||| |||||| || ||||||| ||||||||||||||
Sbjct: 159 aggacatgatcaatgaggtggatgctgatggcaatgggaccattg-acttcccagagttc 217

---

>gb|L01432.1|SOYSCAM3X Soybean calmodulin (SCaM-3) mRNA, complete cds
          Length = 856

 Score = 89.7 bits (45), Expect = 2e-15
 Identities = 102/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||||| ||||| || ||||| ||  ||||||| |||||||| ||||| || ||||
Sbjct: 129 ccaaggagcttggaactgttatgcgttcattggggcaaaacccaactgaggcagaactcc 188

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           ||||||||||||||||||| || |||| ||| || || ||||||| ||||||| ||||||
Sbjct: 189 aggacatgatcaatgaagtggatgctgatgggaatggtaccattg-acttccctgagttc 247

---

>dbj|D10364.1|ORZCAMB O. latipes (killifish) mRNA for calmodulin, partial sequence
          Length = 409

 Score = 89.7 bits (45), Expect = 2e-15
 Identities = 102/120 (85%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||| |||||||| ||||||||||| || ||||| |||||||| || ||||| ||||| |
Sbjct: 69  ccaaagagctgggtacagtcatgcggtctctgggccagaaccccacagaggcagagctgc 128

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||||||||||||||| || || |||| ||| ||||| || || | ||||||||||||||
Sbjct: 129 aggacatgatcaatgaggtggatgctgatggaaacggaacgatag-acttcccagagttc 187

---

>emb|BX927291.8| Zebrafish DNA sequence from clone CH211-261A10 in linkage group 15,
              complete sequence
          Length = 154479

 Score = 87.7 bits (44), Expect = 8e-15
 Identities = 79/91 (86%)
 Strand = Plus / Plus

                                                                          
Query: 28     ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
              ||||||||||||| ||||| ||||||||  |||| |||||||| || || |||||||| |
Sbjct: 124016 ccaaggagctgggcacagtgatgcgctcattgggtcagaacccgactgaagctgagctgc 124075

                                             
Query: 88     aggacatgatcaatgaagtcgacgctgntgg 118
              ||||||||||||| || |||||||||| |||
Sbjct: 124076 aggacatgatcaacgaggtcgacgctgatgg 124106

---

>gb|AY106452.1| Zea mays PCO074292 mRNA sequence
          Length = 929

 Score = 87.7 bits (44), Expect = 8e-15
 Identities = 88/103 (85%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||| || ||||| || ||||||||| ||||||||||||| || ||||||||||| |
Sbjct: 225 ccaaggaacttggaactgtgatgcgctcgttggggcagaaccctactgaggctgagcttc 284

                                                      
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccat 130
           ||||||||||||| || || || |||| |||||| || |||||
Sbjct: 285 aggacatgatcaacgaggttgatgctgatggcaatggaaccat 327

---

>gb|AY741728.1| Penicillium chermesinum strain NRRL 2048 calmodulin gene, partial
           cds
          Length = 705

 Score = 87.7 bits (44), Expect = 8e-15
 Identities = 88/103 (85%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||||||||| || ||||||||||| || || ||||||||  | ||| ||||||| |
Sbjct: 208 ccaaggagctgggcactgtcatgcgctctctcggccagaacccctccgagtctgagctgc 267

                                                      
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccat 130
           |||||||||||||||| || ||||||| |  ||||||||||||
Sbjct: 268 aggacatgatcaatgaggttgacgctgataacaacggcaccat 310

---

>dbj|AB063183.1| Metridium senile CaM gene for calmodulin, complete cds
          Length = 4513

 Score = 87.7 bits (44), Expect = 8e-15
 Identities = 79/91 (86%)
 Strand = Plus / Plus

                                                                        
Query: 28   ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
            |||| ||| |||||||||||||| | ||||| || |||||||| || ||||| |||||||
Sbjct: 3225 ccaaagagttgggaacagtcatgagatcgcttggacagaaccctacagaggccgagctcc 3284

                                           
Query: 88   aggacatgatcaatgaagtcgacgctgntgg 118
            ||||||||||||||||||| || |||| |||
Sbjct: 3285 aggacatgatcaatgaagttgatgctgatgg 3315

---

>dbj|AB063181.1| Metridium senile CaM mRNA for calmodulin, complete cds
          Length = 848

 Score = 87.7 bits (44), Expect = 8e-15
 Identities = 79/91 (86%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||| ||| |||||||||||||| | ||||| || |||||||| || ||||| |||||||
Sbjct: 129 ccaaagagttgggaacagtcatgagatcgcttggacagaaccctacagaggccgagctcc 188

                                          
Query: 88  aggacatgatcaatgaagtcgacgctgntgg 118
           ||||||||||||||||||| || |||| |||
Sbjct: 189 aggacatgatcaatgaagttgatgctgatgg 219

---

>dbj|AB050843.1| Nicotiana tabacum mRNA for calmodulin NtCaM7, complete cds
          Length = 823

 Score = 87.7 bits (44), Expect = 8e-15
 Identities = 88/103 (85%)
 Strand = Plus / Plus

                                                                       
Query: 30  aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
           |||||||| ||||| || ||||| ||  |||||||||||||||| ||||||||||| || 
Sbjct: 144 aaggagcttggaactgtgatgcggtcattggggcagaacccaaccgaggctgagcttcaa 203

                                                      
Query: 90  gacatgatcaatgaagtcgacgctgntggcaacggcaccattg 132
           ||||||||||| |||||||| |||| ||| || || |||||||
Sbjct: 204 gacatgatcaacgaagtcgatgctgatgggaatggaaccattg 246

---

>ref|XM_475464.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 450

 Score = 85.7 bits (43), Expect = 3e-14
 Identities = 100/118 (84%), Gaps = 1/118 (0%)
 Strand = Plus / Plus

                                                                       
Query: 30  aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
           |||||||| ||||| || ||||| || || || ||||||||||| ||||| ||||| |||
Sbjct: 91  aaggagcttggaaccgtgatgcggtcccttggtcagaacccaactgaggcggagctgcag 150

                                                                     
Query: 90  gacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           ||||||||||| || || || |||| |||||| || ||||||| ||||||||||||||
Sbjct: 151 gacatgatcaacgaggttgatgctgatggcaatgggaccattg-acttcccagagttc 207

---

>gb|AC129718.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBa0088I06, complete sequence
          Length = 187651

 Score = 85.7 bits (43), Expect = 3e-14
 Identities = 100/118 (84%), Gaps = 1/118 (0%)
 Strand = Plus / Minus

                                                                         
Query: 30    aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
             |||||||| ||||| || ||||| || || || ||||||||||| ||||| ||||| |||
Sbjct: 56517 aaggagcttggaaccgtgatgcggtcccttggtcagaacccaactgaggcggagctgcag 56458

                                                                       
Query: 90    gacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
             ||||||||||| || || || |||| |||||| || ||||||| ||||||||||||||
Sbjct: 56457 gacatgatcaacgaggttgatgctgatggcaatgggaccattg-acttcccagagttc 56401

---

>emb|AJ971805.1| Aspergillus ibericus partial cdl gene for calmodulin, exons 2-3,
           strain ITEM 4776
          Length = 651

 Score = 85.7 bits (43), Expect = 3e-14
 Identities = 76/87 (87%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||||||||| || |||||||||||||| || ||||||||  | ||| |||||||||
Sbjct: 215 ccaaggagctgggcactgtcatgcgctcgctcggccagaacccctccgagtctgagctcc 274

                                      
Query: 88  aggacatgatcaatgaagtcgacgctg 114
           ||||||||||||| || || |||||||
Sbjct: 275 aggacatgatcaacgaggttgacgctg 301

---

>emb|AJ582715.2|ACA582715 Aspergillus carbonarius partial cdl gene for calmodulin, exons 1-4,
           strain ITEM 4555
          Length = 686

 Score = 85.7 bits (43), Expect = 3e-14
 Identities = 76/87 (87%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||||||||| || |||||||||||||| || ||||||||  | ||| ||||||| |
Sbjct: 233 ccaaggagctgggcactgtcatgcgctcgctcggccagaacccctctgagtctgagcttc 292

                                      
Query: 88  aggacatgatcaatgaagtcgacgctg 114
           |||||||||||||||| ||||| ||||
Sbjct: 293 aggacatgatcaatgaggtcgatgctg 319

---

>emb|AJ582714.2|ACA582714 Aspergillus carbonarius partial cdl gene for calmodulin, exons 1-4,
           strain ITEM 4556
          Length = 686

 Score = 85.7 bits (43), Expect = 3e-14
 Identities = 76/87 (87%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||||||||| || |||||||||||||| || ||||||||  | ||| ||||||| |
Sbjct: 233 ccaaggagctgggcactgtcatgcgctcgctcggccagaacccctctgagtctgagcttc 292

                                      
Query: 88  aggacatgatcaatgaagtcgacgctg 114
           |||||||||||||||| ||||| ||||
Sbjct: 293 aggacatgatcaatgaggtcgatgctg 319

---

>gb|DQ398935.1| Vigna unguiculata calmodulin mRNA, complete cds
          Length = 464

 Score = 85.7 bits (43), Expect = 3e-14
 Identities = 100/118 (84%), Gaps = 1/118 (0%)
 Strand = Plus / Plus

                                                                       
Query: 30  aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
           |||||||| ||||| |||||||| ||  |||| ||||| || || ||||| |||||||| 
Sbjct: 98  aaggagcttggaactgtcatgcgttctttgggtcagaatcccactgaggcagagctccaa 157

                                                                     
Query: 90  gacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           ||||||||||| ||||| || |||| |||||| |||||||||| ||||||| ||||||
Sbjct: 158 gacatgatcaacgaagtagatgctgatggcaatggcaccattg-acttccctgagttc 214

---

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 85.7 bits (43), Expect = 3e-14
 Identities = 100/118 (84%), Gaps = 1/118 (0%)
 Strand = Plus / Minus

                                                                            
Query: 30       aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
                |||||||| ||||| || ||||| || || || ||||||||||| ||||| ||||| |||
Sbjct: 23988028 aaggagcttggaaccgtgatgcggtcccttggtcagaacccaactgaggcggagctgcag 23987969

                                                                          
Query: 90       gacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
                ||||||||||| || || || |||| |||||| || ||||||| ||||||||||||||
Sbjct: 23987968 gacatgatcaacgaggttgatgctgatggcaatgggaccattg-acttcccagagttc 23987912

---

>dbj|AK121606.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033042G12, full
           insert sequence
          Length = 876

 Score = 85.7 bits (43), Expect = 3e-14
 Identities = 100/118 (84%), Gaps = 1/118 (0%)
 Strand = Plus / Plus

                                                                       
Query: 30  aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
           |||||||| ||||| || ||||| || || || ||||||||||| ||||| ||||| |||
Sbjct: 237 aaggagcttggaaccgtgatgcggtcccttggtcagaacccaactgaggcggagctgcag 296

                                                                     
Query: 90  gacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           ||||||||||| || || || |||| |||||| || ||||||| ||||||||||||||
Sbjct: 297 gacatgatcaacgaggttgatgctgatggcaatgggaccattg-acttcccagagttc 353

---

>dbj|AK119167.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-036-F05, full
           insert sequence
          Length = 830

 Score = 85.7 bits (43), Expect = 3e-14
 Identities = 100/118 (84%), Gaps = 1/118 (0%)
 Strand = Plus / Plus

                                                                       
Query: 30  aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
           |||||||| ||||| || ||||| || || || ||||||||||| ||||| ||||| |||
Sbjct: 192 aaggagcttggaaccgtgatgcggtcccttggtcagaacccaactgaggcggagctgcag 251

                                                                     
Query: 90  gacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           ||||||||||| || || || |||| |||||| || ||||||| ||||||||||||||
Sbjct: 252 gacatgatcaacgaggttgatgctgatggcaatgggaccattg-acttcccagagttc 308

---

>dbj|AK059534.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-029-D11, full
           insert sequence
          Length = 968

 Score = 85.7 bits (43), Expect = 3e-14
 Identities = 100/118 (84%), Gaps = 1/118 (0%)
 Strand = Plus / Plus

                                                                       
Query: 30  aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
           |||||||| ||||| || ||||| || || || ||||||||||| ||||| ||||| |||
Sbjct: 190 aaggagcttggaaccgtgatgcggtcccttggtcagaacccaactgaggcggagctgcag 249

                                                                     
Query: 90  gacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           ||||||||||| || || || |||| |||||| || ||||||| ||||||||||||||
Sbjct: 250 gacatgatcaacgaggttgatgctgatggcaatgggaccattg-acttcccagagttc 306

---

>gb|AF042839.1|AF042839 Oryza sativa calmodulin (CaM2) mRNA, complete cds
          Length = 671

 Score = 85.7 bits (43), Expect = 3e-14
 Identities = 100/118 (84%), Gaps = 1/118 (0%)
 Strand = Plus / Plus

                                                                       
Query: 30  aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
           |||||||| ||||| || ||||| || || || ||||||||||| ||||| ||||| |||
Sbjct: 181 aaggagcttggaaccgtgatgcggtcccttggtcagaacccaactgaggcggagctgcag 240

                                                                     
Query: 90  gacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           ||||||||||| || || || |||| |||||| || ||||||| ||||||||||||||
Sbjct: 241 gacatgatcaacgaggttgatgctgatggcaatgggaccattg-acttcccagagttc 297

---

>emb|AJ964873.2| Aspergillus carbonarius partial cdl gene for calmodulin, exon 2,
           strain ITEM 4503
          Length = 674

 Score = 85.7 bits (43), Expect = 3e-14
 Identities = 76/87 (87%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||||||||| || |||||||||||||| || ||||||||  | ||| ||||||| |
Sbjct: 221 ccaaggagctgggcactgtcatgcgctcgctcggccagaacccctctgagtctgagcttc 280

                                      
Query: 88  aggacatgatcaatgaagtcgacgctg 114
           |||||||||||||||| ||||| ||||
Sbjct: 281 aggacatgatcaatgaggtcgatgctg 307

---

>dbj|AB050844.1| Nicotiana tabacum mRNA for calmodulin NtCaM8, complete cds
          Length = 820

 Score = 85.7 bits (43), Expect = 3e-14
 Identities = 100/118 (84%), Gaps = 1/118 (0%)
 Strand = Plus / Plus

                                                                       
Query: 30  aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
           |||||||| ||||| || ||||| ||  |||||||||||||||| || |||||||| || 
Sbjct: 142 aaggagcttggaaccgtgatgcggtcattggggcagaacccaaccgaagctgagcttcaa 201

                                                                     
Query: 90  gacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           || ||||||||||||||||| |||| ||| || || ||||||| ||||||| ||||||
Sbjct: 202 gatatgatcaatgaagtcgatgctgatgggaatgggaccattg-acttccctgagttc 258

---

>dbj|AB050842.1| Nicotiana tabacum mRNA for calmodulin NtCaM6, complete cds
          Length = 813

 Score = 85.7 bits (43), Expect = 3e-14
 Identities = 100/118 (84%), Gaps = 1/118 (0%)
 Strand = Plus / Plus

                                                                       
Query: 30  aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
           |||||||| ||||| || ||||| ||  |||||||||||||||| ||||||||||| || 
Sbjct: 144 aaggagcttggaactgtaatgcggtcattggggcagaacccaaccgaggctgagcttcaa 203

                                                                     
Query: 90  gacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||||||| |||||||| || |||| ||| || || ||||||| | ||||||||||||
Sbjct: 204 gacatgattaatgaagttgatgctgatgggaatgggaccattg-atttcccagagttc 260

---

>dbj|AB050841.1| Nicotiana tabacum mRNA for calmodulin NtCaM5, complete cds
          Length = 823

 Score = 85.7 bits (43), Expect = 3e-14
 Identities = 100/118 (84%), Gaps = 1/118 (0%)
 Strand = Plus / Plus

                                                                       
Query: 30  aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
           |||||||| ||||| || ||||| ||  |||||||||||||||| ||||||||||| || 
Sbjct: 151 aaggagcttggaactgtaatgcggtcattggggcagaacccaaccgaggctgagcttcaa 210

                                                                     
Query: 90  gacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           ||||||||||||||||| || ||||  || || || ||||||| | ||||||||||||
Sbjct: 211 gacatgatcaatgaagttgatgctgacgggaatgggaccattg-atttcccagagttc 267

---

>gb|AY456265.1| Nicotiana attenuata calmodulin mRNA, complete cds
          Length = 568

 Score = 83.8 bits (42), Expect = 1e-13
 Identities = 78/89 (87%), Gaps = 1/89 (1%)
 Strand = Plus / Plus

                                                                       
Query: 58  tggggcagaacccaacggaggctgagctccaggacatgatcaatgaagtcgacgctgntg 117
           |||| ||||||||||| || |||||||||||||||||||| |||||||| || |||| ||
Sbjct: 166 tgggacagaacccaactgaagctgagctccaggacatgataaatgaagtggatgctgatg 225

                                        
Query: 118 gcaacggcaccattgtacttcccagagtt 146
           | || || ||||||| |||||||||||||
Sbjct: 226 gtaatggaaccattg-acttcccagagtt 253

---

>ref|NM_188123.1| Oryza sativa (japonica cultivar-group), Ozsa8555 predicted mRNA
          Length = 450

 Score = 83.8 bits (42), Expect = 1e-13
 Identities = 66/74 (89%)
 Strand = Plus / Plus

                                                                       
Query: 30  aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
           |||||| ||||||| |||||||| |||||||||||||||||||| ||||| || || || 
Sbjct: 91  aaggagttgggaactgtcatgcgttcgctggggcagaacccaactgaggcagaactacaa 150

                         
Query: 90  gacatgatcaatga 103
           ||||||||||||||
Sbjct: 151 gacatgatcaatga 164

---

>emb|Z12828.1|OSCALMOD2 O.sativa gene encoding calmodulin
          Length = 1927

 Score = 83.8 bits (42), Expect = 1e-13
 Identities = 66/74 (89%)
 Strand = Plus / Plus

                                                                        
Query: 30   aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
            |||||| ||||||| |||||||| |||||||||||||||||||| ||||| || || || 
Sbjct: 1556 aaggagttgggaactgtcatgcgttcgctggggcagaacccaactgaggcagaactacaa 1615

                          
Query: 90   gacatgatcaatga 103
            ||||||||||||||
Sbjct: 1616 gacatgatcaatga 1629

---

>emb|Z12839.1|LLCALMOD L.longiflorum mRNA encoding calmodulin
          Length = 681

 Score = 83.8 bits (42), Expect = 1e-13
 Identities = 74/85 (87%)
 Strand = Plus / Plus

                                                                       
Query: 48  atgcgctcgctggggcagaacccaacggaggctgagctccaggacatgatcaatgaagtc 107
           |||||||| ||||| ||||||||||| ||||| ||||||||||||||||||||||| || 
Sbjct: 117 atgcgctccctgggccagaacccaacagaggcagagctccaggacatgatcaatgaggta 176

                                    
Query: 108 gacgctgntggcaacggcaccattg 132
           || ||||  ||||| || |||||||
Sbjct: 177 gatgctgacggcaatgggaccattg 201

---

>gb|DQ122882.1| Chlamydomonas incerta calmodulin mRNA, complete cds
          Length = 995

 Score = 83.8 bits (42), Expect = 1e-13
 Identities = 89/105 (84%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||||||||| || || |||||||||||||| |||||||| || ||||| ||||| |
Sbjct: 149 ccaaggagctggggacggtgatgcgctcgctgggccagaaccccactgaggccgagctgc 208

                                                        
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattg 132
           | ||||||||||  || || |||||||  ||||||||||| ||||
Sbjct: 209 aagacatgatcagcgaggtggacgctgacggcaacggcactattg 253

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
               sequence
          Length = 43261740

 Score = 83.8 bits (42), Expect = 1e-13
 Identities = 66/74 (89%)
 Strand = Plus / Plus

                                                                           
Query: 30      aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
               |||||| ||||||| |||||||| |||||||||||||||||||| ||||| || || || 
Sbjct: 9887580 aaggagttgggaactgtcatgcgttcgctggggcagaacccaactgaggcagaactacaa 9887639

                             
Query: 90      gacatgatcaatga 103
               ||||||||||||||
Sbjct: 9887640 gacatgatcaatga 9887653



 Score = 73.8 bits (37), Expect = 1e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                           
Query: 28      ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
               |||||||||| ||||| || ||||||||  | ||||||||||| || ||||||||||| |
Sbjct: 9195144 ccaaggagcttggaactgtgatgcgctcattagggcagaaccccactgaggctgagcttc 9195085

                            
Query: 88      aggacatgatcaa 100
               |||||||||||||
Sbjct: 9195084 aggacatgatcaa 9195072



 Score = 63.9 bits (32), Expect = 1e-07
 Identities = 38/40 (95%)
 Strand = Plus / Plus

                                                        
Query: 60       gggcagaacccaacggaggctgagctccaggacatgatca 99
                |||||||||||||||||||| ||||| |||||||||||||
Sbjct: 34416082 gggcagaacccaacggaggcggagctgcaggacatgatca 34416121

---

>dbj|AP000815.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1,
             clone:P0003H10
          Length = 142418

 Score = 83.8 bits (42), Expect = 1e-13
 Identities = 66/74 (89%)
 Strand = Plus / Plus

                                                                         
Query: 30    aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
             |||||| ||||||| |||||||| |||||||||||||||||||| ||||| || || || 
Sbjct: 23346 aaggagttgggaactgtcatgcgttcgctggggcagaacccaactgaggcagaactacaa 23405

                           
Query: 90    gacatgatcaatga 103
             ||||||||||||||
Sbjct: 23406 gacatgatcaatga 23419

---

>dbj|AK058646.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-018-E09, full
           insert sequence
          Length = 694

 Score = 83.8 bits (42), Expect = 1e-13
 Identities = 66/74 (89%)
 Strand = Plus / Plus

                                                                       
Query: 30  aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
           |||||| ||||||| |||||||| |||||||||||||||||||| ||||| || || || 
Sbjct: 175 aaggagttgggaactgtcatgcgttcgctggggcagaacccaactgaggcagaactacaa 234

                         
Query: 90  gacatgatcaatga 103
           ||||||||||||||
Sbjct: 235 gacatgatcaatga 248

---

>gb|U91643.1|POU91643 Pleurotus ostreatus calmodulin (CaM) gene, complete cds
          Length = 1197

 Score = 83.8 bits (42), Expect = 1e-13
 Identities = 89/105 (84%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||| ||||| ||||| |||||||||||||||||||||||||| || || || ||  | |
Sbjct: 551 ccaaagagctcggaaccgtcatgcgctcgctggggcagaaccccaccgaagccgaattgc 610

                                                        
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattg 132
           ||||||||||||| ||||| ||||| |  ||||||||||| ||||
Sbjct: 611 aggacatgatcaacgaagttgacgcagacggcaacggcacgattg 655

---

>gb|AY741754.1| Penicillium charlesii strain NRRL 778 calmodulin gene, partial cds
          Length = 710

 Score = 83.8 bits (42), Expect = 1e-13
 Identities = 89/105 (84%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||||| || || |||||||||||||| || ||||||||  | ||| ||||||| |
Sbjct: 198 ccaaggagcttggcactgtcatgcgctcgcttggccagaacccctccgagtctgagctgc 257

                                                        
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattg 132
           ||||||||||||| ||||||||||| |    ||||||||||||||
Sbjct: 258 aggacatgatcaacgaagtcgacgccgacaacaacggcaccattg 302

---

>gb|AY741752.1| Penicillium charlesii strain NRRL 6208 calmodulin gene, partial cds
          Length = 709

 Score = 83.8 bits (42), Expect = 1e-13
 Identities = 89/105 (84%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||||| || || |||||||||||||| || ||||||||  | ||| ||||||| |
Sbjct: 198 ccaaggagcttggcactgtcatgcgctcgcttggccagaacccctccgagtctgagctgc 257

                                                        
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattg 132
           ||||||||||||| ||||||||||| |    ||||||||||||||
Sbjct: 258 aggacatgatcaacgaagtcgacgccgacaacaacggcaccattg 302

---

>gb|AY741745.1| Penicillium charlesii strain NRRL 3464 calmodulin gene, partial cds
          Length = 709

 Score = 83.8 bits (42), Expect = 1e-13
 Identities = 89/105 (84%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||||| || || |||||||||||||| || ||||||||  | ||| ||||||| |
Sbjct: 198 ccaaggagcttggcactgtcatgcgctcgcttggccagaacccctccgagtctgagctgc 257

                                                        
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattg 132
           ||||||||||||| ||||||||||| |    ||||||||||||||
Sbjct: 258 aggacatgatcaacgaagtcgacgccgacaacaacggcaccattg 302

---

>gb|AY741742.1| Penicillium thiersii strain NRRL 32383 calmodulin gene, partial cds
          Length = 690

 Score = 83.8 bits (42), Expect = 1e-13
 Identities = 89/105 (84%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||||||||| || ||||||||||| || || ||||||||  | ||| ||||||| |
Sbjct: 204 ccaaggagctgggtactgtcatgcgctccctcggccagaacccctctgagtctgagctgc 263

                                                        
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattg 132
           |||||||||| ||||| ||||||||||    ||||||||||||||
Sbjct: 264 aggacatgattaatgaggtcgacgctgacaacaacggcaccattg 308

---

>gb|AY741741.1| Penicillium thiersii strain NRRL 31609 calmodulin gene, partial cds
          Length = 690

 Score = 83.8 bits (42), Expect = 1e-13
 Identities = 89/105 (84%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||||||||| || ||||||||||| || || ||||||||  | ||| ||||||| |
Sbjct: 204 ccaaggagctgggtactgtcatgcgctccctcggccagaacccctctgagtctgagctgc 263

                                                        
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattg 132
           |||||||||| ||||| ||||||||||    ||||||||||||||
Sbjct: 264 aggacatgattaatgaggtcgacgctgacaacaacggcaccattg 308

---

>gb|AY741727.1| Penicillium charlesii strain NRRL 1887 calmodulin gene, partial cds
          Length = 710

 Score = 83.8 bits (42), Expect = 1e-13
 Identities = 89/105 (84%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||||| || || |||||||||||||| || ||||||||  | ||| ||||||| |
Sbjct: 198 ccaaggagcttggcactgtcatgcgctcgcttggccagaacccctccgagtctgagctgc 257

                                                        
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattg 132
           ||||||||||||| ||||||||||| |    ||||||||||||||
Sbjct: 258 aggacatgatcaacgaagtcgacgccgacaacaacggcaccattg 302

---

>gb|AY741726.1| Penicillium thiersii strain NRRL 28162 calmodulin gene, partial cds
          Length = 690

 Score = 83.8 bits (42), Expect = 1e-13
 Identities = 89/105 (84%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||||||||| || ||||||||||| || || ||||||||  | ||| ||||||| |
Sbjct: 204 ccaaggagctgggtactgtcatgcgctccctcggccagaacccctctgagtctgagctgc 263

                                                        
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattg 132
           |||||||||| ||||| ||||||||||    ||||||||||||||
Sbjct: 264 aggacatgattaatgaggtcgacgctgacaacaacggcaccattg 308

---

>gb|L18914.1|RICCALMODL Oryza sativa calmodulin gene, complete cds
          Length = 1927

 Score = 83.8 bits (42), Expect = 1e-13
 Identities = 66/74 (89%)
 Strand = Plus / Plus

                                                                        
Query: 30   aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
            |||||| ||||||| |||||||| |||||||||||||||||||| ||||| || || || 
Sbjct: 1556 aaggagttgggaactgtcatgcgttcgctggggcagaacccaactgaggcagaactacaa 1615

                          
Query: 90   gacatgatcaatga 103
            ||||||||||||||
Sbjct: 1616 gacatgatcaatga 1629

---

>gb|L18912.1|LILCALMODU Lilium longiflorum calmodulin mRNA, complete cds
          Length = 681

 Score = 83.8 bits (42), Expect = 1e-13
 Identities = 74/85 (87%)
 Strand = Plus / Plus

                                                                       
Query: 48  atgcgctcgctggggcagaacccaacggaggctgagctccaggacatgatcaatgaagtc 107
           |||||||| ||||| ||||||||||| ||||| ||||||||||||||||||||||| || 
Sbjct: 117 atgcgctccctgggccagaacccaacagaggcagagctccaggacatgatcaatgaggta 176

                                    
Query: 108 gacgctgntggcaacggcaccattg 132
           || ||||  ||||| || |||||||
Sbjct: 177 gatgctgacggcaatgggaccattg 201

---

>dbj|AB063184.1| Halichondria okadai CaM gene for calmodulin, complete cds
          Length = 776

 Score = 83.8 bits (42), Expect = 1e-13
 Identities = 75/85 (88%), Gaps = 1/85 (1%)
 Strand = Plus / Plus

                                                                       
Query: 63  cagaacccaacggaggctgagctccaggacatgatcaatgaagtcgacgctgntggcaac 122
           ||||||||||| || |||||||| ||||||||||||||||| || || |||| |||||| 
Sbjct: 291 cagaacccaaccgaagctgagctgcaggacatgatcaatgaggtggatgctgatggcaat 350

                                    
Query: 123 ggcaccattgtacttcccagagttc 147
           ||||| |||| ||||||||||||||
Sbjct: 351 ggcacaattg-acttcccagagttc 374

---

>dbj|AB063182.1| Halichondria okadai CaM mRNA for calmodulin, complete cds
          Length = 676

 Score = 83.8 bits (42), Expect = 1e-13
 Identities = 75/85 (88%), Gaps = 1/85 (1%)
 Strand = Plus / Plus

                                                                       
Query: 63  cagaacccaacggaggctgagctccaggacatgatcaatgaagtcgacgctgntggcaac 122
           ||||||||||| || |||||||| ||||||||||||||||| || || |||| |||||| 
Sbjct: 190 cagaacccaaccgaagctgagctgcaggacatgatcaatgaggtggatgctgatggcaat 249

                                    
Query: 123 ggcaccattgtacttcccagagttc 147
           ||||| |||| ||||||||||||||
Sbjct: 250 ggcacaattg-acttcccagagttc 273

---

>gb|L14071.1|BYNCALMOD Bryonia dioica calmodulin (Bc329) mRNA, complete cds
          Length = 899

 Score = 83.8 bits (42), Expect = 1e-13
 Identities = 89/105 (84%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||| ||||| || || ||||| || ||||||||||| ||||| || |||||||| |
Sbjct: 160 ccaaggaactggggactgttatgcggtcactggggcagaatccaaccgaagctgagctgc 219

                                                        
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattg 132
           ||||||||||||||||||| || |||| ||| || || |||||||
Sbjct: 220 aggacatgatcaatgaagttgatgctgatggaaatggaaccattg 264

---

>dbj|AB050846.1| Nicotiana tabacum mRNA for calmodulin NtCaM10, complete cds
          Length = 802

 Score = 83.8 bits (42), Expect = 1e-13
 Identities = 78/89 (87%), Gaps = 1/89 (1%)
 Strand = Plus / Plus

                                                                       
Query: 58  tggggcagaacccaacggaggctgagctccaggacatgatcaatgaagtcgacgctgntg 117
           |||| ||||||||||| || |||||||||||||||||||| |||||||| || |||| ||
Sbjct: 172 tgggacagaacccaactgaagctgagctccaggacatgataaatgaagtggatgctgatg 231

                                        
Query: 118 gcaacggcaccattgtacttcccagagtt 146
           | || || ||||||| |||||||||||||
Sbjct: 232 gtaatggaaccattg-acttcccagagtt 259

---

>dbj|AB050845.1| Nicotiana tabacum mRNA for calmodulin NtCaM9, complete cds
          Length = 804

 Score = 83.8 bits (42), Expect = 1e-13
 Identities = 78/89 (87%), Gaps = 1/89 (1%)
 Strand = Plus / Plus

                                                                       
Query: 58  tggggcagaacccaacggaggctgagctccaggacatgatcaatgaagtcgacgctgntg 117
           |||| ||||||||||| || |||||||||||||||||||| |||||||| || |||| ||
Sbjct: 173 tgggacagaacccaactgaagctgagctccaggacatgataaatgaagtggatgctgatg 232

                                        
Query: 118 gcaacggcaccattgtacttcccagagtt 146
           | || || ||||||| |||||||||||||
Sbjct: 233 gtaatggaaccattg-acttcccagagtt 260

---

>gb|AY656700.1| Carassius auratus calmodulin long form mRNA, complete cds
          Length = 1530

 Score = 81.8 bits (41), Expect = 5e-13
 Identities = 59/65 (90%)
 Strand = Plus / Plus

                                                                       
Query: 36  ctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccaggacatg 95
           ||||| ||||| ||||||||||| ||||||||||| ||||||||||| || |||||||||
Sbjct: 163 ctgggcacagtgatgcgctcgctcgggcagaaccccacggaggctgaactgcaggacatg 222

                
Query: 96  atcaa 100
           |||||
Sbjct: 223 atcaa 227

---

>ref|XM_382067.1| Gibberella zeae PH-1 chromosome 1 CALM_NEUCR Calmodulin (CaM)
           (FG01891.1) partial mRNA
          Length = 450

 Score = 81.8 bits (41), Expect = 5e-13
 Identities = 101/120 (84%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||||| ||||| ||||||||||| || || ||||||||  | ||| ||||||| |
Sbjct: 89  ccaaggagctcggaaccgtcatgcgctctctcggccagaacccctccgagtctgagcttc 148

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           ||||||||||||| || ||||||||||    |||||||||||| | ||||||| ||||||
Sbjct: 149 aggacatgatcaacgaggtcgacgctgacaacaacggcaccatcg-acttccctgagttc 207

---

>emb|AJ971806.1| Aspergillus ibericus partial cdl gene for calmodulin, exons 2-3,
           strain ITEM 6600
          Length = 655

 Score = 81.8 bits (41), Expect = 5e-13
 Identities = 65/73 (89%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||||||||| || |||||||||||||| || ||||||||  | ||| |||||||||
Sbjct: 219 ccaaggagctgggcactgtcatgcgctcgctcggccagaacccctccgagtctgagctcc 278

                        
Query: 88  aggacatgatcaa 100
           |||||||||||||
Sbjct: 279 aggacatgatcaa 291

---

>emb|CR717313.2|CNS0GGFB Tetraodon nigroviridis full-length cDNA
          Length = 651

 Score = 81.8 bits (41), Expect = 5e-13
 Identities = 101/120 (84%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||| |||||||| ||||||||| | |||||||| |||||||| || ||||| ||||| |
Sbjct: 200 ccaaagagctgggcacagtcatgaggtcgctgggccagaacccgacagaggcggagctgc 259

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           ||||||||||||| || || ||||||| |||  |||| ||||| | |||| |||||||||
Sbjct: 260 aggacatgatcaacgaggtggacgctgatggtcacggaaccatcg-actttccagagttc 318

---

>ref|XM_776612.1| PREDICTED: Strongylocentrotus purpuratus similar to CG8472-PA,
           isoform A (LOC576290), mRNA
          Length = 516

 Score = 81.8 bits (41), Expect = 5e-13
 Identities = 101/120 (84%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||| |||| || || ||||| || ||||| |||||||| || ||||||||||| |
Sbjct: 116 ccaaggagttgggcaccgtgatgcgatcactgggtcagaaccctaccgaggctgagcttc 175

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           | ||||||||||||||||| |||||||  || ||||| || |||| | ||||||||||||
Sbjct: 176 aagacatgatcaatgaagtagacgctgacggaaacggaacgattg-atttcccagagttc 234

---

>emb|X90560.1|PPCAMPROT Physcomitrella patens mRNA for calmodulin
          Length = 819

 Score = 81.8 bits (41), Expect = 5e-13
 Identities = 85/100 (85%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||||||||||||||| ||||| |||||||| ||||| || || ||||| ||| | |
Sbjct: 250 ccaaggagctgggaacagtaatgcggtcgctgggtcagaatcccaccgaggcagagttgc 309

                                                   
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcac 127
           |||||||||||||||| || || || | ||| ||||||||
Sbjct: 310 aggacatgatcaatgaggttgatgccgatggaaacggcac 349

---

>gb|AF031482.1|AF031482 Zea mays calmodulin (Zmrcalm) mRNA, complete cds
          Length = 480

 Score = 81.8 bits (41), Expect = 5e-13
 Identities = 101/120 (84%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||||| ||||| || |||||||| || || |||||||| || || || ||||| |
Sbjct: 102 ccaaggagcttggaactgtgatgcgctcccttggccagaaccccactgaagcagagctgc 161

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           ||||||||||||| || || || |||| |||||| || ||||||| ||||||||||||||
Sbjct: 162 aggacatgatcaacgaggttgatgctgatggcaatgggaccattg-acttcccagagttc 220

---

>dbj|AB081568.1| Strongylocentrotus intermedius CaM mRNA for calmodulin, complete
           cds
          Length = 1093

 Score = 81.8 bits (41), Expect = 5e-13
 Identities = 101/120 (84%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||| |||| || || ||||| || ||||| |||||||| || ||||||||||| |
Sbjct: 161 ccaaggagttgggcaccgtgatgcgatcactgggtcagaaccctactgaggctgagcttc 220

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           | ||||||||||||||||| |||||||  || ||||| || |||| | ||||||||||||
Sbjct: 221 aagacatgatcaatgaagtagacgctgacggaaacggaacgattg-atttcccagagttc 279

---

>dbj|AB081567.1| Strongylocentrotus intermedius exCaM mRNA for calmodulin, complete
           cds
          Length = 1114

 Score = 81.8 bits (41), Expect = 5e-13
 Identities = 101/120 (84%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||| |||| || || ||||| || ||||| |||||||| || ||||||||||| |
Sbjct: 182 ccaaggagttgggcaccgtgatgcgatcactgggtcagaaccctactgaggctgagcttc 241

                                                                       
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           | ||||||||||||||||| |||||||  || ||||| || |||| | ||||||||||||
Sbjct: 242 aagacatgatcaatgaagtagacgctgacggaaacggaacgattg-atttcccagagttc 300

---

>gb|AY725775.1| Cylindrocladiella peruviana strain CPC 5614 calmodulin (cmdA) gene,
           exons 3 through 5 and partial cds
          Length = 483

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 87/103 (84%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||||| || || ||||||||||| ||||| ||||||||  | ||| |||||||||
Sbjct: 286 ccaaggagcttggcaccgtcatgcgctctctgggccagaacccttccgagtctgagctcc 345

                                                      
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccat 130
           ||||||||||||| || ||||| ||||    ||||||||||||
Sbjct: 346 aggacatgatcaacgaggtcgatgctgacaacaacggcaccat 388

---

>gb|AY830129.1| Hevea brasiliensis calmodulin (CaM) gene, complete cds
          Length = 1947

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 63/71 (88%)
 Strand = Plus / Plus

                                                                        
Query: 48   atgcgctcgctggggcagaacccaacggaggctgagctccaggacatgatcaatgaagtc 107
            ||||| |||||||||||||||||||| || || ||||||||||||||||| |||||||| 
Sbjct: 1609 atgcgttcgctggggcagaacccaactgaagcagagctccaggacatgataaatgaagtt 1668

                       
Query: 108  gacgctgntgg 118
            || |||| |||
Sbjct: 1669 gatgctgatgg 1679

---

>gb|AY830128.1| Hevea brasiliensis calmodulin (CaM) mRNA, complete cds
          Length = 447

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 63/71 (88%)
 Strand = Plus / Plus

                                                                       
Query: 48  atgcgctcgctggggcagaacccaacggaggctgagctccaggacatgatcaatgaagtc 107
           ||||| |||||||||||||||||||| || || ||||||||||||||||| |||||||| 
Sbjct: 109 atgcgttcgctggggcagaacccaactgaagcagagctccaggacatgataaatgaagtt 168

                      
Query: 108 gacgctgntgg 118
           || |||| |||
Sbjct: 169 gatgctgatgg 179

---

>gb|BC068339.1| Danio rerio calmodulin 2, delta, mRNA (cDNA clone MGC:85641
           IMAGE:6805537), complete cds
          Length = 1466

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 88/103 (85%), Gaps = 1/103 (0%)
 Strand = Plus / Plus

                                                                       
Query: 45  gtcatgcgctcgctggggcagaacccaacggaggctgagctccaggacatgatcaatgaa 104
           ||||||||||| || |||||||| || || ||||||||||| || |||||||| ||||||
Sbjct: 151 gtcatgcgctcacttgggcagaatcccacagaggctgagctgcaagacatgataaatgaa 210

                                                      
Query: 105 gtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           || || |||| ||| |||||||| || | ||||||||||||||
Sbjct: 211 gttgatgctgatggaaacggcacgatag-acttcccagagttc 252

---

>gb|BC059427.1| Danio rerio calmodulin 2, delta, mRNA (cDNA clone MGC:73045
           IMAGE:4143672), complete cds
          Length = 1215

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 88/103 (85%), Gaps = 1/103 (0%)
 Strand = Plus / Plus

                                                                       
Query: 45  gtcatgcgctcgctggggcagaacccaacggaggctgagctccaggacatgatcaatgaa 104
           ||||||||||| || |||||||| || || ||||||||||| || |||||||| ||||||
Sbjct: 151 gtcatgcgctcacttgggcagaatcccacagaggctgagctgcaagacatgataaatgaa 210

                                                      
Query: 105 gtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           || || |||| ||| |||||||| || | ||||||||||||||
Sbjct: 211 gttgatgctgatggaaacggcacgatag-acttcccagagttc 252

---

>gb|DQ191657.1| Solanum tuberosum calmodulin 5/6/7/8-like protein mRNA, complete
           cds
          Length = 876

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 66/75 (88%)
 Strand = Plus / Plus

                                                                       
Query: 58  tggggcagaacccaacggaggctgagctccaggacatgatcaatgaagtcgacgctgntg 117
           |||||||||||||||| ||||||||||| || ||||||||||||||||| || |||| ||
Sbjct: 211 tggggcagaacccaactgaggctgagcttcaagacatgatcaatgaagttgatgctgatg 270

                          
Query: 118 gcaacggcaccattg 132
           | || || |||||||
Sbjct: 271 gaaatgggaccattg 285

---

>ref|NM_001032461.1| Ciona intestinalis calmodulin homologue (CaM), mRNA
          Length = 798

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 87/103 (84%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||||||||||| || ||| | ||  |||| || |||||||| || |||||||| |
Sbjct: 121 ccaaggagctgggaaccgttatgaggtctttgggacaaaacccaactgaagctgagcttc 180

                                                      
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccat 130
           ||||||||||||||||||| || ||||  |||||||| |||||
Sbjct: 181 aggacatgatcaatgaagttgatgctgacggcaacggaaccat 223

---

>gb|AF494219.1| Medicago truncatula calmodulin 1 mRNA, complete cds
          Length = 940

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 78/91 (85%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||||| ||||| || ||||| ||  ||||||| |||||||| ||||| ||||| |
Sbjct: 191 ccaaggagcttggaactgttatgcgttcattggggcaaaacccaactgaggcagagcttc 250

                                          
Query: 88  aggacatgatcaatgaagtcgacgctgntgg 118
           ||||||||||||||||||| || |||| |||
Sbjct: 251 aggacatgatcaatgaagtagatgctgatgg 281

---

>gb|BC049483.1| Danio rerio mRNA similar to NMDA receptor-regulated gene 1 (cDNA
           clone IMAGE:5914412)
          Length = 2241

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 88/103 (85%), Gaps = 1/103 (0%)
 Strand = Plus / Plus

                                                                       
Query: 45  gtcatgcgctcgctggggcagaacccaacggaggctgagctccaggacatgatcaatgaa 104
           ||||||||||| || |||||||| || || ||||||||||| || |||||||| ||||||
Sbjct: 173 gtcatgcgctcacttgggcagaatcccacagaggctgagctgcaagacatgataaatgaa 232

                                                      
Query: 105 gtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           || || |||| ||| |||||||| || | ||||||||||||||
Sbjct: 233 gttgatgctgatggaaacggcacgatag-acttcccagagttc 274

---

>emb|Y13974.1|ZMCALMODU Zea mays mRNA for calmodulin
          Length = 450

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 87/103 (84%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||| || ||||| || ||||||||| |||| |||||||| || ||||||||||| |
Sbjct: 89  ccaaggaacttggaactgtgatgcgctcgttgggccagaaccctactgaggctgagcttc 148

                                                      
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccat 130
           ||||||||||||| || || || |||| |||||| || |||||
Sbjct: 149 aggacatgatcaacgaggtagatgctgatggcaatggaaccat 191

---

>emb|Y13578.1|CICAM Ciona intestinalis mRNA for calmodulin
          Length = 790

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 87/103 (84%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||||||||||| || ||| | ||  |||| || |||||||| || |||||||| |
Sbjct: 131 ccaaggagctgggaaccgttatgaggtctttgggacaaaacccaactgaagctgagcttc 190

                                                      
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccat 130
           ||||||||||||||||||| || ||||  |||||||| |||||
Sbjct: 191 aggacatgatcaatgaagttgatgctgacggcaacggaaccat 233

---

>emb|X77397.1|ZMCAM2 Z.mays CaM2 mRNA for calmodulin
          Length = 775

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 72/83 (86%)
 Strand = Plus / Plus

                                                                       
Query: 48  atgcgctcgctggggcagaacccaacggaggctgagctccaggacatgatcaatgaagtc 107
           ||||||||  ||||||||||||| || ||||||||||| ||||||||||||||||| || 
Sbjct: 180 atgcgctcattggggcagaaccctactgaggctgagcttcaggacatgatcaatgaggtt 239

                                  
Query: 108 gacgctgntggcaacggcaccat 130
           || |||| |||||| || |||||
Sbjct: 240 gatgctgatggcaatggaaccat 262

---

>emb|AJ318520.1|SCO318520 Solanum commersonii mRNA for putative calmodulin (caM1 gene)
          Length = 807

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 66/75 (88%)
 Strand = Plus / Plus

                                                                       
Query: 58  tggggcagaacccaacggaggctgagctccaggacatgatcaatgaagtcgacgctgntg 117
           |||||||||||||||| ||||||||||| || ||||||||||||||||| || |||| ||
Sbjct: 146 tggggcagaacccaactgaggctgagcttcaagacatgatcaatgaagttgatgctgatg 205

                          
Query: 118 gcaacggcaccattg 132
           | || || |||||||
Sbjct: 206 gaaatgggaccattg 220

---

>ref|NM_199996.2| Danio rerio calmodulin 2, delta (calm2d), mRNA
          Length = 1466

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 88/103 (85%), Gaps = 1/103 (0%)
 Strand = Plus / Plus

                                                                       
Query: 45  gtcatgcgctcgctggggcagaacccaacggaggctgagctccaggacatgatcaatgaa 104
           ||||||||||| || |||||||| || || ||||||||||| || |||||||| ||||||
Sbjct: 151 gtcatgcgctcacttgggcagaatcccacagaggctgagctgcaagacatgataaatgaa 210

                                                      
Query: 105 gtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           || || |||| ||| |||||||| || | ||||||||||||||
Sbjct: 211 gttgatgctgatggaaacggcacgatag-acttcccagagttc 252

---

>gb|AY831536.1| Phoma sp. WAC 7977 calmodulin gene, partial cds
          Length = 515

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 87/103 (84%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||||| || || |||||||||||||| || |||||||| |  ||| ||||||| |
Sbjct: 330 ccaaggagctcggcaccgtcatgcgctcgctcggccagaaccccagcgagtctgagctgc 389

                                                      
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccat 130
           ||||||||||||| || |||||||| | |  ||||||||||||
Sbjct: 390 aggacatgatcaacgaggtcgacgccgataacaacggcaccat 432

---

>gb|AY831531.1| Phoma sp. OMT 5 calmodulin gene, partial cds
          Length = 515

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 87/103 (84%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||||| || || |||||||||||||| || |||||||| |  ||| ||||||| |
Sbjct: 330 ccaaggagctcggcaccgtcatgcgctcgctcggccagaaccccagcgagtctgagctgc 389

                                                      
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccat 130
           ||||||||||||| || |||||||| | |  ||||||||||||
Sbjct: 390 aggacatgatcaacgaggtcgacgccgataacaacggcaccat 432

---

>dbj|AB076905.1| Ciona intestinalis Ci-CaM mRNA for calmodulin homologue, complete
           cds
          Length = 798

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 87/103 (84%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||||||||||| || ||| | ||  |||| || |||||||| || |||||||| |
Sbjct: 121 ccaaggagctgggaaccgttatgaggtctttgggacaaaacccaactgaagctgagcttc 180

                                                      
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccat 130
           ||||||||||||||||||| || ||||  |||||||| |||||
Sbjct: 181 aggacatgatcaatgaagttgatgctgacggcaacggaaccat 223

---

>gb|U48692.1|TAU48692 Triticum aestivum calmodulin TaCaM2-3 mRNA, complete cds
          Length = 909

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 67/76 (88%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||||||||||| |||||||| || ||||||||||| || || ||||| ||||| |
Sbjct: 157 ccaaggagctgggaactgtcatgcgttccctggggcagaatcccactgaggcagagcttc 216

                           
Query: 88  aggacatgatcaatga 103
           | ||||||||||||||
Sbjct: 217 aagacatgatcaatga 232

---

>gb|U48691.1|TAU48691 Triticum aestivum calmodulin TaCaM2-2 mRNA, complete cds
          Length = 1023

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 67/76 (88%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||||||||||| |||||||| || ||||||||||| || || ||||| ||||| |
Sbjct: 145 ccaaggagctgggaactgtcatgcgttccctggggcagaatcccactgaggcagagcttc 204

                           
Query: 88  aggacatgatcaatga 103
           | ||||||||||||||
Sbjct: 205 aagacatgatcaatga 220

---

>gb|U48690.1|TAU48690 Triticum aestivum calmodulin TaCaM2-1 mRNA, complete cds
          Length = 1125

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 67/76 (88%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||||||||||| |||||||| || ||||||||||| || || ||||| ||||| |
Sbjct: 242 ccaaggagctgggaactgtcatgcgttccctggggcagaatcccactgaggcagagcttc 301

                           
Query: 88  aggacatgatcaatga 103
           | ||||||||||||||
Sbjct: 302 aagacatgatcaatga 317

---

>emb|AL928712.8| Zebrafish DNA sequence from clone CH211-220O11 in linkage group 17,
             complete sequence
          Length = 137441

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 78/91 (85%)
 Strand = Plus / Minus

                                                                         
Query: 28    ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
             ||||||||||||| ||||| ||||||||||| || |||||||| || || ||||| ||||
Sbjct: 90592 ccaaggagctgggcacagtgatgcgctcgctcggacagaaccccacagaagctgaactcc 90533

                                            
Query: 88    aggacatgatcaatgaagtcgacgctgntgg 118
             |||||||||| || || || ||||||| |||
Sbjct: 90532 aggacatgataaacgaggtggacgctgatgg 90502

---

>gb|U20295.1|STU20295 Solanum tuberosum clone PCM6 calmodulin mRNA, complete cds
          Length = 536

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 66/75 (88%)
 Strand = Plus / Plus

                                                                       
Query: 58  tggggcagaacccaacggaggctgagctccaggacatgatcaatgaagtcgacgctgntg 117
           |||||||||||||||| ||||||||||| || ||||||||||||||||| || |||| ||
Sbjct: 197 tggggcagaacccaactgaggctgagcttcaagacatgatcaatgaagttgatgctgatg 256

                          
Query: 118 gcaacggcaccattg 132
           | || || |||||||
Sbjct: 257 gaaatgggaccattg 271

---

>dbj|D10365.1|ORZCAMC O. latipes (killifish) mRNA for calmodulin, partial sequence
          Length = 409

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 78/91 (85%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||| |||||||| ||||| |||||||| ||||| |||||||| || ||||| ||| | |
Sbjct: 69  ccaaagagctggggacagtgatgcgctctctgggacagaaccccactgaggcagagttgc 128

                                          
Query: 88  aggacatgatcaatgaagtcgacgctgntgg 118
           ||||||||||||||||||| || |||| |||
Sbjct: 129 aggacatgatcaatgaagtggatgctgatgg 159

---

>ref|NM_031969.1| Rattus norvegicus calmodulin 1 (Calm1), mRNA
          Length = 3513

 Score = 77.8 bits (39), Expect = 8e-12
 Identities = 99/118 (83%), Gaps = 1/118 (0%)
 Strand = Plus / Plus

                                                                       
Query: 30  aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
           ||||||||||| || |||||||| || ||||| ||||||||||| |||||||| || |||
Sbjct: 138 aaggagctggggactgtcatgcggtcactgggtcagaacccaacagaggctgaactgcag 197

                                                                     
Query: 90  gacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           || |||||||| || || || || |  || || |||||||||| ||||||||||||||
Sbjct: 198 gatatgatcaacgaggtggatgccgacgggaatggcaccattg-acttcccagagttc 254

---

>gb|AY542983.1| Bigelowiella natans calmodulin mRNA, complete cds
          Length = 684

 Score = 77.8 bits (39), Expect = 8e-12
 Identities = 69/79 (87%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||| ||||||||||| ||||||||||| || || || ||||| || ||||||||||| |
Sbjct: 134 ccaaagagctgggaaccgtcatgcgctccctaggacaaaaccctaccgaggctgagctgc 193

                              
Query: 88  aggacatgatcaatgaagt 106
           ||||||||||||| |||||
Sbjct: 194 aggacatgatcaacgaagt 212

---

>gb|DQ457005.1| Synthetic construct plasmid pN1-4neo-GCaMP1.6 His-6-tagged G-CaMP1.6
            gene, complete cds
          Length = 1481

 Score = 77.8 bits (39), Expect = 8e-12
 Identities = 69/79 (87%)
 Strand = Plus / Plus

                                                                        
Query: 28   ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
            ||||||||||||| || || ||||| || |||||||||||||| || || || ||||| |
Sbjct: 1112 ccaaggagctggggacggtgatgcggtctctggggcagaaccccacagaagcagagctgc 1171

                               
Query: 88   aggacatgatcaatgaagt 106
            |||||||||||||||||||
Sbjct: 1172 aggacatgatcaatgaagt 1190

---

>gb|AY513748.1| Oreochromis mossambicus calmodulin mRNA, complete cds
          Length = 773

 Score = 77.8 bits (39), Expect = 8e-12
 Identities = 69/79 (87%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||| ||||| || || ||||||||||| ||||| ||||| || || ||||||||||| |
Sbjct: 274 ccaaagagcttgggactgtcatgcgctctctgggacagaatcctacagaggctgagctgc 333

                              
Query: 88  aggacatgatcaatgaagt 106
           |||||||||||||||||||
Sbjct: 334 aggacatgatcaatgaagt 352

---

>gb|AY459341.1| Oryza sativa (japonica cultivar-group) clone CL031105.6 R2R3-MYB gene
             region
          Length = 58956

 Score = 77.8 bits (39), Expect = 8e-12
 Identities = 100/118 (84%), Gaps = 2/118 (1%)
 Strand = Plus / Plus

                                                                         
Query: 30    aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
             |||||||| ||||| || ||||| || || || ||||||||||| ||||| ||||| |||
Sbjct: 24381 aaggagcttggaaccgtgatgcggtcccttggtcagaacccaactgaggcggagctgcag 24440

                                                                       
Query: 90    gacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
             ||||||||||| || || || |||| |||||| || ||||||| ||||||||||||||
Sbjct: 24441 gacatgatcaacgaggttgatgctgatggcaatgg-accattg-acttcccagagttc 24496

---

>ref|XM_800150.1| Trypanosoma cruzi strain CL Brener calmodulin
           (Tc00.1047053506391.10) partial mRNA
          Length = 450

 Score = 77.8 bits (39), Expect = 8e-12
 Identities = 63/71 (88%)
 Strand = Plus / Plus

                                                                       
Query: 30  aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
           |||||||| || || || |||||||||||||| |||||||| |||||||| ||||| |||
Sbjct: 91  aaggagctcggcacggtgatgcgctcgctgggccagaacccgacggaggcggagctgcag 150

                      
Query: 90  gacatgatcaa 100
           |||||||||||
Sbjct: 151 gacatgatcaa 161

---

>ref|XM_800151.1| Trypanosoma cruzi strain CL Brener calmodulin
           (Tc00.1047053506391.20) partial mRNA
          Length = 450

 Score = 77.8 bits (39), Expect = 8e-12
 Identities = 63/71 (88%)
 Strand = Plus / Plus

                                                                       
Query: 30  aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
           |||||||| || || || |||||||||||||| |||||||| |||||||| ||||| |||
Sbjct: 91  aaggagctcggcacggtgatgcgctcgctgggccagaacccgacggaggcggagctgcag 150

                      
Query: 90  gacatgatcaa 100
           |||||||||||
Sbjct: 151 gacatgatcaa 161

---

>ref|XM_802996.1| Trypanosoma cruzi strain CL Brener calmodulin
           (Tc00.1047053507483.30) partial mRNA
          Length = 624

 Score = 77.8 bits (39), Expect = 8e-12
 Identities = 63/71 (88%)
 Strand = Plus / Plus

                                                                       
Query: 30  aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
           |||||||| || || || |||||||||||||| |||||||| |||||||| ||||| |||
Sbjct: 265 aaggagctcggcacggtgatgcgctcgctgggccagaacccgacggaggcggagctgcag 324

                      
Query: 90  gacatgatcaa 100
           |||||||||||
Sbjct: 325 gacatgatcaa 335

---

>ref|XM_803000.1| Trypanosoma cruzi strain CL Brener calmodulin
           (Tc00.1047053507483.39) partial mRNA
          Length = 450

 Score = 77.8 bits (39), Expect = 8e-12
 Identities = 63/71 (88%)
 Strand = Plus / Plus

                                                                       
Query: 30  aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
           |||||||| || || || |||||||||||||| |||||||| |||||||| ||||| |||
Sbjct: 91  aaggagctcggcacggtgatgcgctcgctgggccagaacccgacggaggcggagctgcag 150

                      
Query: 90  gacatgatcaa 100
           |||||||||||
Sbjct: 151 gacatgatcaa 161

---

>ref|XM_803589.1| Trypanosoma cruzi strain CL Brener calmodulin
           (Tc00.1047053506389.79) partial mRNA
          Length = 257

 Score = 77.8 bits (39), Expect = 8e-12
 Identities = 63/71 (88%)
 Strand = Plus / Plus

                                                                       
Query: 30  aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
           |||||||| || || || |||||||||||||| |||||||| |||||||| ||||| |||
Sbjct: 91  aaggagctcggcacggtgatgcgctcgctgggccagaacccgacggaggcggagctgcag 150

                      
Query: 90  gacatgatcaa 100
           |||||||||||
Sbjct: 151 gacatgatcaa 161

---

>gb|BC058485.1| Rattus norvegicus calmodulin 2, mRNA (cDNA clone MGC:72870
           IMAGE:6921326), complete cds
          Length = 1145

 Score = 77.8 bits (39), Expect = 8e-12
 Identities = 69/79 (87%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||||||||| || || ||||| || |||||||||||||| || || || ||||| |
Sbjct: 161 ccaaggagctggggacggtgatgcggtctctggggcagaaccccacagaagcagagctgc 220

                              
Query: 88  aggacatgatcaatgaagt 106
           |||||||||||||||||||
Sbjct: 221 aggacatgatcaatgaagt 239

---

>gb|BC062085.1| Rattus norvegicus cDNA clone IMAGE:5599826, **** WARNING: chimeric
           clone ****
          Length = 1975

 Score = 77.8 bits (39), Expect = 8e-12
 Identities = 99/118 (83%), Gaps = 1/118 (0%)
 Strand = Plus / Plus

                                                                       
Query: 30  aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
           ||||||||||| || |||||||| || ||||| ||||||||||| |||||||| || |||
Sbjct: 241 aaggagctggggactgtcatgcggtcactgggtcagaacccaacagaggctgaactgcag 300

                                                                     
Query: 90  gacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           || |||||||| || || || || |  || || |||||||||| ||||||||||||||
Sbjct: 301 gatatgatcaacgaggtggatgccgacgggaatggcaccattg-acttcccagagttc 357

---

>emb|X52096.1|TCCALB2 Trypanosoma cruzi CalA2 calmodulin gene
          Length = 1111

 Score = 77.8 bits (39), Expect = 8e-12
 Identities = 63/71 (88%)
 Strand = Plus / Plus

                                                                       
Query: 30  aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
           |||||||| || || || |||||||||||||| |||||||| |||||||| ||||| |||
Sbjct: 563 aaggagctcggcacggtgatgcgctcgctgggccagaacccgacggaggcggagctgcag 622

                      
Query: 90  gacatgatcaa 100
           |||||||||||
Sbjct: 623 gacatgatcaa 633

---

>gb|DQ381402.1| Synthetic construct G-CaMP2 mRNA, complete cds
          Length = 1356

 Score = 77.8 bits (39), Expect = 8e-12
 Identities = 69/79 (87%)
 Strand = Plus / Plus

                                                                        
Query: 28   ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
            ||||||||||||| || || ||||| || |||||||||||||| || || || ||||| |
Sbjct: 995  ccaaggagctggggacggtgatgcggtctctggggcagaaccccacagaagcagagctgc 1054

                               
Query: 88   aggacatgatcaatgaagt 106
            |||||||||||||||||||
Sbjct: 1055 aggacatgatcaatgaagt 1073

---

>gb|AF441190.1|AF441190 Oryza sativa clone 15295 calmodulin (CaM) mRNA, complete cds
          Length = 633

 Score = 77.8 bits (39), Expect = 8e-12
 Identities = 99/118 (83%), Gaps = 1/118 (0%)
 Strand = Plus / Plus

                                                                       
Query: 30  aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
           |||||||| ||||| || ||||| || || || ||||||||||| ||||| ||||| |||
Sbjct: 165 aaggagcttggaaccgtgatgcggtcccttggtcagaacccaactgaggcggagctgcag 224

                                                                     
Query: 90  gacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           ||||||||||| || || || |||| |||||| || ||||||| | ||||||||||||
Sbjct: 225 gacatgatcaacgaggttgatgctgatggcaatgggaccattg-atttcccagagttc 281

---

>gb|AF030032.1| Phaseolus vulgaris calmodulin (CaM) mRNA, PvCaM-1 allele, complete
           cds
          Length = 859

 Score = 77.8 bits (39), Expect = 8e-12
 Identities = 96/114 (84%), Gaps = 1/114 (0%)
 Strand = Plus / Plus

                                                                       
Query: 33  gagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccaggac 92
           ||||| ||||| || ||||| ||  ||||||| |||||||| ||||| ||||||||||||
Sbjct: 188 gagcttggaactgttatgcgttcattggggcaaaacccaactgaggcagagctccaggac 247

                                                                 
Query: 93  atgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagtt 146
           |||||||| ||||| || |||| ||| || || ||||||| ||||||| |||||
Sbjct: 248 atgatcaacgaagtggatgctgatgggaatggtaccattg-acttccctgagtt 300

---

>ref|XM_579543.1| PREDICTED: Rattus norvegicus calmodulin 1 (Calm1), mRNA
          Length = 3515

 Score = 77.8 bits (39), Expect = 8e-12
 Identities = 99/118 (83%), Gaps = 1/118 (0%)
 Strand = Plus / Plus

                                                                       
Query: 30  aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
           ||||||||||| || |||||||| || ||||| ||||||||||| |||||||| || |||
Sbjct: 138 aaggagctggggactgtcatgcggtcactgggtcagaacccaacagaggctgaactgcag 197

                                                                     
Query: 90  gacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           || |||||||| || || || || |  || || |||||||||| ||||||||||||||
Sbjct: 198 gatatgatcaacgaggtggatgccgacgggaatggcaccattg-acttcccagagttc 254

---

>gb|AF178845.1|AF178845 Rattus norvegicus calmodulin mRNA, complete cds
          Length = 3513

 Score = 77.8 bits (39), Expect = 8e-12
 Identities = 99/118 (83%), Gaps = 1/118 (0%)
 Strand = Plus / Plus

                                                                       
Query: 30  aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
           ||||||||||| || |||||||| || ||||| ||||||||||| |||||||| || |||
Sbjct: 138 aaggagctggggactgtcatgcggtcactgggtcagaacccaacagaggctgaactgcag 197

                                                                     
Query: 90  gacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           || |||||||| || || || || |  || || |||||||||| ||||||||||||||
Sbjct: 198 gatatgatcaacgaggtggatgccgacgggaatggcaccattg-acttcccagagttc 254

---

>emb|X13933.1|RNRCM1 R.norvegicus mRNA for calmodulin (pRCM1)
          Length = 1446

 Score = 77.8 bits (39), Expect = 8e-12
 Identities = 99/118 (83%), Gaps = 1/118 (0%)
 Strand = Plus / Plus

                                                                       
Query: 30  aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
           ||||||||||| || |||||||| || ||||| ||||||||||| |||||||| || |||
Sbjct: 203 aaggagctggggactgtcatgcggtcactgggtcagaacccaacagaggctgaactgcag 262

                                                                     
Query: 90  gacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           || |||||||| || || || || |  || || |||||||||| ||||||||||||||
Sbjct: 263 gatatgatcaacgaggtggatgccgacgggaatggcaccattg-acttcccagagttc 319

---

>emb|X13835.1|RNCAMII3 R.norvegicus CaMII gene, exons 3,4 & 5
          Length = 2182

 Score = 77.8 bits (39), Expect = 8e-12
 Identities = 69/79 (87%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||||||||| || || ||||| || |||||||||||||| || || || ||||| |
Sbjct: 89  ccaaggagctggggacggtgatgcggtctctggggcagaaccccacagaagcagagctgc 148

                              
Query: 88  aggacatgatcaatgaagt 106
           |||||||||||||||||||
Sbjct: 149 aggacatgatcaatgaagt 167

---

>emb|AJ550759.1|RNO550759 Synthetic construct pN1-G-CaMP gene for calcium-sensing GFP analog
          Length = 1290

 Score = 77.8 bits (39), Expect = 8e-12
 Identities = 69/79 (87%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||||||||| || || ||||| || |||||||||||||| || || || ||||| |
Sbjct: 921 ccaaggagctggggacggtgatgcggtctctggggcagaaccccacagaagcagagctgc 980

                              
Query: 88  aggacatgatcaatgaagt 106
           |||||||||||||||||||
Sbjct: 981 aggacatgatcaatgaagt 999

---

>gb|U20297.1|STU20297 Solanum tuberosum clone PCM8 calmodulin gene, complete cds
          Length = 450

 Score = 77.8 bits (39), Expect = 8e-12
 Identities = 99/118 (83%), Gaps = 1/118 (0%)
 Strand = Plus / Plus

                                                                       
Query: 30  aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
           |||||||| ||||| || ||||| ||| |||| || || ||||| ||||||||||| || 
Sbjct: 91  aaggagcttggaactgtgatgcgttcgttgggacaaaatccaactgaggctgagcttcaa 150

                                                                     
Query: 90  gacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           ||||||||||||||||| || |||| ||| || || ||||||| ||||||| ||||||
Sbjct: 151 gacatgatcaatgaagttgatgctgatggaaatggaaccattg-acttccccgagttc 207

---

>gb|U20293.1|STU20293 Solanum tuberosum clone PCM4 calmodulin gene, partial cds
          Length = 375

 Score = 77.8 bits (39), Expect = 8e-12
 Identities = 99/118 (83%), Gaps = 1/118 (0%)
 Strand = Plus / Plus

                                                                       
Query: 30  aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
           |||||||| ||||| || ||||| ||| |||| || || ||||| ||||||||||| || 
Sbjct: 16  aaggagcttggaactgtgatgcgttcgttgggacaaaatccaactgaggctgagcttcaa 75

                                                                     
Query: 90  gacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           ||||||||||||||||| || |||| ||| || || ||||||| ||||||| ||||||
Sbjct: 76  gacatgatcaatgaagttgatgctgatggaaatggaaccattg-acttccccgagttc 132

---

>gb|U20291.1|STU20291 Solanum tuberosum clone PCM2 calmodulin gene, partial cds
          Length = 375

 Score = 77.8 bits (39), Expect = 8e-12
 Identities = 99/118 (83%), Gaps = 1/118 (0%)
 Strand = Plus / Plus

                                                                       
Query: 30  aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
           |||||||| ||||| || ||||| ||| |||| || || ||||| ||||||||||| || 
Sbjct: 16  aaggagcttggaaccgtgatgcgttcgttgggacaaaatccaactgaggctgagcttcaa 75

                                                                     
Query: 90  gacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           ||||||||||||||||| || |||| ||| || || ||||||| ||||||| ||||||
Sbjct: 76  gacatgatcaatgaagttgatgctgatggaaatggaaccattg-acttccccgagttc 132

---

>gb|M17069.1|RATCAMA Rat calmodulin (RCM3) mRNA, complete cds
          Length = 1112

 Score = 77.8 bits (39), Expect = 8e-12
 Identities = 69/79 (87%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||||||||| || || ||||| || |||||||||||||| || || || ||||| |
Sbjct: 159 ccaaggagctggggacggtgatgcggtctctggggcagaaccccacagaagcagagctgc 218

                              
Query: 88  aggacatgatcaatgaagt 106
           |||||||||||||||||||
Sbjct: 219 aggacatgatcaatgaagt 237

---

>gb|M19312.1|RATCAM Rat calmodulin mRNA, complete cds
          Length = 1084

 Score = 77.8 bits (39), Expect = 8e-12
 Identities = 69/79 (87%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||||||||| || || ||||| || |||||||||||||| || || || ||||| |
Sbjct: 140 ccaaggagctggggacggtgatgcggtctctggggcagaaccccacagaagcagagctgc 199

                              
Query: 88  aggacatgatcaatgaagt 106
           |||||||||||||||||||
Sbjct: 200 aggacatgatcaatgaagt 218

---

>gb|M80831.1|PETCALPRO Petunia hybrida CAM53 mRNA, complete cds
          Length = 767

 Score = 77.8 bits (39), Expect = 8e-12
 Identities = 99/118 (83%), Gaps = 1/118 (0%)
 Strand = Plus / Plus

                                                                       
Query: 30  aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
           |||||||| ||||| || ||||| ||  |||| ||||||||||| ||||||||||| || 
Sbjct: 191 aaggagcttggaaccgtgatgcggtcattgggacagaacccaactgaggctgagcttcaa 250

                                                                     
Query: 90  gacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||||||| |||||||| || |||| ||| || || ||||||| ||||||| ||||||
Sbjct: 251 gacatgattaatgaagttgatgctgatgggaatgggaccattg-acttccctgagttc 307

---

>ref|NM_017326.1| Rattus norvegicus calmodulin 2 (Calm2), mRNA
          Length = 1112

 Score = 77.8 bits (39), Expect = 8e-12
 Identities = 69/79 (87%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||||||||| || || ||||| || |||||||||||||| || || || ||||| |
Sbjct: 159 ccaaggagctggggacggtgatgcggtctctggggcagaaccccacagaagcagagctgc 218

                              
Query: 88  aggacatgatcaatgaagt 106
           |||||||||||||||||||
Sbjct: 219 aggacatgatcaatgaagt 237

---

>dbj|D10366.1|ORZCAMD O. latipes (killifish) mRNA for calmodulin, partial sequence
          Length = 409

 Score = 77.8 bits (39), Expect = 8e-12
 Identities = 99/118 (83%), Gaps = 1/118 (0%)
 Strand = Plus / Plus

                                                                       
Query: 30  aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
           ||||| ||||| ||||| ||| | || ||||| || ||||| || ||||||||||| |||
Sbjct: 71  aaggaactggggacagtgatgaggtcactgggacaaaaccccactgaggctgagctacag 130

                                                                     
Query: 90  gacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagttc 147
           |||||||| ||||| || || |||| ||| ||||||||||||| ||||||| ||||||
Sbjct: 131 gacatgattaatgaggtggatgctgatggtaacggcaccattg-acttccccgagttc 187

---

>ref|NM_180529.2| Arabidopsis thaliana CAM6 (CALMODULIN 6); calcium ion binding
           AT5G21274 (CAM6) mRNA, complete cds
          Length = 758

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 88/105 (83%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||||| ||||| || ||| | || |||||||| |||||||| || |||||||| |
Sbjct: 157 ccaaggagctcggaaccgtgatgaggtctctggggcaaaacccaacagaagctgagcttc 216

                                                        
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattg 132
           | ||||||||||||||||| || || | ||| ||||| |||||||
Sbjct: 217 aagacatgatcaatgaagttgatgcagatgggaacgggaccattg 261

---

>gb|DQ207852.1| Solanum tuberosum clone 075A11 calmodulin-like mRNA, complete cds
          Length = 1109

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 77/89 (86%), Gaps = 1/89 (1%)
 Strand = Plus / Plus

                                                                       
Query: 58  tggggcagaacccaacggaggctgagctccaggacatgatcaatgaagtcgacgctgntg 117
           |||| ||||||||||| || |||||||||||||||||||| |||||||| || |||| ||
Sbjct: 158 tgggacagaacccaactgaagctgagctccaggacatgataaatgaagtggatgctgatg 217

                                        
Query: 118 gcaacggcaccattgtacttcccagagtt 146
           | || || ||||| | |||||||||||||
Sbjct: 218 gtaatggaaccatcg-acttcccagagtt 245

---

>ref|XM_414988.1| PREDICTED: Gallus gallus similar to calmodulin, striated muscle -
           chicken (LOC416692), mRNA
          Length = 1099

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 59/66 (89%)
 Strand = Plus / Plus

                                                                       
Query: 30  aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
           ||||||||||| || ||||||||||| |||||||||||||| || ||||| ||||| |||
Sbjct: 442 aaggagctgggcactgtcatgcgctcactggggcagaaccccaccgaggcggagctgcag 501

                 
Query: 90  gacatg 95
           ||||||
Sbjct: 502 gacatg 507

---

>gb|AY180259.1| Stachybotrys kampalensis strain UAMH 7746 calmodulin (Cal) gene,
           partial cds
          Length = 440

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 71/82 (86%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||||||||| || ||||||||||| ||||| ||||||||  | ||| | ||||| |
Sbjct: 242 ccaaggagctgggtaccgtcatgcgctctctgggccagaacccctccgagtccgagcttc 301

                                 
Query: 88  aggacatgatcaatgaagtcga 109
           ||||||||||||| ||||||||
Sbjct: 302 aggacatgatcaacgaagtcga 323

---

>gb|DQ450840.1| Solanum chacoense calmodulin (CAM1) mRNA, complete cds
          Length = 831

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 77/89 (86%), Gaps = 1/89 (1%)
 Strand = Plus / Plus

                                                                       
Query: 58  tggggcagaacccaacggaggctgagctccaggacatgatcaatgaagtcgacgctgntg 117
           |||| ||||||||||| || |||||||||||||||||||| |||||||| || |||| ||
Sbjct: 195 tgggacagaacccaactgaagctgagctccaggacatgataaatgaagtggatgctgatg 254

                                        
Query: 118 gcaacggcaccattgtacttcccagagtt 146
           | || || ||||||| ||||||| |||||
Sbjct: 255 gtaatggaaccattg-acttccctgagtt 282

---

>emb|Z12024.1|ATCMACAM6 A.thaliana mRNA (clone ACaM6) for calmodulin
          Length = 660

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 88/105 (83%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||||| ||||| || ||| | || |||||||| |||||||| || |||||||| |
Sbjct: 126 ccaaggagctcggaaccgtgatgaggtctctggggcaaaacccaacagaagctgagcttc 185

                                                        
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattg 132
           | ||||||||||||||||| || || | ||| ||||| |||||||
Sbjct: 186 aagacatgatcaatgaagttgatgcagatgggaacgggaccattg 230

---

>emb|Y09853.1|CACAM Cicer arietinum mRNA for CaM protein
          Length = 858

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 88/105 (83%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||| || ||||| || ||||| || || ||||| |||||||| ||||| ||||| |
Sbjct: 184 ccaaggaacttggaactgtaatgcggtctcttgggcaaaacccaactgaggcagagctgc 243

                                                        
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattg 132
           |||||||||| ||||||||||| |||| ||| || || |||||||
Sbjct: 244 aggacatgataaatgaagtcgatgctgatggaaatggtaccattg 288

---

>emb|AJ843112.1| Quercus petraea mRNA for calmodulin (caM-2 gene)
          Length = 676

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 55/61 (90%)
 Strand = Plus / Plus

                                                                       
Query: 58  tggggcagaacccaacggaggctgagctccaggacatgatcaatgaagtcgacgctgntg 117
           |||| ||||||||||| ||||| |||||||||||||||||||||||||| || |||| ||
Sbjct: 139 tgggccagaacccaactgaggcagagctccaggacatgatcaatgaagttgatgctgatg 198

            
Query: 118 g 118
           |
Sbjct: 199 g 199

---

>gb|AY094037.1| Arabidopsis thaliana AT3g43810/T28A8_100 mRNA, complete cds
          Length = 450

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 88/105 (83%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||||| ||||| || ||| | || |||||||| |||||||| || |||||||| |
Sbjct: 89  ccaaggagctcggaaccgtgatgaggtctctggggcaaaacccaacagaagctgagcttc 148

                                                        
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattg 132
           | ||||||||||||||||| || || | ||| ||||| |||||||
Sbjct: 149 aagacatgatcaatgaagttgatgcagatgggaacgggaccattg 193

---

>gb|AY050350.1| Arabidopsis thaliana AT3g43810/T28A8_100 mRNA, complete cds
          Length = 759

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 88/105 (83%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||||| ||||| || ||| | || |||||||| |||||||| || |||||||| |
Sbjct: 157 ccaaggagctcggaaccgtgatgaggtctctggggcaaaacccaacagaagctgagcttc 216

                                                        
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattg 132
           | ||||||||||||||||| || || | ||| ||||| |||||||
Sbjct: 217 aagacatgatcaatgaagttgatgcagatgggaacgggaccattg 261

---

>gb|L20507.1|VIRCALMODU Vigna radiata calmodulin mRNA, complete cds
          Length = 820

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 98/117 (83%), Gaps = 1/117 (0%)
 Strand = Plus / Plus

                                                                       
Query: 30  aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
           |||||||| ||||| || ||||| ||  ||||||| |||||||| ||||| || ||||||
Sbjct: 173 aaggagctcggaactgttatgcgttcattggggcaaaacccaactgaggcagaactccag 232

                                                                    
Query: 90  gacatgatcaatgaagtcgacgctgntggcaacggcaccattgtacttcccagagtt 146
           ||||||||||| ||||| || |||| ||| || || ||||||| ||||||| |||||
Sbjct: 233 gacatgatcaacgaagtggatgctgatgggaatggtaccattg-acttccctgagtt 288

---

>emb|BX824041.1|CNS0A7BJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH17ZG03 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 376

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 88/105 (83%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||||| ||||| || ||| | || |||||||| |||||||| || |||||||| |
Sbjct: 14  ccaaggagctcggaaccgtgatgaggtctctggggcaaaacccaacagaagctgagcttc 73

                                                        
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattg 132
           | ||||||||||||||||| || || | ||| ||||| |||||||
Sbjct: 74  aagacatgatcaatgaagttgatgcagatgggaacgggaccattg 118

---

>emb|BX822955.1|CNS0A7H5 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB76ZA01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 455

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 88/105 (83%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||||| ||||| || ||| | || |||||||| |||||||| || |||||||| |
Sbjct: 92  ccaaggagctcggaaccgtgatgaggtctctggggcaaaacccaacagaagctgagcttc 151

                                                        
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattg 132
           | ||||||||||||||||| || || | ||| ||||| |||||||
Sbjct: 152 aagacatgatcaatgaagttgatgcagatgggaacgggaccattg 196

---

>emb|BX825155.1|CNS0A68K Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL16ZF10 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 455

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 88/105 (83%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||||| ||||| || ||| | || |||||||| |||||||| || |||||||| |
Sbjct: 92  ccaaggagctcggaaccgtgatgaggtctctggggcaaaacccaacagaagctgagcttc 151

                                                        
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattg 132
           | ||||||||||||||||| || || | ||| ||||| |||||||
Sbjct: 152 aagacatgatcaatgaagttgatgcagatgggaacgggaccattg 196

---

>gb|AC140977.1| Arabidopsis thaliana chromosome 5 BAC F13M11 genomic sequence, complete
             sequence
          Length = 112600

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 88/105 (83%)
 Strand = Plus / Plus

                                                                         
Query: 28    ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
             |||||||||| ||||| || ||| | || |||||||| |||||||| || |||||||| |
Sbjct: 59835 ccaaggagctcggaaccgtgatgaggtctctggggcaaaacccaacagaagctgagcttc 59894

                                                          
Query: 88    aggacatgatcaatgaagtcgacgctgntggcaacggcaccattg 132
             | ||||||||||||||||| || || | ||| ||||| |||||||
Sbjct: 59895 aagacatgatcaatgaagttgatgcagatgggaacgggaccattg 59939

---

>gb|AC171018.2| Gallus gallus BAC clone CH261-11F14 from chromosome ul, complete
             sequence
          Length = 216886

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                         
Query: 30    aaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctccag 89
             ||||||||||| || ||||||||||| |||||||||||||| || ||||| ||||| |||
Sbjct: 94344 aaggagctgggcactgtcatgcgctcactggggcagaaccccaccgaggcggagctgcag 94285

                   
Query: 90    gacatg 95
             ||||||
Sbjct: 94284 gacatg 94279

---

>gb|U91642.1|POU91642 Pleurotus ostreatus calmodulin mRNA, complete cds
          Length = 576

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 88/105 (83%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||| ||||| ||||| ||||||||||| |||||||||||||| || || || ||  | |
Sbjct: 102 ccaaagagctcggaaccgtcatgcgctcactggggcagaaccccaccgaagccgaattgc 161

                                                        
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattg 132
           ||||||||||||| ||||| ||||| |  ||||||||||| ||||
Sbjct: 162 aggacatgatcaacgaagttgacgcagacggcaacggcacgattg 206

---

>gb|U20294.1|STU20294 Solanum tuberosum clone PCM5 calmodulin gene, complete cds
          Length = 450

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 77/89 (86%), Gaps = 1/89 (1%)
 Strand = Plus / Plus

                                                                       
Query: 58  tggggcagaacccaacggaggctgagctccaggacatgatcaatgaagtcgacgctgntg 117
           |||| ||||||||||| || |||||||||||||||||||| |||||||| || |||| ||
Sbjct: 119 tgggacagaacccaactgaagctgagctccaggacatgataaatgaagtggatgctgatg 178

                                        
Query: 118 gcaacggcaccattgtacttcccagagtt 146
           | || || ||||| | |||||||||||||
Sbjct: 179 gtaatggaaccatcg-acttcccagagtt 206

---

>gb|J05116.1|ACKCAL A.klebsiana calmodulin gene, complete cds
          Length = 1254

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 88/105 (83%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           ||||||| || || || |||||||| ||| | || || |||||||| || ||||| ||||
Sbjct: 583 ccaaggaactcggtaccgtcatgcgttcggtcggccaaaacccaaccgaagctgaactcc 642

                                                        
Query: 88  aggacatgatcaatgaagtcgacgctgntggcaacggcaccattg 132
           | || |||||||| |||||||| |||| |||||||||||||||||
Sbjct: 643 aagatatgatcaacgaagtcgatgctgatggcaacggcaccattg 687

---

>gb|AY725755.1| Cylindrocladium hongkongense strain CBS 114828 calmodulin (cmdA)
           gene, exons 3 through 5 and partial cds
          Length = 475

 Score = 73.8 bits (37), Expect = 1e-10
 Identities = 73/85 (85%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||||| || || ||||||||||| ||||| ||||||||  | ||| ||||||| |
Sbjct: 283 ccaaggagcttggcactgtcatgcgctccctgggccagaacccctccgagtctgagcttc 342

                                    
Query: 88  aggacatgatcaatgaagtcgacgc 112
           ||||||||||||| || ||||||||
Sbjct: 343 aggacatgatcaacgaggtcgacgc 367

---

>gb|AY725754.1| Cylindrocladium hongkongense strain CBS 114711 calmodulin (cmdA)
           gene, exons 3 through 5 and partial cds
          Length = 475

 Score = 73.8 bits (37), Expect = 1e-10
 Identities = 73/85 (85%)
 Strand = Plus / Plus

                                                                       
Query: 28  ccaaggagctgggaacagtcatgcgctcgctggggcagaacccaacggaggctgagctcc 87
           |||||||||| || || ||||||||||| ||||| ||||||||  | ||| ||||||| |
Sbjct: 283 ccaaggagcttggcactgtcatgcgctccctgggccagaacccctccgagtctgagcttc 342

                                    
Query: 88  aggacatgatcaatgaagtcgacgc 112
           ||||||||||||| || ||||||||
Sbjct: 343 aggacatgatcaacgaggtcgacgc 367


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 898,446
Number of Sequences: 3902068
Number of extensions: 898446
Number of successful extensions: 67584
Number of sequences better than 10.0: 2084
Number of HSP's better than 10.0 without gapping: 2061
Number of HSP's successfully gapped in prelim test: 24
Number of HSP's that attempted gapping in prelim test: 65063
Number of HSP's gapped (non-prelim): 2348
length of query: 147
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 126
effective length of database: 17,151,101,840
effective search space: 2161038831840
effective search space used: 2161038831840
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)

---