ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags19n08
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC123665.9| Mus musculus chromosome 14, clone RP23-226A4, com... 44 0.60
2gb|AC120837.6| Mus musculus Strain C57BL6/J chromosome 11 BAC, R... 44 0.60
3emb|AL603745.16| Mouse DNA sequence from clone RP23-392I13 on ch... 44 0.60
4emb|BX088552.1|CNS09S4T Mus musculus chromosome 11 region in the... 44 0.60
5gb|AC164977.2| Mus musculus BAC clone RP23-446B6 from chromosome... 44 0.60
6emb|AL713882.1|CNS07YOZ Mus musculus chromosome 11 region in the... 44 0.60
7gb|AC150524.3| Bos taurus BAC CH240-89P8 (Children's Hospital O... 42 2.4
8gb|AC093331.9| Homo sapiens chromosome 8, clone RP11-59O2, compl... 42 2.4
9emb|CR380952.1| Candida glabrata strain CBS138 chromosome F comp... 42 2.4
10dbj|AP007157.1| Aspergillus oryzae RIB40 genomic DNA, SC023 42 2.4
11gb|AC097516.2| Homo sapiens BAC clone RP11-468A23 from 4, comple... 42 2.4
12gb|AC148686.1| Macaca mulatta Major Histocompatibility Complex B... 42 2.4
13dbj|AB128049.1| Macaca mulatta genes, MHC class I region, partia... 42 2.4
14gb|AY740018.1| Homo sapiens paired box gene 1 (PAX1) gene, parti... 40 9.4
15gb|AY692264.1| Bacteriophage T5 strain st0 deletion mutant, comp... 40 9.4
16gb|AY543070.1| Bacteriophage T5, complete genome 40 9.4
17ref|XM_723199.1| Plasmodium yoelii yoelii str. 17XNL CCAAT-box D... 40 9.4
18gb|AC078848.3| Homo sapiens BAC clone CTD-2220I23 from 7, comple... 40 9.4
19ref|XM_672856.1| Plasmodium berghei strain ANKA hypothetical pro... 40 9.4
20emb|AL391356.22| Human DNA sequence from clone RP11-100A13 on ch... 40 9.4
21emb|AL035562.14|HS1065O2 Human DNA sequence from clone RP5-1065O... 40 9.4
22emb|AL162755.2|NMA4Z2491 Neisseria meningitidis serogroup A stra... 40 9.4
23gb|AC063923.21| Homo sapiens 3 BAC RP11-59E19 (Roswell Park Canc... 40 9.4
24gb|AC128658.3| Homo sapiens 3 BAC CTB-124C22 (Cal Tech Human BAC... 40 9.4
25gb|AC107460.5| Homo sapiens chromosome 8, clone RP11-452N4, comp... 40 9.4
26gb|AC009470.4| Homo sapiens BAC clone RP11-125K7 from 11, comple... 40 9.4
27gb|AC025432.4| Homo sapiens chromosome 3 clone CTB-124C22, compl... 40 9.4
28gb|AC010370.5| Homo sapiens chromosome 3 clone CTD-2049J23, comp... 40 9.4
29gb|DP000006.1| Oryctolagus cuniculus target 1 genomic scaffold 40 9.4
30gb|AC019342.8|AC019342 Homo sapiens, clone RP11-21D15, complete ... 40 9.4
31tpg|BK005598.1| TPA: TPA_exp: Homo sapiens NSP (NSP) gene, compl... 40 9.4
32gb|AE002098.2| Neisseria meningitidis MC58, complete genome 40 9.4
33dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 40 9.4
34gb|AC005183.3| Homo sapiens 12 BAC RP11-288K12 (Roswell Park Can... 40 9.4
35gb|AC153100.3| Oryctolagus cuniculus clone LB1-192J7, complete s... 40 9.4
36dbj|AP004863.3| Oryza sativa (japonica cultivar-group) genomic D... 40 9.4
37dbj|AP004093.3| Oryza sativa (japonica cultivar-group) genomic D... 40 9.4
38dbj|BS000236.1| Pan troglodytes chromosome 22 clone:PTB-058L13, ... 40 9.4
39gb|AC005016.1|AC005016 Homo sapiens BAC clone GS1-180J15 from 7q... 40 9.4
40gb|AY587007.1| Bacteriophage T5 strain ATCC 11303-B5, complete g... 40 9.4
41emb|AJ437103.1|GSP437103 Glomus arbuscular mycorrhizal symbiont ... 40 9.4
42dbj|AP001751.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 40 9.4
43gb|AC004702.1|AC004702 Homo sapiens chromosome 17, clone HRPC836... 40 9.4
44gb|AC124442.3| Mus musculus BAC clone RP24-178G20 from 7, comple... 40 9.4
45emb|AL929346.5| Zebrafish DNA sequence from clone DKEY-38P12, co... 40 9.4
46dbj|AP001048.1| Homo sapiens genomic DNA, chromosome 21, clone:K... 40 9.4
47emb|AL732603.3| Mouse DNA sequence from clone RP23-154H8 on chro... 40 9.4
48dbj|AP001266.4| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 9.4
49emb|AL627406.15| Mouse DNA sequence from clone RP23-188A12 on ch... 40 9.4 
>gb|AC123665.9| Mus musculus chromosome 14, clone RP23-226A4, complete sequence
          Length = 241576

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 161    tctgacataaaatttagcactg 182
              ||||||||||||||||||||||
Sbjct: 150786 tctgacataaaatttagcactg 150765
to top
>gb|AC120837.6| Mus musculus Strain C57BL6/J chromosome 11 BAC, RP23-439E2, Complete
             Sequence, complete sequence
          Length = 211996

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 459   tttggaggcctgaaattgatgt 480
             ||||||||||||||||||||||
Sbjct: 39601 tttggaggcctgaaattgatgt 39622
to top
>emb|AL603745.16| Mouse DNA sequence from clone RP23-392I13 on chromosome 11 Contains the
             5' end of the Rad51l3 gene for RAD51-like 3 (S.
             cerevisiae), two novel genes, the gene for a novel WD40
             repeat containing protein, the Cmya4 gene for
             cardiomyopathy associated 4, a novel gene,  the Slfn5,
             Slfn9, Slfn8 and Slfn2 genes for schlafen 5, 9, 8 and 2, a
             SET domain-containing protein 8 (Set8) pseudogene, a
             ribosomal protein L12 (Rpl12) pseudogene, a schlafen
             (Slfn) pseudogene and a CpG island, complete sequence
          Length = 198392

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 459   tttggaggcctgaaattgatgt 480
             ||||||||||||||||||||||
Sbjct: 58388 tttggaggcctgaaattgatgt 58367
to top
>emb|BX088552.1|CNS09S4T Mus musculus chromosome 11 region in the Om locus area (D11Mit37-Scya6)
             clone CITB-248O2 of library Caltech CITB-BAC from
             chromosome 11 of Mus musculus (mouse)
          Length = 190320

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 459   tttggaggcctgaaattgatgt 480
             ||||||||||||||||||||||
Sbjct: 62823 tttggaggcctgaaattgatgt 62802
to top
>gb|AC164977.2| Mus musculus BAC clone RP23-446B6 from chromosome 14, complete sequence
          Length = 179146

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 161    tctgacataaaatttagcactg 182
              ||||||||||||||||||||||
Sbjct: 161449 tctgacataaaatttagcactg 161470
to top
>emb|AL713882.1|CNS07YOZ Mus musculus chromosome 11 region in the Om locus area (D11Mit37-Scya6)
             clone 4B7 of library Caltech CITB-BAC from chromosome 11
             of Mus musculus (mouse)
          Length = 132348

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 459   tttggaggcctgaaattgatgt 480
             ||||||||||||||||||||||
Sbjct: 19313 tttggaggcctgaaattgatgt 19334
to top
>gb|AC150524.3| Bos taurus  BAC CH240-89P8 (Children's Hospital Oakland Research
              Institute Bovine BAC Library (male)) complete sequence
          Length = 189720

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 613    aatagtagagatagtagacat 633
              |||||||||||||||||||||
Sbjct: 108572 aatagtagagatagtagacat 108552
to top
>gb|AC093331.9| Homo sapiens chromosome 8, clone RP11-59O2, complete sequence
          Length = 170974

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 147   tttatgcaaggtaatctgaca 167
             |||||||||||||||||||||
Sbjct: 43017 tttatgcaaggtaatctgaca 42997
to top
>emb|CR380952.1| Candida glabrata strain CBS138 chromosome F complete sequence
          Length = 927101

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 581    aagtatatattgtcttgaatgactc 605
              ||||||||||||||||| |||||||
Sbjct: 882196 aagtatatattgtcttgcatgactc 882220
to top
>dbj|AP007157.1| Aspergillus oryzae RIB40 genomic DNA, SC023
          Length = 2661830

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 577     tccgaagtatatattgtcttg 597
               |||||||||||||||||||||
Sbjct: 1567202 tccgaagtatatattgtcttg 1567182
to top
>gb|AC097516.2| Homo sapiens BAC clone RP11-468A23 from 4, complete sequence
          Length = 159064

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 135   gaattatacagatttatgcaa 155
             |||||||||||||||||||||
Sbjct: 89173 gaattatacagatttatgcaa 89153
to top
>gb|AC148686.1| Macaca mulatta Major Histocompatibility Complex BAC MMU192G09, complete
             sequence
          Length = 181166

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 455   tgaatttggaggcctgaaatt 475
             |||||||||||||||||||||
Sbjct: 61645 tgaatttggaggcctgaaatt 61625
to top
>dbj|AB128049.1| Macaca mulatta genes, MHC class I region, partial and complete cds
          Length = 3284914

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 455    tgaatttggaggcctgaaatt 475
              |||||||||||||||||||||
Sbjct: 774904 tgaatttggaggcctgaaatt 774924
to top
>gb|AY740018.1| Homo sapiens paired box gene 1 (PAX1) gene, partial cds
          Length = 12292

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 457  aatttggaggcctgaaattg 476
            ||||||||||||||||||||
Sbjct: 2830 aatttggaggcctgaaattg 2849
to top
>gb|AY692264.1| Bacteriophage T5 strain st0 deletion mutant, complete genome
          Length = 113238

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 191   tcagaaacgtattgatatgc 210
             ||||||||||||||||||||
Sbjct: 37883 tcagaaacgtattgatatgc 37902
to top
>gb|AY543070.1| Bacteriophage T5, complete genome
          Length = 121750

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 191   tcagaaacgtattgatatgc 210
             ||||||||||||||||||||
Sbjct: 46088 tcagaaacgtattgatatgc 46107
to top
>ref|XM_723199.1| Plasmodium yoelii yoelii str. 17XNL CCAAT-box DNA binding protein
            subunit B (PY01024) partial mRNA
          Length = 1467

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 86   taacaaaagtacatttttta 105
            ||||||||||||||||||||
Sbjct: 1213 taacaaaagtacatttttta 1194
to top
>gb|AC078848.3| Homo sapiens BAC clone CTD-2220I23 from 7, complete sequence
          Length = 134778

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 13    tggatacagagtttttgtca 32
             ||||||||||||||||||||
Sbjct: 10305 tggatacagagtttttgtca 10324
to top
>ref|XM_672856.1| Plasmodium berghei strain ANKA hypothetical protein (PB000346.02.0)
            partial mRNA
          Length = 1281

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 86   taacaaaagtacatttttta 105
            ||||||||||||||||||||
Sbjct: 1027 taacaaaagtacatttttta 1008
to top
>emb|AL391356.22| Human DNA sequence from clone RP11-100A13 on chromosome 10 Contains a
             neurofilament 3 (NEF3) pseudogene and part of a novel
             gene, complete sequence
          Length = 65377

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 62    tctagccacctgaaattagt 81
             ||||||||||||||||||||
Sbjct: 22168 tctagccacctgaaattagt 22149
to top
>emb|AL035562.14|HS1065O2 Human DNA sequence from clone RP5-1065O2 on chromosome 20p11.21-11.23
             Contains the RPL41P1 gene for ribosomal protein L41
             pseudogene 1, the SLC25A5L gene for solute carrier family
             25 (mitochondrial carrier; adenine nucleotide
             translocator) member 5-like pseudogene, the PAX1 gene for
             paired box gene 1 and three CpG islands, complete sequence
          Length = 127192

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 457   aatttggaggcctgaaattg 476
             ||||||||||||||||||||
Sbjct: 59114 aatttggaggcctgaaattg 59095
to top
>emb|AL162755.2|NMA4Z2491 Neisseria meningitidis serogroup A strain Z2491 complete genome;
             segment 4/7
          Length = 331801

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 23    gtttttgtcaattatgtttc 42
             ||||||||||||||||||||
Sbjct: 32256 gtttttgtcaattatgtttc 32275
to top
>gb|AC063923.21| Homo sapiens 3 BAC RP11-59E19 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 153448

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 613   aatagtagagatagtagaca 632
             ||||||||||||||||||||
Sbjct: 53803 aatagtagagatagtagaca 53784
to top
>gb|AC128658.3| Homo sapiens 3 BAC CTB-124C22 (Cal Tech Human BAC Library B) complete
            sequence
          Length = 24206

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 118  agggaaacacaataggggaa 137
            ||||||||||||||||||||
Sbjct: 3357 agggaaacacaataggggaa 3338
to top
>gb|AC107460.5| Homo sapiens chromosome 8, clone RP11-452N4, complete sequence
          Length = 137945

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 163    tgacataaaatttagcactg 182
              ||||||||||||||||||||
Sbjct: 116374 tgacataaaatttagcactg 116393
to top
>gb|AC009470.4| Homo sapiens BAC clone RP11-125K7 from 11, complete sequence
          Length = 162511

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 93    agtacattttttaggggtagaaat 116
             ||||||||||| ||||||||||||
Sbjct: 49574 agtacatttttgaggggtagaaat 49597
to top
>gb|AC025432.4| Homo sapiens chromosome 3 clone CTB-124C22, complete sequence
          Length = 69458

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 118  agggaaacacaataggggaa 137
            ||||||||||||||||||||
Sbjct: 3358 agggaaacacaataggggaa 3339
to top
>gb|AC010370.5| Homo sapiens chromosome 3 clone CTD-2049J23, complete sequence
          Length = 157079

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 118   agggaaacacaataggggaa 137
             ||||||||||||||||||||
Sbjct: 48676 agggaaacacaataggggaa 48695
to top
>gb|DP000006.1| Oryctolagus cuniculus target 1 genomic scaffold
          Length = 1889755

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 163    tgacataaaatttagcactg 182
              ||||||||||||||||||||
Sbjct: 865073 tgacataaaatttagcactg 865092
to top
>gb|AC019342.8|AC019342 Homo sapiens, clone RP11-21D15, complete sequence
          Length = 79673

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 163   tgacataaaatttagcactg 182
             ||||||||||||||||||||
Sbjct: 39946 tgacataaaatttagcactg 39965
to top
>tpg|BK005598.1| TPA: TPA_exp: Homo sapiens NSP (NSP) gene, complete cds, alternatively
              spliced
          Length = 227735

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 616    agtagagatagtagacatat 635
              ||||||||||||||||||||
Sbjct: 159129 agtagagatagtagacatat 159110
to top
>gb|AE002098.2| Neisseria meningitidis MC58, complete genome
          Length = 2272360

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 23     gtttttgtcaattatgtttc 42
              ||||||||||||||||||||
Sbjct: 886493 gtttttgtcaattatgtttc 886512
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 86      taacaaaagtacatttttta 105
               ||||||||||||||||||||
Sbjct: 3475708 taacaaaagtacatttttta 3475689
to top
>gb|AC005183.3| Homo sapiens 12 BAC RP11-288K12 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 82995

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 425   tacttggcactttggaatca 444
             ||||||||||||||||||||
Sbjct: 24472 tacttggcactttggaatca 24453
to top
>gb|AC153100.3| Oryctolagus cuniculus clone LB1-192J7, complete sequence
          Length = 132131

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 163   tgacataaaatttagcactg 182
             ||||||||||||||||||||
Sbjct: 31293 tgacataaaatttagcactg 31312
to top
>dbj|AP004863.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OSJNBa0023I17
          Length = 141852

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 86    taacaaaagtacatttttta 105
             ||||||||||||||||||||
Sbjct: 20503 taacaaaagtacatttttta 20484
to top
>dbj|AP004093.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1661_C12
          Length = 122214

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 86    taacaaaagtacatttttta 105
             ||||||||||||||||||||
Sbjct: 88531 taacaaaagtacatttttta 88512
to top
>dbj|BS000236.1| Pan troglodytes chromosome 22 clone:PTB-058L13, map 22, complete
              sequences
          Length = 160456

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 328    ggttagtgatgcttgtattc 347
              ||||||||||||||||||||
Sbjct: 131355 ggttagtgatgcttgtattc 131374
to top
>gb|AC005016.1|AC005016 Homo sapiens BAC clone GS1-180J15 from 7q31, complete sequence
          Length = 123277

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 13   tggatacagagtttttgtca 32
            ||||||||||||||||||||
Sbjct: 3720 tggatacagagtttttgtca 3739
to top
>gb|AY587007.1| Bacteriophage T5 strain ATCC 11303-B5, complete genome
          Length = 121752

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 191   tcagaaacgtattgatatgc 210
             ||||||||||||||||||||
Sbjct: 46008 tcagaaacgtattgatatgc 46027
to top
>emb|AJ437103.1|GSP437103 Glomus arbuscular mycorrhizal symbiont of Voyria rosea 18S rRNA
           gene (partial), 5.8S rRNA gene, 28S rRNA gene (partial)
           and ITS 1 and 2, clone 137-2, Voyria rosea sample T
          Length = 466

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 463 gaggcctgaaattgatgttt 482
           ||||||||||||||||||||
Sbjct: 331 gaggcctgaaattgatgttt 350
to top
>dbj|AP001751.1| Homo sapiens genomic DNA, chromosome 21q, section 95/105
          Length = 340000

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 328    ggttagtgatgcttgtattc 347
              ||||||||||||||||||||
Sbjct: 195541 ggttagtgatgcttgtattc 195560
to top
>gb|AC004702.1|AC004702 Homo sapiens chromosome 17, clone HRPC836L9, complete sequence
          Length = 120821

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 616   agtagagatagtagacatat 635
             ||||||||||||||||||||
Sbjct: 44100 agtagagatagtagacatat 44119
to top
>gb|AC124442.3| Mus musculus BAC clone RP24-178G20 from 7, complete sequence
          Length = 177517

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 406   gttgatgtttctaatcatgt 425
             ||||||||||||||||||||
Sbjct: 92147 gttgatgtttctaatcatgt 92166
to top
>emb|AL929346.5| Zebrafish DNA sequence from clone DKEY-38P12, complete sequence
          Length = 232537

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 98     attttttaggggtagaaata 117
              ||||||||||||||||||||
Sbjct: 212188 attttttaggggtagaaata 212207
to top
>dbj|AP001048.1| Homo sapiens genomic DNA, chromosome 21, clone:KB1216G2, MX1-D21S171
            region, complete sequence
          Length = 16588

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 328  ggttagtgatgcttgtattc 347
            ||||||||||||||||||||
Sbjct: 2733 ggttagtgatgcttgtattc 2752
to top
>emb|AL732603.3| Mouse DNA sequence from clone RP23-154H8 on chromosome 2, complete
             sequence
          Length = 87251

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 105   aggggtagaaataagggaaa 124
             ||||||||||||||||||||
Sbjct: 19869 aggggtagaaataagggaaa 19850
to top
>dbj|AP001266.4| Homo sapiens genomic DNA, chromosome 11 clone:RP11-770G2, complete
              sequence
          Length = 175872

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 93     agtacattttttaggggtagaaat 116
              ||||||||||| ||||||||||||
Sbjct: 141685 agtacatttttgaggggtagaaat 141708
to top
>emb|AL627406.15| Mouse DNA sequence from clone RP23-188A12 on chromosome 4, complete
            sequence
          Length = 155214

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 461  tggaggcctgaaattgatgt 480
            ||||||||||||||||||||
Sbjct: 3653 tggaggcctgaaattgatgt 3672


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,719,606
Number of Sequences: 3902068
Number of extensions: 5719606
Number of successful extensions: 102759
Number of sequences better than 10.0: 49
Number of HSP's better than 10.0 without gapping: 49
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 102583
Number of HSP's gapped (non-prelim): 176
length of query: 684
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 661
effective length of database: 17,143,297,704
effective search space: 11331719782344
effective search space used: 11331719782344
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top