ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags18n06
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AK068562.1| Oryza sativa (japonica cultivar-group) cDNA clon... 392 e-106
2gb|AC157500.1| Oryza sativa (japonica cultivar-group) BAC clone ... 208 1e-50
3gb|AY664491.1| Bartonella bacilliformis fumarase C (fumC) gene, ... 62 2e-06
4emb|Z15160.1|BBGROELT B.bacilliformis GroEL-type gene encoding h... 62 2e-06
5gb|M98257.1|BAOBB63A Bartonella bacilliformis immunoreactive pro... 62 2e-06
6ref|NM_102387.1| Arabidopsis thaliana ATP binding / protein bind... 54 5e-04
7gb|AY515129.1| Bartonella phoceensis strain 16120 GroEL gene, pa... 54 5e-04
8emb|AJ749669.1| Bartonella henselae groES gene, groEL gene and p... 54 5e-04
9gb|AY116641.1| Bartonella koehlerae heat shock protein Hsp60 (gr... 54 5e-04
10emb|BX897699.1| Bartonella henselae strain Houston-1, complete g... 54 5e-04
11gb|AF304023.1| Bartonella henselae strain 90-615 heat shock prot... 54 5e-04
12gb|AF304022.1| Bartonella henselae strain FIZZ heat shock protei... 54 5e-04
13gb|AF304021.1| Bartonella henselae strain SA-2 heat shock protei... 54 5e-04
14gb|AF304020.1| Bartonella henselae strain CAL-1 heat shock prote... 54 5e-04
15gb|AF304019.1| Bartonella henselae strain URLLY8 heat shock prot... 54 5e-04
16gb|AF299357.1| Bartonella alsatica HSP60 gene, partial cds 54 5e-04
17dbj|AK221637.1| Arabidopsis thaliana mRNA for chaperonin precurs... 54 5e-04
18gb|AY123688.1| Bartonella henselae strain ATCC 49882 Cpn60 (cpn6... 54 5e-04
19gb|AY445615.1| Ruminococcus albus strain B199 GroEL (groEL) gene... 54 5e-04
20gb|AF014829.1|AF014829 Bartonella henselae 60 kDa heat shock pro... 54 5e-04
21gb|U78514.1|BHU78514 Bartonella henselae heat shock protein HSP6... 54 5e-04
22gb|U96734.1|BHU96734 Bartonella henselae GroES (groES) and GroEL... 54 5e-04
23ref|NM_125033.3| Arabidopsis thaliana ATP binding / protein bind... 52 0.002
24ref|NM_001037006.1| Arabidopsis thaliana ATP binding / protein b... 52 0.002
25gb|AE008538.1| Streptococcus pneumoniae R6 section 154 of 184 of... 52 0.002
26gb|AF352805.1| Streptococcus pneumoniae ATCC33400 60 kDa chapero... 52 0.002
27gb|AF237466.1| Streptococcus sp. Z89 60 kDa chaperonin (cpn60) g... 52 0.002
28gb|AF237459.1| Streptococcus pneumoniae 60 kDa chaperonin (cpn60... 52 0.002
29gb|AF237458.1| Streptococcus mitis 60 kDa chaperonin (cpn60) gen... 52 0.002
30gb|AY344504.1| Streptococcus pneumoniae chaperonin GroEL gene, p... 52 0.002
31gb|AF325449.1|AF325449 Streptococcus pneumoniae GroES and GroEL ... 52 0.002
32emb|BX831822.1|CNS09YNB Arabidopsis thaliana Full-length cDNA Co... 52 0.002
33gb|AC079829.6|AC079829 Arabidopsis thaliana chromosome 1 BAC F28... 52 0.002
34gb|AE005672.2| Streptococcus pneumoniae TIGR4, complete genome 52 0.002
35dbj|AB019234.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 52 0.002
36gb|AF117741.1|AF117741 Streptococcus pneumoniae strain CP1200 co... 52 0.002
37gb|AF237465.1| Streptococcus sp. Z12 60 kDa chaperonin (cpn60) g... 50 0.007
38gb|DQ166941.1| Bartonella sp. SE-Bart-A GroEL (groEL) gene, part... 50 0.007
39gb|AE016795.2| Vibrio vulnificus CMCP6 chromosome I complete seq... 50 0.007
40emb|BX571872.1| Photorhabdus luminescens subsp. laumondii TTO1 c... 50 0.007
41dbj|BA000037.2| Vibrio vulnificus YJ016 DNA, chromosome I, compl... 50 0.007
42gb|AF485800.1| Streptococcus parauberis strain 25 60 kDa chapero... 50 0.007
43gb|AF485799.1| Streptococcus parauberis strain 21B 60 kDa chaper... 50 0.007
44gb|AF485798.1| Streptococcus parauberis strain ATCC 13386 60 kDa... 50 0.007
45ref|NM_185419.2| Oryza sativa (japonica cultivar-group), mRNA 48 0.029
46gb|AY691303.1| Streptococcus hyointestinalis 60 kDa chaperonin (... 48 0.029
47gb|AF352801.1| Streptococcus mitis ATCC49456 60 kDa chaperonin (... 48 0.029
48gb|AY360225.1| Streptococcus sinensis strain HKU6 chaperonin Gro... 48 0.029
49gb|AY360224.1| Streptococcus sinensis strain HKU5 chaperonin Gro... 48 0.029
50gb|AY360223.1| Streptococcus sinensis strain HKU4 chaperonin Gro... 48 0.029
51emb|CR954246.1| Pseudoalteromonas haloplanktis str. TAC125 chrom... 48 0.029
52gb|CP000323.1| Psychrobacter cryohalolentis K5, complete genome 48 0.029
53gb|AY342353.1| Streptococcus mitis GroEL gene, partial cds 48 0.029
54gb|AF417589.1| Streptococcus mitis ATCC 49456 GroES gene, comple... 48 0.029
55emb|AJ243594.2|PHA243594 Pseudoalteromonas haloplanktis groEL, g... 48 0.029
56gb|AY123664.1| Psychrobacter immobilis strain ATCC 43116 Cpn60 (... 48 0.029
57dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.029
58dbj|AP001389.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.029
59dbj|AK101334.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.029
60dbj|AK062098.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.029
61gb|AY562900.1| Uncultured bacterium clone w07_d12 60 kDa chapero... 48 0.029
62gb|AY562750.1| Uncultured bacterium clone c05_d02 60 kDa chapero... 48 0.029
63gb|AY562732.1| Uncultured bacterium clone c02_h02 60 kDa chapero... 48 0.029
64gb|AY562681.1| Uncultured bacterium clone b12_f01 60 kDa chapero... 48 0.029
65gb|AY562603.1| Uncultured bacterium clone b04_e01 60 kDa chapero... 48 0.029
66gb|AY562597.1| Uncultured bacterium clone b03_b07 60 kDa chapero... 48 0.029
67gb|U46136.1|STU46136 Solanum tuberosum chaperonin-60 beta subuni... 48 0.029
68gb|AY837544.1| Pseudomonas syringae pv. syringae strain NCPPB 28... 46 0.11
69gb|AY837542.1| Pseudomonas syringae pv. phaseolicola strain NCPP... 46 0.11
70gb|AY837541.1| Pseudomonas syringae pv. glycinea strain NCPPB 12... 46 0.11
71gb|CP000127.1| Nitrosococcus oceani ATCC 19707, complete genome 46 0.11
72gb|AF437115.1| Uncultured pig faeces bacterium clone 010_G02 60 ... 46 0.11
73gb|CP000075.1| Pseudomonas syringae pv. syringae B728a, complete... 46 0.11
74gb|CP000058.1| Pseudomonas syringae pv. phaseolicola 1448A, comp... 46 0.11
75emb|AJ621256.1| Enterococcus canis partial GroEL gene for heat s... 46 0.11
76gb|AY116642.1| Bartonella schoenbuchensis heat shock protein Hsp... 46 0.11
77emb|BX908798.1| Parachlamydia-related symbiont UWE25, complete g... 46 0.11
78emb|AJ621724.1| Lactobacillus vaccinostercus partial hsp60 gene ... 46 0.11
79emb|AJ621721.1| Lactobacillus durianis partial hsp60 gene for Gr... 46 0.11
80emb|AJ558227.1|HFE558227 Helicobacter felis partial hsp60 gene f... 46 0.11
81gb|AF355773.1| Bartonella birtlesii 60 KDa heat shock protein (g... 46 0.11
82gb|AE003849.1| Xylella fastidiosa 9a5c, complete genome 46 0.11
83gb|AY123726.1| Streptococcus hyovaginalis strain ATCC 700866 Cpn... 46 0.11
84gb|AY123691.1| Bartonella elizabethae strain ATCC 49927 Cpn60 (c... 46 0.11
85gb|AY123657.1| Acinetobacter johnsonii strain ATCC 17909 Cpn60 (... 46 0.11
86gb|AY837450.1| Vibrio sp. 14G07 heat shock protein 60 (hsp60) ge... 46 0.11
87gb|AY837435.1| Vibrio sp. 14E12 heat shock protein 60 (hsp60) ge... 46 0.11
88gb|AY837389.1| Vibrio sp. 14A09 heat shock protein 60 (hsp60) ge... 46 0.11
89gb|AY837388.1| Vibrio sp. 14A08 heat shock protein 60 (hsp60) ge... 46 0.11
90gb|AY837289.1| Vibrio sp. 12F02 heat shock protein 60 (hsp60) ge... 46 0.11
91gb|AY837240.1| Vibrio sp. 12A04 heat shock protein 60 (hsp60) ge... 46 0.11
92gb|AY837149.1| Vibrio sp. 1B06 heat shock protein 60 (hsp60) gen... 46 0.11
93dbj|AB057417.1| Pseudoalteromonas sp. PS1M3 gene for GroES, GroE... 46 0.11
94gb|AF230956.1| Vibrio vulnificus strain 921751 HSP60 gene, parti... 46 0.11
95gb|AF230955.1| Vibrio vulnificus strain ATCC27562 HSP60 gene, pa... 46 0.11
96gb|AF014834.1|AF014834 Bartonella elizabethae 60 kDa heat shock ... 46 0.11
97gb|AE009442.1| Xylella fastidiosa Temecula1, complete genome 46 0.11
98gb|AF429692.1| Lactobacillus mali strain ATCC 27054 60 kDa heat ... 46 0.11
99gb|AF429690.1| Lactobacillus kefirgranum strain ATCC 51647 60 kD... 46 0.11
100gb|AC149899.2| Xenopus tropicalis clone ISB-339J14, complete seq... 46 0.11
101gb|AF417583.1| Enterococcus avium ATCC 14025 GroES and GroEL gen... 44 0.45
102gb|AY837570.1| Prevotella melaninogenica strain ATCC 25845D 60 k... 44 0.45
103gb|AY691258.1| Faecalibacterium prausnitzii 60 kDa chaperonin (c... 44 0.45
104gb|AF437105.1| Uncultured pig faeces bacterium clone 010_D03 60 ... 44 0.45
105gb|AF352799.1| Streptococcus parasanguinis ATCC15912 60 kDa chap... 44 0.45
106gb|AF245678.1| Enterococcus avium 60 kDa chaperonin (cpn60) gene... 44 0.45
107gb|CP000082.1| Psychrobacter arcticus 273-4, complete genome 44 0.45
108gb|DQ106381.1| Uncultured bacterium clone pi1_cl24_cn1 60 kDa ch... 44 0.45
109gb|DQ106086.1| Uncultured bacterium clone ce0_cl37_cn1 60 kDa ch... 44 0.45
110gb|AY344501.1| Streptococcus parasanguinis chaperonin GroEL gene... 44 0.45
111gb|AY344499.1| Streptococcus gordonii chaperonin GroEL-like gene... 44 0.45
112emb|AL008634.1|HS396D17 Human DNA sequence from clone RP3-396D17... 44 0.45
113emb|BX321856.1| Nitrosomonas europaea ATCC 19718, complete genom... 44 0.45
114gb|AF338228.1| Streptococcus gordonii ABC transporter, GroES, an... 44 0.45
115gb|AY017380.1| Fibrobacter succinogenes S85 heat shock protein 6... 44 0.45
116gb|AY123738.1| Streptococcus gordonii strain ATCC 10558 Cpn60 (c... 44 0.45
117gb|AY123698.1| Aerococcus urinae strain ATCC 51268 Cpn60 (cpn60)... 44 0.45
118gb|AF230948.1| Vibrio mimicus strain ATCC33653 HSP60 gene, parti... 44 0.45
119gb|AF245226.1|AF245226 Homo sapiens chromosome 21 map 21q21 clon... 44 0.45
120dbj|BS000047.1| Pan troglodytes chromosome 22 clone:PTB-109H19, ... 44 0.45
121gb|AY714804.1| Wolbachia endosymbiont of Culex quinquefasciatus ... 44 0.45
122gb|AY714803.1| Wolbachia endosymbiont of Trichogramma cordubensi... 44 0.45
123dbj|AP001674.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 44 0.45
124emb|AL929112.6| Mouse DNA sequence from clone RP23-397G5 on chro... 44 0.45
125dbj|AP001345.2| Homo sapiens genomic DNA, chromosome 21q21.1-q21... 44 0.45
126gb|AF417584.1| Enterococcus casseliflavus ATCC 25788 GroES and G... 42 1.8
127gb|AF417582.1| Enterococcus faecium ATCC 19434 GroES and GroEL g... 42 1.8
128gb|AY491449.1| Enterococcus faecium strain NTUH 8724 GroEL (groE... 42 1.8
129gb|AY491446.1| Enterococcus faecium strain NTUH 8824-1 GroEL (gr... 42 1.8
130gb|AY691283.1| Prevotella heparinolytica 60 kDa chaperonin (cpn6... 42 1.8
131gb|AF437187.1| Uncultured pig faeces bacterium clone 016_D10 60 ... 42 1.8
132gb|AF352811.1| Streptococcus agalactiae ATCC12386 60 kDa chapero... 42 1.8
133gb|AF352804.1| Streptococcus canis ATCC43496 60 kDa chaperonin (... 42 1.8
134gb|AF352802.1| Streptococcus cristatus ATCC51100 60 kDa chaperon... 42 1.8
135gb|AF245682.1| Enterococcus casseliflavus 60 kDa chaperonin (cpn... 42 1.8
136gb|AF245681.1| Enterococcus faecium 60 kDa chaperonin (cpn60) ge... 42 1.8
137gb|AF245674.1| Lactococcus garvieae 60 kDa chaperonin (cpn60) ge... 42 1.8
138gb|AF245670.1| Enterococcus sp. R871 60 kDa chaperonin (cpn60) g... 42 1.8
139gb|AY328549.1| Enterococcus flavescens GroES (groES) and GroEL (... 42 1.8
140gb|AY328538.1| Enterococcus faecium strain 4140 GroEL (groEL) ge... 42 1.8
141gb|AY328536.1| Enterococcus faecium strain 2423 GroEL (groEL) ge... 42 1.8
142gb|AY315820.1| Enterococcus faecium strain ATCC 35667 GroES and ... 42 1.8
143gb|CP000114.1| Streptococcus agalactiae A909, complete genome 42 1.8
144gb|DQ106365.1| Uncultured bacterium clone pi0_cl3_cn1 60 kDa cha... 42 1.8
145gb|DQ106348.1| Uncultured bacterium clone mj1_cl15_cn1 60 kDa ch... 42 1.8
146gb|DQ106324.1| Uncultured bacterium clone mj0_cl0_sn23 60 kDa ch... 42 1.8
147gb|DQ106270.1| Uncultured bacterium clone dl1_cl14_cn1 60 kDa ch... 42 1.8
148gb|DQ106126.1| Uncultured bacterium clone ce1_cl0_sn33 60 kDa ch... 42 1.8
149gb|DQ156594.1| Acinetobacter calcoaceticus strain DSM 7324 60 kD... 42 1.8
150gb|AY508648.1| Streptococcus agalactiae strain 8 60 kDa chaperon... 42 1.8
151gb|AY487423.1| Streptococcus agalactiae 60 kDa chaperonin (cpn60... 42 1.8
152emb|CT009769.4| Mouse DNA sequence from clone RP23-44C21 on chro... 42 1.8
153emb|CR735141.14| Zebrafish DNA sequence from clone CH211-128E9 i... 42 1.8
154emb|AJ621263.1| Enterococcus solitarius partial GroEL gene for h... 42 1.8
155emb|AJ621261.1| Enterococcus pallens partial GroEL gene for heat... 42 1.8
156emb|AJ621257.1| Enterococcus flavescens partial GroEL gene for h... 42 1.8
157gb|AE014285.1| Streptococcus agalactiae 2603V/R section 95 of 10... 42 1.8
158emb|AL766855.1|SAG766855 Streptococcus agalactiae NEM316 complet... 42 1.8
159gb|AY121367.1| Streptococcus dysgalactiae strain HKU 7 chaperoni... 42 1.8
160gb|DQ395179.1| Bartonella tamii strain Th239 heat shock protein ... 42 1.8
161gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome 42 1.8
162gb|AF485797.1| Streptococcus dysgalactiae strain 74 60 kDa chape... 42 1.8
163gb|AF485796.1| Streptococcus dysgalactiae strain 62 60 kDa chape... 42 1.8
164gb|AF485795.1| Streptococcus dysgalactiae strain ATCC 43078 60 k... 42 1.8
165gb|AF485794.1| Streptococcus dysgalactiae strain ATCC 27957 60 k... 42 1.8
166gb|AF485793.1| Streptococcus agalactiae strain 13824-5 60 kDa ch... 42 1.8
167gb|AF485792.1| Streptococcus agalactiae strain 13821-4 60 kDa ch... 42 1.8
168gb|AF485791.1| Streptococcus agalactiae strain ATCC 27956 60 kDa... 42 1.8
169gb|AF485790.1| Streptococcus agalactiae strain ATCC 13813 60 kDa... 42 1.8
170gb|AF242277.1|AF242277 Macrococcus equipercicus heat shock prote... 42 1.8
171gb|AF019778.1|AF019778 Staphylococcus hyicus strain ATCC11249 ch... 42 1.8
172gb|AF019777.1|AF019777 Staphylococcus hyicus strain 16K chaperon... 42 1.8
173gb|AY123705.1| Granulicatella adiacens strain ATCC 49175 Cpn60 (... 42 1.8
174gb|AY123644.1| Streptococcus dysgalactiae strain ATCC 43078 Cpn6... 42 1.8
175gb|AY837411.1| Vibrio sp. 14C08 heat shock protein 60 (hsp60) ge... 42 1.8
176gb|AY837261.1| Vibrio sp. 12C03 heat shock protein 60 (hsp60) ge... 42 1.8
177gb|AY837255.1| Vibrio sp. 12B09 heat shock protein 60 (hsp60) ge... 42 1.8
178gb|AY837235.1| Vibrio sp. 7H03 heat shock protein 60 (hsp60) gen... 42 1.8
179gb|AY837233.1| Vibrio sp. 7G12 heat shock protein 60 (hsp60) gen... 42 1.8
180gb|AY837226.1| Vibrio sp. 7F11 heat shock protein 60 (hsp60) gen... 42 1.8
181gb|AY837225.1| Vibrio sp. 7F10 heat shock protein 60 (hsp60) gen... 42 1.8
182gb|AY837224.1| Vibrio sp. 7F08 heat shock protein 60 (hsp60) gen... 42 1.8
183gb|AY837222.1| Vibrio sp. 7F06 heat shock protein 60 (hsp60) gen... 42 1.8
184gb|AY837221.1| Vibrio sp. 7F05 heat shock protein 60 (hsp60) gen... 42 1.8
185gb|AY837218.1| Vibrio sp. 7E07 heat shock protein 60 (hsp60) gen... 42 1.8
186gb|AY837214.1| Vibrio sp. 7E02 heat shock protein 60 (hsp60) gen... 42 1.8
187gb|AY837206.1| Vibrio sp. 7C09 heat shock protein 60 (hsp60) gen... 42 1.8
188gb|AY837202.1| Vibrio sp. 7B12 heat shock protein 60 (hsp60) gen... 42 1.8
189gb|AY837197.1| Vibrio sp. 7B04 heat shock protein 60 (hsp60) gen... 42 1.8
190gb|AY837192.1| Vibrio sp. 7A06 heat shock protein 60 (hsp60) gen... 42 1.8
191gb|AY837190.1| Vibrio sp. 7A03 heat shock protein 60 (hsp60) gen... 42 1.8
192gb|AY837150.1| Vibrio sp. 1B07 heat shock protein 60 (hsp60) gen... 42 1.8
193emb|BX823782.1|CNS0A5D5 Arabidopsis thaliana Full-length cDNA Co... 42 1.8
194gb|AF325222.1|AF325222 Streptococcus agalactiae 60kDa chaperonin... 42 1.8
195gb|AY017169.1| Vibrio vulnificus groEL gene, complete cds 42 1.8
196gb|AY121366.1| Streptococcus dysgalactiae subsp. equisimilis str... 42 1.8
197gb|AY121365.1| Streptococcus dysgalactiae subsp. equisimilis str... 42 1.8
198gb|AY121364.1| Streptococcus dysgalactiae subsp. equisimilis str... 42 1.8
199gb|AY121363.1| Streptococcus dysgalactiae subsp. dysgalactiae st... 42 1.8
200gb|AF230950.1| Vibrio ordalii HSP60 gene, partial cds 42 1.8
201gb|AF230933.1| Listonella anguillarum strain NB122 Hsp60 (hsp60)... 42 1.8
202gb|AF230932.1| Listonella anguillarum strain ATCC19264 Hsp60 (hs... 42 1.8
203emb|X57520.1|LMGROELSR L.micdadei DNA for gro ELS operon 42 1.8
204dbj|AB073221.2| Colwellia maris groESL operon (groES and groEL),... 42 1.8
205emb|AM235732.1| Listonella anguillarum partial cpn60 gene for ch... 42 1.8
206gb|CP000020.1| Vibrio fischeri ES114 chromosome I, complete sequ... 42 1.8
207gb|AF152236.1| Methylovorus sp. strain SS1 groESL operon, comple... 42 1.8
208gb|M86549.1|XBCGROEX Amoeba proteus symbiotic bacterium groES an... 42 1.8
209emb|AM162559.1| Listonella anguillarum partial hsp60 gene for he... 42 1.8
210dbj|AP005638.2| Homo sapiens genomic DNA, chromosome 11 clone:CM... 42 1.8
211gb|AF429643.1| Pediococcus claussenii strain CCC B962A 60 kDa he... 42 1.8
212gb|AC156638.2| Mus musculus BAC clone RP24-255L24 from chromosom... 42 1.8
213ref|NM_179480.1| Arabidopsis thaliana CPN60B (CHAPERONIN 60 BETA... 40 7.0
214ref|NM_104424.2| Arabidopsis thaliana CPN60B (CHAPERONIN 60 BETA... 40 7.0
215ref|NM_112193.1| Arabidopsis thaliana ATP binding / protein bind... 40 7.0
216ref|NM_202718.1| Arabidopsis thaliana alpha-galactosidase/ hydro... 40 7.0
217ref|NM_115489.4| Arabidopsis thaliana alpha-galactosidase/ hydro... 40 7.0
218gb|AY691282.1| Prevotella enoeca 60 kDa chaperonin (cpn60) gene,... 40 7.0
219gb|AF437243.1| Uncultured pig faeces bacterium clone B40-0022 60... 40 7.0
220gb|AF440237.1| Bacteroides uniformis CPN60 (cpn60) gene, partial... 40 7.0
221gb|AF352808.1| Streptococcus anginosus ATCC33397 60 kDa chaperon... 40 7.0
222gb|AC146609.3| Mus musculus BAC clone RP23-162K11 from chromosom... 40 7.0
223gb|DQ410272.1| HIV-1 isolate H22v2ed3 from USA envelope glycopro... 40 7.0
224gb|CP000358.1| Deinococcus geothermalis DSM 11300 plasmid 1, com... 40 7.0
225gb|DQ106370.1| Uncultured bacterium clone pi1_cl0_sn27 60 kDa ch... 40 7.0
226gb|DQ106358.1| Uncultured bacterium clone pi0_cl0_sn54 60 kDa ch... 40 7.0
227gb|DQ106331.1| Uncultured bacterium clone mj0_cl13_cn1 60 kDa ch... 40 7.0
228gb|DQ106327.1| Uncultured bacterium clone mj0_cl0_sn8 60 kDa cha... 40 7.0
229gb|DQ106272.1| Uncultured bacterium clone dl1_cl17_cn1 60 kDa ch... 40 7.0
230gb|DQ106230.1| Uncultured bacterium clone dl0_cl12_cn1 60 kDa ch... 40 7.0
231gb|DQ106222.1| Uncultured bacterium clone dl0_cl0_sn11 60 kDa ch... 40 7.0
232gb|DQ106176.1| Uncultured bacterium clone ce1_cl3_cn1 60 kDa cha... 40 7.0
233gb|DQ106134.1| Uncultured bacterium clone ce1_cl0_sn66 60 kDa ch... 40 7.0
234gb|DQ106071.1| Uncultured bacterium clone ce0_cl2_cn6 60 kDa cha... 40 7.0
235gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 40 7.0
236gb|DQ156613.1| Acinetobacter baumannii strain st1954 60 kDa chap... 40 7.0
237gb|DQ156612.1| Acinetobacter baumannii strain st1650 60 kDa chap... 40 7.0
238gb|DQ156611.1| Acinetobacter genomosp. 13TU strain st7961 60 kDa... 40 7.0
239gb|DQ156610.1| Acinetobacter genomosp. 13TU strain st11681 60 kD... 40 7.0
240gb|DQ156609.1| Acinetobacter baumannii strain V7459 60 kDa chape... 40 7.0
241gb|DQ156608.1| Acinetobacter baumannii strain st17093 60 kDa cha... 40 7.0
242gb|DQ156607.1| Acinetobacter baumannii strain st14970 60 kDa cha... 40 7.0
243gb|DQ156606.1| Acinetobacter baumannii strain st15598 60 kDa cha... 40 7.0
244gb|DQ156605.1| Acinetobacter baumannii strain st21359 60 kDa cha... 40 7.0
245gb|DQ156604.1| Acinetobacter baumannii strain st20820 60 kDa cha... 40 7.0
246gb|DQ156603.1| Acinetobacter baumannii strain st14733 60 kDa cha... 40 7.0
247gb|DQ156602.1| Acinetobacter baumannii strain st284 60 kDa chape... 40 7.0
248gb|DQ156601.1| Acinetobacter baumannii strain U11177 60 kDa chap... 40 7.0
249gb|DQ156600.1| Acinetobacter baumannii strain U10247 60 kDa chap... 40 7.0
250gb|DQ156599.1| Acinetobacter baumannii strain U1901 60 kDa chape... 40 7.0
251gb|DQ156598.1| Acinetobacter baumannii strain W5420 60 kDa chape... 40 7.0
252gb|DQ156597.1| Acinetobacter baumannii strain DSM 30007 60 kDa c... 40 7.0
253gb|DQ156595.1| Acinetobacter baumannii strain DSM 30008 60 kDa c... 40 7.0
254gb|DQ156592.1| Acinetobacter baumannii strain RUH875 60 kDa chap... 40 7.0
255gb|DQ156591.1| Acinetobacter baumannii strain RHU134 60 kDa chap... 40 7.0
256gb|DQ156590.1| Acinetobacter baumannii strain RUH2207 60 kDa cha... 40 7.0
257gb|DQ156589.1| Acinetobacter calcoaceticus strain 2001-16313 60 ... 40 7.0
258gb|DQ156588.1| Acinetobacter baumannii strain 11094 60 kDa chape... 40 7.0
259gb|DQ156587.1| Acinetobacter baumannii strain 2001-12583 60 kDa ... 40 7.0
260gb|DQ156586.1| Acinetobacter baumannii strain 2001-30645 60 kDa ... 40 7.0
261gb|DQ156584.1| Acinetobacter baumannii strain 2002-9198 60 kDa c... 40 7.0
262gb|DQ156583.1| Acinetobacter baumannii strain 2002-34100 60 kDa ... 40 7.0
263gb|DQ156582.1| Acinetobacter baumannii strain 62309 60 kDa chape... 40 7.0
264gb|DQ156581.1| Acinetobacter baumannii strain 61812 60 kDa chape... 40 7.0
265gb|DQ156579.1| Acinetobacter baumannii strain 135467 60 kDa chap... 40 7.0
266gb|DQ156578.1| Acinetobacter baumannii strain 135323 60 kDa chap... 40 7.0
267gb|DQ156577.1| Acinetobacter baumannii strain 135172 60 kDa chap... 40 7.0
268gb|DQ156576.1| Acinetobacter baumannii strain 224220 60 kDa chap... 40 7.0
269gb|DQ156575.1| Acinetobacter baumannii strain 118151 60 kDa chap... 40 7.0
270gb|DQ156574.1| Acinetobacter baumannii strain 113402 60 kDa chap... 40 7.0
271gb|DQ156573.1| Acinetobacter baumannii strain 60127 60 kDa chape... 40 7.0
272gb|DQ156572.1| Acinetobacter baumannii strain 213278 60 kDa chap... 40 7.0
273gb|DQ156571.1| Acinetobacter baumannii strain 220383 60 kDa chap... 40 7.0
274gb|DQ156570.1| Acinetobacter baumannii strain 228620 60 kDa chap... 40 7.0
275gb|DQ156569.1| Acinetobacter baumannii strain 218011 60 kDa chap... 40 7.0
276gb|DQ156568.1| Acinetobacter baumannii strain 288611 60 kDa chap... 40 7.0
277gb|DQ156567.1| Acinetobacter baumannii strain 151101 60 kDa chap... 40 7.0
278gb|DQ156566.1| Acinetobacter baumannii strain 52400 60 kDa chape... 40 7.0
279gb|DQ156565.1| Acinetobacter baumannii strain 62791 60 kDa chape... 40 7.0
280gb|AY334447.1| Candidatus Blochmannia floridanus isolate Cflor36... 40 7.0
281gb|AY334445.1| Candidatus Blochmannia americanus isolate Camer00... 40 7.0
282gb|AY334438.1| Candidatus Blochmannia schaefferi isolate Cscha16... 40 7.0
283gb|AF130421.1| Secondary endosymbiont of Bemisia tabaci chaperon... 40 7.0
284gb|AY462932.1| Secondary endosymbiont of Bemisia tabaci GroEL (g... 40 7.0
285gb|AY462931.1| Secondary endosymbiont of Bemisia tabaci GroEL (g... 40 7.0
286gb|AY462930.1| Secondary endosymbiont of Bemisia tabaci GroEL (g... 40 7.0
287gb|AY462929.1| Secondary endosymbiont of Bemisia tabaci GroEL (g... 40 7.0
288gb|AY445874.1| Secondary endosymbiont of Bemisia tabaci GroEL (g... 40 7.0
289gb|AY445873.1| Secondary endosymbiont of Bemisia tabaci GroEL (g... 40 7.0
290gb|AY445872.1| Secondary endosymbiont of Bemisia tabaci GroEL (g... 40 7.0
291gb|AC005223.1| Arabidopsis thaliana chromosome I BAC T5A14, comp... 40 7.0
292gb|DQ062242.1| Streptococcus sobrinus serotype g GroES (groES) g... 40 7.0
293gb|DQ062239.1| Streptococcus sobrinus serotype d GroES (groES) g... 40 7.0
294gb|CP000056.1| Streptococcus pyogenes MGAS6180, complete genome 40 7.0
295gb|AY344497.1| Streptococcus anginosus chaperonin GroEL gene, pa... 40 7.0
296gb|AF404511.1| Sodalis glossinidius groEL (mopB) gene, partial cds 40 7.0
297gb|AY059013.1| Rickettsia akari GroEL protein gene, partial cds 40 7.0
298gb|AC094241.9| Rattus norvegicus 1 BAC CH230-3C7 (Children's Hos... 40 7.0
299emb|Z68903.1|SCCPN60 S.cereale cv. Petkus "Halo" encoding cpn60 40 7.0
300gb|AY114020.1| Arabidopsis thaliana putative alpha-galactosidase... 40 7.0
301gb|AY074321.1| Arabidopsis thaliana putative alpha-galactosidase... 40 7.0
302emb|BX248584.1| Blochmannia floridanus complete genome; segment 1/3 40 7.0
303emb|AJ558235.1|HBI558235 Helicobacter bizzozeronii partial hsp60... 40 7.0
304emb|AJ558231.1|HBI558231 Helicobacter bizzozeronii partial hsp60... 40 7.0
305emb|CR932799.1| Mus musculus chromosome 2, clone RPCI-22-207E02 ... 40 7.0
306dbj|AB231904.1| Megacopta punctatissima symbiont gene for GroEL ... 40 7.0
307dbj|AP008232.1| Sodalis glossinidius str. 'morsitans' DNA, compl... 40 7.0
308gb|AF378195.1| Streptococcus anginosus GroES (groES) and GroEL (... 40 7.0
309gb|AY081501.1| Arabidopsis thaliana Rubisco subunit binding-prot... 40 7.0
310gb|AC096741.3| Homo sapiens BAC clone RP11-327O17 from 4, comple... 40 7.0
311gb|AC093863.3| Homo sapiens BAC clone RP11-552I10 from 4, comple... 40 7.0
312gb|AY940883.1| Bacteroides uniformis 10 kDa chaperonin (groES) a... 40 7.0
313gb|AY123715.1| Bordetella holmesii strain ATCC 51541 Cpn60 (cpn6... 40 7.0
314gb|AY123700.1| Granulicatella balaenopterae strain ATCC 700813 C... 40 7.0
315gb|AY123695.1| Bartonella clarridgeiae strain ATCC 51734 Cpn60 (... 40 7.0
316gb|AY123687.1| Comamonas testosteroni strain ATCC 11996 Cpn60 (c... 40 7.0
317gb|AY123682.1| Acinetobacter calcoaceticus strain ATCC 23055 Cpn... 40 7.0
318gb|AY123669.1| Acinetobacter baumannii strain ATCC 19606 Cpn60 (... 40 7.0
319gb|AY123658.1| Acinetobacter junii strain ATCC 17908 Cpn60 (cpn6... 40 7.0
320gb|AY123640.1| Proteus mirabilis strain ATCC 25933 Cpn60 (cpn60)... 40 7.0
321gb|AC138589.16| Mus musculus chromosome 1, clone RP24-153C14, co... 40 7.0
322gb|AY332856.1| Yersinia aldovae strain CNY 71121 60 kDa heat sho... 40 7.0
323gb|AY332855.1| Yersinia aldovae strain 35236 60 kDa heat shock p... 40 7.0
324gb|AF326971.1|AF326971 Sodalis glossinidius groEL (mopB) gene, c... 40 7.0
325gb|AF386945.1|AF386945 Arabidopsis thaliana Rubisco subunit bind... 40 7.0
326dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.0
327emb|BX814891.1|CNS0ADZ4 Arabidopsis thaliana Full-length cDNA Co... 40 7.0
328emb|BX822543.1|CNS0A7LR Arabidopsis thaliana Full-length cDNA Co... 40 7.0
329emb|BX822739.1|CNS0A62G Arabidopsis thaliana Full-length cDNA Co... 40 7.0
330emb|BX822949.1|CNS0A5TS Arabidopsis thaliana Full-length cDNA Co... 40 7.0
331emb|BX823822.1|CNS0A5CU Arabidopsis thaliana Full-length cDNA Co... 40 7.0
332emb|BX823606.1|CNS0A5EQ Arabidopsis thaliana Full-length cDNA Co... 40 7.0
333emb|BX823461.1|CNS0A5D8 Arabidopsis thaliana Full-length cDNA Co... 40 7.0
334emb|BX823316.1|CNS0A5G0 Arabidopsis thaliana Full-length cDNA Co... 40 7.0
335emb|BX823260.1|CNS0A5BJ Arabidopsis thaliana Full-length cDNA Co... 40 7.0
336emb|BX823219.1|CNS0A5DO Arabidopsis thaliana Full-length cDNA Co... 40 7.0
337emb|BX826044.1|CNS0A543 Arabidopsis thaliana Full-length cDNA Co... 40 7.0
338emb|BX825512.1|CNS0A4ZE Arabidopsis thaliana Full-length cDNA Co... 40 7.0
339emb|BX824990.1|CNS0A4O5 Arabidopsis thaliana Full-length cDNA Co... 40 7.0
340emb|BX824901.1|CNS0A4O4 Arabidopsis thaliana Full-length cDNA Co... 40 7.0
341gb|AC082651.6| Homo sapiens BAC clone RP11-521D12 from 2, comple... 40 7.0
342gb|AC011900.6| Homo sapiens BAC clone RP11-542L18 from 2, comple... 40 7.0
343gb|AF321517.1|AF321517 Sodalis glossinidius groEL (mopB) gene, p... 40 7.0
344gb|AC104321.7| Oryza sativa chromosome 3 BAC OSJNBa0052F07 genom... 40 7.0
345emb|BX571892.9| Mouse DNA sequence from clone RP23-207B21 on chr... 40 7.0
346gb|AY922364.1| Providencia stuartii 60 kDa chaperonin (cpn60) ge... 40 7.0
347dbj|AP000603.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 40 7.0
348dbj|AK027027.1| Homo sapiens cDNA: FLJ23374 fis, clone HEP16126 40 7.0
349gb|L10132.1|BACSGROESL Bacillus stearothermophilus GroES (groES)... 40 7.0
350gb|AF036670.1| Ehrlichia risticii groESL heat shock protein gene... 40 7.0
351gb|AF014831.1|AF014831 Bartonella clarridgeiae 60 kDa heat shock... 40 7.0
352gb|AC006226.4|AC006226 Homo sapiens chromosome 4 clone C0011C13 ... 40 7.0
353gb|AF405394.1| Pediococcus pentosaceus clone P05 HSP60 gene, par... 40 7.0
354gb|AY562884.1| Uncultured bacterium clone w03_b02 60 kDa chapero... 40 7.0
355gb|AY562856.1| Uncultured bacterium clone c13_b07 60 kDa chapero... 40 7.0
356gb|AY562838.1| Uncultured bacterium clone c12_b04 60 kDa chapero... 40 7.0
357gb|AY562821.1| Uncultured bacterium clone c11_a01 60 kDa chapero... 40 7.0
358gb|AY562602.1| Uncultured bacterium clone b03_g03 60 kDa chapero... 40 7.0
359gb|AY562590.1| Uncultured bacterium clone b02_f08 60 kDa chapero... 40 7.0
360gb|AE017143.1| Haemophilus ducreyi strain 35000HP complete genome 40 7.0
361gb|AF027335.1|AF027335 Equus caballus prostaglandin G/H synthase... 40 7.0
362gb|DQ302725.1| Streptococcus infantarius subsp. infantarius stra... 40 7.0
363gb|DQ302724.1| Streptococcus pasteurianus strain ATCC 43144 GroE... 40 7.0
364gb|AC131779.4| Mus musculus BAC clone RP24-336D11 from 8, comple... 40 7.0
365gb|M35598.1|ATH60CPNB A.thaliana plastid 60-kDa chaperonin-60 be... 40 7.0
366gb|M91030.1|HEAGROESL Haemophilus ducreyi heat shock protein (gr... 40 7.0

>dbj|AK068562.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013152E19, full
           insert sequence
          Length = 2339

 Score =  392 bits (198), Expect = e-106
 Identities = 384/446 (86%)
 Strand = Plus / Plus

                                                                       
Query: 1   aacgatattgccggcgatgggtgtaccacttctataatccttgctcaaggcctgattgct 60
           |||||| |||| || ||||| ||||||||||| |||||||||||||||||||| || |||
Sbjct: 423 aacgatgttgctggtgatggttgtaccacttccataatccttgctcaaggcctcatcgct 482

                                                                       
Query: 61  gaaggaatgaaggttcttgctgctggaatgaatccggttcaaattgcgcgtggcattggg 120
           |||||||||||||| ||||| |||||||| ||||| || || |||||||| ||||||| |
Sbjct: 483 gaaggaatgaaggtgcttgcagctggaattaatcctgtccagattgcgcggggcattgag 542

                                                                       
Query: 121 aggactgctgatgctttggtttctgaactcaagttgatgtcacgggagattgaagatcat 180
           | |||||||  ||||||||| ||||||||||  |||||||| |||||||| ||||| |||
Sbjct: 543 aagactgcttctgctttggtgtctgaactcagattgatgtcccgggagatagaagaccat 602

                                                                       
Query: 181 gaaatagcacacgtggctgcagttagtgccggaaatgattacgctgtcggaaacatgatt 240
           ||||| ||||| ||||||||||||||||| ||| ||||||| ||||| ||||| ||||||
Sbjct: 603 gaaattgcacatgtggctgcagttagtgcaggagatgattatgctgttggaaatatgatt 662

                                                                       
Query: 241 tctgatgcttttaaaagagtaggcagggaaggcatggttagaattgaaaacgggagaagc 300
           ||||||||||||||||||||||||||| |||||||||| || |||||||| || ||  ||
Sbjct: 663 tctgatgcttttaaaagagtaggcaggaaaggcatggtgaggattgaaaatggaaggggc 722

                                                                       
Query: 301 actgtaaacagtttggaggttgtcgaaggaatgcagtttgaacgtggttacctctcacct 360
           || | |||  || | ||| |||| ||||||||||| ||||||||||||||||||||||| 
Sbjct: 723 acggaaaatggtctagagattgtggaaggaatgcaatttgaacgtggttacctctcaccg 782

                                                                       
Query: 361 ttctttgtcaccaatcatgcaaatatgtccgcggagtacactgactgtaagatcctgttg 420
           | |||||| ||  ||  | ||||||||||||||||||  ||||||||||||||  |||||
Sbjct: 783 tactttgtgactgattgtacaaatatgtccgcggagtttactgactgtaagatattgttg 842

                                     
Query: 421 gttgacaagataatttctgatccaag 446
           |||||||||| |||| ||||| ||||
Sbjct: 843 gttgacaagaaaattactgatgcaag 868



to top

>gb|AC157500.1| Oryza sativa (japonica cultivar-group) BAC clone OSJNBb0056O04, from
             chromosome 4, complete sequence
          Length = 90825

 Score =  208 bits (105), Expect = 1e-50
 Identities = 210/245 (85%)
 Strand = Plus / Minus

                                                                         
Query: 167   agattgaagatcatgaaatagcacacgtggctgcagttagtgccggaaatgattacgctg 226
             |||| ||||| |||||||| ||||| ||||||||||||||||| ||| ||||||| ||||
Sbjct: 21398 agatagaagaccatgaaattgcacatgtggctgcagttagtgcaggagatgattatgctg 21339

                                                                         
Query: 227   tcggaaacatgatttctgatgcttttaaaagagtaggcagggaaggcatggttagaattg 286
             | ||||| ||||||||||||||||||||||||||||||||| |||||||||| || ||||
Sbjct: 21338 ttggaaatatgatttctgatgcttttaaaagagtaggcaggaaaggcatggtgaggattg 21279

                                                                         
Query: 287   aaaacgggagaagcactgtaaacagtttggaggttgtcgaaggaatgcagtttgaacgtg 346
             |||| || ||  |||| | |||  || | ||| |||| ||||||||||| ||||||||||
Sbjct: 21278 aaaatggaaggggcacggaaaatggtctagagattgtggaaggaatgcaatttgaacgtg 21219

                                                                         
Query: 347   gttacctctcacctttctttgtcaccaatcatgcaaatatgtccgcggagtacactgact 406
             ||||||||||||| | |||||| ||  ||  | ||||||||||||||||||  |||||||
Sbjct: 21218 gttacctctcaccgtactttgtgactgattgtacaaatatgtccgcggagtttactgact 21159

                  
Query: 407   gtaag 411
             |||||
Sbjct: 21158 gtaag 21154



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 67/74 (90%)
 Strand = Plus / Minus

                                                                         
Query: 1     aacgatattgccggcgatgggtgtaccacttctataatccttgctcaaggcctgattgct 60
             |||||| |||| || ||||| ||||||||||| |||||||||||||||||||| || |||
Sbjct: 21803 aacgatgttgctggtgatggttgtaccacttccataatccttgctcaaggcctcatcgct 21744

                           
Query: 61    gaaggaatgaaggt 74
             ||||||||||||||
Sbjct: 21743 gaaggaatgaaggt 21730



to top

>gb|AY664491.1| Bartonella bacilliformis fumarase C (fumC) gene, partial cds;
            hypothetical protein gene, complete cds; and groE operon,
            complete sequence
          Length = 2459

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/63 (87%)
 Strand = Plus / Plus

                                                                        
Query: 313  ttggaggttgtcgaaggaatgcagtttgaacgtggttacctctcacctttctttgtcacc 372
            ||||| ||||| ||||||||||||||||| ||||| || || || |||| ||||||||||
Sbjct: 1274 ttggaagttgttgaaggaatgcagtttgatcgtgggtatctttctccttactttgtcacc 1333

               
Query: 373  aat 375
            |||
Sbjct: 1334 aat 1336



to top

>emb|Z15160.1|BBGROELT B.bacilliformis GroEL-type gene encoding heat shock protein 60
          Length = 1635

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/63 (87%)
 Strand = Plus / Plus

                                                                       
Query: 313 ttggaggttgtcgaaggaatgcagtttgaacgtggttacctctcacctttctttgtcacc 372
           ||||| ||||| ||||||||||||||||| ||||| || || || |||| ||||||||||
Sbjct: 559 ttggaagttgttgaaggaatgcagtttgatcgtgggtatctttctccttactttgtcacc 618

              
Query: 373 aat 375
           |||
Sbjct: 619 aat 621



to top

>gb|M98257.1|BAOBB63A Bartonella bacilliformis immunoreactive protein (bb63) gene,
           complete cds
          Length = 1894

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/63 (87%)
 Strand = Plus / Plus

                                                                       
Query: 313 ttggaggttgtcgaaggaatgcagtttgaacgtggttacctctcacctttctttgtcacc 372
           ||||| ||||| ||||||||||||||||| ||||| || || || |||| ||||||||||
Sbjct: 628 ttggaagttgttgaaggaatgcagtttgatcgtgggtatctttctccttactttgtcacc 687

              
Query: 373 aat 375
           |||
Sbjct: 688 aat 690



to top

>ref|NM_102387.1| Arabidopsis thaliana ATP binding / protein binding AT1G26230 mRNA,
           complete cds
          Length = 1843

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 72/87 (82%)
 Strand = Plus / Plus

                                                                       
Query: 166 gagattgaagatcatgaaatagcacacgtggctgcagttagtgccggaaatgattacgct 225
           |||||||||||||||||  | || || || || ||||||||||| || ||||| ||||  
Sbjct: 533 gagattgaagatcatgagcttgctcatgttgcagcagttagtgcggggaatgactacgaa 592

                                      
Query: 226 gtcggaaacatgatttctgatgctttt 252
           || ||||||||||||||  ||||||||
Sbjct: 593 gtgggaaacatgatttccaatgctttt 619



to top

>gb|AY515129.1| Bartonella phoceensis strain 16120 GroEL gene, partial cds
          Length = 1437

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                              
Query: 325 gaaggaatgcagtttgaacgtggttacctctcacctttctttgtcaccaat 375
           ||||||||||||||||| ||||| || || || |||| |||||||||||||
Sbjct: 369 gaaggaatgcagtttgatcgtggatatctttccccttactttgtcaccaat 419



to top

>emb|AJ749669.1| Bartonella henselae groES gene, groEL gene and phnA gene
          Length = 3905

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                               
Query: 325  gaaggaatgcagtttgaacgtggttacctctcacctttctttgtcaccaat 375
            ||||||||||||||||| ||||| || || || |||| |||||||||||||
Sbjct: 1199 gaaggaatgcagtttgatcgtggatatctttccccttactttgtcaccaat 1249



to top

>gb|AY116641.1| Bartonella koehlerae heat shock protein Hsp60 (groEL) gene, partial
           cds
          Length = 1188

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 54/63 (85%)
 Strand = Plus / Plus

                                                                       
Query: 313 ttggaggttgtcgaaggaatgcagtttgaacgtggttacctctcacctttctttgtcacc 372
           ||||| ||||| |||||||||||||| || ||||| || || || |||| ||||||||||
Sbjct: 278 ttggaagttgttgaaggaatgcagttcgatcgtggatatctttccccttactttgtcacc 337

              
Query: 373 aat 375
           |||
Sbjct: 338 aat 340



to top

>emb|BX897699.1| Bartonella henselae strain Houston-1, complete genome
          Length = 1931047

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                                  
Query: 325     gaaggaatgcagtttgaacgtggttacctctcacctttctttgtcaccaat 375
               ||||||||||||||||| ||||| || || || |||| |||||||||||||
Sbjct: 1548700 gaaggaatgcagtttgatcgtggatatctttccccttactttgtcaccaat 1548650



to top

>gb|AF304023.1| Bartonella henselae strain 90-615 heat shock protein Hsp60 (groEL)
           gene, partial cds
          Length = 1403

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                              
Query: 325 gaaggaatgcagtttgaacgtggttacctctcacctttctttgtcaccaat 375
           ||||||||||||||||| ||||| || || || |||| |||||||||||||
Sbjct: 354 gaaggaatgcagtttgatcgtggatatctttccccttactttgtcaccaat 404



to top

>gb|AF304022.1| Bartonella henselae strain FIZZ heat shock protein Hsp60 (groEL)
           gene, partial cds
          Length = 1402

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                              
Query: 325 gaaggaatgcagtttgaacgtggttacctctcacctttctttgtcaccaat 375
           ||||||||||||||||| ||||| || || || |||| |||||||||||||
Sbjct: 353 gaaggaatgcagtttgatcgtggatatctttccccttactttgtcaccaat 403



to top

>gb|AF304021.1| Bartonella henselae strain SA-2 heat shock protein Hsp60 (groEL)
           gene, partial cds
          Length = 1336

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                              
Query: 325 gaaggaatgcagtttgaacgtggttacctctcacctttctttgtcaccaat 375
           ||||||||||||||||| ||||| || || || |||| |||||||||||||
Sbjct: 290 gaaggaatgcagtttgatcgtggatatctttccccttactttgtcaccaat 340



to top

>gb|AF304020.1| Bartonella henselae strain CAL-1 heat shock protein Hsp60 (groEL)
           gene, partial cds
          Length = 1375

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                              
Query: 325 gaaggaatgcagtttgaacgtggttacctctcacctttctttgtcaccaat 375
           ||||||||||||||||| ||||| || || || |||| |||||||||||||
Sbjct: 328 gaaggaatgcagtttgatcgtggatatctttccccttactttgtcaccaat 378



to top

>gb|AF304019.1| Bartonella henselae strain URLLY8 heat shock protein Hsp60 (groEL)
           gene, partial cds
          Length = 1305

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                              
Query: 325 gaaggaatgcagtttgaacgtggttacctctcacctttctttgtcaccaat 375
           ||||||||||||||||| ||||| || || || |||| |||||||||||||
Sbjct: 323 gaaggaatgcagtttgatcgtggatatctttccccttactttgtcaccaat 373



to top

>gb|AF299357.1| Bartonella alsatica HSP60 gene, partial cds
          Length = 1418

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 325 gaaggaatgcagtttgaacgtggttacctctcacctttctttgtcac 371
           ||||||||||||||||| ||||| || || ||||||| |||||||||
Sbjct: 355 gaaggaatgcagtttgatcgtggatatctttcaccttactttgtcac 401



to top

>dbj|AK221637.1| Arabidopsis thaliana mRNA for chaperonin precursor, complete cds,
           clone: RAFL07-98-N18
          Length = 2011

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 72/87 (82%)
 Strand = Plus / Plus

                                                                       
Query: 166 gagattgaagatcatgaaatagcacacgtggctgcagttagtgccggaaatgattacgct 225
           |||||||||||||||||  | || || || || ||||||||||| || ||||| ||||  
Sbjct: 561 gagattgaagatcatgagcttgctcatgttgcagcagttagtgcggggaatgactacgaa 620

                                      
Query: 226 gtcggaaacatgatttctgatgctttt 252
           || ||||||||||||||  ||||||||
Sbjct: 621 gtgggaaacatgatttccaatgctttt 647



to top

>gb|AY123688.1| Bartonella henselae strain ATCC 49882 Cpn60 (cpn60) gene, partial
           cds
          Length = 555

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                              
Query: 325 gaaggaatgcagtttgaacgtggttacctctcacctttctttgtcaccaat 375
           ||||||||||||||||| ||||| || || || |||| |||||||||||||
Sbjct: 298 gaaggaatgcagtttgatcgtggatatctttccccttactttgtcaccaat 348



to top

>gb|AY445615.1| Ruminococcus albus strain B199 GroEL (groEL) gene, partial cds
          Length = 1380

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttacctctcacctt 361
           ||||| ||||||||||||||||| ||||| ||||| |||||||
Sbjct: 450 gttgttgaaggaatgcagtttgaccgtggatacctttcacctt 492



to top

>gb|AF014829.1|AF014829 Bartonella henselae 60 kDa heat shock protein (groEL) gene, partial
           cds
          Length = 1627

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                              
Query: 325 gaaggaatgcagtttgaacgtggttacctctcacctttctttgtcaccaat 375
           ||||||||||||||||| ||||| || || || |||| |||||||||||||
Sbjct: 570 gaaggaatgcagtttgatcgtggatatctttccccttactttgtcaccaat 620



to top

>gb|U78514.1|BHU78514 Bartonella henselae heat shock protein HSP60 (groEL) gene, complete
           cds
          Length = 1644

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                              
Query: 325 gaaggaatgcagtttgaacgtggttacctctcacctttctttgtcaccaat 375
           ||||||||||||||||| ||||| || || || |||| |||||||||||||
Sbjct: 571 gaaggaatgcagtttgatcgtggatatctttccccttactttgtcaccaat 621



to top

>gb|U96734.1|BHU96734 Bartonella henselae GroES (groES) and GroEL (groEL) genes, partial
           cds
          Length = 1442

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                              
Query: 325 gaaggaatgcagtttgaacgtggttacctctcacctttctttgtcaccaat 375
           ||||||||||||||||| ||||| || || || |||| |||||||||||||
Sbjct: 789 gaaggaatgcagtttgatcgtggatatctttccccttactttgtcaccaat 839



to top

>ref|NM_125033.3| Arabidopsis thaliana ATP binding / protein binding AT5G56500
           transcript variant AT5G56500.1 mRNA, complete cds
          Length = 2315

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttacctctcacctttctttgtcacc 372
           ||||| ||||||||||| ||||| ||||||||  |||| |||| ||||||||||
Sbjct: 806 gttgttgaaggaatgcaatttgatcgtggttatatctctccttactttgtcacc 859



to top

>ref|NM_001037006.1| Arabidopsis thaliana ATP binding / protein binding AT5G56500
           transcript variant AT5G56500.2 mRNA, complete cds
          Length = 2355

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttacctctcacctttctttgtcacc 372
           ||||| ||||||||||| ||||| ||||||||  |||| |||| ||||||||||
Sbjct: 846 gttgttgaaggaatgcaatttgatcgtggttatatctctccttactttgtcacc 899



to top

>gb|AE008538.1| Streptococcus pneumoniae R6 section 154 of 184 of the complete genome
          Length = 11318

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                              
Query: 325  gaaggaatgcagtttgaacgtggttacctctcac 358
            ||||||||||||||||| ||||||||||| ||||
Sbjct: 2960 gaaggaatgcagtttgaccgtggttacctttcac 2927



to top

>gb|AF352805.1| Streptococcus pneumoniae ATCC33400 60 kDa chaperonin (cpn60) gene,
           partial cds
          Length = 552

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                             
Query: 325 gaaggaatgcagtttgaacgtggttacctctcac 358
           ||||||||||||||||| ||||||||||| ||||
Sbjct: 295 gaaggaatgcagtttgaccgtggttacctttcac 328



to top

>gb|AF237466.1| Streptococcus sp. Z89 60 kDa chaperonin (cpn60) gene, partial cds
          Length = 552

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                             
Query: 325 gaaggaatgcagtttgaacgtggttacctctcac 358
           ||||||||||||||||| ||||||||||| ||||
Sbjct: 295 gaaggaatgcagtttgaccgtggttacctttcac 328



to top

>gb|AF237459.1| Streptococcus pneumoniae 60 kDa chaperonin (cpn60) gene, partial
           cds
          Length = 552

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                             
Query: 325 gaaggaatgcagtttgaacgtggttacctctcac 358
           ||||||||||||||||| ||||||||||| ||||
Sbjct: 295 gaaggaatgcagtttgaccgtggttacctttcac 328



to top

>gb|AF237458.1| Streptococcus mitis 60 kDa chaperonin (cpn60) gene, partial cds
          Length = 552

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                             
Query: 325 gaaggaatgcagtttgaacgtggttacctctcac 358
           ||||||||||||||||| ||||||||||| ||||
Sbjct: 295 gaaggaatgcagtttgaccgtggttacctttcac 328



to top

>gb|AY344504.1| Streptococcus pneumoniae chaperonin GroEL gene, partial cds
          Length = 1463

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                             
Query: 325 gaaggaatgcagtttgaacgtggttacctctcac 358
           ||||||||||||||||| ||||||||||| ||||
Sbjct: 517 gaaggaatgcagtttgaccgtggttacctttcac 550



to top

>gb|AF325449.1|AF325449 Streptococcus pneumoniae GroES and GroEL mRNAs, complete cds
          Length = 2107

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                              
Query: 325  gaaggaatgcagtttgaacgtggttacctctcac 358
            ||||||||||||||||| ||||||||||| ||||
Sbjct: 1049 gaaggaatgcagtttgaccgtggttacctttcac 1082



to top

>emb|BX831822.1|CNS09YNB Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH31ZC11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1462

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttacctctcacctttctttgtcacc 372
           ||||| ||||||||||| ||||| ||||||||  |||| |||| ||||||||||
Sbjct: 200 gttgttgaaggaatgcaatttgatcgtggttatatctctccttactttgtcacc 253



to top

>gb|AC079829.6|AC079829 Arabidopsis thaliana chromosome 1 BAC F28B23 genomic sequence, complete
             sequence
          Length = 96699

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 71/86 (82%)
 Strand = Plus / Plus

                                                                         
Query: 167   agattgaagatcatgaaatagcacacgtggctgcagttagtgccggaaatgattacgctg 226
             ||||||||||||||||  | || || || || ||||||||||| || ||||| ||||  |
Sbjct: 43334 agattgaagatcatgagcttgctcatgttgcagcagttagtgcggggaatgactacgaag 43393

                                       
Query: 227   tcggaaacatgatttctgatgctttt 252
             | ||||||||||||||  ||||||||
Sbjct: 43394 tgggaaacatgatttccaatgctttt 43419



to top

>gb|AE005672.2| Streptococcus pneumoniae TIGR4, complete genome
          Length = 2160842

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                                 
Query: 325     gaaggaatgcagtttgaacgtggttacctctcac 358
               ||||||||||||||||| ||||||||||| ||||
Sbjct: 1821420 gaaggaatgcagtttgaccgtggttacctttcac 1821387



to top

>dbj|AB019234.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MKN22
          Length = 27229

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttacctctcacctttctttgtcacc 372
           ||||| ||||||||||| ||||| ||||||||  |||| |||| ||||||||||
Sbjct: 546 gttgttgaaggaatgcaatttgatcgtggttatatctctccttactttgtcacc 599



to top

>gb|AF117741.1|AF117741 Streptococcus pneumoniae strain CP1200 cochaperonin GroES (groES) and
            chaperonin GroEL (groEL) genes, complete cds
          Length = 2401

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                              
Query: 325  gaaggaatgcagtttgaacgtggttacctctcac 358
            ||||||||||||||||| ||||||||||| ||||
Sbjct: 1183 gaaggaatgcagtttgaccgtggttacctttcac 1216



to top

>gb|AF237465.1| Streptococcus sp. Z12 60 kDa chaperonin (cpn60) gene, partial cds
          Length = 552

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 314 tggaggttgtcgaaggaatgcagtttgaacgtggttacctctcac 358
           |||| ||||| |||||||||||||| || ||||||||||| ||||
Sbjct: 284 tggaagttgttgaaggaatgcagttcgaccgtggttacctttcac 328



to top

>gb|DQ166941.1| Bartonella sp. SE-Bart-A GroEL (groEL) gene, partial cds
          Length = 1036

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttacctctcacctttctttgtcac 371
           ||||| ||||||||||||||||| ||||| || || || |||| |||||||||
Sbjct: 18  gttgttgaaggaatgcagtttgatcgtggatatctttctccttactttgtcac 70



to top

>gb|AE016795.2| Vibrio vulnificus CMCP6 chromosome I complete sequence
          Length = 3281944

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                        
Query: 319     gttgtcgaaggaatgcagtttgaacgtggttacctctcacc 359
               ||||| ||||| ||||||||||| ||||||||||| |||||
Sbjct: 1245631 gttgtagaaggcatgcagtttgaccgtggttacctatcacc 1245671



to top

>emb|BX571872.1| Photorhabdus luminescens subsp. laumondii TTO1 complete genome; segment
              14/17
          Length = 348498

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                   
Query: 325    gaaggaatgcagtttgaacgtggttacctctcacctt 361
              ||||| ||||||||||| |||||||||||||| ||||
Sbjct: 306331 gaaggtatgcagtttgaccgtggttacctctctcctt 306295



to top

>dbj|BA000037.2| Vibrio vulnificus YJ016 DNA, chromosome I, complete sequence
          Length = 3354505

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                        
Query: 319     gttgtcgaaggaatgcagtttgaacgtggttacctctcacc 359
               ||||| ||||| ||||||||||| ||||||||||| |||||
Sbjct: 3187885 gttgttgaaggtatgcagtttgaccgtggttacctatcacc 3187845



to top

>gb|AF485800.1| Streptococcus parauberis strain 25 60 kDa chaperonin Cpn60 (cpn60)
           gene, partial cds
          Length = 476

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 325 gaaggaatgcagtttgaacgtggttacct 353
           ||||||||||||||||| |||||||||||
Sbjct: 274 gaaggaatgcagtttgaccgtggttacct 302



to top

>gb|AF485799.1| Streptococcus parauberis strain 21B 60 kDa chaperonin Cpn60 (cpn60)
           gene, partial cds
          Length = 476

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 325 gaaggaatgcagtttgaacgtggttacct 353
           ||||||||||||||||| |||||||||||
Sbjct: 274 gaaggaatgcagtttgaccgtggttacct 302



to top

>gb|AF485798.1| Streptococcus parauberis strain ATCC 13386 60 kDa chaperonin Cpn60
           (cpn60) gene, partial cds
          Length = 476

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 325 gaaggaatgcagtttgaacgtggttacct 353
           ||||||||||||||||| |||||||||||
Sbjct: 274 gaaggaatgcagtttgaccgtggttacct 302



to top

>ref|NM_185419.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2131

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 319 gttgtcgaaggaatgcagtttgaacgtggtta 350
           ||||| || |||||||||||||||||||||||
Sbjct: 819 gttgtggagggaatgcagtttgaacgtggtta 850



to top

>gb|AY691303.1| Streptococcus hyointestinalis 60 kDa chaperonin (cpn60) gene,
           partial cds
          Length = 552

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttacctctcac 358
           ||||| ||||| ||||| ||||| ||||||||||||||||
Sbjct: 289 gttgttgaagggatgcaatttgaccgtggttacctctcac 328



to top

>gb|AF352801.1| Streptococcus mitis ATCC49456 60 kDa chaperonin (cpn60) gene,
           partial cds
          Length = 552

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttacctctcac 358
           ||||| ||||||||||||||||| || |||||||| ||||
Sbjct: 289 gttgttgaaggaatgcagtttgaccgcggttacctttcac 328



to top

>gb|AY360225.1| Streptococcus sinensis strain HKU6 chaperonin GroEL (groEL) gene,
           partial cds
          Length = 1471

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 314 tggaggttgtcgaaggaatgcagtttgaacgtggttacct 353
           |||| ||||| ||||||||||||||||| ||||| |||||
Sbjct: 506 tggatgttgtagaaggaatgcagtttgaccgtggctacct 545



to top

>gb|AY360224.1| Streptococcus sinensis strain HKU5 chaperonin GroEL (groEL) gene,
           partial cds
          Length = 1472

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 314 tggaggttgtcgaaggaatgcagtttgaacgtggttacct 353
           |||| ||||| ||||||||||||||||| ||||| |||||
Sbjct: 506 tggatgttgtagaaggaatgcagtttgaccgtggctacct 545



to top

>gb|AY360223.1| Streptococcus sinensis strain HKU4 chaperonin GroEL (groEL) gene,
           partial cds
          Length = 1454

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 314 tggaggttgtcgaaggaatgcagtttgaacgtggttacct 353
           |||| ||||| ||||||||||||||||| ||||| |||||
Sbjct: 507 tggatgttgtagaaggaatgcagtttgaccgtggctacct 546



to top

>emb|CR954246.1| Pseudoalteromonas haloplanktis str. TAC125 chromosome I, complete
              sequence
          Length = 3214944

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                              
Query: 319    gttgtcgaaggaatgcagtttgaacgtggttacctctcacctttcttt 366
              ||||| ||||| ||||||||||| ||||||||||| || |||| ||||
Sbjct: 273839 gttgttgaaggcatgcagtttgaccgtggttacctatctccttacttt 273792



to top

>gb|CP000323.1| Psychrobacter cryohalolentis K5, complete genome
          Length = 3059876

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                              
Query: 319    gttgtcgaaggaatgcagtttgaacgtggtta 350
              ||||||||||| ||||||||||| ||||||||
Sbjct: 639166 gttgtcgaaggtatgcagtttgatcgtggtta 639197



to top

>gb|AY342353.1| Streptococcus mitis GroEL gene, partial cds
          Length = 1478

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttacctctcac 358
           ||||| ||||||||||||||||| || |||||||| ||||
Sbjct: 518 gttgttgaaggaatgcagtttgaccgcggttacctttcac 557



to top

>gb|AF417589.1| Streptococcus mitis ATCC 49456 GroES gene, complete cds; and GroEL
           gene, partial cds
          Length = 1974

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttacctctcac 358
           ||||| ||||||||||||||||| || |||||||| ||||
Sbjct: 931 gttgttgaaggaatgcagtttgaccgcggttacctttcac 970



to top

>emb|AJ243594.2|PHA243594 Pseudoalteromonas haloplanktis groEL, groES genes
          Length = 2241

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 319  gttgtcgaaggaatgcagtttgaacgtggttacctctcacctttcttt 366
            ||||| ||||| ||||||||||| ||||||||||| || |||| ||||
Sbjct: 1071 gttgttgaaggcatgcagtttgaccgtggttacctatctccttacttt 1118



to top

>gb|AY123664.1| Psychrobacter immobilis strain ATCC 43116 Cpn60 (cpn60) gene,
           partial cds
          Length = 555

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 319 gttgtcgaaggaatgcagtttgaacgtggtta 350
           ||||||||||| ||||||||||| ||||||||
Sbjct: 292 gttgtcgaaggtatgcagtttgaccgtggtta 323



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6,
              complete sequence
          Length = 30731886

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                              
Query: 319    gttgtcgaaggaatgcagtttgaacgtggtta 350
              ||||| || |||||||||||||||||||||||
Sbjct: 812924 gttgtggagggaatgcagtttgaacgtggtta 812893



to top

>dbj|AP001389.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0541H01
          Length = 157519

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                             
Query: 319   gttgtcgaaggaatgcagtttgaacgtggtta 350
             ||||| || |||||||||||||||||||||||
Sbjct: 96058 gttgtggagggaatgcagtttgaacgtggtta 96027



to top

>dbj|AK101334.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034I03, full
           insert sequence
          Length = 2131

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 319 gttgtcgaaggaatgcagtttgaacgtggtta 350
           ||||| || |||||||||||||||||||||||
Sbjct: 819 gttgtggagggaatgcagtttgaacgtggtta 850



to top

>dbj|AK062098.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-045-A02, full
           insert sequence
          Length = 1781

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 319 gttgtcgaaggaatgcagtttgaacgtggtta 350
           ||||| || |||||||||||||||||||||||
Sbjct: 487 gttgtggagggaatgcagtttgaacgtggtta 518



to top

>gb|AY562900.1| Uncultured bacterium clone w07_d12 60 kDa chaperonin (cpn60) gene,
           partial cds
          Length = 552

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttacctctcac 358
           ||||| ||||| ||||| ||||| ||||||||||||||||
Sbjct: 289 gttgttgaagggatgcaatttgaccgtggttacctctcac 328



to top

>gb|AY562750.1| Uncultured bacterium clone c05_d02 60 kDa chaperonin (cpn60) gene,
           partial cds
          Length = 552

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttacctctcac 358
           ||||| ||||| ||||| ||||| ||||||||||||||||
Sbjct: 289 gttgttgaagggatgcaatttgaccgtggttacctctcac 328



to top

>gb|AY562732.1| Uncultured bacterium clone c02_h02 60 kDa chaperonin (cpn60) gene,
           partial cds
          Length = 552

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttacctctcac 358
           ||||| ||||| ||||| ||||| ||||||||||||||||
Sbjct: 289 gttgttgaagggatgcaatttgaccgtggttacctctcac 328



to top

>gb|AY562681.1| Uncultured bacterium clone b12_f01 60 kDa chaperonin (cpn60) gene,
           partial cds
          Length = 552

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttacctctcac 358
           ||||| ||||| ||||| ||||| ||||||||||||||||
Sbjct: 289 gttgttgaagggatgcaatttgaccgtggttacctctcac 328



to top

>gb|AY562603.1| Uncultured bacterium clone b04_e01 60 kDa chaperonin (cpn60) gene,
           partial cds
          Length = 552

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttacctctcac 358
           ||||| ||||| ||||| ||||| ||||||||||||||||
Sbjct: 289 gttgttgaagggatgcaatttgaccgtggttacctctcac 328



to top

>gb|AY562597.1| Uncultured bacterium clone b03_b07 60 kDa chaperonin (cpn60) gene,
           partial cds
          Length = 552

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttacctctcac 358
           ||||| ||||| ||||| ||||| ||||||||||||||||
Sbjct: 289 gttgttgaagggatgcaatttgaccgtggttacctctcac 328



to top

>gb|U46136.1|STU46136 Solanum tuberosum chaperonin-60 beta subunit mRNA, nuclear gene
           encoding chloroplast protein, complete cds
          Length = 2078

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 325 gaaggaatgcagtttgaacgtggttacctctcacctttctttgt 368
           ||||||||||| ||||| ||||||||| |||| |||| ||||||
Sbjct: 767 gaaggaatgcaatttgaccgtggttacgtctctccttactttgt 810



to top

>gb|AY837544.1| Pseudomonas syringae pv. syringae strain NCPPB 281 60 kDa
           chaperonin (cpn60) gene, partial cds
          Length = 555

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttacct 353
           ||||| ||||| ||||||||||| |||||||||||
Sbjct: 292 gttgtagaaggcatgcagtttgaccgtggttacct 326



to top

>gb|AY837542.1| Pseudomonas syringae pv. phaseolicola strain NCPPB 52 60 kDa
           chaperonin (cpn60) gene, partial cds
          Length = 555

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttacct 353
           ||||| ||||| ||||||||||| |||||||||||
Sbjct: 292 gttgtagaaggcatgcagtttgaccgtggttacct 326



to top

>gb|AY837541.1| Pseudomonas syringae pv. glycinea strain NCPPB 1245 60 kDa
           chaperonin (cpn60) gene, partial cds
          Length = 555

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttacct 353
           ||||| ||||| ||||||||||| |||||||||||
Sbjct: 292 gttgtagaaggcatgcagtttgaccgtggttacct 326



to top

>gb|CP000127.1| Nitrosococcus oceani ATCC 19707, complete genome
          Length = 3481691

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                          
Query: 314     tggaggttgtcgaaggaatgcagtttgaacgtggttacctctc 356
               |||| ||||| ||||||||||||||||| || ||||| |||||
Sbjct: 3305121 tggaagttgtggaaggaatgcagtttgatcggggttatctctc 3305079



to top

>gb|AF437115.1| Uncultured pig faeces bacterium clone 010_G02 60 kDa chaperonin
           (cpn60) gene, partial cds
          Length = 558

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 317 aggttgtcgaaggaatgcagtttgaacgtgg 347
           ||||||||||||| ||||||||||| |||||
Sbjct: 293 aggttgtcgaaggtatgcagtttgaccgtgg 323



to top

>gb|CP000075.1| Pseudomonas syringae pv. syringae B728a, complete genome
          Length = 6093698

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                  
Query: 319     gttgtcgaaggaatgcagtttgaacgtggttacct 353
               ||||| ||||| ||||||||||| |||||||||||
Sbjct: 4856605 gttgtagaaggcatgcagtttgaccgtggttacct 4856571



to top

>gb|CP000058.1| Pseudomonas syringae pv. phaseolicola 1448A, complete genome
          Length = 5928787

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                  
Query: 319     gttgtcgaaggaatgcagtttgaacgtggttacct 353
               ||||| ||||| ||||||||||| |||||||||||
Sbjct: 4660341 gttgtagaaggcatgcagtttgaccgtggttacct 4660307



to top

>emb|AJ621256.1| Enterococcus canis partial GroEL gene for heat shock protein 60,
           type strain LMG 12316T
          Length = 688

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttacct 353
           ||||| ||||||||||| ||||| |||||||||||
Sbjct: 433 gttgtggaaggaatgcaatttgaccgtggttacct 467



to top

>gb|AY116642.1| Bartonella schoenbuchensis heat shock protein Hsp60 (groEL) gene,
           partial cds
          Length = 1187

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 325 gaaggaatgcagtttgaacgtggttacctctcacctttctttgtcac 371
           ||||| ||||||||||| ||||| ||||| |||||||  ||||||||
Sbjct: 289 gaaggtatgcagtttgatcgtgggtacctttcaccttattttgtcac 335



to top

>emb|BX908798.1| Parachlamydia-related symbiont UWE25, complete genome
          Length = 2414465

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 43     gctcaaggcctgattgctgaagg 65
              |||||||||||||||||||||||
Sbjct: 931679 gctcaaggcctgattgctgaagg 931657



to top

>emb|AJ621724.1| Lactobacillus vaccinostercus partial hsp60 gene for GroEL, strain
           LMG 9215T
          Length = 968

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 313 ttggaggttgtcgaaggaatgcagtttgaacgtggttac 351
           ||||| ||||| ||||||||||| ||||| |||||||||
Sbjct: 433 ttggacgttgttgaaggaatgcaatttgatcgtggttac 471



to top

>emb|AJ621721.1| Lactobacillus durianis partial hsp60 gene for GroEL, strain CCUG
           45405T
          Length = 924

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 313 ttggaggttgtcgaaggaatgcagtttgaacgtggttac 351
           ||||| ||||| ||||||||||| ||||| |||||||||
Sbjct: 406 ttggacgttgttgaaggaatgcaatttgatcgtggttac 444



to top

>emb|AJ558227.1|HFE558227 Helicobacter felis partial hsp60 gene for heat shock protein 60,
           strain Kukka
          Length = 541

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 325 gaaggaatgcagtttgaacgtggttacctctcacctttctttgtcaccaat 375
           ||||| ||||| ||||| || ||||||||||| |||| |||||| ||||||
Sbjct: 290 gaaggtatgcaatttgatcgcggttacctctctccttactttgtaaccaat 340



to top

>gb|AF355773.1| Bartonella birtlesii 60 KDa heat shock protein (groEl) gene,
           partial cds
          Length = 1418

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 325 gaaggaatgcagtttgaacgtggttacctctcacctttctttgtcac 371
           ||||| ||||||||||| ||||| ||||| |||||||  ||||||||
Sbjct: 354 gaaggtatgcagtttgatcgtgggtacctttcaccttattttgtcac 400



to top

>gb|AE003849.1| Xylella fastidiosa 9a5c, complete genome
          Length = 2679306

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                     
Query: 313    ttggaggttgtcgaaggaatgcagtttgaacgtggttac 351
              ||||| || |||||||| ||||||||||| |||||||||
Sbjct: 595720 ttggatgtcgtcgaagggatgcagtttgaccgtggttac 595682



to top

>gb|AY123726.1| Streptococcus hyovaginalis strain ATCC 700866 Cpn60 (cpn60) gene,
           partial cds
          Length = 552

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 gaaggaatgcagtttgaacgtggttac 351
           ||||||||||||||||| |||||||||
Sbjct: 295 gaaggaatgcagtttgaccgtggttac 321



to top

>gb|AY123691.1| Bartonella elizabethae strain ATCC 49927 Cpn60 (cpn60) gene,
           partial cds
          Length = 555

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 313 ttggaggttgtcgaaggaatgcagtttgaacgtggttacctctcacctttctttgtcacc 372
           ||||| ||||| ||||||||||| ||||| ||||| || || || |||| |||||| |||
Sbjct: 286 ttggaagttgtggaaggaatgcaatttgaccgtggctatctttccccttactttgtgacc 345

              
Query: 373 aat 375
           |||
Sbjct: 346 aat 348



to top

>gb|AY123657.1| Acinetobacter johnsonii strain ATCC 17909 Cpn60 (cpn60) gene,
           partial cds
          Length = 555

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 312 tttggaggttgtcgaaggaatgcagtttgaacgtggtta 350
           |||||| ||||| ||||| ||||||||||| ||||||||
Sbjct: 285 tttggacgttgttgaaggtatgcagtttgaccgtggtta 323



to top

>gb|AY837450.1| Vibrio sp. 14G07 heat shock protein 60 (hsp60) gene, partial cds
          Length = 541

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttacct 353
           ||||| ||||| ||||||||||| |||||||||||
Sbjct: 300 gttgttgaaggtatgcagtttgaccgtggttacct 334



to top

>gb|AY837435.1| Vibrio sp. 14E12 heat shock protein 60 (hsp60) gene, partial cds
          Length = 541

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttacct 353
           ||||| ||||| ||||||||||| |||||||||||
Sbjct: 300 gttgttgaaggtatgcagtttgaccgtggttacct 334



to top

>gb|AY837389.1| Vibrio sp. 14A09 heat shock protein 60 (hsp60) gene, partial cds
          Length = 541

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttacct 353
           ||||| ||||| ||||||||||| |||||||||||
Sbjct: 300 gttgttgaaggtatgcagtttgaccgtggttacct 334



to top

>gb|AY837388.1| Vibrio sp. 14A08 heat shock protein 60 (hsp60) gene, partial cds
          Length = 541

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttacct 353
           ||||| ||||| ||||||||||| |||||||||||
Sbjct: 300 gttgttgaaggtatgcagtttgaccgtggttacct 334



to top

>gb|AY837289.1| Vibrio sp. 12F02 heat shock protein 60 (hsp60) gene, partial cds
          Length = 541

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttacct 353
           ||||| ||||| ||||||||||| |||||||||||
Sbjct: 300 gttgttgaaggtatgcagtttgaccgtggttacct 334



to top

>gb|AY837240.1| Vibrio sp. 12A04 heat shock protein 60 (hsp60) gene, partial cds
          Length = 541

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttacct 353
           ||||| ||||| ||||||||||| |||||||||||
Sbjct: 300 gttgttgaaggtatgcagtttgaccgtggttacct 334



to top

>gb|AY837149.1| Vibrio sp. 1B06 heat shock protein 60 (hsp60) gene, partial cds
          Length = 541

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttacct 353
           ||||| ||||| ||||||||||| |||||||||||
Sbjct: 300 gttgttgaaggtatgcagtttgaccgtggttacct 334



to top

>dbj|AB057417.1| Pseudoalteromonas sp. PS1M3 gene for GroES, GroEL, complete cds
          Length = 2715

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                               
Query: 319  gttgtcgaaggaatgcagtttgaacgtggttacct 353
            ||||| ||||| ||||||||||| |||||||||||
Sbjct: 1378 gttgtagaaggcatgcagtttgaccgtggttacct 1412



to top

>gb|AF230956.1| Vibrio vulnificus strain 921751 HSP60 gene, partial cds
          Length = 556

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 325 gaaggaatgcagtttgaacgtggttacctctcacc 359
           ||||| ||||||||||| ||||||||||| |||||
Sbjct: 299 gaaggtatgcagtttgaccgtggttacctatcacc 333



to top

>gb|AF230955.1| Vibrio vulnificus strain ATCC27562 HSP60 gene, partial cds
          Length = 556

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 325 gaaggaatgcagtttgaacgtggttacctctcacc 359
           ||||| ||||||||||| ||||||||||| |||||
Sbjct: 299 gaaggtatgcagtttgaccgtggttacctatcacc 333



to top

>gb|AF014834.1|AF014834 Bartonella elizabethae 60 kDa heat shock protein (groEL) gene,
           partial cds
          Length = 1449

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 313 ttggaggttgtcgaaggaatgcagtttgaacgtggttacctctcacctttctttgtcacc 372
           ||||| ||||| ||||||||||| ||||| ||||| || || || |||| |||||| |||
Sbjct: 382 ttggaagttgtggaaggaatgcaatttgaccgtggctatctttccccttactttgtgacc 441

              
Query: 373 aat 375
           |||
Sbjct: 442 aat 444



to top

>gb|AE009442.1| Xylella fastidiosa Temecula1, complete genome
          Length = 2519802

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                      
Query: 313     ttggaggttgtcgaaggaatgcagtttgaacgtggttac 351
               ||||| || |||||||| ||||||||||| |||||||||
Sbjct: 1783442 ttggatgtcgtcgaagggatgcagtttgaccgtggttac 1783480



to top

>gb|AF429692.1| Lactobacillus mali strain ATCC 27054 60 kDa heat shock protein
           (HSP60) gene, partial cds
          Length = 552

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 313 ttggaggttgtcgaaggaatgcagtttgaacgtgg 347
           ||||| ||||| ||||||||||||||||| |||||
Sbjct: 283 ttggatgttgtggaaggaatgcagtttgatcgtgg 317



to top

>gb|AF429690.1| Lactobacillus kefirgranum strain ATCC 51647 60 kDa heat shock
           protein (HSP60) gene, partial cds
          Length = 552

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 313 ttggaggttgtcgaaggaatgcagtttgaacgtgg 347
           ||||| ||||| ||||||||||||||||| |||||
Sbjct: 283 ttggatgttgtggaaggaatgcagtttgatcgtgg 317



to top

>gb|AC149899.2| Xenopus tropicalis clone ISB-339J14, complete sequence
          Length = 82063

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 238   atttctgatgcttttaaaagagt 260
             |||||||||||||||||||||||
Sbjct: 33968 atttctgatgcttttaaaagagt 33990



to top

>gb|AF417583.1| Enterococcus avium ATCC 14025 GroES and GroEL genes, partial cds
          Length = 1881

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 325 gaaggaatgcagtttgaacgtggttacctctcac 358
           ||||||||||| ||||| ||||||||||| ||||
Sbjct: 850 gaaggaatgcaatttgatcgtggttacctatcac 883



to top

>gb|AY837570.1| Prevotella melaninogenica strain ATCC 25845D 60 kDa chaperonin
           (cpn60) gene, partial cds
          Length = 558

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 331 atgcagtttgaacgtggttacctctc 356
           ||||||||||| ||||||||||||||
Sbjct: 307 atgcagtttgatcgtggttacctctc 332



to top

>gb|AY691258.1| Faecalibacterium prausnitzii 60 kDa chaperonin (cpn60) gene,
           partial cds
          Length = 555

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 325 gaaggaatgcagtttgaacgtggttacctctcacctttctttgtcaccaa 374
           ||||| ||||||||||| ||||| |||||||| |||| ||| || |||||
Sbjct: 298 gaaggcatgcagtttgaccgtggctacctctccccttacttcgtgaccaa 347



to top

>gb|AF437105.1| Uncultured pig faeces bacterium clone 010_D03 60 kDa chaperonin
           (cpn60) gene, partial cds
          Length = 558

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 331 atgcagtttgaacgtggttacctctc 356
           ||||||||||| ||||||||||||||
Sbjct: 307 atgcagtttgatcgtggttacctctc 332



to top

>gb|AF352799.1| Streptococcus parasanguinis ATCC15912 60 kDa chaperonin (cpn60)
           gene, partial cds
          Length = 552

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 325 gaaggaatgcagtttgaacgtggttacctctcac 358
           ||||| ||||| ||||| ||||||||||||||||
Sbjct: 295 gaaggtatgcaatttgaccgtggttacctctcac 328



to top

>gb|AF245678.1| Enterococcus avium 60 kDa chaperonin (cpn60) gene, partial cds
          Length = 552

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 325 gaaggaatgcagtttgaacgtggttacctctcac 358
           ||||||||||| ||||| ||||||||||| ||||
Sbjct: 295 gaaggaatgcaatttgatcgtggttacctatcac 328



to top

>gb|CP000082.1| Psychrobacter arcticus 273-4, complete genome
          Length = 2650701

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                    
Query: 313    ttggaggttgtcgaaggaatgcagtttgaacgtggtta 350
              ||||| ||||| ||||| ||||||||||| ||||||||
Sbjct: 647844 ttggaagttgtggaaggtatgcagtttgaccgtggtta 647881



to top

>gb|DQ106381.1| Uncultured bacterium clone pi1_cl24_cn1 60 kDa chaperonin (cpn60)
           gene, partial cds
          Length = 552

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 325 gaaggaatgcagtttgaacgtggtta 350
           ||||||||||||||||| ||||||||
Sbjct: 295 gaaggaatgcagtttgagcgtggtta 320



to top

>gb|DQ106086.1| Uncultured bacterium clone ce0_cl37_cn1 60 kDa chaperonin (cpn60)
           gene, partial cds
          Length = 552

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 325 gaaggaatgcagtttgaacgtggtta 350
           ||||||||||||||||| ||||||||
Sbjct: 295 gaaggaatgcagtttgaccgtggtta 320



to top

>gb|AY344501.1| Streptococcus parasanguinis chaperonin GroEL gene, partial cds
          Length = 1431

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 325 gaaggaatgcagtttgaacgtggttacctctcac 358
           ||||| ||||| ||||| ||||||||||||||||
Sbjct: 504 gaaggtatgcaatttgaccgtggttacctctcac 537



to top

>gb|AY344499.1| Streptococcus gordonii chaperonin GroEL-like gene, partial sequence
          Length = 1436

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 314 tggaggttgtcgaaggaatgcagtttgaacgtgg 347
           |||| ||||| ||||||||||||||||| |||||
Sbjct: 488 tggatgttgtagaaggaatgcagtttgaccgtgg 521



to top

>emb|AL008634.1|HS396D17 Human DNA sequence from clone RP3-396D17 on chromosome 1p33-35.3
             Contains EST, STS, GSS, complete sequence
          Length = 152592

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   aggcagggaaggcatggttaga 282
             ||||||||||||||||||||||
Sbjct: 97309 aggcagggaaggcatggttaga 97330



to top

>emb|BX321856.1| Nitrosomonas europaea ATCC 19718, complete genome; segment 1/10
          Length = 302050

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                           
Query: 325   gaaggaatgcagtttgaacgtggttacctctcacctttctttgtca 370
             |||||||||||||| || |||||||| ||||| |||| ||| ||||
Sbjct: 35505 gaaggaatgcagttcgaccgtggttatctctctccttacttcgtca 35550



to top

>gb|AF338228.1| Streptococcus gordonii ABC transporter, GroES, and GroEL genes,
            complete cds
          Length = 3666

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                              
Query: 314  tggaggttgtcgaaggaatgcagtttgaacgtgg 347
            |||| ||||| ||||||||||||||||| |||||
Sbjct: 1973 tggatgttgtagaaggaatgcagtttgaccgtgg 2006



to top

>gb|AY017380.1| Fibrobacter succinogenes S85 heat shock protein 60 (groEL) gene,
           partial cds
          Length = 756

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttacctctc 356
           ||||||||||| |||||||| || ||||| ||||||||
Sbjct: 472 gttgtcgaaggtatgcagttcgaccgtggctacctctc 509



to top

>gb|AY123738.1| Streptococcus gordonii strain ATCC 10558 Cpn60 (cpn60) gene,
           partial cds
          Length = 552

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 314 tggaggttgtcgaaggaatgcagtttgaacgtgg 347
           |||| ||||| ||||||||||||||||| |||||
Sbjct: 284 tggatgttgtagaaggaatgcagtttgaccgtgg 317



to top

>gb|AY123698.1| Aerococcus urinae strain ATCC 51268 Cpn60 (cpn60) gene, partial cds
          Length = 552

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttacctctc 356
           ||||| ||||| ||||| ||||| ||||||||||||||
Sbjct: 289 gttgttgaagggatgcaatttgaccgtggttacctctc 326



to top

>gb|AF230948.1| Vibrio mimicus strain ATCC33653 HSP60 gene, partial cds
          Length = 556

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                         
Query: 314 tggaggttgtcgaaggaatgcagtttgaacgtggttacctctcacc 359
           |||| ||||| ||||| ||||||||||| ||||| ||||| |||||
Sbjct: 288 tggatgttgtagaaggtatgcagtttgaccgtggctacctgtcacc 333



to top

>gb|AF245226.1|AF245226 Homo sapiens chromosome 21 map 21q21 clone B845I12, complete sequence
          Length = 178237

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 268    gaaggcatggttagaattgaaa 289
              ||||||||||||||||||||||
Sbjct: 152631 gaaggcatggttagaattgaaa 152610



to top

>dbj|BS000047.1| Pan troglodytes chromosome 22 clone:PTB-109H19, map 22, complete
              sequences
          Length = 214118

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 268    gaaggcatggttagaattgaaa 289
              ||||||||||||||||||||||
Sbjct: 130196 gaaggcatggttagaattgaaa 130175



to top

>gb|AY714804.1| Wolbachia endosymbiont of Culex quinquefasciatus GroEL (groEL)
           gene, partial cds
          Length = 870

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 331 atgcagtttgaacgtggttacctctc 356
           ||||||||||| ||||||||||||||
Sbjct: 532 atgcagtttgaccgtggttacctctc 557



to top

>gb|AY714803.1| Wolbachia endosymbiont of Trichogramma cordubensis GroEL (groEL)
           gene, partial cds
          Length = 870

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 331 atgcagtttgaacgtggttacctctc 356
           ||||||||||| ||||||||||||||
Sbjct: 532 atgcagtttgaccgtggttacctctc 557



to top

>dbj|AP001674.1| Homo sapiens genomic DNA, chromosome 21q, section 18/105
          Length = 340000

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 268    gaaggcatggttagaattgaaa 289
              ||||||||||||||||||||||
Sbjct: 289429 gaaggcatggttagaattgaaa 289408



to top

>emb|AL929112.6| Mouse DNA sequence from clone RP23-397G5 on chromosome 4, complete
             sequence
          Length = 179785

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 236   tgatttctgatgcttttaaaagagta 261
             ||||||||||||||| ||||||||||
Sbjct: 45476 tgatttctgatgcttataaaagagta 45501



to top

>dbj|AP001345.2| Homo sapiens genomic DNA, chromosome 21q21.1-q21.2, clone:B755I19,
             LL56-APP region, complete sequence
          Length = 24379

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 268   gaaggcatggttagaattgaaa 289
             ||||||||||||||||||||||
Sbjct: 12468 gaaggcatggttagaattgaaa 12447



to top

>gb|AF417584.1| Enterococcus casseliflavus ATCC 25788 GroES and GroEL genes,
           partial cds
          Length = 1886

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttac 351
           ||||| ||||||||||| ||||| |||||||||
Sbjct: 852 gttgtggaaggaatgcaatttgatcgtggttac 884



to top

>gb|AF417582.1| Enterococcus faecium ATCC 19434 GroES and GroEL genes, partial cds
          Length = 1904

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttac 351
           ||||| ||||| ||||||||||| |||||||||
Sbjct: 870 gttgtagaaggtatgcagtttgatcgtggttac 902



to top

>gb|AY491449.1| Enterococcus faecium strain NTUH 8724 GroEL (groEL) gene, partial
           cds
          Length = 727

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttac 351
           ||||| ||||| ||||||||||| |||||||||
Sbjct: 48  gttgtagaaggtatgcagtttgatcgtggttac 80



to top

>gb|AY491446.1| Enterococcus faecium strain NTUH 8824-1 GroEL (groEL) gene, partial
           cds
          Length = 727

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttac 351
           ||||| ||||| ||||||||||| |||||||||
Sbjct: 48  gttgtagaaggtatgcagtttgatcgtggttac 80



to top

>gb|AY691283.1| Prevotella heparinolytica 60 kDa chaperonin (cpn60) gene, partial
           cds
          Length = 558

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 325 gaaggaatgcagtttgaacgtggttacct 353
           ||||| ||||||||||| |||||||||||
Sbjct: 301 gaaggtatgcagtttgaccgtggttacct 329



to top

>gb|AF437187.1| Uncultured pig faeces bacterium clone 016_D10 60 kDa chaperonin
           (cpn60) gene, partial cds
          Length = 552

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 314 tggaggttgtcgaaggaatgcagtt 338
           |||||||||||||||| ||||||||
Sbjct: 284 tggaggttgtcgaaggcatgcagtt 308



to top

>gb|AF352811.1| Streptococcus agalactiae ATCC12386 60 kDa chaperonin (cpn60) gene,
           partial cds
          Length = 552

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 319 gttgtcgaaggaatgcagtttgaacgtgg 347
           ||||| ||||||||||||||||| |||||
Sbjct: 289 gttgtggaaggaatgcagtttgaccgtgg 317



to top

>gb|AF352804.1| Streptococcus canis ATCC43496 60 kDa chaperonin (cpn60) gene,
           partial cds
          Length = 552

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 325 gaaggaatgcagtttgaacgtggttacct 353
           ||||| ||||||||||| |||||||||||
Sbjct: 295 gaaggcatgcagtttgaccgtggttacct 323



to top

>gb|AF352802.1| Streptococcus cristatus ATCC51100 60 kDa chaperonin (cpn60) gene,
           partial cds
          Length = 552

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 325 gaaggaatgcagtttgaacgtggttacct 353
           ||||||||||||||||| ||||| |||||
Sbjct: 295 gaaggaatgcagtttgaccgtggctacct 323



to top

>gb|AF245682.1| Enterococcus casseliflavus 60 kDa chaperonin (cpn60) gene, partial
           cds
          Length = 552

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttac 351
           ||||| ||||||||||| ||||| |||||||||
Sbjct: 289 gttgtggaaggaatgcaatttgatcgtggttac 321



to top

>gb|AF245681.1| Enterococcus faecium 60 kDa chaperonin (cpn60) gene, partial cds
          Length = 552

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttac 351
           ||||| ||||| ||||||||||| |||||||||
Sbjct: 289 gttgtagaaggtatgcagtttgatcgtggttac 321



to top

>gb|AF245674.1| Lactococcus garvieae 60 kDa chaperonin (cpn60) gene, partial cds
          Length = 552

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttac 351
           ||||| ||||| ||||||||||| |||||||||
Sbjct: 289 gttgtagaaggtatgcagtttgaccgtggttac 321



to top

>gb|AF245670.1| Enterococcus sp. R871 60 kDa chaperonin (cpn60) gene, partial cds
          Length = 552

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttac 351
           ||||| ||||||||||| ||||| |||||||||
Sbjct: 289 gttgttgaaggaatgcaatttgatcgtggttac 321



to top

>gb|AY328549.1| Enterococcus flavescens GroES (groES) and GroEL (groEL) genes,
           partial cds
          Length = 1890

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttac 351
           ||||| ||||||||||| ||||| |||||||||
Sbjct: 876 gttgtggaaggaatgcaatttgatcgtggttac 908



to top

>gb|AY328538.1| Enterococcus faecium strain 4140 GroEL (groEL) gene, partial cds
          Length = 577

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttac 351
           ||||| ||||| ||||||||||| |||||||||
Sbjct: 48  gttgtagaaggtatgcagtttgatcgtggttac 80



to top

>gb|AY328536.1| Enterococcus faecium strain 2423 GroEL (groEL) gene, partial cds
          Length = 577

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttac 351
           ||||| ||||| ||||||||||| |||||||||
Sbjct: 48  gttgtagaaggtatgcagtttgatcgtggttac 80



to top

>gb|AY315820.1| Enterococcus faecium strain ATCC 35667 GroES and GroEL genes,
           partial cds
          Length = 1908

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttac 351
           ||||| ||||| ||||||||||| |||||||||
Sbjct: 894 gttgtagaaggtatgcagtttgatcgtggttac 926



to top

>gb|CP000114.1| Streptococcus agalactiae A909, complete genome
          Length = 2127839

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                            
Query: 319     gttgtcgaaggaatgcagtttgaacgtgg 347
               ||||| ||||||||||||||||| |||||
Sbjct: 2008613 gttgtagaaggaatgcagtttgaccgtgg 2008585



to top

>gb|DQ106365.1| Uncultured bacterium clone pi0_cl3_cn1 60 kDa chaperonin (cpn60)
           gene, partial cds
          Length = 552

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttac 351
           ||||| ||||||||||| ||||| |||||||||
Sbjct: 289 gttgttgaaggaatgcaatttgatcgtggttac 321



to top

>gb|DQ106348.1| Uncultured bacterium clone mj1_cl15_cn1 60 kDa chaperonin (cpn60)
           gene, partial cds
          Length = 552

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                
Query: 325 gaaggaatgcagtttgaacgtggttacctctcacctt 361
           ||||| ||||||||||| |||||||| || |||||||
Sbjct: 295 gaaggtatgcagtttgaccgtggttatctatcacctt 331



to top

>gb|DQ106324.1| Uncultured bacterium clone mj0_cl0_sn23 60 kDa chaperonin (cpn60)
           gene, partial cds
          Length = 552

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttac 351
           ||||| ||||| ||||||||||| |||||||||
Sbjct: 289 gttgttgaaggcatgcagtttgaccgtggttac 321



to top

>gb|DQ106270.1| Uncultured bacterium clone dl1_cl14_cn1 60 kDa chaperonin (cpn60)
           gene, partial cds
          Length = 552

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                
Query: 325 gaaggaatgcagtttgaacgtggttacctctcacctt 361
           ||||| ||||||||||| ||||||||| | |||||||
Sbjct: 295 gaaggtatgcagtttgaccgtggttacttatcacctt 331



to top

>gb|DQ106126.1| Uncultured bacterium clone ce1_cl0_sn33 60 kDa chaperonin (cpn60)
           gene, partial cds
          Length = 552

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                
Query: 325 gaaggaatgcagtttgaacgtggttacctctcacctt 361
           ||||| ||||||||||| |||||||| || |||||||
Sbjct: 295 gaaggtatgcagtttgaccgtggttatctatcacctt 331



to top

>gb|DQ156594.1| Acinetobacter calcoaceticus strain DSM 7324 60 kDa chaperonin
           (cpn60) gene, partial cds
          Length = 421

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttacctctcacctttctttg 367
           ||||| ||||| ||||||||||| ||||||||  |||| |||| |||||
Sbjct: 235 gttgtagaaggtatgcagtttgaccgtggttatatctctccttactttg 283



to top

>gb|AY508648.1| Streptococcus agalactiae strain 8 60 kDa chaperonin Cpn60 (cpn60)
           gene, partial cds
          Length = 310

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 319 gttgtcgaaggaatgcagtttgaacgtgg 347
           ||||| ||||||||||||||||| |||||
Sbjct: 214 gttgtggaaggaatgcagtttgaccgtgg 242



to top

>gb|AY487423.1| Streptococcus agalactiae 60 kDa chaperonin (cpn60) gene, partial
           cds
          Length = 310

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 319 gttgtcgaaggaatgcagtttgaacgtgg 347
           ||||| ||||||||||||||||| |||||
Sbjct: 214 gttgtggaaggaatgcagtttgaccgtgg 242



to top

>emb|CT009769.4| Mouse DNA sequence from clone RP23-44C21 on chromosome 9, complete
             sequence
          Length = 197074

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 258   agtaggcagggaaggcatggt 278
             |||||||||||||||||||||
Sbjct: 27716 agtaggcagggaaggcatggt 27736



to top

>emb|CR735141.14| Zebrafish DNA sequence from clone CH211-128E9 in linkage group 15,
             complete sequence
          Length = 108767

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 234   catgatttctgatgcttttaa 254
             |||||||||||||||||||||
Sbjct: 41822 catgatttctgatgcttttaa 41802



to top

>emb|AJ621263.1| Enterococcus solitarius partial GroEL gene for heat shock protein
           60, type strain LMG 12890T
          Length = 707

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttac 351
           ||||| ||||||||||| ||||| |||||||||
Sbjct: 352 gttgttgaaggaatgcaatttgaccgtggttac 384



to top

>emb|AJ621261.1| Enterococcus pallens partial GroEL gene for heat shock protein 60,
           type strain CCUG 45554T
          Length = 785

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttac 351
           ||||||||||| ||||| ||||| |||||||||
Sbjct: 430 gttgtcgaaggtatgcaatttgaccgtggttac 462



to top

>emb|AJ621257.1| Enterococcus flavescens partial GroEL gene for heat shock protein
           60, type strain DSM 7370T
          Length = 827

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttac 351
           ||||| ||||||||||| ||||| |||||||||
Sbjct: 472 gttgtggaaggaatgcaatttgatcgtggttac 504



to top

>gb|AE014285.1| Streptococcus agalactiae 2603V/R section 95 of 100 of the complete
             genome
          Length = 21495

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 319   gttgtcgaaggaatgcagtttgaacgtgg 347
             ||||| ||||||||||||||||| |||||
Sbjct: 17438 gttgtggaaggaatgcagtttgaccgtgg 17410



to top

>emb|AL766855.1|SAG766855 Streptococcus agalactiae NEM316 complete genome, segment 13
          Length = 89050

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 319   gttgtcgaaggaatgcagtttgaacgtgg 347
             ||||| ||||||||||||||||| |||||
Sbjct: 84929 gttgtggaaggaatgcagtttgaccgtgg 84901



to top

>gb|AY121367.1| Streptococcus dysgalactiae strain HKU 7 chaperonin GroEL gene,
           partial cds
          Length = 1415

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 325 gaaggaatgcagtttgaacgtggttacct 353
           ||||| ||||||||||| |||||||||||
Sbjct: 480 gaaggcatgcagtttgatcgtggttacct 508



to top

>gb|DQ395179.1| Bartonella tamii strain Th239 heat shock protein (groEL) gene,
           partial cds
          Length = 1369

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 48/57 (84%)
 Strand = Plus / Plus

                                                                    
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttacctctcacctttctttgtcaccaat 375
           ||||| ||||| ||||| ||||| ||||| || || || |||| |||||||||||||
Sbjct: 346 gttgttgaaggtatgcaatttgatcgtggctatctttctccttactttgtcaccaat 402



to top

>gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome
          Length = 4712337

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                    
Query: 325     gaaggaatgcagtttgaacgtggttacctctcacctt 361
               ||||| ||||||||||| ||||| ||||| |||||||
Sbjct: 1215534 gaaggcatgcagtttgaccgtggctacctgtcacctt 1215498



to top

>gb|AF485797.1| Streptococcus dysgalactiae strain 74 60 kDa chaperonin Cpn60
           (cpn60) gene, partial cds
          Length = 476

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 325 gaaggaatgcagtttgaacgtggttacct 353
           ||||| ||||||||||| |||||||||||
Sbjct: 274 gaaggcatgcagtttgaccgtggttacct 302



to top

>gb|AF485796.1| Streptococcus dysgalactiae strain 62 60 kDa chaperonin Cpn60
           (cpn60) gene, partial cds
          Length = 476

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 325 gaaggaatgcagtttgaacgtggttacct 353
           ||||| ||||||||||| |||||||||||
Sbjct: 274 gaaggcatgcagtttgaccgtggttacct 302



to top

>gb|AF485795.1| Streptococcus dysgalactiae strain ATCC 43078 60 kDa chaperonin
           Cpn60 (cpn60) gene, partial cds
          Length = 476

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 325 gaaggaatgcagtttgaacgtggttacct 353
           ||||| ||||||||||| |||||||||||
Sbjct: 274 gaaggcatgcagtttgaccgtggttacct 302



to top

>gb|AF485794.1| Streptococcus dysgalactiae strain ATCC 27957 60 kDa chaperonin
           Cpn60 (cpn60) gene, partial cds
          Length = 476

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 325 gaaggaatgcagtttgaacgtggttacct 353
           ||||| ||||||||||| |||||||||||
Sbjct: 274 gaaggcatgcagtttgaccgtggttacct 302



to top

>gb|AF485793.1| Streptococcus agalactiae strain 13824-5 60 kDa chaperonin Cpn60
           (cpn60) gene, partial cds
          Length = 476

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 319 gttgtcgaaggaatgcagtttgaacgtgg 347
           ||||| ||||||||||||||||| |||||
Sbjct: 268 gttgtggaaggaatgcagtttgaccgtgg 296



to top

>gb|AF485792.1| Streptococcus agalactiae strain 13821-4 60 kDa chaperonin Cpn60
           (cpn60) gene, partial cds
          Length = 476

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 319 gttgtcgaaggaatgcagtttgaacgtgg 347
           ||||| ||||||||||||||||| |||||
Sbjct: 268 gttgtggaaggaatgcagtttgaccgtgg 296



to top

>gb|AF485791.1| Streptococcus agalactiae strain ATCC 27956 60 kDa chaperonin Cpn60
           (cpn60) gene, partial cds
          Length = 476

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 319 gttgtcgaaggaatgcagtttgaacgtgg 347
           ||||| ||||||||||||||||| |||||
Sbjct: 268 gttgtggaaggaatgcagtttgaccgtgg 296



to top

>gb|AF485790.1| Streptococcus agalactiae strain ATCC 13813 60 kDa chaperonin Cpn60
           (cpn60) gene, partial cds
          Length = 476

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 319 gttgtcgaaggaatgcagtttgaacgtgg 347
           ||||| ||||||||||||||||| |||||
Sbjct: 268 gttgtggaaggaatgcagtttgaccgtgg 296



to top

>gb|AF242277.1|AF242277 Macrococcus equipercicus heat shock protein 60 gene, partial cds
          Length = 554

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttac 351
           ||||| ||||| ||||||||||| |||||||||
Sbjct: 290 gttgtagaagggatgcagtttgaccgtggttac 322



to top

>gb|AF019778.1|AF019778 Staphylococcus hyicus strain ATCC11249 chaperonin 60 (cpn60) gene,
           partial cds
          Length = 552

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 319 gttgtcgaaggaatgcagtttgaacgtgg 347
           ||||| ||||||||||||||||| |||||
Sbjct: 289 gttgtagaaggaatgcagtttgatcgtgg 317



to top

>gb|AF019777.1|AF019777 Staphylococcus hyicus strain 16K chaperonin 60 (cpn60) gene,
           partial cds
          Length = 552

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 319 gttgtcgaaggaatgcagtttgaacgtgg 347
           ||||| ||||||||||||||||| |||||
Sbjct: 289 gttgtagaaggaatgcagtttgatcgtgg 317



to top

>gb|AY123705.1| Granulicatella adiacens strain ATCC 49175 Cpn60 (cpn60) gene,
           partial cds
          Length = 552

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttac 351
           ||||| ||||||||||| ||||| |||||||||
Sbjct: 289 gttgtagaaggaatgcaatttgaccgtggttac 321



to top

>gb|AY123644.1| Streptococcus dysgalactiae strain ATCC 43078 Cpn60 (cpn60) gene,
           partial cds
          Length = 552

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 325 gaaggaatgcagtttgaacgtggttacct 353
           ||||| ||||||||||| |||||||||||
Sbjct: 295 gaaggcatgcagtttgaccgtggttacct 323



to top

>gb|AY837411.1| Vibrio sp. 14C08 heat shock protein 60 (hsp60) gene, partial cds
          Length = 541

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 325 gaaggaatgcagtttgaacgtggttacct 353
           ||||| ||||||||||| |||||||||||
Sbjct: 306 gaaggtatgcagtttgatcgtggttacct 334



to top

>gb|AY837261.1| Vibrio sp. 12C03 heat shock protein 60 (hsp60) gene, partial cds
          Length = 541

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttac 351
           ||||||||||| ||||| ||||| |||||||||
Sbjct: 300 gttgtcgaaggtatgcaatttgaccgtggttac 332



to top

>gb|AY837255.1| Vibrio sp. 12B09 heat shock protein 60 (hsp60) gene, partial cds
          Length = 541

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 325 gaaggaatgcagtttgaacgtggttacct 353
           ||||| ||||||||||| |||||||||||
Sbjct: 306 gaaggtatgcagtttgatcgtggttacct 334



to top

>gb|AY837235.1| Vibrio sp. 7H03 heat shock protein 60 (hsp60) gene, partial cds
          Length = 541

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 325 gaaggaatgcagtttgaacgtggttacct 353
           ||||| ||||||||||| |||||||||||
Sbjct: 306 gaaggtatgcagtttgaccgtggttacct 334



to top

>gb|AY837233.1| Vibrio sp. 7G12 heat shock protein 60 (hsp60) gene, partial cds
          Length = 541

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 325 gaaggaatgcagtttgaacgtggttacct 353
           ||||| ||||||||||| |||||||||||
Sbjct: 306 gaaggtatgcagtttgaccgtggttacct 334



to top

>gb|AY837226.1| Vibrio sp. 7F11 heat shock protein 60 (hsp60) gene, partial cds
          Length = 541

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 325 gaaggaatgcagtttgaacgtggttacct 353
           ||||| ||||||||||| |||||||||||
Sbjct: 306 gaaggtatgcagtttgaccgtggttacct 334



to top

>gb|AY837225.1| Vibrio sp. 7F10 heat shock protein 60 (hsp60) gene, partial cds
          Length = 541

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 325 gaaggaatgcagtttgaacgtggttacct 353
           ||||| ||||||||||| |||||||||||
Sbjct: 306 gaaggtatgcagtttgaccgtggttacct 334



to top

>gb|AY837224.1| Vibrio sp. 7F08 heat shock protein 60 (hsp60) gene, partial cds
          Length = 541

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 325 gaaggaatgcagtttgaacgtggttacct 353
           ||||| ||||||||||| |||||||||||
Sbjct: 306 gaaggtatgcagtttgaccgtggttacct 334



to top

>gb|AY837222.1| Vibrio sp. 7F06 heat shock protein 60 (hsp60) gene, partial cds
          Length = 541

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 325 gaaggaatgcagtttgaacgtggttacct 353
           ||||| ||||||||||| |||||||||||
Sbjct: 306 gaaggtatgcagtttgaccgtggttacct 334



to top

>gb|AY837221.1| Vibrio sp. 7F05 heat shock protein 60 (hsp60) gene, partial cds
          Length = 541

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 325 gaaggaatgcagtttgaacgtggttacct 353
           ||||| ||||||||||| |||||||||||
Sbjct: 306 gaaggtatgcagtttgaccgtggttacct 334



to top

>gb|AY837218.1| Vibrio sp. 7E07 heat shock protein 60 (hsp60) gene, partial cds
          Length = 539

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 325 gaaggaatgcagtttgaacgtggttacct 353
           ||||| ||||||||||| |||||||||||
Sbjct: 306 gaaggtatgcagtttgaccgtggttacct 334



to top

>gb|AY837214.1| Vibrio sp. 7E02 heat shock protein 60 (hsp60) gene, partial cds
          Length = 541

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 325 gaaggaatgcagtttgaacgtggttacct 353
           ||||| ||||||||||| |||||||||||
Sbjct: 306 gaaggtatgcagtttgaccgtggttacct 334



to top

>gb|AY837206.1| Vibrio sp. 7C09 heat shock protein 60 (hsp60) gene, partial cds
          Length = 541

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 325 gaaggaatgcagtttgaacgtggttacct 353
           ||||| ||||||||||| |||||||||||
Sbjct: 306 gaaggtatgcagtttgaccgtggttacct 334



to top

>gb|AY837202.1| Vibrio sp. 7B12 heat shock protein 60 (hsp60) gene, partial cds
          Length = 541

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 325 gaaggaatgcagtttgaacgtggttacct 353
           ||||| ||||||||||| |||||||||||
Sbjct: 306 gaaggtatgcagtttgaccgtggttacct 334



to top

>gb|AY837197.1| Vibrio sp. 7B04 heat shock protein 60 (hsp60) gene, partial cds
          Length = 541

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 325 gaaggaatgcagtttgaacgtggttacct 353
           ||||| ||||||||||| |||||||||||
Sbjct: 306 gaaggtatgcagtttgaccgtggttacct 334



to top

>gb|AY837192.1| Vibrio sp. 7A06 heat shock protein 60 (hsp60) gene, partial cds
          Length = 541

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 325 gaaggaatgcagtttgaacgtggttacct 353
           ||||| ||||||||||| |||||||||||
Sbjct: 306 gaaggtatgcagtttgaccgtggttacct 334



to top

>gb|AY837190.1| Vibrio sp. 7A03 heat shock protein 60 (hsp60) gene, partial cds
          Length = 541

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 325 gaaggaatgcagtttgaacgtggttacct 353
           ||||| ||||||||||| |||||||||||
Sbjct: 306 gaaggtatgcagtttgaccgtggttacct 334



to top

>gb|AY837150.1| Vibrio sp. 1B07 heat shock protein 60 (hsp60) gene, partial cds
          Length = 541

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 325 gaaggaatgcagtttgaacgtggttacct 353
           ||||| ||||||||||| |||||||||||
Sbjct: 306 gaaggtatgcagtttgaccgtggttacct 334



to top

>emb|BX823782.1|CNS0A5D5 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS75ZB02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1482

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 123 gactgctgatgctttggtttc 143
           |||||||||||||||||||||
Sbjct: 365 gactgctgatgctttggtttc 385



to top

>gb|AF325222.1|AF325222 Streptococcus agalactiae 60kDa chaperonin gene, complete cds
          Length = 1718

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 319 gttgtcgaaggaatgcagtttgaacgtgg 347
           ||||| ||||||||||||||||| |||||
Sbjct: 654 gttgtggaaggaatgcagtttgaccgtgg 682



to top

>gb|AY017169.1| Vibrio vulnificus groEL gene, complete cds
          Length = 1644

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 319 gttgtcgaaggaatgcagtttgaacgtggttacctctcacc 359
           ||||| ||||| ||||||||||| |||||||| || |||||
Sbjct: 565 gttgttgaaggtatgcagtttgaccgtggttatctatcacc 605



to top

>gb|AY121366.1| Streptococcus dysgalactiae subsp. equisimilis strain CIP 55-123
           chaperonin GroEL gene, partial cds
          Length = 1422

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 325 gaaggaatgcagtttgaacgtggttacct 353
           ||||| ||||||||||| |||||||||||
Sbjct: 487 gaaggcatgcagtttgaccgtggttacct 515



to top

>gb|AY121365.1| Streptococcus dysgalactiae subsp. equisimilis strain ATCC 12394
           chaperonin GroEL gene, partial cds
          Length = 1421

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 325 gaaggaatgcagtttgaacgtggttacct 353
           ||||| ||||||||||| |||||||||||
Sbjct: 495 gaaggcatgcagtttgatcgtggttacct 523



to top

>gb|AY121364.1| Streptococcus dysgalactiae subsp. equisimilis strain ATCC 35666
           chaperonin GroEL gene, partial cds
          Length = 1421

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 325 gaaggaatgcagtttgaacgtggttacct 353
           ||||| ||||||||||| |||||||||||
Sbjct: 486 gaaggcatgcagtttgatcgtggttacct 514



to top

>gb|AY121363.1| Streptococcus dysgalactiae subsp. dysgalactiae strain ATCC 43078
           chaperonin GroEL gene, partial cds
          Length = 1384

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 325 gaaggaatgcagtttgaacgtggttacct 353
           ||||| ||||||||||| |||||||||||
Sbjct: 462 gaaggcatgcagtttgaccgtggttacct 490



to top

>gb|AF230950.1| Vibrio ordalii HSP60 gene, partial cds
          Length = 556

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 325 gaaggaatgcagtttgaacgtggttacct 353
           ||||| ||||||||||| |||||||||||
Sbjct: 299 gaaggtatgcagtttgaccgtggttacct 327



to top

>gb|AF230933.1| Listonella anguillarum strain NB122 Hsp60 (hsp60) gene, partial cds
          Length = 556

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 325 gaaggaatgcagtttgaacgtggttacct 353
           ||||| ||||||||||| |||||||||||
Sbjct: 299 gaaggcatgcagtttgatcgtggttacct 327



to top

>gb|AF230932.1| Listonella anguillarum strain ATCC19264 Hsp60 (hsp60) gene, partial
           cds
          Length = 556

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 325 gaaggaatgcagtttgaacgtggttacct 353
           ||||| ||||||||||| |||||||||||
Sbjct: 299 gaaggtatgcagtttgatcgtggttacct 327



to top

>emb|X57520.1|LMGROELSR L.micdadei DNA for gro ELS operon
          Length = 2770

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                             
Query: 319  gttgtcgaaggaatgcagtttgaacgtggttac 351
            ||||| ||||| ||||||||||| |||||||||
Sbjct: 1029 gttgttgaaggtatgcagtttgatcgtggttac 1061



to top

>dbj|AB073221.2| Colwellia maris groESL operon (groES and groEL), complete sequence
          Length = 2901

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                             
Query: 319  gttgtcgaaggaatgcagtttgaacgtggttac 351
            ||||| ||||| ||||||||||| |||||||||
Sbjct: 1487 gttgttgaaggtatgcagtttgaccgtggttac 1519



to top

>emb|AM235732.1| Listonella anguillarum partial cpn60 gene for chaperonin 60
           protein, strain NCMB 6
          Length = 521

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 325 gaaggaatgcagtttgaacgtggttacct 353
           ||||| ||||||||||| |||||||||||
Sbjct: 292 gaaggtatgcagtttgatcgtggttacct 320



to top

>gb|CP000020.1| Vibrio fischeri ES114 chromosome I, complete sequence
          Length = 2906179

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                               
Query: 319    gttgtcgaaggaatgcagtttgaacgtggttac 351
              ||||| ||||| ||||||||||| |||||||||
Sbjct: 228529 gttgttgaaggtatgcagtttgaccgtggttac 228561



to top

>gb|AF152236.1| Methylovorus sp. strain SS1 groESL operon, complete sequence
          Length = 3212

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                             
Query: 322  gtcgaaggaatgcagtttgaacgtggttacctc 354
            |||||||| ||||||||||| ||||| ||||||
Sbjct: 1574 gtcgaaggcatgcagtttgatcgtggctacctc 1606



to top

>gb|M86549.1|XBCGROEX Amoeba proteus symbiotic bacterium groES and groEL genes, complete
            cds's
          Length = 2672

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                             
Query: 319  gttgtcgaaggaatgcagtttgaacgtggttac 351
            ||||| ||||| ||||||||||| |||||||||
Sbjct: 1279 gttgttgaaggtatgcagtttgaccgtggttac 1311



to top

>emb|AM162559.1| Listonella anguillarum partial hsp60 gene for heat shock protein
           60, strain 610
          Length = 531

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 325 gaaggaatgcagtttgaacgtggttacct 353
           ||||| ||||||||||| |||||||||||
Sbjct: 290 gaaggcatgcagtttgatcgtggttacct 318



to top

>dbj|AP005638.2| Homo sapiens genomic DNA, chromosome 11 clone:CMB9-61B13, complete
             sequence
          Length = 83280

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 349   tacctctcacctttctttgtc 369
             |||||||||||||||||||||
Sbjct: 42395 tacctctcacctttctttgtc 42415



to top

>gb|AF429643.1| Pediococcus claussenii strain CCC B962A 60 kDa heat shock protein
           (HSP60) gene, partial cds
          Length = 552

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 319 gttgtcgaaggaatgcagtttgaacgtgg 347
           ||||| ||||||||||||||||| |||||
Sbjct: 289 gttgttgaaggaatgcagtttgaccgtgg 317



to top

>gb|AC156638.2| Mus musculus BAC clone RP24-255L24 from chromosome 9, complete
            sequence
          Length = 162792

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 258  agtaggcagggaaggcatggt 278
            |||||||||||||||||||||
Sbjct: 4692 agtaggcagggaaggcatggt 4672



to top

>ref|NM_179480.1| Arabidopsis thaliana CPN60B (CHAPERONIN 60 BETA); ATP binding /
           protein binding AT1G55490 (CPN60B) transcript variant
           AT1G55490.2 mRNA, complete cds
          Length = 2060

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 325 gaaggaatgcagtttgaacgtggttacctctcacctttctttgt 368
           ||||||||||| ||||| ||||||||  |||| |||| ||||||
Sbjct: 836 gaaggaatgcaatttgaccgtggttatatctctccttactttgt 879



to top

>ref|NM_104424.2| Arabidopsis thaliana CPN60B (CHAPERONIN 60 BETA); ATP binding /
           protein binding AT1G55490 (CPN60B) transcript variant
           AT1G55490.1 mRNA, complete cds
          Length = 2087

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 325 gaaggaatgcagtttgaacgtggttacctctcacctttctttgt 368
           ||||||||||| ||||| ||||||||  |||| |||| ||||||
Sbjct: 863 gaaggaatgcaatttgaccgtggttatatctctccttactttgt 906



to top

>ref|NM_112193.1| Arabidopsis thaliana ATP binding / protein binding AT3G13470 mRNA,
           complete cds
          Length = 1922

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 319 gttgtcgaaggaatgcagtttgaacgtggtta 350
           ||||| ||||||||||| ||||| ||||||||
Sbjct: 715 gttgtggaaggaatgcaatttgaccgtggtta 746



to top

>ref|NM_202718.1| Arabidopsis thaliana alpha-galactosidase/ hydrolase, hydrolyzing
           O-glycosyl compounds AT3G56310 transcript variant
           AT3G56310.2 mRNA, complete cds
          Length = 1879

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 124 actgctgatgctttggtttc 143
           ||||||||||||||||||||
Sbjct: 342 actgctgatgctttggtttc 361



to top

>ref|NM_115489.4| Arabidopsis thaliana alpha-galactosidase/ hydrolase, hydrolyzing
           O-glycosyl compounds AT3G56310 transcript variant
           AT3G56310.1 mRNA, complete cds
          Length = 1975

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 124 actgctgatgctttggtttc 143
           ||||||||||||||||||||
Sbjct: 366 actgctgatgctttggtttc 385



to top

>gb|AY691282.1| Prevotella enoeca 60 kDa chaperonin (cpn60) gene, partial cds
          Length = 558

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 319 gttgtcgaaggaatgcagtttgaacgtggtta 350
           ||||| ||||||||||||||||| || |||||
Sbjct: 295 gttgtagaaggaatgcagtttgatcgcggtta 326



to top

>gb|AF437243.1| Uncultured pig faeces bacterium clone B40-0022 60 kDa chaperonin
           (cpn60) gene, partial cds
          Length = 558

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 325 gaaggaatgcagtttgaacgtggttacctctc 356
           ||||| ||||||||||| || |||||||||||
Sbjct: 301 gaaggtatgcagtttgaccgcggttacctctc 332



to top

>gb|AF440237.1| Bacteroides uniformis CPN60 (cpn60) gene, partial cds
          Length = 558

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 325 gaaggaatgcagtttgaacgtggttacctctc 356
           ||||| |||||||| || ||||||||||||||
Sbjct: 301 gaaggtatgcagttcgaccgtggttacctctc 332



to top

>gb|AF352808.1| Streptococcus anginosus ATCC33397 60 kDa chaperonin (cpn60) gene,
           partial cds
          Length = 552

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                   
Query: 314 tggaggttgtcgaaggaatgcagtttgaacgtggttacct 353
           |||| ||||| ||||||||||| ||||| || ||||||||
Sbjct: 284 tggacgttgtagaaggaatgcaatttgaccgcggttacct 323



to top

>gb|AC146609.3| Mus musculus BAC clone RP23-162K11 from chromosome 14, complete
             sequence
          Length = 199215

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 465   ctttagtgctgtaaaagaagattt 488
             ||||||||||| ||||||||||||
Sbjct: 74250 ctttagtgctggaaaagaagattt 74273



to top

>gb|DQ410272.1| HIV-1 isolate H22v2ed3 from USA envelope glycoprotein (env) gene,
            complete cds
          Length = 2598

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 22   tgtaccacttctataatcct 41
            ||||||||||||||||||||
Sbjct: 2528 tgtaccacttctataatcct 2509



to top

>gb|CP000358.1| Deinococcus geothermalis DSM 11300 plasmid 1, complete sequence
          Length = 574126

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 69     gaaggttcttgctgctggaa 88
              ||||||||||||||||||||
Sbjct: 341490 gaaggttcttgctgctggaa 341509



to top

>gb|DQ106370.1| Uncultured bacterium clone pi1_cl0_sn27 60 kDa chaperonin (cpn60)
           gene, partial cds
          Length = 552

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 314 tggaggttgtcgaaggaatgcagtttgaacgtggttacctctcacctt 361
           |||| ||||| ||||| ||||||||||| || |||||| | |||||||
Sbjct: 284 tggaagttgttgaagggatgcagtttgaccgcggttacttatcacctt 331



to top

>gb|DQ106358.1| Uncultured bacterium clone pi0_cl0_sn54 60 kDa chaperonin (cpn60)
           gene, partial cds
          Length = 552

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 319 gttgtcgaaggaatgcagtttgaacgtggtta 350
           ||||| ||||| ||||||||||| ||||||||
Sbjct: 289 gttgttgaaggtatgcagtttgatcgtggtta 320



to top

>gb|DQ106331.1| Uncultured bacterium clone mj0_cl13_cn1 60 kDa chaperonin (cpn60)
           gene, partial cds
          Length = 552

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 314 tggaggttgtcgaaggaatgcagtttga 341
           |||| ||||| |||||||||||||||||
Sbjct: 284 tggaagttgttgaaggaatgcagtttga 311



to top

>gb|DQ106327.1| Uncultured bacterium clone mj0_cl0_sn8 60 kDa chaperonin (cpn60)
           gene, partial cds
          Length = 552

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 314 tggaggttgtcgaaggaatgcagtttgaacgtggttacctctcacctt 361
           |||| ||||| ||||| ||||||||||| || |||||| | |||||||
Sbjct: 284 tggaagttgttgaagggatgcagtttgaccgcggttacttatcacctt 331



to top

>gb|DQ106272.1| Uncultured bacterium clone dl1_cl17_cn1 60 kDa chaperonin (cpn60)
           gene, partial cds
          Length = 552

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 314 tggaggttgtcgaaggaatgcagtttga 341
           |||| ||||| |||||||||||||||||
Sbjct: 284 tggaagttgttgaaggaatgcagtttga 311



to top

>gb|DQ106230.1| Uncultured bacterium clone dl0_cl12_cn1 60 kDa chaperonin (cpn60)
           gene, partial cds
          Length = 552

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 314 tggaggttgtcgaaggaatgcagtttga 341
           |||| ||||| |||||||||||||||||
Sbjct: 284 tggaagttgttgaaggaatgcagtttga 311



to top

>gb|DQ106222.1| Uncultured bacterium clone dl0_cl0_sn11 60 kDa chaperonin (cpn60)
           gene, partial cds
          Length = 555

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 319 gttgtcgaaggaatgcagtttgaacgtggtta 350
           ||||| ||||| ||||||||||| ||||||||
Sbjct: 292 gttgtagaaggtatgcagtttgaccgtggtta 323



to top

>gb|DQ106176.1| Uncultured bacterium clone ce1_cl3_cn1 60 kDa chaperonin (cpn60)
           gene, partial cds
          Length = 558

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 325 gaaggaatgcagtttgaacgtggttacctctc 356
           ||||| |||||||| || ||||||||||||||
Sbjct: 301 gaaggtatgcagttcgaccgtggttacctctc 332



to top

>gb|DQ106134.1| Uncultured bacterium clone ce1_cl0_sn66 60 kDa chaperonin (cpn60)
           gene, partial cds
          Length = 552

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 320 ttgtcgaaggaatgcagtttgaacgtggttac 351
           |||| ||||||||||||||||| || ||||||
Sbjct: 290 ttgtagaaggaatgcagtttgaccgcggttac 321



to top

>gb|DQ106071.1| Uncultured bacterium clone ce0_cl2_cn6 60 kDa chaperonin (cpn60)
           gene, partial cds
          Length = 552

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 325 gaaggaatgcagtttgaacgtggttacctctc 356
           ||||| ||||||||||| ||||||||| ||||
Sbjct: 295 gaaggtatgcagtttgaccgtggttacatctc 326



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 70       aaggttcttgctgctggaat 89
                ||||||||||||||||||||
Sbjct: 33085302 aaggttcttgctgctggaat 33085321



to top

>gb|DQ156613.1| Acinetobacter baumannii strain st1954 60 kDa chaperonin (cpn60)
           gene, partial cds
          Length = 421

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 319 gttgtcgaaggaatgcagtttgaacgtggtta 350
           ||||| ||||| ||||||||||| ||||||||
Sbjct: 235 gttgtagaaggtatgcagtttgaccgtggtta 266



to top

>gb|DQ156612.1| Acinetobacter baumannii strain st1650 60 kDa chaperonin (cpn60)
           gene, partial cds
          Length = 421

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 319 gttgtcgaaggaatgcagtttgaacgtggtta 350
           ||||| ||||| ||||||||||| ||||||||
Sbjct: 235 gttgtagaaggtatgcagtttgaccgtggtta 266



to top

>gb|DQ156611.1| Acinetobacter genomosp. 13TU strain st7961 60 kDa chaperonin
           (cpn60) gene, partial cds
          Length = 421

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 319 gttgtcgaaggaatgcagtttgaacgtggtta 350
           ||||| ||||| ||||||||||| ||||||||
Sbjct: 235 gttgtagaaggtatgcagtttgaccgtggtta 266



to top

>gb|DQ156610.1| Acinetobacter genomosp. 13TU strain st11681 60 kDa chaperonin
           (cpn60) gene, partial cds
          Length = 421

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 319 gttgtcgaaggaatgcagtttgaacgtggtta 350
           ||||| ||||| ||||||||||| ||||||||
Sbjct: 235 gttgtagaaggtatgcagtttgaccgtggtta 266



to top

>gb|DQ156609.1| Acinetobacter baumannii strain V7459 60 kDa chaperonin (cpn60)
           gene, partial cds
          Length = 421

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 319 gttgtcgaaggaatgcagtttgaacgtggtta 350
           ||||| ||||| ||||||||||| ||||||||
Sbjct: 235 gttgtagaaggtatgcagtttgaccgtggtta 266



to top

>gb|DQ156608.1| Acinetobacter baumannii strain st17093 60 kDa chaperonin (cpn60)
           gene, partial cds
          Length = 421

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 319 gttgtcgaaggaatgcagtttgaacgtggtta 350
           ||||| ||||| ||||||||||| ||||||||
Sbjct: 235 gttgtagaaggtatgcagtttgaccgtggtta 266



to top

>gb|DQ156607.1| Acinetobacter baumannii strain st14970 60 kDa chaperonin (cpn60)
           gene, partial cds
          Length = 421

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 319 gttgtcgaaggaatgcagtttgaacgtggtta 350
           ||||| ||||| ||||||||||| ||||||||
Sbjct: 235 gttgtagaaggtatgcagtttgaccgtggtta 266



to top

>gb|DQ156606.1| Acinetobacter baumannii strain st15598 60 kDa chaperonin (cpn60)
           gene, partial cds
          Length = 421

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 319 gttgtcgaaggaatgcagtttgaacgtggtta 350
           ||||| ||||| ||||||||||| ||||||||
Sbjct: 235 gttgtagaaggtatgcagtttgaccgtggtta 266



to top

>gb|DQ156605.1| Acinetobacter baumannii strain st21359 60 kDa chaperonin (cpn60)
           gene, partial cds
          Length = 421

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 319 gttgtcgaaggaatgcagtttgaacgtggtta 350
           ||||| ||||| ||||||||||| ||||||||
Sbjct: 235 gttgtagaaggtatgcagtttgaccgtggtta 266



to top

>gb|DQ156604.1| Acinetobacter baumannii strain st20820 60 kDa chaperonin (cpn60)
           gene, partial cds
          Length = 421

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 319 gttgtcgaaggaatgcagtttgaacgtggtta 350
           ||||| ||||| ||||||||||| ||||||||
Sbjct: 235 gttgtagaaggtatgcagtttgaccgtggtta 266



to top

>gb|DQ156603.1| Acinetobacter baumannii strain st14733 60 kDa chaperonin (cpn60)
           gene, partial cds
          Length = 421

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 319 gttgtcgaaggaatgcagtttgaacgtggtta 350
           ||||| ||||| ||||||||||| ||||||||
Sbjct: 235 gttgtagaaggtatgcagtttgaccgtggtta 266



to top

>gb|DQ156602.1| Acinetobacter baumannii strain st284 60 kDa chaperonin (cpn60)
           gene, partial cds
          Length = 421

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 319 gttgtcgaaggaatgcagtttgaacgtggtta 350
           ||||| ||||| ||||||||||| ||||||||
Sbjct: 235 gttgtagaaggtatgcagtttgaccgtggtta 266



to top

>gb|DQ156601.1| Acinetobacter baumannii strain U11177 60 kDa chaperonin (cpn60)
           gene, partial cds
          Length = 421

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 319 gttgtcgaaggaatgcagtttgaacgtggtta 350
           ||||| ||||| ||||||||||| ||||||||
Sbjct: 235 gttgtagaaggtatgcagtttgaccgtggtta 266



to top

>gb|DQ156600.1| Acinetobacter baumannii strain U10247 60 kDa chaperonin (cpn60)
           gene, partial cds
          Length = 421

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 319 gttgtcgaaggaatgcagtttgaacgtggtta 350
           ||||| ||||| ||||||||||| ||||||||
Sbjct: 235 gttgtagaaggtatgcagtttgaccgtggtta 266



to top

>gb|DQ156599.1| Acinetobacter baumannii strain U1901 60 kDa chaperonin (cpn60)
           gene, partial cds
          Length = 421

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 319 gttgtcgaaggaatgcagtttgaacgtggtta 350
           ||||| ||||| ||||||||||| ||||||||
Sbjct: 235 gttgtagaaggtatgcagtttgaccgtggtta 266


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,681,838
Number of Sequences: 3902068
Number of extensions: 4681838
Number of successful extensions: 95821
Number of sequences better than 10.0: 366
Number of HSP's better than 10.0 without gapping: 366
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 95041
Number of HSP's gapped (non-prelim): 773
length of query: 519
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 496
effective length of database: 17,143,297,704
effective search space: 8503075661184
effective search space used: 8503075661184
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top