Clone Information

BLAST Search Result

Clone Name	bags20b06
Clone Library Name	barley_pub

No.	Definition	Score (bits)	E Value
1	gb\|AC137593.2\| Oryza sativa (Japonica cultiva-group) chromosome ...	149	1e-32
2	dbj\|AP008215.1\| Oryza sativa (japonica cultivar-group) genomic D...	149	1e-32
3	gb\|AY107797.1\| Zea mays PCO101826 mRNA sequence	96	1e-16
4	gb\|AC115484.2\| Drosophila melanogaster clone BACR06K01, complete...	48	0.031
5	gb\|AC092399.2\| Drosophila melanogaster, chromosome 2L, region 36...	48	0.031
6	gb\|AC092395.1\|AC092395 Drosophila melanogaster, chromosome 2L, r...	48	0.031
7	gb\|AE003649.2\| Drosophila melanogaster chromosome 2L, section 58...	48	0.031
8	gb\|AC112210.2\| Homo sapiens chromosome 3 clone RP11-221D23, comp...	44	0.48
9	gb\|AC158996.2\| Mus musculus BAC clone RP24-137I10 from chromosom...	44	0.48
10	gb\|AC092217.1\|AC092217 Drosophila melanogaster, chromosome 2L, r...	44	0.48
11	gb\|CP000250.1\| Rhodopseudomonas palustris HaA2, complete genome	44	0.48
12	dbj\|AP008207.1\| Oryza sativa (japonica cultivar-group) genomic D...	44	0.48
13	dbj\|AP002845.3\| Oryza sativa (japonica cultivar-group) genomic D...	44	0.48
14	gb\|AE003577.4\| Drosophila melanogaster chromosome 2L, section 14...	44	0.48
15	gb\|AC004371.1\|AC004371 Drosophila melanogaster DNA sequence (P1 ...	44	0.48
16	gb\|AC149782.2\| Bos taurus BAC CH240-6M21 (Children's Hospital O...	42	1.9
17	ref\|XM_752673.1\| Ustilago maydis 521 hypothetical protein (UM016...	42	1.9
18	gb\|AC175208.3\| Cavia porcellus clone CH234-14J14, complete sequence	42	1.9
19	emb\|AL939129.1\|SCO939129 Streptomyces coelicolor A3(2) complete ...	42	1.9
20	emb\|AL121770.1\|SPAC821 S.pombe chromosome I cosmid c821	42	1.9
21	gb\|AC013432.4\| Drosophila melanogaster, chromosome X, region 15F...	42	1.9
22	gb\|CP000251.1\| Anaeromyxobacter dehalogenans 2CP-C, complete genome	42	1.9
23	gb\|AE003505.3\| Drosophila melanogaster chromosome X, section 57 ...	42	1.9
24	emb\|BX322793.7\| Zebrafish DNA sequence from clone CH211-208I8 in...	42	1.9
25	emb\|BX927093.8\| Zebrafish DNA sequence from clone DKEY-53P2 in l...	42	1.9
26	emb\|X57509.1\|PUPENRPI P.univalens terminal heterochromatin penta...	42	1.9
27	ref\|NM_196097.1\| Oryza sativa (japonica cultivar-group) putative...	40	7.5
28	gb\|AE017283.1\| Propionibacterium acnes KPA171202, complete genome	40	7.5
29	gb\|AC113514.9\| Mus musculus chromosome 19, clone RP23-475D11, co...	40	7.5
30	gb\|CP000124.1\| Burkholderia pseudomallei 1710b chromosome I, com...	40	7.5
31	gb\|AC147901.2\| Xenopus tropicalis clone CH216-57C20, complete se...	40	7.5
32	gb\|AC134879.3\| Homo sapiens BAC clone RP11-295P22 from Y, comple...	40	7.5
33	ref\|XM_534544.2\| PREDICTED: Canis familiaris similar to protein ...	40	7.5
34	emb\|BX571706.24\| Zebrafish DNA sequence from clone DKEYP-123H11 ...	40	7.5
35	ref\|XM_803377.1\| Trypanosoma cruzi strain CL Brener hypothetical...	40	7.5
36	ref\|XM_813059.1\| Trypanosoma cruzi strain CL Brener hypothetical...	40	7.5
37	emb\|BX908796.11\| Zebrafish DNA sequence from clone CH211-198E20 ...	40	7.5
38	gb\|AC124178.3\| Mus musculus BAC clone RP23-193J15 from 18, compl...	40	7.5
39	gb\|AC121966.2\| Mus musculus BAC clone RP24-267N15 from 12, compl...	40	7.5
40	gb\|AC115754.7\| Mus musculus chromosome 12, clone RP23-34D20, com...	40	7.5
41	gb\|AC146866.6\| Medicago truncatula clone mth2-19a14, complete se...	40	7.5
42	emb\|CR589944.10\| Zebrafish DNA sequence from clone CH211-14I3 in...	40	7.5
43	gb\|AC158585.3\| Mus musculus chromosome 5, clone RP24-250F5, comp...	40	7.5
44	gb\|AC096691.6\| Oryza sativa chromosome 10 BAC OSJNBa0083M08 geno...	40	7.5
45	gb\|AC136932.4\| Homo sapiens chromosome 16 clone CTD-2522B17, com...	40	7.5
46	emb\|BX571965.1\| Burkholderia pseudomallei strain K96243, chromos...	40	7.5
47	emb\|AL645826.9\| Zebrafish DNA sequence from clone XX-173D22 in l...	40	7.5
48	emb\|AJ851756.1\| Gallus gallus mRNA for hypothetical protein, clo...	40	7.5
49	gb\|AC155227.3\| Rhinolophus ferrumequinum clone VMRC7-4K1, comple...	40	7.5
50	emb\|BX511135.6\| Zebrafish DNA sequence from clone CH211-134D21 i...	40	7.5
51	emb\|BX548018.9\| Zebrafish DNA sequence from clone DKEY-23O18 in ...	40	7.5
52	emb\|BX293556.14\| Zebrafish DNA sequence from clone DKEY-21N20 in...	40	7.5
53	emb\|BX572081.6\| Zebrafish DNA sequence from clone DKEYP-86G5 in ...	40	7.5
54	emb\|BX571833.6\| Zebrafish DNA sequence from clone DKEY-287J13, c...	40	7.5
55	dbj\|BS000654.1\| Pan troglodytes chromosome Y clone:PTB-129E12, c...	40	7.5
56	gb\|DQ397873.1\| Cenarchaeum symbiosum clone C13A11, complete sequ...	40	7.5
57	gb\|DP000054.1\| Pan troglodytes chromosome Y, partial sequence	40	7.5
58	emb\|BX322638.6\| Zebrafish DNA sequence from clone DKEYP-114C5 in...	40	7.5
59	gb\|AE012047.1\| Xanthomonas axonopodis pv. citri str. 306, secti...	40	7.5
60	gb\|AC023687.3\| Drosophila melanogaster X BAC RP98-36C7 (Roswell ...	40	7.5
61	gb\|AC113335.1\| Genomic sequence for Oryza sativa (japonica culti...	40	7.5
62	gb\|AC022960.13\| Homo sapiens chromosome 18, clone RP11-210K20, c...	40	7.5
63	dbj\|AK158834.1\| Mus musculus visual cortex cDNA, RIKEN full-leng...	40	7.5
64	gb\|AE017285.1\| Desulfovibrio vulgaris subsp. vulgaris str. Hilde...	40	7.5
65	gb\|AC154190.2\| Mus musculus BAC clone RP24-465P16 from chromosom...	40	7.5
66	gb\|CP000011.2\| Burkholderia mallei ATCC 23344 chromosome 2, comp...	40	7.5
67	dbj\|AP008216.1\| Oryza sativa (japonica cultivar-group) genomic D...	40	7.5
68	gb\|DP000028.1\| Rhinolophus ferrumequinum target 1 genomic scaffold	40	7.5
69	gb\|AC172374.4\| Pan troglodytes BAC clone CH251-119H6 from chromo...	40	7.5
70	gb\|AC150909.3\| Pan troglodytes BAC clone CH251-1056O7 from chrom...	40	7.5
71	gb\|AC156805.2\| Pan troglodytes BAC clone CH251-830G14 from chrom...	40	7.5
72	dbj\|BA000030.2\| Streptomyces avermitilis MA-4680 genomic DNA, co...	40	7.5
73	gb\|AE004834.1\| Pseudomonas aeruginosa PAO1, section 395 of 529 o...	40	7.5
74	gb\|AC137499.2\| Homo sapiens chromosome 16 clone RP11-317D10, com...	40	7.5
75	dbj\|BA000035.2\| Corynebacterium efficiens YS-314 DNA, complete g...	40	7.5
76	emb\|BX248394.5\| Zebrafish DNA sequence from clone CH211-205P19 i...	40	7.5
77	ref\|XM_308776.2\| Anopheles gambiae str. PEST ENSANGP00000014983 ...	40	7.5
78	emb\|AL583842.40\| Human DNA sequence from clone RP11-417J8 on chr...	40	7.5
79	gb\|AE003488.3\| Drosophila melanogaster chromosome X, section 40 ...	40	7.5
80	gb\|AY772007.1\| Nocardioides sp. JS614 putative PAPS reductase ge...	40	7.5
81	emb\|BX247867.7\| Zebrafish DNA sequence from clone CH211-268D5 in...	40	7.5
82	gb\|AC174468.2\| Medicago truncatula chromosome 2 BAC clone mth2-8...	40	7.5
83	emb\|CT030235.12\| Mouse DNA sequence from clone RP23-240F19 on ch...	40	7.5
84	gb\|AE016959.3\| Oryza sativa (japonica cultivar-group) chromosome...	40	7.5
85	gb\|CP000221.1\| Drosophila melanogaster genomic scaffold 21100002...	40	7.5
86	gb\|AC133181.2\| Mus musculus BAC clone RP24-169F11 from 8, comple...	40	7.5
87	emb\|AL929147.7\| Mouse DNA sequence from clone RP23-429P18 on chr...	40	7.5
88	emb\|AJ401317.1\|SHY401317 Saccharum hybrid cultivar R570 microsat...	40	7.5
89	emb\|X57503.1\|PUPENRPC P.univalens pentameric repeat segment DNA ...	40	7.5

>gb|AC137593.2| Oryza sativa (Japonica cultiva-group) chromosome 9 BAC clone
             OSJNBa0043I04, complete sequence
          Length = 145191

 Score =  149 bits (75), Expect = 1e-32
 Identities = 194/233 (83%), Gaps = 3/233 (1%)
 Strand = Plus / Plus

                                                                         
Query: 116   cgaggcgtcggcgcacccggacgcgccaatggattccaacgcggtgttcgccgccggcca 175
             |||||||||| ||||||| |||||||| |||||   |||||| | |||||||||||||  
Sbjct: 80685 cgaggcgtcgtcgcaccccgacgcgcccatggacctcaacgccgcgttcgccgccggcgc 80744

                                                                         
Query: 176   ggacaggatctactccgtggagatgttcaggatcttcggcaaggtcctggacttcgcgac 235
             |||||   ||||| ||||||||||||||||| ||||||||||||| || ||||||| |||
Sbjct: 80745 ggacaccgtctacgccgtggagatgttcagggtcttcggcaaggtgctcgacttcgtgac 80804

                                                                         
Query: 236   ggcgtgccgggtctc---cggcggcgagcagaggtggagccgcatcgcccgggagaacgc 292
             |||||||||||||||   |  || ||| ||  ||||| ||||  |||| ||| | |||||
Sbjct: 80805 ggcgtgccgggtctcggacaccgacgaccaccggtggcgccggctcgcgcggaacaacgc 80864

                                                                  
Query: 293   tgccgcggaggccgacgccatgtcctgccggctgaaatccatggccgtgctgc 345
              |||||||| ||||||||||||||| ||  ||||||||||||||| |||||||
Sbjct: 80865 cgccgcggacgccgacgccatgtccagcaagctgaaatccatggcggtgctgc 80917



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                               
Query: 7     cggctgttcatgctctgcgtctcgtggtgcgacc 40
             |||||| | |||||||||||||||||||||||||
Sbjct: 80569 cggctgctgatgctctgcgtctcgtggtgcgacc 80602

to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score =  149 bits (75), Expect = 1e-32
 Identities = 194/233 (83%), Gaps = 3/233 (1%)
 Strand = Plus / Plus

                                                                            
Query: 116      cgaggcgtcggcgcacccggacgcgccaatggattccaacgcggtgttcgccgccggcca 175
                |||||||||| ||||||| |||||||| |||||   |||||| | |||||||||||||  
Sbjct: 21734665 cgaggcgtcgtcgcaccccgacgcgcccatggacctcaacgccgcgttcgccgccggcgc 21734724

                                                                            
Query: 176      ggacaggatctactccgtggagatgttcaggatcttcggcaaggtcctggacttcgcgac 235
                |||||   ||||| ||||||||||||||||| ||||||||||||| || ||||||| |||
Sbjct: 21734725 ggacaccgtctacgccgtggagatgttcagggtcttcggcaaggtgctcgacttcgtgac 21734784

                                                                            
Query: 236      ggcgtgccgggtctc---cggcggcgagcagaggtggagccgcatcgcccgggagaacgc 292
                |||||||||||||||   |  || ||| ||  ||||| ||||  |||| ||| | |||||
Sbjct: 21734785 ggcgtgccgggtctcggacaccgacgaccaccggtggcgccggctcgcgcggaacaacgc 21734844

                                                                     
Query: 293      tgccgcggaggccgacgccatgtcctgccggctgaaatccatggccgtgctgc 345
                 |||||||| ||||||||||||||| ||  ||||||||||||||| |||||||
Sbjct: 21734845 cgccgcggacgccgacgccatgtccagcaagctgaaatccatggcggtgctgc 21734897



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                                  
Query: 7        cggctgttcatgctctgcgtctcgtggtgcgacc 40
                |||||| | |||||||||||||||||||||||||
Sbjct: 21734549 cggctgctgatgctctgcgtctcgtggtgcgacc 21734582

to top

>gb|AY107797.1| Zea mays PCO101826 mRNA sequence
          Length = 491

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 141/172 (81%)
 Strand = Plus / Plus

                                                                       
Query: 174 caggacaggatctactccgtggagatgttcaggatcttcggcaaggtcctggacttcgcg 233
           ||||||||||||||| |||| |||||||||||||||||||| || || || || ||||  
Sbjct: 9   caggacaggatctacgccgtagagatgttcaggatcttcggtaaagtgcttgatttcgtt 68

                                                                       
Query: 234 acggcgtgccgggtctccggcggcgagcagaggtggagccgcatcgcccgggagaacgct 293
           || || |||||||| || | || ||| |||| |||||||||  | | |||||| ||||| 
Sbjct: 69  actgcctgccgggtttcggacgccgaacagatgtggagccgggttggccgggaaaacgcg 128

                                                               
Query: 294 gccgcggaggccgacgccatgtcctgccggctgaaatccatggccgtgctgc 345
           ||  ||||||||||| ||||||| ||| |||| ||||| ||||| |||||||
Sbjct: 129 gcgacggaggccgactccatgtcatgcaggctcaaatctatggcggtgctgc 180

to top

>gb|AC115484.2| Drosophila melanogaster clone BACR06K01, complete sequence
          Length = 168504

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 451    aattccattgcattgcattgcttgctgt 478
              |||||||||||| |||||||||||||||
Sbjct: 141834 aattccattgcaatgcattgcttgctgt 141861

to top

>gb|AC092399.2| Drosophila melanogaster, chromosome 2L, region 36B-36C, BAC clone
              BACR31N11, complete sequence
          Length = 122013

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 451    aattccattgcattgcattgcttgctgt 478
              |||||||||||| |||||||||||||||
Sbjct: 117071 aattccattgcaatgcattgcttgctgt 117098

to top

>gb|AC092395.1|AC092395 Drosophila melanogaster, chromosome 2L, region 36C-36D, BAC clone
             BACR12D02, complete sequence
          Length = 164414

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 451   aattccattgcattgcattgcttgctgt 478
             |||||||||||| |||||||||||||||
Sbjct: 15189 aattccattgcaatgcattgcttgctgt 15216

to top

>gb|AE003649.2| Drosophila melanogaster chromosome 2L, section 58 of 83 of the complete
             sequence
          Length = 275699

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 451   aattccattgcattgcattgcttgctgt 478
             |||||||||||| |||||||||||||||
Sbjct: 82528 aattccattgcaatgcattgcttgctgt 82555

to top

>gb|AC112210.2| Homo sapiens chromosome 3 clone RP11-221D23, complete sequence
          Length = 146699

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 422   ttgctgactgatgtgcagctcg 443
             ||||||||||||||||||||||
Sbjct: 79818 ttgctgactgatgtgcagctcg 79839

to top

>gb|AC158996.2| Mus musculus BAC clone RP24-137I10 from chromosome 9, complete sequence
          Length = 154654

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 521   atatgatatgatatgataccaa 542
             ||||||||||||||||||||||
Sbjct: 48149 atatgatatgatatgataccaa 48170

to top

>gb|AC092217.1|AC092217 Drosophila melanogaster, chromosome 2L, region 24D-24E, BAC clone
              BACR11D14, complete sequence
          Length = 158347

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 444    gtacagcaattccattgcattgcatt 469
              |||||||||||||||| |||||||||
Sbjct: 142755 gtacagcaattccatttcattgcatt 142780

to top

>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome
          Length = 5331656

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 152     caacgcggtgttcgccgccggc 173
               ||||||||||||||||||||||
Sbjct: 3702349 caacgcggtgttcgccgccggc 3702370

to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1,
              complete sequence
          Length = 43261740

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 154    acgcggtgttcgccgccggcca 175
              ||||||||||||||||||||||
Sbjct: 492165 acgcggtgttcgccgccggcca 492186

to top

>dbj|AP002845.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0482C06
          Length = 182779

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 154    acgcggtgttcgccgccggcca 175
              ||||||||||||||||||||||
Sbjct: 132366 acgcggtgttcgccgccggcca 132387

to top

>gb|AE003577.4| Drosophila melanogaster chromosome 2L, section 14 of 83 of the complete
              sequence
          Length = 290034

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 444    gtacagcaattccattgcattgcatt 469
              |||||||||||||||| |||||||||
Sbjct: 108852 gtacagcaattccatttcattgcatt 108827

to top

>gb|AC004371.1|AC004371 Drosophila melanogaster DNA sequence (P1 DS06482 (D76)), complete
             sequence
          Length = 87124

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 444   gtacagcaattccattgcattgcatt 469
             |||||||||||||||| |||||||||
Sbjct: 19082 gtacagcaattccatttcattgcatt 19057

to top

>gb|AC149782.2| Bos taurus  BAC CH240-6M21 (Children's Hospital Oakland Research
             Institute Bovine BAC Library (male)) complete sequence
          Length = 196394

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 371   tctgtttttcttttccactta 391
             |||||||||||||||||||||
Sbjct: 71558 tctgtttttcttttccactta 71538

to top

>ref|XM_752673.1| Ustilago maydis 521 hypothetical protein (UM01619.1) partial mRNA
          Length = 2580

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 94   cgataccgctgctccagtgga 114
            |||||||||||||||||||||
Sbjct: 1290 cgataccgctgctccagtgga 1310

to top

>gb|AC175208.3| Cavia porcellus clone CH234-14J14, complete sequence
          Length = 140345

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 366   tctactctgtttttcttttccactt 390
             |||||||||||| ||||||||||||
Sbjct: 60800 tctactctgtttatcttttccactt 60824

to top

>emb|AL939129.1|SCO939129 Streptomyces coelicolor A3(2) complete genome; segment 26/29
          Length = 292200

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 240    tgccgggtctccggcggcgagcaga 264
              ||||||||||||| |||||||||||
Sbjct: 289545 tgccgggtctccgtcggcgagcaga 289521

to top

>emb|AL121770.1|SPAC821 S.pombe chromosome I cosmid c821
          Length = 35452

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 456   cattgcattgcattgcttgct 476
             |||||||||||||||||||||
Sbjct: 20190 cattgcattgcattgcttgct 20170

to top

>gb|AC013432.4| Drosophila melanogaster, chromosome X, region 15F-15F, BAC clone
             BACR01K05, complete sequence
          Length = 162761

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 521   atatgatatgatatgatacca 541
             |||||||||||||||||||||
Sbjct: 35968 atatgatatgatatgatacca 35948

to top

>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 8       ggctgttcatgctctgcgtct 28
               |||||||||||||||||||||
Sbjct: 2974295 ggctgttcatgctctgcgtct 2974275

to top

>gb|AE003505.3| Drosophila melanogaster chromosome X, section 57 of 74 of the complete
              sequence
          Length = 314205

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 521    atatgatatgatatgatacca 541
              |||||||||||||||||||||
Sbjct: 130431 atatgatatgatatgatacca 130451

to top

>emb|BX322793.7| Zebrafish DNA sequence from clone CH211-208I8 in linkage group 9,
             complete sequence
          Length = 192039

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 521   atatgatatgatatgatacca 541
             |||||||||||||||||||||
Sbjct: 76596 atatgatatgatatgatacca 76576

to top

>emb|BX927093.8| Zebrafish DNA sequence from clone DKEY-53P2 in linkage group 11,
             complete sequence
          Length = 68923

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 519   caatatgatatgatatgatac 539
             |||||||||||||||||||||
Sbjct: 38329 caatatgatatgatatgatac 38349

to top

>emb|X57509.1|PUPENRPI P.univalens terminal heterochromatin pentameric repeat segment DNA
           (clone pAm10)
          Length = 470

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 451 aattccattgcattgcattgc 471
           |||||||||||||||||||||
Sbjct: 29  aattccattgcattgcattgc 49

to top

>ref|NM_196097.1| Oryza sativa (japonica cultivar-group) putative PPR-repeat protein
            (OJ1003C07.14), mRNA
          Length = 2742

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 163  tcgccgccggccaggacagg 182
            ||||||||||||||||||||
Sbjct: 2139 tcgccgccggccaggacagg 2158

to top

>gb|AE017283.1| Propionibacterium acnes KPA171202, complete genome
          Length = 2560265

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 121     cgtcggcgcacccggacgcg 140
               ||||||||||||||||||||
Sbjct: 2320009 cgtcggcgcacccggacgcg 2320028

to top

>gb|AC113514.9| Mus musculus chromosome 19, clone RP23-475D11, complete sequence
          Length = 170366

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 364   tgtctactctgtttttcttt 383
             ||||||||||||||||||||
Sbjct: 39303 tgtctactctgtttttcttt 39284

to top

>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence
          Length = 4126292

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 163     tcgccgccggccaggacagg 182
               ||||||||||||||||||||
Sbjct: 3909229 tcgccgccggccaggacagg 3909210

to top

>gb|AC147901.2| Xenopus tropicalis clone CH216-57C20, complete sequence
          Length = 151523

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 520   aatatgatatgatatgatac 539
             ||||||||||||||||||||
Sbjct: 39151 aatatgatatgatatgatac 39170

to top

>gb|AC134879.3| Homo sapiens BAC clone RP11-295P22 from Y, complete sequence
          Length = 205515

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 450   caattccattgcattgcatt 469
             ||||||||||||||||||||
Sbjct: 85277 caattccattgcattgcatt 85296



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 452   attccattgcattgcattgc 471
             ||||||||||||||||||||
Sbjct: 66986 attccattgcattgcattgc 67005

to top

>ref|XM_534544.2| PREDICTED: Canis familiaris similar to protein tyrosine phosphatase,
            non-receptor type 18 (LOC606794), mRNA
          Length = 11301

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 301  aggccgacgccatgtcctgc 320
            ||||||||||||||||||||
Sbjct: 5202 aggccgacgccatgtcctgc 5221

to top

>emb|BX571706.24| Zebrafish DNA sequence from clone DKEYP-123H11 in linkage group 11,
              complete sequence
          Length = 196333

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 520    aatatgatatgatatgatac 539
              ||||||||||||||||||||
Sbjct: 179164 aatatgatatgatatgatac 179183

to top

>ref|XM_803377.1| Trypanosoma cruzi strain CL Brener hypothetical protein
           (Tc00.1047053506895.20) partial mRNA
          Length = 1596

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 55  acaaggtggtgcggaaggtg 74
           ||||||||||||||||||||
Sbjct: 539 acaaggtggtgcggaaggtg 558

to top

>ref|XM_813059.1| Trypanosoma cruzi strain CL Brener hypothetical protein
           (Tc00.1047053508501.270) partial mRNA
          Length = 1596

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 55  acaaggtggtgcggaaggtg 74
           ||||||||||||||||||||
Sbjct: 539 acaaggtggtgcggaaggtg 558

to top

>emb|BX908796.11| Zebrafish DNA sequence from clone CH211-198E20 in linkage group 15,
             complete sequence
          Length = 204627

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 519   caatatgatatgatatgata 538
             ||||||||||||||||||||
Sbjct: 58283 caatatgatatgatatgata 58302

to top

>gb|AC124178.3| Mus musculus BAC clone RP23-193J15 from 18, complete sequence
          Length = 206833

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 519   caatatgatatgatatgata 538
             ||||||||||||||||||||
Sbjct: 88265 caatatgatatgatatgata 88246

to top

>gb|AC121966.2| Mus musculus BAC clone RP24-267N15 from 12, complete sequence
          Length = 163521

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 519    caatatgatatgatatgata 538
              ||||||||||||||||||||
Sbjct: 149748 caatatgatatgatatgata 149767

to top

>gb|AC115754.7| Mus musculus chromosome 12, clone RP23-34D20, complete sequence
          Length = 217173

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 519    caatatgatatgatatgata 538
              ||||||||||||||||||||
Sbjct: 205576 caatatgatatgatatgata 205557

to top

>gb|AC146866.6| Medicago truncatula clone mth2-19a14, complete sequence
          Length = 145002

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 368   tactctgtttttcttttcca 387
             ||||||||||||||||||||
Sbjct: 79246 tactctgtttttcttttcca 79227

to top

>emb|CR589944.10| Zebrafish DNA sequence from clone CH211-14I3 in linkage group 11,
             complete sequence
          Length = 157142

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 519   caatatgatatgatatgata 538
             ||||||||||||||||||||
Sbjct: 62930 caatatgatatgatatgata 62911

to top

>gb|AC158585.3| Mus musculus chromosome 5, clone RP24-250F5, complete sequence
          Length = 158066

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 519   caatatgatatgatatgata 538
             ||||||||||||||||||||
Sbjct: 67536 caatatgatatgatatgata 67555

to top

>gb|AC096691.6| Oryza sativa chromosome 10 BAC OSJNBa0083M08 genomic sequence, complete
             sequence
          Length = 106110

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 163   tcgccgccggccaggacagg 182
             ||||||||||||||||||||
Sbjct: 10935 tcgccgccggccaggacagg 10954

to top

>gb|AC136932.4| Homo sapiens chromosome 16 clone CTD-2522B17, complete sequence
          Length = 171882

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 452    attccattgcattgcattgc 471
              ||||||||||||||||||||
Sbjct: 153379 attccattgcattgcattgc 153398



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 452    attccattgcattgcattgc 471
              ||||||||||||||||||||
Sbjct: 147552 attccattgcattgcattgc 147571

to top

>emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromosome 1, complete sequence
          Length = 4074542

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 163     tcgccgccggccaggacagg 182
               ||||||||||||||||||||
Sbjct: 3651041 tcgccgccggccaggacagg 3651022

to top

>emb|AL645826.9| Zebrafish DNA sequence from clone XX-173D22 in linkage group 9 Contains
             a transposase pseudogene, a novel gene similar to human
             SCEL (sciellin), the 5' part of a novel gene and two CpG
             islands, complete sequence
          Length = 88949

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 515   atctcaatatgatatgatatgata 538
             |||| |||||||||||||||||||
Sbjct: 44746 atctaaatatgatatgatatgata 44769

to top

>emb|AJ851756.1| Gallus gallus mRNA for hypothetical protein, clone 27f8
          Length = 4458

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 366  tctactctgtttttcttttc 385
            ||||||||||||||||||||
Sbjct: 4377 tctactctgtttttcttttc 4396

to top

>gb|AC155227.3| Rhinolophus ferrumequinum clone VMRC7-4K1, complete sequence
          Length = 160979

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 521    atatgatatgatatgatacc 540
              ||||||||||||||||||||
Sbjct: 109696 atatgatatgatatgatacc 109677

to top

>emb|BX511135.6| Zebrafish DNA sequence from clone CH211-134D21 in linkage group 5,
             complete sequence
          Length = 164976

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 515   atctcaatatgatatgatatgata 538
             |||| |||||||||||||||||||
Sbjct: 18707 atctaaatatgatatgatatgata 18730

to top

>emb|BX548018.9| Zebrafish DNA sequence from clone DKEY-23O18 in linkage group 14,
             complete sequence
          Length = 113040

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 519   caatatgatatgatatgata 538
             ||||||||||||||||||||
Sbjct: 38612 caatatgatatgatatgata 38593

to top

>emb|BX293556.14| Zebrafish DNA sequence from clone DKEY-21N20 in linkage group 11,
             complete sequence
          Length = 212880

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 520   aatatgatatgatatgatac 539
             ||||||||||||||||||||
Sbjct: 38985 aatatgatatgatatgatac 39004

to top

>emb|BX572081.6| Zebrafish DNA sequence from clone DKEYP-86G5 in linkage group 11,
             complete sequence
          Length = 152148

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 519   caatatgatatgatatgata 538
             ||||||||||||||||||||
Sbjct: 95315 caatatgatatgatatgata 95334

to top

>emb|BX571833.6| Zebrafish DNA sequence from clone DKEY-287J13, complete sequence
          Length = 198050

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 520   aatatgatatgatatgatac 539
             ||||||||||||||||||||
Sbjct: 29457 aatatgatatgatatgatac 29476

to top

>dbj|BS000654.1| Pan troglodytes chromosome Y clone:PTB-129E12, complete sequences
          Length = 193714

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 452    attccattgcattgcattgc 471
              ||||||||||||||||||||
Sbjct: 172186 attccattgcattgcattgc 172205

to top

>gb|DQ397873.1| Cenarchaeum symbiosum clone C13A11, complete sequence
          Length = 40499

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 510   ataccatctcaatatgatatgata 533
             ||||||||||||||||||| ||||
Sbjct: 20892 ataccatctcaatatgataggata 20869

to top

>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence
          Length = 23952694

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 452     attccattgcattgcattgc 471
               ||||||||||||||||||||
Sbjct: 6016935 attccattgcattgcattgc 6016954

to top

>emb|BX322638.6| Zebrafish DNA sequence from clone DKEYP-114C5 in linkage group 11,
             complete sequence
          Length = 85185

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 369   actctgtttttcttttccac 388
             ||||||||||||||||||||
Sbjct: 20278 actctgtttttcttttccac 20297

to top

>gb|AE012047.1| Xanthomonas axonopodis pv. citri str. 306,  section 425 of 469 of the
            complete genome
          Length = 11178

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 51   gaggacaaggtggtgcggaa 70
            ||||||||||||||||||||
Sbjct: 5404 gaggacaaggtggtgcggaa 5385

to top

>gb|AC023687.3| Drosophila melanogaster X BAC RP98-36C7 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 185848

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 520    aatatgatatgatatgatac 539
              ||||||||||||||||||||
Sbjct: 120145 aatatgatatgatatgatac 120126

to top

>gb|AC113335.1| Genomic sequence for Oryza sativa (japonica cultivar-group) cultivar
              Nipponbare clone OJ1003C07, from chromosome 10, complete
              sequence
          Length = 115188

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 163    tcgccgccggccaggacagg 182
              ||||||||||||||||||||
Sbjct: 101756 tcgccgccggccaggacagg 101775

to top

>gb|AC022960.13| Homo sapiens chromosome 18, clone RP11-210K20, complete sequence
          Length = 171051

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 520    aatatgatatgatatgatac 539
              ||||||||||||||||||||
Sbjct: 121552 aatatgatatgatatgatac 121571

to top

>dbj|AK158834.1| Mus musculus visual cortex cDNA, RIKEN full-length enriched library,
            clone:K430340P04 product:unclassifiable, full insert
            sequence
          Length = 4199

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 330  tccatggccgtgctgctcct 349
            ||||||||||||||||||||
Sbjct: 1022 tccatggccgtgctgctcct 1003

to top

>gb|AE017285.1| Desulfovibrio vulgaris subsp. vulgaris str. Hildenborough, complete genome
          Length = 3570858

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 239     gtgccgggtctccggcggcg 258
               ||||||||||||||||||||
Sbjct: 1330118 gtgccgggtctccggcggcg 1330137

to top

>gb|AC154190.2| Mus musculus BAC clone RP24-465P16 from chromosome 16, complete
             sequence
          Length = 150894

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 330   tccatggccgtgctgctcct 349
             ||||||||||||||||||||
Sbjct: 25706 tccatggccgtgctgctcct 25687

to top

>gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, complete sequence
          Length = 2325379

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 163    tcgccgccggccaggacagg 182
              ||||||||||||||||||||
Sbjct: 532844 tcgccgccggccaggacagg 532863

to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 163      tcgccgccggccaggacagg 182
                ||||||||||||||||||||
Sbjct: 11057301 tcgccgccggccaggacagg 11057282

to top

>gb|DP000028.1| Rhinolophus ferrumequinum target 1 genomic scaffold
          Length = 1756392

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 521     atatgatatgatatgatacc 540
               ||||||||||||||||||||
Sbjct: 1442364 atatgatatgatatgatacc 1442345

to top

>gb|AC172374.4| Pan troglodytes BAC clone CH251-119H6 from chromosome y, complete
             sequence
          Length = 176115

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 452   attccattgcattgcattgc 471
             ||||||||||||||||||||
Sbjct: 50601 attccattgcattgcattgc 50620

to top

>gb|AC150909.3| Pan troglodytes BAC clone CH251-1056O7 from chromosome y, complete
              sequence
          Length = 178039

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 452    attccattgcattgcattgc 471
              ||||||||||||||||||||
Sbjct: 177642 attccattgcattgcattgc 177661

to top

>gb|AC156805.2| Pan troglodytes BAC clone CH251-830G14 from chromosome y, complete
             sequence
          Length = 230623

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 452   attccattgcattgcattgc 471
             ||||||||||||||||||||
Sbjct: 92011 attccattgcattgcattgc 91992

to top

>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 153     aacgcggtgttcgccgccgg 172
               ||||||||||||||||||||
Sbjct: 2613050 aacgcggtgttcgccgccgg 2613069

to top

>gb|AE004834.1| Pseudomonas aeruginosa PAO1, section 395 of 529 of the complete
            genome
          Length = 11537

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 309  gccatgtcctgccggctgaa 328
            ||||||||||||||||||||
Sbjct: 4480 gccatgtcctgccggctgaa 4461

to top

>gb|AC137499.2| Homo sapiens chromosome 16 clone RP11-317D10, complete sequence
          Length = 159831

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 452   attccattgcattgcattgc 471
             ||||||||||||||||||||
Sbjct: 22509 attccattgcattgcattgc 22490

to top

>dbj|BA000035.2| Corynebacterium efficiens YS-314 DNA, complete genome
          Length = 3147090

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 296     cgcggaggccgacgccatgt 315
               ||||||||||||||||||||
Sbjct: 3101214 cgcggaggccgacgccatgt 3101195

to top

>emb|BX248394.5| Zebrafish DNA sequence from clone CH211-205P19 in linkage group 12,
             complete sequence
          Length = 143099

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 519   caatatgatatgatatgata 538
             ||||||||||||||||||||
Sbjct: 27202 caatatgatatgatatgata 27183

to top

>ref|XM_308776.2| Anopheles gambiae str. PEST ENSANGP00000014983
           (ENSANGG00000012494), partial mRNA
          Length = 2943

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 65  gcggaaggtgttcgagctga 84
           ||||||||||||||||||||
Sbjct: 759 gcggaaggtgttcgagctga 778

to top

>emb|AL583842.40| Human DNA sequence from clone RP11-417J8 on chromosome 1, complete
           sequence
          Length = 195588

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 452 attccattgcattgcattgc 471
           ||||||||||||||||||||
Sbjct: 79  attccattgcattgcattgc 60

to top

>gb|AE003488.3| Drosophila melanogaster chromosome X, section 40 of 74 of the complete
              sequence
          Length = 315134

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 520    aatatgatatgatatgatac 539
              ||||||||||||||||||||
Sbjct: 229993 aatatgatatgatatgatac 230012

to top

>gb|AY772007.1| Nocardioides sp. JS614 putative PAPS reductase gene, partial cds;
             putative argininosuccinate lyase, putative
             1-aminocyclopropane-1-carboxylate deaminase, putative
             adenylosuccinate lyase, putative phosphosulfolactate
             synthase, putative oxidoreductase/dehydrogenase, putative
             short-chain dehydrogenase, putative acyl-CoA transferase,
             putative acyl-CoA synthetase, epoxyalkane: coenzyme M
             transferase (etnE), probable alkene monooxygenase beta
             subunit (etnA), probable alkene monooxygenase effector
             (etnB), probable alkene monooxygenase alpha subunit
             (etnC), probable alkene monooxygenase reductase,
             hypothetical proteins, putative dimethylsulfoxide
             reductase, hypothetical protein, putative TraA conjugation
             protein, hypothetical protein, putative ParB partitioning
             protein, and hypothetical proteins genes, complete cds;
             putative DNA integrase/recombinase gene, partial cds; and
             unknown gene
          Length = 34814

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 223   tggacttcgcgacggcgtgc 242
             ||||||||||||||||||||
Sbjct: 11580 tggacttcgcgacggcgtgc 11599

to top

>emb|BX247867.7| Zebrafish DNA sequence from clone CH211-268D5 in linkage group 24,
              complete sequence
          Length = 146928

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 520    aatatgatatgatatgatac 539
              ||||||||||||||||||||
Sbjct: 115456 aatatgatatgatatgatac 115437

to top

>gb|AC174468.2| Medicago truncatula chromosome 2 BAC clone mth2-89f22, complete
             sequence
          Length = 89512

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 522   tatgatatgatatgatacca 541
             ||||||||||||||||||||
Sbjct: 84203 tatgatatgatatgatacca 84222

to top

>emb|CT030235.12| Mouse DNA sequence from clone RP23-240F19 on chromosome 16, complete
             sequence
          Length = 236028

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 330   tccatggccgtgctgctcct 349
             ||||||||||||||||||||
Sbjct: 20722 tccatggccgtgctgctcct 20741

to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 163      tcgccgccggccaggacagg 182
                ||||||||||||||||||||
Sbjct: 11063741 tcgccgccggccaggacagg 11063722

to top

>gb|CP000221.1| Drosophila melanogaster genomic scaffold 211000022280740
          Length = 552562

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 456    cattgcattgcattgcttgc 475
              ||||||||||||||||||||
Sbjct: 211759 cattgcattgcattgcttgc 211740

to top

>gb|AC133181.2| Mus musculus BAC clone RP24-169F11 from 8, complete sequence
          Length = 140384

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 520   aatatgatatgatatgatac 539
             ||||||||||||||||||||
Sbjct: 68029 aatatgatatgatatgatac 68048

to top

>emb|AL929147.7| Mouse DNA sequence from clone RP23-429P18 on chromosome 2, complete
              sequence
          Length = 155602

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 518    tcaatatgatatgatatgat 537
              ||||||||||||||||||||
Sbjct: 105713 tcaatatgatatgatatgat 105694

to top

>emb|AJ401317.1|SHY401317 Saccharum hybrid cultivar R570 microsatellite DNA, clone mSSCIR40
          Length = 424

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 452 attccattgcattgcattgc 471
           ||||||||||||||||||||
Sbjct: 360 attccattgcattgcattgc 379

to top

>emb|X57503.1|PUPENRPC P.univalens pentameric repeat segment DNA (clone pAm3)
          Length = 537

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 452 attccattgcattgcattgc 471
           ||||||||||||||||||||
Sbjct: 422 attccattgcattgcattgc 441



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 451 aattccattgcattgcattg 470
           ||||||||||||||||||||
Sbjct: 136 aattccattgcattgcattg 155


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,677,794
Number of Sequences: 3902068
Number of extensions: 4677794
Number of successful extensions: 107165
Number of sequences better than 10.0: 89
Number of HSP's better than 10.0 without gapping: 89
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 105299
Number of HSP's gapped (non-prelim): 1856
length of query: 556
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 533
effective length of database: 17,143,297,704
effective search space: 9137377676232
effective search space used: 9137377676232
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

to top

full-length cDNA and EST

Clone Information

BLAST Search Result