ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags19g11
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC150566.16| Medicago truncatula clone mth2-21o10, complete s... 46 0.11
2gb|AC165377.4| Nomascus leucogenys leucogenys clone CH271-412A17... 44 0.45
3gb|AC150657.1| Pan troglodytes chromosome 8 clone PTB-123K23 map... 42 1.8
4gb|AC150656.1| Pan troglodytes chromosome 8 clone PTB-026H08 map... 42 1.8
5gb|AC150655.1| Pan troglodytes chromosome 8 clone PTB-006D12 map... 42 1.8
6gb|AC146000.4| Pan troglodytes BAC clone RP43-147L18 from 7, com... 42 1.8
7gb|AF285443.4| Homo sapiens chromosome 8 clone SCb-449o20 map p2... 42 1.8
8gb|AF252830.5| Homo sapiens chromosome 8 clone SCb-295j18 map p2... 42 1.8
9gb|AC131269.3| Homo sapiens chromosome 8, clone RP11-416I21, com... 42 1.8
10gb|AC130360.4| Homo sapiens chromosome 8, clone RP11-287P18, com... 42 1.8
11gb|AC144428.1| Pan troglodytes BAC clone RP43-2C19 from 7, compl... 42 1.8
12gb|AC095787.7| Rattus norvegicus 14 BAC CH230-9M3 (Children's Ho... 42 1.8
13gb|AF252831.2| Homo sapiens chromosome 8 clone SCb-177k12 map 8p... 42 1.8
14gb|DP000046.1| Aotus nancymaae target 106 genomic scaffold 42 1.8
15gb|DP000047.1| Saimiri boliviensis boliviensis target 106 genomi... 42 1.8
16gb|AC130339.12| Homo sapiens chromosome 8, clone RP13-941O14, co... 42 1.8
17gb|AC016903.3| Homo sapiens BAC clone RP11-259I20 from 2, comple... 42 1.8
18gb|AC130367.12| Homo sapiens chromosome 8, clone RP11-1322A13, c... 42 1.8
19gb|AC134683.9| Homo sapiens chromosome 8, clone RP11-1175L4, com... 42 1.8
20gb|AC024084.4|AC024084 Human Chromosome 7 clone RP11-212C18, com... 42 1.8
21gb|AC134395.7| Homo sapiens chromosome 8, clone RP11-739E3, comp... 42 1.8
22emb|AL161415.2|CNS01RH5 Human chromosome 14 DNA sequence BAC R-1... 42 1.8
23gb|AC130365.5| Homo sapiens chromosome 8, clone RP11-1195F20, co... 42 1.8
24gb|AC144741.3| Oryza sativa (japonica cultivar-group) chromosome... 40 7.0
25gb|AC115719.10| Mus musculus chromosome 18, clone RP24-356J16, c... 40 7.0
26gb|AC107206.4| Oryza sativa chromosome 3 BAC OSJNBa0063J18 genom... 40 7.0
27gb|AY673602.1| Homo sapiens cell division cycle 42 (GTP binding ... 40 7.0
28gb|AY494081.1| Pirital virus segment L, complete sequence 40 7.0
29gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 40 7.0
30gb|AC103613.7| Mus musculus chromosome 14, clone RP24-75B12, com... 40 7.0
31gb|AC146815.1| Mus musculus BAC clone RP23-239A11 from chromosom... 40 7.0
32gb|AC116585.3| Mus musculus BAC clone RP23-358A16 from chromosom... 40 7.0
33gb|AC114574.8| Mus musculus chromosome 6, clone RP23-151F20, com... 40 7.0
34emb|CR382363.14| Zebrafish DNA sequence from clone DKEY-23P11 in... 40 7.0
35gb|AC123954.4| Mus musculus BAC clone RP23-249L6 from 13, comple... 40 7.0
36ref|XM_758109.1| Theileria parva strain Muguga chromosome 3 hypo... 40 7.0
37gb|AC141114.14| Medicago truncatula clone mth2-8g20, complete se... 40 7.0
38emb|AL583843.5| Human DNA sequence from clone RP11-492I2 on chro... 40 7.0
39emb|AL445437.4| Human DNA sequence from clone RP11-60A14 on chro... 40 7.0
40emb|AL049636.22|HSDJ792G4 Human DNA sequence from clone RP4-792G... 40 7.0
41emb|AL031281.6|HS224A6 Human DNA sequence from clone RP1-224A6 o... 40 7.0
42emb|AL645923.14| Mouse DNA sequence from clone RP23-75H1 on chro... 40 7.0
43gb|AC034214.5| Homo sapiens chromosome 5 clone CTD-2001E22, comp... 40 7.0
44gb|AC026787.5| Homo sapiens chromosome 5 clone CTD-2143L24, comp... 40 7.0
45dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.0
46dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.0
47dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.0
48gb|M84809.1|MUSAGTFCP Mus musculus alpha-globin transcription fa... 40 7.0
49gb|AC122733.11| Mus musculus chromosome 5, clone RP24-506B15, co... 40 7.0
50gb|AC099698.14| Mus musculus chromosome 5, clone RP23-415O9, com... 40 7.0
51gb|AC003015.1|AC003015 Human BAC clone GS1-113H23 from 5p15.2, c... 40 7.0
52gb|AC155881.2| Medicago truncatula chromosome 7 BAC clone mte1-6... 40 7.0
53gb|AC161883.6| Mus musculus BAC clone RP23-91K1 from chromosome ... 40 7.0
54ref|NM_033476.1| Mus musculus transcription factor CP2 (Tcfcp2),... 40 7.0
55gb|AC144631.3| Mus musculus BAC clone RP23-112C14 from 3, comple... 40 7.0
56dbj|AP004506.1| Lotus japonicus genomic DNA, chromosome 1, clone... 40 7.0
57gb|AC155715.24| Mus musculus 10 BAC RP24-118H2 (Roswell Park Can... 40 7.0
58emb|AL671880.15| Mouse DNA sequence from clone RP23-384C22 on ch... 40 7.0 
>gb|AC150566.16| Medicago truncatula clone mth2-21o10, complete sequence
          Length = 130981

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 199   gagataaagaggtgagagagaga 221
             |||||||||||||||||||||||
Sbjct: 49103 gagataaagaggtgagagagaga 49081
to top
>gb|AC165377.4| Nomascus leucogenys leucogenys clone CH271-412A17, complete sequence
          Length = 195646

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 84     gctatataatttggagagattt 105
              ||||||||||||||||||||||
Sbjct: 180980 gctatataatttggagagattt 180959
to top
>gb|AC150657.1| Pan troglodytes chromosome 8 clone PTB-123K23 map human ortholog p23.1,
              complete sequence
          Length = 173624

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 199    gagataaagaggtgagagagagacaagag 227
              |||| ||||||||||||||||| ||||||
Sbjct: 118386 gagagaaagaggtgagagagaggcaagag 118358
to top
>gb|AC150656.1| Pan troglodytes chromosome 8 clone PTB-026H08 map human ortholog p23.1,
              complete sequence
          Length = 155351

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 199    gagataaagaggtgagagagagacaagag 227
              |||| ||||||||||||||||| ||||||
Sbjct: 103529 gagagaaagaggtgagagagaggcaagag 103501
to top
>gb|AC150655.1| Pan troglodytes chromosome 8 clone PTB-006D12 map human ortholog p23.1,
             complete sequence
          Length = 89111

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 199   gagataaagaggtgagagagagacaagag 227
             |||| ||||||||||||||||| ||||||
Sbjct: 36737 gagagaaagaggtgagagagaggcaagag 36765
to top
>gb|AC146000.4| Pan troglodytes BAC clone RP43-147L18 from 7, complete sequence
          Length = 176192

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 119    gatgagatgagtcaaggaagagaga 143
              ||||||||| |||||||||||||||
Sbjct: 155684 gatgagatgtgtcaaggaagagaga 155708
to top
>gb|AF285443.4| Homo sapiens chromosome 8 clone SCb-449o20 map p23.1, complete sequence
          Length = 147536

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 199    gagataaagaggtgagagagagacaagag 227
              |||| ||||||||||||||||| ||||||
Sbjct: 104894 gagagaaagaggtgagagagaggcaagag 104866
to top
>gb|AF252830.5| Homo sapiens chromosome 8 clone SCb-295j18 map p23.1, complete sequence
          Length = 172560

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 199   gagataaagaggtgagagagagacaagag 227
             |||| ||||||||||||||||| ||||||
Sbjct: 97327 gagagaaagaggtgagagagaggcaagag 97299
to top
>gb|AC131269.3| Homo sapiens chromosome 8, clone RP11-416I21, complete sequence
          Length = 190031

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 199    gagataaagaggtgagagagagacaagag 227
              |||| ||||||||||||||||| ||||||
Sbjct: 152987 gagagaaagaggtgagagagaggcaagag 153015
to top
>gb|AC130360.4| Homo sapiens chromosome 8, clone RP11-287P18, complete sequence
          Length = 171474

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 199   gagataaagaggtgagagagagacaagag 227
             |||| ||||||||||||||||| ||||||
Sbjct: 80615 gagagaaagaggtgagagagaggcaagag 80643
to top
>gb|AC144428.1| Pan troglodytes BAC clone RP43-2C19 from 7, complete sequence
          Length = 208183

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 119    gatgagatgagtcaaggaagagaga 143
              ||||||||| |||||||||||||||
Sbjct: 168736 gatgagatgtgtcaaggaagagaga 168712
to top
>gb|AC095787.7| Rattus norvegicus 14 BAC CH230-9M3 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 242500

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 414    agtttccattctggtttaatctctc 438
              |||||| ||||||||||||||||||
Sbjct: 235282 agtttctattctggtttaatctctc 235258
to top
>gb|AF252831.2| Homo sapiens chromosome 8 clone SCb-177k12 map 8p22-p21, complete
             sequence
          Length = 115137

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 199   gagataaagaggtgagagagagacaagag 227
             |||| ||||||||||||||||| ||||||
Sbjct: 59416 gagagaaagaggtgagagagaggcaagag 59444
to top
>gb|DP000046.1| Aotus nancymaae target 106 genomic scaffold
          Length = 387541

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 268    gctcatttctttttctcaagt 288
              |||||||||||||||||||||
Sbjct: 247352 gctcatttctttttctcaagt 247372
to top
>gb|DP000047.1| Saimiri boliviensis boliviensis target 106 genomic scaffold
          Length = 211360

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 268    gctcatttctttttctcaagt 288
              |||||||||||||||||||||
Sbjct: 170862 gctcatttctttttctcaagt 170882
to top
>gb|AC130339.12| Homo sapiens chromosome 8, clone RP13-941O14, complete sequence
          Length = 173255

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 199    gagataaagaggtgagagagagacaagag 227
              |||| ||||||||||||||||| ||||||
Sbjct: 103755 gagagaaagaggtgagagagaggcaagag 103783
to top
>gb|AC016903.3| Homo sapiens BAC clone RP11-259I20 from 2, complete sequence
          Length = 172512

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 14    ctctcttcttgggaaattggg 34
             |||||||||||||||||||||
Sbjct: 29124 ctctcttcttgggaaattggg 29104
to top
>gb|AC130367.12| Homo sapiens chromosome 8, clone RP11-1322A13, complete sequence
          Length = 188884

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 199    gagataaagaggtgagagagagacaagag 227
              |||| ||||||||||||||||| ||||||
Sbjct: 125500 gagagaaagaggtgagagagaggcaagag 125472
to top
>gb|AC134683.9| Homo sapiens chromosome 8, clone RP11-1175L4, complete sequence
          Length = 172084

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 199    gagataaagaggtgagagagagacaagag 227
              |||| ||||||||||||||||| ||||||
Sbjct: 105400 gagagaaagaggtgagagagaggcaagag 105372
to top
>gb|AC024084.4|AC024084 Human Chromosome 7 clone RP11-212C18, complete sequence
          Length = 183709

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 119    gatgagatgagtcaaggaagagaga 143
              ||||||||| |||||||||||||||
Sbjct: 113542 gatgagatgtgtcaaggaagagaga 113518
to top
>gb|AC134395.7| Homo sapiens chromosome 8, clone RP11-739E3, complete sequence
          Length = 178401

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 199    gagataaagaggtgagagagagacaagag 227
              |||| ||||||||||||||||| ||||||
Sbjct: 102245 gagagaaagaggtgagagagaggcaagag 102217
to top
>emb|AL161415.2|CNS01RH5 Human chromosome 14 DNA sequence BAC R-139D16 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 161443

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 207    gaggtgagagagagacaagag 227
              |||||||||||||||||||||
Sbjct: 100792 gaggtgagagagagacaagag 100772
to top
>gb|AC130365.5| Homo sapiens chromosome 8, clone RP11-1195F20, complete sequence
          Length = 171639

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 199   gagataaagaggtgagagagagacaagag 227
             |||| ||||||||||||||||| ||||||
Sbjct: 84688 gagagaaagaggtgagagagaggcaagag 84716
to top
>gb|AC144741.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBa0086E02, complete sequence
          Length = 150474

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 122   gagatgagtcaaggaagaga 141
             ||||||||||||||||||||
Sbjct: 47364 gagatgagtcaaggaagaga 47383
to top
>gb|AC115719.10| Mus musculus chromosome 18, clone RP24-356J16, complete sequence
          Length = 177037

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 16     ctcttcttgggaaattgggt 35
              ||||||||||||||||||||
Sbjct: 100812 ctcttcttgggaaattgggt 100831
to top
>gb|AC107206.4| Oryza sativa chromosome 3 BAC OSJNBa0063J18 genomic sequence, complete
              sequence
          Length = 154558

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 121    tgagatgagtcaaggaagag 140
              ||||||||||||||||||||
Sbjct: 114174 tgagatgagtcaaggaagag 114193
to top
>gb|AY673602.1| Homo sapiens cell division cycle 42 (GTP binding protein, 25kDa)
             (CDC42) gene, complete cds
          Length = 43574

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 210   gtgagagagagacaagagtt 229
             ||||||||||||||||||||
Sbjct: 28172 gtgagagagagacaagagtt 28191
to top
>gb|AY494081.1| Pirital virus segment L, complete sequence
          Length = 7089

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 204 aaagaggtgagagagagaca 223
           ||||||||||||||||||||
Sbjct: 82  aaagaggtgagagagagaca 101
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 121      tgagatgagtcaaggaagag 140
                ||||||||||||||||||||
Sbjct: 23277693 tgagatgagtcaaggaagag 23277712
to top
>gb|AC103613.7| Mus musculus chromosome 14, clone RP24-75B12, complete sequence
          Length = 191158

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 430   taatctctccttttctattt 449
             ||||||||||||||||||||
Sbjct: 20964 taatctctccttttctattt 20983
to top
>gb|AC146815.1| Mus musculus BAC clone RP23-239A11 from chromosome 8, complete sequence
          Length = 203073

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 205    aagaggtgagagagagacaa 224
              ||||||||||||||||||||
Sbjct: 154208 aagaggtgagagagagacaa 154227
to top
>gb|AC116585.3| Mus musculus BAC clone RP23-358A16 from chromosome 3, complete sequence
          Length = 227492

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 198    tgagataaagaggtgagagagaga 221
              ||||| ||||||||||||||||||
Sbjct: 130647 tgagagaaagaggtgagagagaga 130670
to top
>gb|AC114574.8| Mus musculus chromosome 6, clone RP23-151F20, complete sequence
          Length = 252723

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 230    ggctatgggcatgggtttct 249
              ||||||||||||||||||||
Sbjct: 183994 ggctatgggcatgggtttct 184013
to top
>emb|CR382363.14| Zebrafish DNA sequence from clone DKEY-23P11 in linkage group 25,
             complete sequence
          Length = 129281

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 428   tttaatctctccttttctat 447
             ||||||||||||||||||||
Sbjct: 85786 tttaatctctccttttctat 85805
to top
>gb|AC123954.4| Mus musculus BAC clone RP23-249L6 from 13, complete sequence
          Length = 200727

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 493    accttgagaaccaacacaatgttt 516
              |||||||||||||| |||||||||
Sbjct: 127483 accttgagaaccaaaacaatgttt 127460
to top
>ref|XM_758109.1| Theileria parva strain Muguga chromosome 3 hypothetical protein
           (TP03_0184) partial mRNA
          Length = 1443

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 274 ttctttttctcaagttcagt 293
           ||||||||||||||||||||
Sbjct: 385 ttctttttctcaagttcagt 404
to top
>gb|AC141114.14| Medicago truncatula clone mth2-8g20, complete sequence
          Length = 120527

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 199   gagataaagaggtgagagag 218
             ||||||||||||||||||||
Sbjct: 71781 gagataaagaggtgagagag 71762
to top
>emb|AL583843.5| Human DNA sequence from clone RP11-492I2 on chromosome 1 Contains the
             5' end of the ELAVL4 gene for ELAV (embryonic lethal,
             abnormal vision, Drosophila)-like 4 ((Hu antigen D) and a
             novel pseudogene, complete sequence
          Length = 62263

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 133   aggaagagagactggaattt 152
             ||||||||||||||||||||
Sbjct: 51862 aggaagagagactggaattt 51881
to top
>emb|AL445437.4| Human DNA sequence from clone RP11-60A14 on chromosome 1 Contains STSs
             and GSSs, complete sequence
          Length = 102094

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 323   ttgttgtggttcaagtcata 342
             ||||||||||||||||||||
Sbjct: 85390 ttgttgtggttcaagtcata 85409
to top
>emb|AL049636.22|HSDJ792G4 Human DNA sequence from clone RP4-792G4 on chromosome 1p31.2-32.2
            Contains the 5' end of the ALG6 gene for
            asparagine-linked glycosylation 6 homolog (yeast alpha-1
            3-glucosyltransferase), a DnaJ (Hsp40) homolog subfamily
            C member 7 (DNAJC7) pseudogene, the FOXD3 gene for
            forkhead box D3, a novel gene, the 5' end of a novel gene
            and a CpG island, complete sequence
          Length = 142728

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 11   aatctctcttcttgggaaat 30
            ||||||||||||||||||||
Sbjct: 9897 aatctctcttcttgggaaat 9878
to top
>emb|AL031281.6|HS224A6 Human DNA sequence from clone RP1-224A6 on chromosome 1p35.1-36.23
             Contains the 3' UTR of the ELA3A gene for elastase 3A
             (pancreatic (protease E)), three novel genes, the CDC42
             gene for cell division cycle 42 (GTP binding protein,
             25kDa), the 3' end of the WNT4 gene for wingless-type MMTV
             integration site family (member 4) and a CpG island,
             complete sequence
          Length = 129366

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 210   gtgagagagagacaagagtt 229
             ||||||||||||||||||||
Sbjct: 62382 gtgagagagagacaagagtt 62363
to top
>emb|AL645923.14| Mouse DNA sequence from clone RP23-75H1 on chromosome 13 Contains three
             vomeronasal 1 receptor, H (V1rh) pseudogenes, a V1ri
             pseudogene, a ribosomal protein L5 (RPL5) pseudogene, the
             V1rh9, V1rh10 and V1rh20 genes for vomeronasal 1 receptors
             H9, H10 and H20, the gene for a novel vomeronasal 1
             receptor, H (V1rh) family member and a novel gene,
             complete sequence
          Length = 157361

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 133   aggaagagagactggaattt 152
             ||||||||||||||||||||
Sbjct: 36831 aggaagagagactggaattt 36812
to top
>gb|AC034214.5| Homo sapiens chromosome 5 clone CTD-2001E22, complete sequence
          Length = 108661

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 273  tttctttttctcaagttcag 292
            ||||||||||||||||||||
Sbjct: 7163 tttctttttctcaagttcag 7182
to top
>gb|AC026787.5| Homo sapiens chromosome 5 clone CTD-2143L24, complete sequence
          Length = 146296

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 273   tttctttttctcaagttcag 292
             ||||||||||||||||||||
Sbjct: 47422 tttctttttctcaagttcag 47403
to top
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 205      aagaggtgagagagagacaa 224
                ||||||||||||||||||||
Sbjct: 17009671 aagaggtgagagagagacaa 17009652
to top
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
               sequence
          Length = 29737217

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 122     gagatgagtcaaggaagaga 141
               ||||||||||||||||||||
Sbjct: 3969499 gagatgagtcaaggaagaga 3969518
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 121      tgagatgagtcaaggaagag 140
                ||||||||||||||||||||
Sbjct: 23270721 tgagatgagtcaaggaagag 23270740
to top
>gb|M84809.1|MUSAGTFCP Mus musculus alpha-globin transcription factor CP2 mRNA, complete cds
          Length = 3226

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 206  agaggtgagagagagacaag 225
            ||||||||||||||||||||
Sbjct: 2602 agaggtgagagagagacaag 2621
to top
>gb|AC122733.11| Mus musculus chromosome 5, clone RP24-506B15, complete sequence
          Length = 157625

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 415  gtttccattctggtttaatctctc 438
            ||||| ||||||||||||||||||
Sbjct: 6900 gtttctattctggtttaatctctc 6877
to top
>gb|AC099698.14| Mus musculus chromosome 5, clone RP23-415O9, complete sequence
          Length = 220813

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 415    gtttccattctggtttaatctctc 438
              ||||| ||||||||||||||||||
Sbjct: 110300 gtttctattctggtttaatctctc 110323
to top
>gb|AC003015.1|AC003015 Human BAC clone GS1-113H23 from 5p15.2, complete sequence
          Length = 132953

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 273   tttctttttctcaagttcag 292
             ||||||||||||||||||||
Sbjct: 57260 tttctttttctcaagttcag 57279
to top
>gb|AC155881.2| Medicago truncatula chromosome 7 BAC clone mte1-60d3, complete sequence
          Length = 100208

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 199   gagataaagaggtgagagag 218
             ||||||||||||||||||||
Sbjct: 81696 gagataaagaggtgagagag 81715
to top
>gb|AC161883.6| Mus musculus BAC clone RP23-91K1 from chromosome 14, complete sequence
          Length = 206274

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 430    taatctctccttttctattt 449
              ||||||||||||||||||||
Sbjct: 119805 taatctctccttttctattt 119824
to top
>ref|NM_033476.1| Mus musculus transcription factor CP2 (Tcfcp2), mRNA
          Length = 3226

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 206  agaggtgagagagagacaag 225
            ||||||||||||||||||||
Sbjct: 2602 agaggtgagagagagacaag 2621
to top
>gb|AC144631.3| Mus musculus BAC clone RP23-112C14 from 3, complete sequence
          Length = 179548

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 192    tgaatatgagataaagaggtgaga 215
              |||||||||||| |||||||||||
Sbjct: 123003 tgaatatgagatgaagaggtgaga 122980
to top
>dbj|AP004506.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT03K03, TM0036a,
             complete sequence
          Length = 62624

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 428   tttaatctctccttttctat 447
             ||||||||||||||||||||
Sbjct: 10398 tttaatctctccttttctat 10417
to top
>gb|AC155715.24| Mus musculus 10 BAC RP24-118H2 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 174860

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 346    aatgtgattatgattcagtt 365
              ||||||||||||||||||||
Sbjct: 163451 aatgtgattatgattcagtt 163470
to top
>emb|AL671880.15| Mouse DNA sequence from clone RP23-384C22 on chromosome X, complete
             sequence
          Length = 200535

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 415   gtttccattctggtttaatctctc 438
             ||||| ||||||||||||||||||
Sbjct: 13575 gtttctattctggtttaatctctc 13552


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,796,931
Number of Sequences: 3902068
Number of extensions: 5796931
Number of successful extensions: 118958
Number of sequences better than 10.0: 58
Number of HSP's better than 10.0 without gapping: 58
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 118675
Number of HSP's gapped (non-prelim): 283
length of query: 516
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 493
effective length of database: 17,143,297,704
effective search space: 8451645768072
effective search space used: 8451645768072
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top