ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | bags18k16 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY103621.1| Zea mays PCO154872 mRNA sequence Length = 805 Score = 640 bits (323), Expect = e-180 Identities = 449/491 (91%) Strand = Plus / Plus Query: 35 cctccggtctcgagagctcgccagaatggtcgcccacaggttccaccagtaccaggtggt 94 ||||||| | || ||||||||| ||||||||||||||||||||| |||||||||||||| Sbjct: 43 cctccggccacgcgagctcgccgaaatggtcgcccacaggttccatcagtaccaggtggt 102 Query: 95 gggtcgcgcgctgccgaccccgggcgatgagcagcccaagatctaccgcatgaagctctg 154 ||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||| Sbjct: 103 gggtcgcgcgctgccgaccccaaccgatgagcaccccaagatctaccgcatgaagctctg 162 Query: 155 ggccaccaacgaggtccgcgccaagtccaagttctggtacttcctgaggaagctcaagaa 214 ||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 163 ggccaccaacgaggttcgcgccaagtccaagttctggtacttcctgagaaagctcaagaa 222 Query: 215 ggtgaagaaggccaacggccagatgctcgccatcaacgagatctttgagaagaacccgac 274 |||||||||| ||| ||||||||||| ||||||||||||||||||||| |||||||| Sbjct: 223 ggtgaagaagagcaatggccagatgcttgccatcaacgagatctttgagcgcaacccgac 282 Query: 275 caccatcaagaactacggcatctggctgcgctaccagagcaggaccggttaccacaacat 334 ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 283 caccatcaagaactatggcatctggctgcgctaccagagcaggactggttaccacaacat 342 Query: 335 gtacaaggagtaccgcgacacgactctgaacggcggtttggagcagatgtacacggagat 394 ||||||||||||||||||||| || |||||||||| ||||||||||||||| ||||| Sbjct: 343 gtacaaggagtaccgcgacaccaccctgaacggcgcagtggagcagatgtacaacgagat 402 Query: 395 ggcgtcgcggcaccgcgtgcgttccccgtgcatccagatcatcaagactgcgacggtgga 454 ||| || || ||||||||| | ||||| ||||| |||||||||||||| |||||||| | Sbjct: 403 ggcctcccgccaccgcgtgaggtccccctgcatacagatcatcaagacagcgacggtcca 462 Query: 455 cttcaagctgtgcaagagggacaacacgaagcagttccacaactcgaagatcaagttccc 514 ||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| Sbjct: 463 cttcaagctgtgcaagagggacaacaccaagcagttccacaactccgagatcaagttccc 522 Query: 515 gctggtgtacc 525 ||| ||||||| Sbjct: 523 gcttgtgtacc 533
>dbj|AK102673.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033102C12, full insert sequence Length = 966 Score = 569 bits (287), Expect = e-159 Identities = 422/467 (90%) Strand = Plus / Plus Query: 59 aatggtcgcccacaggttccaccagtaccaggtggtgggtcgcgcgctgccgaccccggg 118 |||||||||| |||||||||| |||||||||||||||||||||||||| |||||||| || Sbjct: 65 aatggtcgcctacaggttccatcagtaccaggtggtgggtcgcgcgctcccgacccccgg 124 Query: 119 cgatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaa 178 ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 125 cgatgagcaccccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaa 184 Query: 179 gtccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagat 238 |||||||||||||||||||||||||||||| ||||||||||||||| ||| || ||||| Sbjct: 185 gtccaagttctggtacttcctgaggaagctgaagaaggtgaagaagagcaatggacagat 244 Query: 239 gctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctg 298 ||||||||||||||||||||||||| ||||| || || |||||||||||||||||||| Sbjct: 245 gctcgccatcaacgagatctttgagcgtaaccctacaacgatcaagaactacggcatctg 304 Query: 299 gctgcgctaccagagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgac 358 |||||| ||||||||||| || ||||||||||||||||||||||| ||||| ||||| || Sbjct: 305 gctgcgttaccagagcagaacaggttaccacaacatgtacaaggaataccgtgacactac 364 Query: 359 tctgaacggcggtttggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttc 418 |||||| || | | |||||||||||||||| |||||||| || || ||||| ||| | | Sbjct: 365 tctgaatggtgctgtggagcagatgtacaccgagatggcctctcgtcaccgtgtgaggtt 424 Query: 419 cccgtgcatccagatcatcaagactgcgacggtggacttcaagctgtgcaagagggacaa 478 ||| ||||| |||||||||||||| || || || |||||||||| |||||||||||||| Sbjct: 425 cccctgcattcagatcatcaagaccgcaacagttcacttcaagctctgcaagagggacaa 484 Query: 479 cacgaagcagttccacaactcgaagatcaagttcccgctggtgtacc 525 ||| |||||||||||||||||||| |||||||||||||| ||||||| Sbjct: 485 cactaagcagttccacaactcgaatatcaagttcccgctcgtgtacc 531
>gb|BT017327.1| Zea mays clone EL01N0320F05.c mRNA sequence Length = 791 Score = 537 bits (271), Expect = e-149 Identities = 403/447 (90%) Strand = Plus / Plus Query: 71 caggttccaccagtaccaggtggtgggtcgcgcgctgccgaccccgggcgatgagcagcc 130 ||||||||| ||||||||||||||||| |||||||||||||| || ||||||||||| | Sbjct: 57 caggttccatcagtaccaggtggtggggcgcgcgctgccgacgcccggcgatgagcactc 116 Query: 131 caagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaagtccaagttctg 190 ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 117 caagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaagagcaagttctg 176 Query: 191 gtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgccatcaa 250 ||||||| |||||||| | |||||||| |||||| |||||||||| | || |||||||| Sbjct: 177 gtacttcttgaggaagttgaagaaggttaagaagagcaacggccaggtcctggccatcaa 236 Query: 251 cgagatctttgagaagaacccgaccaccatcaagaactacggcatctggctgcgctacca 310 ||||||||||||| |||||||| || |||||||||||||||||||||||||||||||| Sbjct: 237 cgagatctttgagcgtaacccgacgacaatcaagaactacggcatctggctgcgctacca 296 Query: 311 gagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgactctgaacggcgg 370 |||||| ||||| |||||||||||||||||||||||||||||||| || ||||| |||| Sbjct: 297 gagcagaaccggctaccacaacatgtacaaggagtaccgcgacacaaccctgaatggcgc 356 Query: 371 tttggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttccccgtgcatcca 430 | ||||||||||||||| |||||||| || || ||||||||| | ||||| |||||||| Sbjct: 357 tgtggagcagatgtacaacgagatggcctctcgccaccgcgtgaggtccccctgcatcca 416 Query: 431 gatcatcaagactgcgacggtggacttcaagctgtgcaagagggacaacacgaagcagtt 490 |||||||||||||||||||||| |||||||||| ||||||||||||||||| |||||||| Sbjct: 417 gatcatcaagactgcgacggtgcacttcaagctctgcaagagggacaacactaagcagtt 476 Query: 491 ccacaactcgaagatcaagttcccgct 517 ||||||| |||||||||||||||| Sbjct: 477 ccacaacagtgagatcaagttcccgct 503
>gb|AY103768.1| Zea mays PCO155588 mRNA sequence Length = 818 Score = 521 bits (263), Expect = e-145 Identities = 407/455 (89%) Strand = Plus / Plus Query: 71 caggttccaccagtaccaggtggtgggtcgcgcgctgccgaccccgggcgatgagcagcc 130 ||||||||| ||||||||||||||||| |||||||||||||| || ||||| ||||| || Sbjct: 75 caggttccatcagtaccaggtggtggggcgcgcgctgccgacgcccggcgacgagcaccc 134 Query: 131 caagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaagtccaagttctg 190 |||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| Sbjct: 135 caagatctaccgcatgaagctctgggccaccaacgaagtccgcgccaagagcaagttctg 194 Query: 191 gtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgccatcaa 250 |||||||||||||||| | |||||||| |||||| |||||| ||| | || |||||||| Sbjct: 195 gtacttcctgaggaagttgaagaaggttaagaagagcaacggtcaggtcctggccatcaa 254 Query: 251 cgagatctttgagaagaacccgaccaccatcaagaactacggcatctggctgcgctacca 310 ||||||||| ||| |||||||| || |||||||||||||||||||||||||||||||| Sbjct: 255 cgagatcttcgagcgtaacccgacgacgatcaagaactacggcatctggctgcgctacca 314 Query: 311 gagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgactctgaacggcgg 370 |||||| ||||| |||||||||||||||||||||||||||||||| || ||||| |||| Sbjct: 315 gagcagaaccggctaccacaacatgtacaaggagtaccgcgacacaaccctgaatggcgc 374 Query: 371 tttggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttccccgtgcatcca 430 | ||||||||||||||| |||||||| || || ||||||||| | ||||| |||||||| Sbjct: 375 tgtggagcagatgtacaacgagatggcttctcgccaccgcgtgaggtccccctgcatcca 434 Query: 431 gatcatcaagactgcgacggtggacttcaagctgtgcaagagggacaacacgaagcagtt 490 |||||||||||||||||||||| |||||||||| ||||||||||||||||| |||||||| Sbjct: 435 gatcatcaagactgcgacggtgcacttcaagctctgcaagagggacaacactaagcagtt 494 Query: 491 ccacaactcgaagatcaagttcccgctggtgtacc 525 ||||||| ||||||||||||| || ||||||| Sbjct: 495 ccacaacagtgagatcaagttcccactcgtgtacc 529
>gb|BT016199.1| Zea mays clone Contig32 mRNA sequence Length = 732 Score = 498 bits (251), Expect = e-137 Identities = 404/455 (88%) Strand = Plus / Plus Query: 71 caggttccaccagtaccaggtggtgggtcgcgcgctgccgaccccgggcgatgagcagcc 130 ||||||||| ||||||||||||||||| |||||||||||||| || ||||| ||||| || Sbjct: 82 caggttccatcagtaccaggtggtggggcgcgcgctgccgacgcccggcgacgagcaccc 141 Query: 131 caagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaagtccaagttctg 190 |||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| Sbjct: 142 caagatctaccgcatgaagctctgggccaccaacgaagtccgcgccaagagcaagttctg 201 Query: 191 gtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgccatcaa 250 |||||||||||||||| | |||||||| |||||| |||||| ||| | || |||||||| Sbjct: 202 gtacttcctgaggaagttgaagaaggttaagaagagcaacggtcaggtcctggccatcaa 261 Query: 251 cgagatctttgagaagaacccgaccaccatcaagaactacggcatctggctgcgctacca 310 ||||||||| ||| |||||||| || |||||||||||||||||||||||||||||||| Sbjct: 262 cgagatcttcgagcgtaacccgacgacgatcaagaactacggcatctggctgcgctacca 321 Query: 311 gagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgactctgaacggcgg 370 |||||| ||||| |||||||||||||||||||||||||||||||| || |||||||||| Sbjct: 322 gagcagaaccggctaccacaacatgtacaaggagtaccgcgacacaaccctgaacggcgc 381 Query: 371 tttggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttccccgtgcatcca 430 | | ||||||||||||| |||||||| || || ||||||||| | ||||| |||||||| Sbjct: 382 tgtagagcagatgtacaatgagatggcttctcgccaccgcgtgaggtccccatgcatcca 441 Query: 431 gatcatcaagactgcgacggtggacttcaagctgtgcaagagggacaacacgaagcagtt 490 |||||||||||| || || ||| |||||||||||||||||||||||||||| |||||||| Sbjct: 442 gatcatcaagaccgccacagtgcacttcaagctgtgcaagagggacaacaccaagcagtt 501 Query: 491 ccacaactcgaagatcaagttcccgctggtgtacc 525 |||||| ||||||||||||| || ||||||| Sbjct: 502 tcacaacagtgagatcaagttcccactcgtgtacc 536
>gb|BT017504.1| Zea mays clone EL01N0414H05.c mRNA sequence Length = 834 Score = 460 bits (232), Expect = e-126 Identities = 361/404 (89%) Strand = Plus / Plus Query: 71 caggttccaccagtaccaggtggtgggtcgcgcgctgccgaccccgggcgatgagcagcc 130 ||||||||| ||||||||||||||||| |||||||||||||| || ||||| ||||| || Sbjct: 62 caggttccatcagtaccaggtggtggggcgcgcgctgccgacgcccggcgacgagcaccc 121 Query: 131 caagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaagtccaagttctg 190 |||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| Sbjct: 122 caagatctaccgcatgaagctctgggccaccaacgaagtccgcgccaagagcaagttctg 181 Query: 191 gtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgccatcaa 250 |||||||||||||||| | |||||||| |||||| |||||| ||| | || |||||||| Sbjct: 182 gtacttcctgaggaagttgaagaaggttaagaagagcaacggtcaggtcctggccatcaa 241 Query: 251 cgagatctttgagaagaacccgaccaccatcaagaactacggcatctggctgcgctacca 310 ||||||||| ||| |||||||| || |||||||||||||||||||||||||||||||| Sbjct: 242 cgagatcttcgagcgtaacccgacgacgatcaagaactacggcatctggctgcgctacca 301 Query: 311 gagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgactctgaacggcgg 370 |||||| ||||| |||||||||||||||||||||||||||||||| || |||||||||| Sbjct: 302 gagcagaaccggctaccacaacatgtacaaggagtaccgcgacacaaccctgaacggcgc 361 Query: 371 tttggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttccccgtgcatcca 430 | | ||||||||||||| |||||||| || || ||||||||| | ||||| |||||||| Sbjct: 362 tgtagagcagatgtacaatgagatggcttctcgccaccgcgtgaggtccccatgcatcca 421 Query: 431 gatcatcaagactgcgacggtggacttcaagctgtgcaagaggg 474 |||||||||||| || || ||| ||||||||||||||||||||| Sbjct: 422 gatcatcaagaccgccacagtgcacttcaagctgtgcaagaggg 465
>ref|NM_191253.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 537 Score = 377 bits (190), Expect = e-101 Identities = 388/454 (85%) Strand = Plus / Plus Query: 71 caggttccaccagtaccaggtggtgggtcgcgcgctgccgaccccgggcgatgagcagcc 130 ||||||||||||||||||||||||||| | | |||||||| ||| ||| ||||| || Sbjct: 12 caggttccaccagtaccaggtggtggggaggggcctgccgacgccgaccgacgagcaccc 71 Query: 131 caagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaagtccaagttctg 190 ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct: 72 caagatctaccgcatgaagctctgggctaccaacgaggtccgcgccaagtccaagttctg 131 Query: 191 gtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgccatcaa 250 ||||||||| | ||||| ||||||||||||||| |||||| ||||| || |||||||| Sbjct: 132 gtacttcctccgcaagctgaagaaggtgaagaagagcaacgggcagatccttgccatcaa 191 Query: 251 cgagatctttgagaagaacccgaccaccatcaagaactacggcatctggctgcgctacca 310 |||||| |||||||||||||| || || ||||||||||| |||||||||||||| ||||| Sbjct: 192 cgagatttttgagaagaacccaacaactatcaagaactatggcatctggctgcgttacca 251 Query: 311 gagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgactctgaacggcgg 370 ||| ||||| || |||||||||||||||||||||||||| || || || || || || | Sbjct: 252 gagtaggactggctaccacaacatgtacaaggagtaccgtgataccaccctcaatggtgc 311 Query: 371 tttggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttccccgtgcatcca 430 | |||||||||||||| |||||||| || || ||||| || | | ||| ||||| || Sbjct: 312 cgttgagcagatgtacactgagatggcttcccgccaccgtgtcagattcccttgcattca 371 Query: 431 gatcatcaagactgcgacggtggacttcaagctgtgcaagagggacaacacgaagcagtt 490 ||||||||||||||| || || |||| || || |||||| | |||||||| |||||||| Sbjct: 372 gatcatcaagactgctactgtccactttaaactctgcaagcgtgacaacactaagcagtt 431 Query: 491 ccacaactcgaagatcaagttcccgctggtgtac 524 |||||| || | ||||||||||| ||||||||| Sbjct: 432 ccacaagtcagatatcaagttcccactggtgtac 465
>dbj|AK121755.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033088C04, full insert sequence Length = 910 Score = 369 bits (186), Expect = 8e-99 Identities = 387/454 (85%) Strand = Plus / Plus Query: 71 caggttccaccagtaccaggtggtgggtcgcgcgctgccgaccccgggcgatgagcagcc 130 ||||||||||||||||||||||||||| | | |||||||| | | ||| ||||| || Sbjct: 129 caggttccaccagtaccaggtggtggggaggggcctgccgacgcggaccgacgagcaccc 188 Query: 131 caagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaagtccaagttctg 190 ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct: 189 caagatctaccgcatgaagctctgggctaccaacgaggtccgcgccaagtccaagttctg 248 Query: 191 gtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgccatcaa 250 ||||||||| | ||||| ||||||||||||||| |||||| ||||| || |||||||| Sbjct: 249 gtacttcctccgcaagctgaagaaggtgaagaagagcaacgggcagatccttgccatcaa 308 Query: 251 cgagatctttgagaagaacccgaccaccatcaagaactacggcatctggctgcgctacca 310 |||||| |||||||||||||| || || ||||||||||| |||||||||||||| ||||| Sbjct: 309 cgagatttttgagaagaacccaacaactatcaagaactatggcatctggctgcgttacca 368 Query: 311 gagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgactctgaacggcgg 370 ||| ||||| || |||||||||||||||||||||||||| || || || || || || | Sbjct: 369 gagtaggactggctaccacaacatgtacaaggagtaccgtgataccaccctcaatggtgc 428 Query: 371 tttggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttccccgtgcatcca 430 | |||||||||||||| |||||||| || || ||||| || | | ||| ||||| || Sbjct: 429 cgttgagcagatgtacactgagatggcttcccgccaccgtgtcagattcccttgcattca 488 Query: 431 gatcatcaagactgcgacggtggacttcaagctgtgcaagagggacaacacgaagcagtt 490 ||||||||||||||| || || |||| || || |||||| | |||||||| |||||||| Sbjct: 489 gatcatcaagactgctactgtccactttaaactctgcaagcgtgacaacactaagcagtt 548 Query: 491 ccacaactcgaagatcaagttcccgctggtgtac 524 |||||| || | ||||||||||| ||||||||| Sbjct: 549 ccacaagtcagatatcaagttcccactggtgtac 582
>ref|NM_191921.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 588 Score = 317 bits (160), Expect = 3e-83 Identities = 292/336 (86%) Strand = Plus / Plus Query: 190 ggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgccatca 249 ||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| Sbjct: 182 ggtacttcctgaggaagctgaagaaggtgaagaagagcaacggccagatgctcgccatca 241 Query: 250 acgagatctttgagaagaacccgaccaccatcaagaactacggcatctggctgcgctacc 309 |||||||||| ||| ||||| ||||| ||||||||||| |||||||||||||| |||| Sbjct: 242 acgagatcttcgagcgcaacccaaccacgatcaagaactatggcatctggctgcgttacc 301 Query: 310 agagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgactctgaacggcg 369 ||||||| |||||||||||||||||||||||||||||||| ||||| || |||| || | Sbjct: 302 agagcagaaccggttaccacaacatgtacaaggagtaccgtgacactacattgaatggtg 361 Query: 370 gtttggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttccccgtgcatcc 429 |||| ||||||||||| |||||||| || || ||||| ||| | | ||| ||||||| Sbjct: 362 ccgtggaacagatgtacaccgagatggcttctcgccaccgtgtgagattcccttgcatcc 421 Query: 430 agatcatcaagactgcgacggtggacttcaagctgtgcaagagggacaacacgaagcagt 489 ||||||||||||| || || || |||||||||| ||||||||||||||||| ||||||| Sbjct: 422 agatcatcaagaccgccactgtccacttcaagctctgcaagagggacaacaccaagcagt 481 Query: 490 tccacaactcgaagatcaagttcccgctggtgtacc 525 |||||||| || ||||||||||| || ||||||| Sbjct: 482 tccacaacgggagcatcaagttcccccttgtgtacc 517 Score = 174 bits (88), Expect = 2e-40 Identities = 112/120 (93%) Strand = Plus / Plus Query: 71 caggttccaccagtaccaggtggtgggtcgcgcgctgccgaccccgggcgatgagcagcc 130 ||||||||| ||||||||||||||||| ||||||||||||||||| ||||||||||| || Sbjct: 12 caggttccatcagtaccaggtggtggggcgcgcgctgccgacccccggcgatgagcaccc 71 Query: 131 caagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaagtccaagttctg 190 |||||||||||| |||||||||||||||||||| ||||||||||||||| ||||||||| Sbjct: 72 caagatctaccggatgaagctctgggccaccaatgaggtccgcgccaagagcaagttctg 131
>ref|NM_129000.2| Arabidopsis thaliana structural constituent of ribosome AT2G34480 mRNA, complete cds Length = 785 Score = 268 bits (135), Expect = 2e-68 Identities = 330/395 (83%) Strand = Plus / Plus Query: 120 gatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaag 179 |||| |||||| ||||| ||| | |||||||||||||| || |||||||| || |||||| Sbjct: 101 gatgtgcagcctaagatttacaggatgaagctctgggctacgaacgaggttcgtgccaag 160 Query: 180 tccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatg 239 |||||||||||||| ||| |||||||||||||||||||||||||| || || |||||| Sbjct: 161 tccaagttctggtatttcttgaggaagctcaagaaggtgaagaagagtaatggacagatg 220 Query: 240 ctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctgg 299 ||||||||||||||||||| |||||||||||| || || |||||||||| ||| || ||| Sbjct: 221 ctcgccatcaacgagatctatgagaagaacccaacaacgatcaagaacttcggtatttgg 280 Query: 300 ctgcgctaccagagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgact 359 || | |||||||| || || || |||||||||||||||||||||||||| ||||| ||| Sbjct: 281 ttgaggtaccagagtagaactgggtaccacaacatgtacaaggagtaccgtgacaccact 340 Query: 360 ctgaacggcggtttggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttcc 419 || ||||| | | | |||||||||||||| |||||||| || || ||||| || | | | Sbjct: 341 cttaacggagctgttgagcagatgtacactgagatggcatcccgtcaccgtgtcagattc 400 Query: 420 ccgtgcatccagatcatcaagactgcgacggtggacttcaagctgtgcaagagggacaac 479 || ||||| |||||||||||||| || || || ||||||||||||||| || | | Sbjct: 401 ccttgcattcagatcatcaagacagccactgtcccagccaagctgtgcaagagagagagc 460 Query: 480 acgaagcagttccacaactcgaagatcaagttccc 514 || || |||||||||||| |||||||||||||| Sbjct: 461 actaaacagttccacaacagcaagatcaagttccc 495
>gb|BT000076.1| Arabidopsis thaliana 60S ribosomal protein L18A (At2g34480) mRNA, complete cds Length = 672 Score = 268 bits (135), Expect = 2e-68 Identities = 330/395 (83%) Strand = Plus / Plus Query: 120 gatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaag 179 |||| |||||| ||||| ||| | |||||||||||||| || |||||||| || |||||| Sbjct: 61 gatgtgcagcctaagatttacaggatgaagctctgggctacgaacgaggttcgtgccaag 120 Query: 180 tccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatg 239 |||||||||||||| ||| |||||||||||||||||||||||||| || || |||||| Sbjct: 121 tccaagttctggtatttcttgaggaagctcaagaaggtgaagaagagtaatggacagatg 180 Query: 240 ctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctgg 299 ||||||||||||||||||| |||||||||||| || || |||||||||| ||| || ||| Sbjct: 181 ctcgccatcaacgagatctatgagaagaacccaacaacgatcaagaacttcggtatttgg 240 Query: 300 ctgcgctaccagagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgact 359 || | |||||||| || || || |||||||||||||||||||||||||| ||||| ||| Sbjct: 241 ttgaggtaccagagtagaactgggtaccacaacatgtacaaggagtaccgtgacaccact 300 Query: 360 ctgaacggcggtttggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttcc 419 || ||||| | | | |||||||||||||| |||||||| || || ||||| || | | | Sbjct: 301 cttaacggagctgttgagcagatgtacactgagatggcatcccgtcaccgtgtcagattc 360 Query: 420 ccgtgcatccagatcatcaagactgcgacggtggacttcaagctgtgcaagagggacaac 479 || ||||| |||||||||||||| || || || ||||||||||||||| || | | Sbjct: 361 ccttgcattcagatcatcaagacagccactgtcccagccaagctgtgcaagagagagagc 420 Query: 480 acgaagcagttccacaactcgaagatcaagttccc 514 || || |||||||||||| |||||||||||||| Sbjct: 421 actaaacagttccacaacagcaagatcaagttccc 455
>gb|AY120778.1| Arabidopsis thaliana 60S ribosomal protein L18A (At2g34480) mRNA, complete cds Length = 734 Score = 268 bits (135), Expect = 2e-68 Identities = 330/395 (83%) Strand = Plus / Plus Query: 120 gatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaag 179 |||| |||||| ||||| ||| | |||||||||||||| || |||||||| || |||||| Sbjct: 96 gatgtgcagcctaagatttacaggatgaagctctgggctacgaacgaggttcgtgccaag 155 Query: 180 tccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatg 239 |||||||||||||| ||| |||||||||||||||||||||||||| || || |||||| Sbjct: 156 tccaagttctggtatttcttgaggaagctcaagaaggtgaagaagagtaatggacagatg 215 Query: 240 ctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctgg 299 ||||||||||||||||||| |||||||||||| || || |||||||||| ||| || ||| Sbjct: 216 ctcgccatcaacgagatctatgagaagaacccaacaacgatcaagaacttcggtatttgg 275 Query: 300 ctgcgctaccagagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgact 359 || | |||||||| || || || |||||||||||||||||||||||||| ||||| ||| Sbjct: 276 ttgaggtaccagagtagaactgggtaccacaacatgtacaaggagtaccgtgacaccact 335 Query: 360 ctgaacggcggtttggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttcc 419 || ||||| | | | |||||||||||||| |||||||| || || ||||| || | | | Sbjct: 336 cttaacggagctgttgagcagatgtacactgagatggcatcccgtcaccgtgtcagattc 395 Query: 420 ccgtgcatccagatcatcaagactgcgacggtggacttcaagctgtgcaagagggacaac 479 || ||||| |||||||||||||| || || || ||||||||||||||| || | | Sbjct: 396 ccttgcattcagatcatcaagacagccactgtcccagccaagctgtgcaagagagagagc 455 Query: 480 acgaagcagttccacaactcgaagatcaagttccc 514 || || |||||||||||| |||||||||||||| Sbjct: 456 actaaacagttccacaacagcaagatcaagttccc 490
>emb|BX818972.1|CNS0A9U8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB32ZE10 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 752 Score = 268 bits (135), Expect = 2e-68 Identities = 330/395 (83%) Strand = Plus / Plus Query: 120 gatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaag 179 |||| |||||| ||||| ||| | |||||||||||||| || |||||||| || |||||| Sbjct: 95 gatgtgcagcctaagatttacaggatgaagctctgggctacgaacgaggttcgtgccaag 154 Query: 180 tccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatg 239 |||||||||||||| ||| |||||||||||||||||||||||||| || || |||||| Sbjct: 155 tccaagttctggtatttcttgaggaagctcaagaaggtgaagaagagtaatggacagatg 214 Query: 240 ctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctgg 299 ||||||||||||||||||| |||||||||||| || || |||||||||| ||| || ||| Sbjct: 215 ctcgccatcaacgagatctatgagaagaacccaacaacgatcaagaacttcggtatttgg 274 Query: 300 ctgcgctaccagagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgact 359 || | |||||||| || || || |||||||||||||||||||||||||| ||||| ||| Sbjct: 275 ttgaggtaccagagtagaactgggtaccacaacatgtacaaggagtaccgtgacaccact 334 Query: 360 ctgaacggcggtttggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttcc 419 || ||||| | | | |||||||||||||| |||||||| || || ||||| || | | | Sbjct: 335 cttaacggagctgttgagcagatgtacactgagatggcatcccgtcaccgtgtcagattc 394 Query: 420 ccgtgcatccagatcatcaagactgcgacggtggacttcaagctgtgcaagagggacaac 479 || ||||| |||||||||||||| || || || ||||||||||||||| || | | Sbjct: 395 ccttgcattcagatcatcaagacagccactgtcccagccaagctgtgcaagagagagagc 454 Query: 480 acgaagcagttccacaactcgaagatcaagttccc 514 || || |||||||||||| |||||||||||||| Sbjct: 455 actaaacagttccacaacagcaagatcaagttccc 489
>emb|BX818907.1|CNS0A9RI Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB25ZH03 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 704 Score = 268 bits (135), Expect = 2e-68 Identities = 330/395 (83%) Strand = Plus / Plus Query: 120 gatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaag 179 |||| |||||| ||||| ||| | |||||||||||||| || |||||||| || |||||| Sbjct: 47 gatgtgcagcctaagatttacaggatgaagctctgggctacgaacgaggttcgtgccaag 106 Query: 180 tccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatg 239 |||||||||||||| ||| |||||||||||||||||||||||||| || || |||||| Sbjct: 107 tccaagttctggtatttcttgaggaagctcaagaaggtgaagaagagtaatggacagatg 166 Query: 240 ctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctgg 299 ||||||||||||||||||| |||||||||||| || || |||||||||| ||| || ||| Sbjct: 167 ctcgccatcaacgagatctatgagaagaacccaacaacgatcaagaacttcggtatttgg 226 Query: 300 ctgcgctaccagagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgact 359 || | |||||||| || || || |||||||||||||||||||||||||| ||||| ||| Sbjct: 227 ttgaggtaccagagtagaactgggtaccacaacatgtacaaggagtaccgtgacaccact 286 Query: 360 ctgaacggcggtttggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttcc 419 || ||||| | | | |||||||||||||| |||||||| || || ||||| || | | | Sbjct: 287 cttaacggagctgttgagcagatgtacactgagatggcatcccgtcaccgtgtcagattc 346 Query: 420 ccgtgcatccagatcatcaagactgcgacggtggacttcaagctgtgcaagagggacaac 479 || ||||| |||||||||||||| || || || ||||||||||||||| || | | Sbjct: 347 ccttgcattcagatcatcaagacagccactgtcccagccaagctgtgcaagagagagagc 406 Query: 480 acgaagcagttccacaactcgaagatcaagttccc 514 || || |||||||||||| |||||||||||||| Sbjct: 407 actaaacagttccacaacagcaagatcaagttccc 441
>gb|AC124143.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0053D02, complete sequence Length = 157106 Score = 264 bits (133), Expect = 3e-67 Identities = 238/273 (87%) Strand = Plus / Plus Query: 253 agatctttgagaagaacccgaccaccatcaagaactacggcatctggctgcgctaccaga 312 ||||||||||| ||||| || || |||||||||||||||||||||||||| ||||||| Sbjct: 129865 agatctttgagcgtaaccctacaacgatcaagaactacggcatctggctgcgttaccaga 129924 Query: 313 gcaggaccggttaccacaacatgtacaaggagtaccgcgacacgactctgaacggcggtt 372 |||| || ||||||||||||||||||||||| ||||| ||||| |||||||| || | | Sbjct: 129925 gcagaacaggttaccacaacatgtacaaggaataccgtgacactactctgaatggtgctg 129984 Query: 373 tggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttccccgtgcatccaga 432 |||||||||||||||| |||||||| || || ||||| ||| | | ||| ||||| |||| Sbjct: 129985 tggagcagatgtacaccgagatggcctctcgtcaccgtgtgaggttcccctgcattcaga 130044 Query: 433 tcatcaagactgcgacggtggacttcaagctgtgcaagagggacaacacgaagcagttcc 492 |||||||||| || || || |||||||||| ||||||||||||||||| |||||||||| Sbjct: 130045 tcatcaagaccgcaacagttcacttcaagctctgcaagagggacaacactaagcagttcc 130104 Query: 493 acaactcgaagatcaagttcccgctggtgtacc 525 |||||||||| |||||||||||||| ||||||| Sbjct: 130105 acaactcgaatatcaagttcccgctcgtgtacc 130137 Score = 204 bits (103), Expect = 3e-49 Identities = 115/119 (96%) Strand = Plus / Plus Query: 74 gttccaccagtaccaggtggtgggtcgcgcgctgccgaccccgggcgatgagcagcccaa 133 |||||| |||||||||||||||||||||||||| |||||||| ||||||||||| ||||| Sbjct: 128575 gttccatcagtaccaggtggtgggtcgcgcgctcccgacccccggcgatgagcaccccaa 128634 Query: 134 gatctaccgcatgaagctctgggccaccaacgaggtccgcgccaagtccaagttctggt 192 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 128635 gatctaccgcatgaagctctgggccaccaacgaggtccgcgccaagtccaagttctggt 128693 Score = 89.7 bits (45), Expect = 1e-14 Identities = 60/65 (92%) Strand = Plus / Plus Query: 190 ggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgccatca 249 ||||||||||||||||||| ||||||||||||||| ||| || |||||||||||||||| Sbjct: 128777 ggtacttcctgaggaagctgaagaaggtgaagaagagcaatggacagatgctcgccatca 128836 Query: 250 acgag 254 ||||| Sbjct: 128837 acgag 128841
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 264 bits (133), Expect = 3e-67 Identities = 238/273 (87%) Strand = Plus / Plus Query: 253 agatctttgagaagaacccgaccaccatcaagaactacggcatctggctgcgctaccaga 312 ||||||||||| ||||| || || |||||||||||||||||||||||||| ||||||| Sbjct: 27899448 agatctttgagcgtaaccctacaacgatcaagaactacggcatctggctgcgttaccaga 27899507 Query: 313 gcaggaccggttaccacaacatgtacaaggagtaccgcgacacgactctgaacggcggtt 372 |||| || ||||||||||||||||||||||| ||||| ||||| |||||||| || | | Sbjct: 27899508 gcagaacaggttaccacaacatgtacaaggaataccgtgacactactctgaatggtgctg 27899567 Query: 373 tggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttccccgtgcatccaga 432 |||||||||||||||| |||||||| || || ||||| ||| | | ||| ||||| |||| Sbjct: 27899568 tggagcagatgtacaccgagatggcctctcgtcaccgtgtgaggttcccctgcattcaga 27899627 Query: 433 tcatcaagactgcgacggtggacttcaagctgtgcaagagggacaacacgaagcagttcc 492 |||||||||| || || || |||||||||| ||||||||||||||||| |||||||||| Sbjct: 27899628 tcatcaagaccgcaacagttcacttcaagctctgcaagagggacaacactaagcagttcc 27899687 Query: 493 acaactcgaagatcaagttcccgctggtgtacc 525 |||||||||| |||||||||||||| ||||||| Sbjct: 27899688 acaactcgaatatcaagttcccgctcgtgtacc 27899720 Score = 204 bits (103), Expect = 3e-49 Identities = 115/119 (96%) Strand = Plus / Plus Query: 74 gttccaccagtaccaggtggtgggtcgcgcgctgccgaccccgggcgatgagcagcccaa 133 |||||| |||||||||||||||||||||||||| |||||||| ||||||||||| ||||| Sbjct: 27898158 gttccatcagtaccaggtggtgggtcgcgcgctcccgacccccggcgatgagcaccccaa 27898217 Query: 134 gatctaccgcatgaagctctgggccaccaacgaggtccgcgccaagtccaagttctggt 192 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 27898218 gatctaccgcatgaagctctgggccaccaacgaggtccgcgccaagtccaagttctggt 27898276 Score = 89.7 bits (45), Expect = 1e-14 Identities = 60/65 (92%) Strand = Plus / Plus Query: 190 ggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgccatca 249 ||||||||||||||||||| ||||||||||||||| ||| || |||||||||||||||| Sbjct: 27898360 ggtacttcctgaggaagctgaagaaggtgaagaagagcaatggacagatgctcgccatca 27898419 Query: 250 acgag 254 ||||| Sbjct: 27898420 acgag 27898424
>gb|BT006559.1| Arabidopsis thaliana At2g34480 gene, complete cds Length = 537 Score = 260 bits (131), Expect = 5e-66 Identities = 311/371 (83%) Strand = Plus / Plus Query: 144 atgaagctctgggccaccaacgaggtccgcgccaagtccaagttctggtacttcctgagg 203 |||||||||||||| || |||||||| || |||||||||||||||||||| ||| ||||| Sbjct: 85 atgaagctctgggctacgaacgaggttcgtgccaagtccaagttctggtatttcttgagg 144 Query: 204 aagctcaagaaggtgaagaaggccaacggccagatgctcgccatcaacgagatctttgag 263 ||||||||||||||||||||| || || ||||||||||||||||||||||||| |||| Sbjct: 145 aagctcaagaaggtgaagaagagtaatggacagatgctcgccatcaacgagatctatgag 204 Query: 264 aagaacccgaccaccatcaagaactacggcatctggctgcgctaccagagcaggaccggt 323 |||||||| || || |||||||||| ||| || ||| || | |||||||| || || || Sbjct: 205 aagaacccaacaacgatcaagaacttcggtatttggttgaggtaccagagtagaactggg 264 Query: 324 taccacaacatgtacaaggagtaccgcgacacgactctgaacggcggtttggagcagatg 383 |||||||||||||||||||||||||| ||||| ||||| ||||| | | | ||||||||| Sbjct: 265 taccacaacatgtacaaggagtaccgtgacaccactcttaacggagctgttgagcagatg 324 Query: 384 tacacggagatggcgtcgcggcaccgcgtgcgttccccgtgcatccagatcatcaagact 443 ||||| |||||||| || || ||||| || | | ||| ||||| |||||||||||||| Sbjct: 325 tacactgagatggcatcccgtcaccgtgtcagattcccttgcattcagatcatcaagaca 384 Query: 444 gcgacggtggacttcaagctgtgcaagagggacaacacgaagcagttccacaactcgaag 503 || || || ||||||||||||||| || | ||| || |||||||||||| ||| Sbjct: 385 gccactgtcccagccaagctgtgcaagagagagagcactaaacagttccacaacagcaag 444 Query: 504 atcaagttccc 514 ||||||||||| Sbjct: 445 atcaagttccc 455
>gb|AY042803.1| Arabidopsis thaliana Unknown protein mRNA, complete cds Length = 755 Score = 260 bits (131), Expect = 5e-66 Identities = 311/371 (83%) Strand = Plus / Plus Query: 144 atgaagctctgggccaccaacgaggtccgcgccaagtccaagttctggtacttcctgagg 203 |||||||||||||| || |||||||| || |||||||||||||||||||| ||| ||||| Sbjct: 120 atgaagctctgggctacgaacgaggttcgtgccaagtccaagttctggtatttcttgagg 179 Query: 204 aagctcaagaaggtgaagaaggccaacggccagatgctcgccatcaacgagatctttgag 263 ||||||||||||||||||||| || || ||||||||||||||||||||||||| |||| Sbjct: 180 aagctcaagaaggtgaagaagagtaatggacagatgctcgccatcaacgagatctatgag 239 Query: 264 aagaacccgaccaccatcaagaactacggcatctggctgcgctaccagagcaggaccggt 323 |||||||| || || |||||||||| ||| || ||| || | |||||||| || || || Sbjct: 240 aagaacccaacaacgatcaagaacttcggtatttggttgaggtaccagagtagaactggg 299 Query: 324 taccacaacatgtacaaggagtaccgcgacacgactctgaacggcggtttggagcagatg 383 |||||||||||||||||||||||||| ||||| ||||| ||||| | | | ||||||||| Sbjct: 300 taccacaacatgtacaaggagtaccgtgacaccactcttaacggagctgttgagcagatg 359 Query: 384 tacacggagatggcgtcgcggcaccgcgtgcgttccccgtgcatccagatcatcaagact 443 ||||| |||||||| || || ||||| || | | ||| ||||| |||||||||||||| Sbjct: 360 tacactgagatggcatcccgtcaccgtgtcagattcccttgcattcagatcatcaagaca 419 Query: 444 gcgacggtggacttcaagctgtgcaagagggacaacacgaagcagttccacaactcgaag 503 || || || ||||||||||||||| || | ||| || |||||||||||| ||| Sbjct: 420 gccactgtcccagccaagctgtgcaagagagagagcactaaacagttccacaacagcaag 479 Query: 504 atcaagttccc 514 ||||||||||| Sbjct: 480 atcaagttccc 490
>dbj|D21301.1|RICSS128 Oryza sativa SS128 mRNA for ribosomal protein L18a, partial sequence Length = 380 Score = 254 bits (128), Expect = 3e-64 Identities = 217/247 (87%) Strand = Plus / Plus Query: 279 atcaagaactacggcatctggctgcgctaccagagcaggaccggttaccacaacatgtac 338 ||||||||||||||||||||| |||| ||||||||||| || |||||||||||||||||| Sbjct: 16 atcaagaactacggcatctggntgcgttaccagagcagaacaggttaccacaacatgtac 75 Query: 339 aaggagtaccgcgacacgactctgaacggcggtttggagcagatgtacacggagatggcg 398 ||||| ||||| ||||| |||||||| || | | |||||||||||||||| |||||||| Sbjct: 76 aaggaataccgtgacactactctgaatggtgctgtggagcagatgtacaccgagatggcc 135 Query: 399 tcgcggcaccgcgtgcgttccccgtgcatccagatcatcaagactgcgacggtggacttc 458 || || ||||| ||| | | ||| ||||| |||||||||||||| || || || ||||| Sbjct: 136 tctcgtcaccgtgtgaggttcccctgcattcagatcatcaagaccgcaacagttcacttc 195 Query: 459 aagctgtgcaagagggacaacacgaagcagttccacaactcgaagatcaagttcccgctg 518 ||||| ||||||||||||||||| |||||||||||||||||||| |||||||||||||| Sbjct: 196 aagctctgcaagagggacaacactaagcagttccacaactcgaatatcaagttcccgctc 255 Query: 519 gtgtacc 525 ||||||| Sbjct: 256 gtgtacc 262
>ref|NM_112321.2| Arabidopsis thaliana structural constituent of ribosome AT3G14600 mRNA, complete cds Length = 853 Score = 248 bits (125), Expect = 2e-62 Identities = 331/397 (83%), Gaps = 2/397 (0%) Strand = Plus / Plus Query: 119 cgatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaa 178 ||||||||| || ||||||||| | |||||||| |||| | || || || ||||||| Sbjct: 136 cgatgagcaccctaagatctacaggatgaagctttggggtagaaatgaagtatgcgccaa 195 Query: 179 gtccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagat 238 ||||||||||||||||||| ||||||| || |||||||||||||| |||||| ||||| Sbjct: 196 gtccaagttctggtacttcatgaggaaactgaagaaggtgaagaaaagcaacggacagat 255 Query: 239 gctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctg 298 ||| |||||||| ||||| || ||||||||||| || ||||||||||||||||| ||||| Sbjct: 256 gcttgccatcaatgagattttcgagaagaacccaacgaccatcaagaactacgggatctg 315 Query: 299 gctgcgctaccagagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgac 358 | |||| || |||||| | || || |||||||||||||||||||||||||| ||||| || Sbjct: 316 gttgcgttatcagagccgaactgggtaccacaacatgtacaaggagtaccgtgacacaac 375 Query: 359 tctgaacggcggtttggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttc 418 || || || || |||||||||||||||| |||||||| || || || | ||| | | Sbjct: 376 actcaatggtggagtggagcagatgtacactgagatggcttctcgtcatagagtgaggtt 435 Query: 419 cccgtgcatccagatcatcaagactgcgacggtggacttc-aagctgtgcaagagggaca 477 ||| ||||| |||||||||||||||||||| || || | ||||| |||||||| || | Sbjct: 436 cccttgcattcagatcatcaagactgcgactgt-ccctgcaaagctttgcaagagagaga 494 Query: 478 acacgaagcagttccacaactcgaagatcaagttccc 514 ||| ||||||||||| |||||||||||||||||||| Sbjct: 495 tcaccaagcagttccataactcgaagatcaagttccc 531
>gb|AY097377.1| Arabidopsis thaliana AT3g14600/MIE1_10 mRNA, complete cds Length = 537 Score = 248 bits (125), Expect = 2e-62 Identities = 331/397 (83%), Gaps = 2/397 (0%) Strand = Plus / Plus Query: 119 cgatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaa 178 ||||||||| || ||||||||| | |||||||| |||| | || || || ||||||| Sbjct: 60 cgatgagcaccctaagatctacaggatgaagctttggggtagaaatgaagtatgcgccaa 119 Query: 179 gtccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagat 238 ||||||||||||||||||| ||||||| || |||||||||||||| |||||| ||||| Sbjct: 120 gtccaagttctggtacttcatgaggaaactgaagaaggtgaagaaaagcaacggacagat 179 Query: 239 gctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctg 298 ||| |||||||| ||||| || ||||||||||| || ||||||||||||||||| ||||| Sbjct: 180 gcttgccatcaatgagattttcgagaagaacccaacgaccatcaagaactacgggatctg 239 Query: 299 gctgcgctaccagagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgac 358 | |||| || |||||| | || || |||||||||||||||||||||||||| ||||| || Sbjct: 240 gttgcgttatcagagccgaactgggtaccacaacatgtacaaggagtaccgtgacacaac 299 Query: 359 tctgaacggcggtttggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttc 418 || || || || |||||||||||||||| |||||||| || || || | ||| | | Sbjct: 300 actcaatggtggagtggagcagatgtacactgagatggcttctcgtcatagagtgaggtt 359 Query: 419 cccgtgcatccagatcatcaagactgcgacggtggacttc-aagctgtgcaagagggaca 477 ||| ||||| |||||||||||||||||||| || || | ||||| |||||||| || | Sbjct: 360 cccttgcattcagatcatcaagactgcgactgt-ccctgcaaagctttgcaagagagaga 418 Query: 478 acacgaagcagttccacaactcgaagatcaagttccc 514 ||| ||||||||||| |||||||||||||||||||| Sbjct: 419 tcaccaagcagttccataactcgaagatcaagttccc 455
>gb|AY072540.1| Arabidopsis thaliana AT3g14600/MIE1_10 mRNA, complete cds Length = 829 Score = 248 bits (125), Expect = 2e-62 Identities = 331/397 (83%), Gaps = 2/397 (0%) Strand = Plus / Plus Query: 119 cgatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaa 178 ||||||||| || ||||||||| | |||||||| |||| | || || || ||||||| Sbjct: 111 cgatgagcaccctaagatctacaggatgaagctttggggtagaaatgaagtatgcgccaa 170 Query: 179 gtccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagat 238 ||||||||||||||||||| ||||||| || |||||||||||||| |||||| ||||| Sbjct: 171 gtccaagttctggtacttcatgaggaaactgaagaaggtgaagaaaagcaacggacagat 230 Query: 239 gctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctg 298 ||| |||||||| ||||| || ||||||||||| || ||||||||||||||||| ||||| Sbjct: 231 gcttgccatcaatgagattttcgagaagaacccaacgaccatcaagaactacgggatctg 290 Query: 299 gctgcgctaccagagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgac 358 | |||| || |||||| | || || |||||||||||||||||||||||||| ||||| || Sbjct: 291 gttgcgttatcagagccgaactgggtaccacaacatgtacaaggagtaccgtgacacaac 350 Query: 359 tctgaacggcggtttggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttc 418 || || || || |||||||||||||||| |||||||| || || || | ||| | | Sbjct: 351 actcaatggtggagtggagcagatgtacactgagatggcttctcgtcatagagtgaggtt 410 Query: 419 cccgtgcatccagatcatcaagactgcgacggtggacttc-aagctgtgcaagagggaca 477 ||| ||||| |||||||||||||||||||| || || | ||||| |||||||| || | Sbjct: 411 cccttgcattcagatcatcaagactgcgactgt-ccctgcaaagctttgcaagagagaga 469 Query: 478 acacgaagcagttccacaactcgaagatcaagttccc 514 ||| ||||||||||| |||||||||||||||||||| Sbjct: 470 tcaccaagcagttccataactcgaagatcaagttccc 506
>emb|BX819594.1|CNS0A9TR Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB92ZG02 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 711 Score = 234 bits (118), Expect = 3e-58 Identities = 325/394 (82%) Strand = Plus / Plus Query: 120 gatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaag 179 |||| |||||| ||||| ||| | |||||||||||||| || |||||||| || |||||| Sbjct: 97 gatgtgcagcctaagatttacaggatgaagctctgggctacgaacgaggttcgtgccaag 156 Query: 180 tccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatg 239 |||||||||||||| ||| |||||||||||||||||||||||||| || || ||||| Sbjct: 157 tccaagttctggtatttcttgaggaagctcaagaaggtgaagaagagtaatggaaagatg 216 Query: 240 ctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctgg 299 ||||||||||||||||||| |||||||||||| || || |||||||||| ||| || ||| Sbjct: 217 ctcgccatcaacgagatctatgagaagaacccaacaacgatcaagaacttcggtatttgg 276 Query: 300 ctgcgctaccagagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgact 359 || | |||||||| || || || |||||||||||||||||||||||||| |||| ||| Sbjct: 277 ttgaggtaccagagtagaactgggtaccacaacatgtacaaggagtaccgttacaccact 336 Query: 360 ctgaacggcggtttggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttcc 419 || ||||| | | | ||||||||||| || |||||||| || || |||| || | | | Sbjct: 337 cttaacggtgctgttgagcagatgtatactgagatggcatcccgtcaccttgtaagattc 396 Query: 420 ccgtgcatccagatcatcaagactgcgacggtggacttcaagctgtgcaagagggacaac 479 || ||||| |||||||||||||| || || || ||||||||||||||| || | | Sbjct: 397 ccttgcattcagatcatcaagacagcaactgtcccagccaagctgtgcaagagagagagc 456 Query: 480 acgaagcagttccacaactcgaagatcaagttcc 513 || || |||||||||||| ||||||||||||| Sbjct: 457 actaaacagttccacaacagcaagatcaagttcc 490
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 220 bits (111), Expect = 4e-54 Identities = 222/259 (85%) Strand = Plus / Minus Query: 267 aacccgaccaccatcaagaactacggcatctggctgcgctaccagagcaggaccggttac 326 ||||| ||||| ||||||||||| |||||||||||||| ||||||||||| ||||||||| Sbjct: 27260428 aacccaaccacgatcaagaactatggcatctggctgcgttaccagagcagaaccggttac 27260369 Query: 327 cacaacatgtacaaggagtaccgcgacacgactctgaacggcggtttggagcagatgtac 386 ||||||||||||||||||||||| ||||| || |||| || | |||| ||||||||| Sbjct: 27260368 cacaacatgtacaaggagtaccgtgacactacattgaatggtgccgtggaacagatgtac 27260309 Query: 387 acggagatggcgtcgcggcaccgcgtgcgttccccgtgcatccagatcatcaagactgcg 446 || |||||||| || || ||||| ||| | | ||| |||||||||||||||||||| || Sbjct: 27260308 accgagatggcttctcgccaccgtgtgagattcccttgcatccagatcatcaagaccgcc 27260249 Query: 447 acggtggacttcaagctgtgcaagagggacaacacgaagcagttccacaactcgaagatc 506 || || |||||||||| ||||||||||||||||| ||||||||||||||| || ||| Sbjct: 27260248 actgtccacttcaagctctgcaagagggacaacaccaagcagttccacaacgggagcatc 27260189 Query: 507 aagttcccgctggtgtacc 525 |||||||| || ||||||| Sbjct: 27260188 aagttcccccttgtgtacc 27260170 Score = 174 bits (88), Expect = 2e-40 Identities = 226/272 (83%) Strand = Plus / Minus Query: 253 agatctttgagaagaacccgaccaccatcaagaactacggcatctggctgcgctaccaga 312 |||| |||||||||||||| || || ||||||||||| |||||||||||||| ||||||| Sbjct: 31553090 agatttttgagaagaacccaacaactatcaagaactatggcatctggctgcgttaccaga 31553031 Query: 313 gcaggaccggttaccacaacatgtacaaggagtaccgcgacacgactctgaacggcggtt 372 | ||||| || |||||||||||||||||||||||||| || || || || || || | Sbjct: 31553030 gtaggactggctaccacaacatgtacaaggagtaccgtgataccaccctcaatggtgccg 31552971 Query: 373 tggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttccccgtgcatccaga 432 | |||||||||||||| |||||||| || || ||||| || | | ||| ||||| |||| Sbjct: 31552970 ttgagcagatgtacactgagatggcttcccgccaccgtgtcagattcccttgcattcaga 31552911 Query: 433 tcatcaagactgcgacggtggacttcaagctgtgcaagagggacaacacgaagcagttcc 492 ||||||||||||| || || |||| || || |||||| | |||||||| |||||||||| Sbjct: 31552910 tcatcaagactgctactgtccactttaaactctgcaagcgtgacaacactaagcagttcc 31552851 Query: 493 acaactcgaagatcaagttcccgctggtgtac 524 |||| || | ||||||||||| ||||||||| Sbjct: 31552850 acaagtcagatatcaagttcccactggtgtac 31552819 Score = 172 bits (87), Expect = 9e-40 Identities = 111/119 (93%) Strand = Plus / Minus Query: 74 gttccaccagtaccaggtggtgggtcgcgcgctgccgaccccgggcgatgagcagcccaa 133 |||||| ||||||||||||||||| ||||||||||||||||| ||||||||||| ||||| Sbjct: 27261519 gttccatcagtaccaggtggtggggcgcgcgctgccgacccccggcgatgagcaccccaa 27261460 Query: 134 gatctaccgcatgaagctctgggccaccaacgaggtccgcgccaagtccaagttctggt 192 ||||||||| |||||||||||||||||||| ||||||||||||||| ||||||||||| Sbjct: 27261459 gatctaccggatgaagctctgggccaccaatgaggtccgcgccaagagcaagttctggt 27261401 Score = 149 bits (75), Expect = 1e-32 Identities = 108/119 (90%) Strand = Plus / Minus Query: 74 gttccaccagtaccaggtggtgggtcgcgcgctgccgaccccgggcgatgagcagcccaa 133 |||||||||||||||||||||||| | | |||||||| ||| ||| ||||| ||||| Sbjct: 31553859 gttccaccagtaccaggtggtggggaggggcctgccgacgccgaccgacgagcaccccaa 31553800 Query: 134 gatctaccgcatgaagctctgggccaccaacgaggtccgcgccaagtccaagttctggt 192 |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Sbjct: 31553799 gatctaccgcatgaagctctgggctaccaacgaggtccgcgccaagtccaagttctggt 31553741 Score = 105 bits (53), Expect = 2e-19 Identities = 62/65 (95%) Strand = Plus / Minus Query: 190 ggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgccatca 249 ||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| Sbjct: 27261300 ggtacttcctgaggaagctgaagaaggtgaagaagagcaacggccagatgctcgccatca 27261241 Query: 250 acgag 254 ||||| Sbjct: 27261240 acgag 27261236 Score = 58.0 bits (29), Expect = 4e-05 Identities = 56/65 (86%) Strand = Plus / Minus Query: 190 ggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgccatca 249 |||||||||| | ||||| ||||||||||||||| |||||| ||||| || ||||||| Sbjct: 31553647 ggtacttcctccgcaagctgaagaaggtgaagaagagcaacgggcagatccttgccatca 31553588 Query: 250 acgag 254 ||||| Sbjct: 31553587 acgag 31553583
>dbj|AP003760.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJNBb0063G05 Length = 182681 Score = 220 bits (111), Expect = 4e-54 Identities = 222/259 (85%) Strand = Plus / Minus Query: 267 aacccgaccaccatcaagaactacggcatctggctgcgctaccagagcaggaccggttac 326 ||||| ||||| ||||||||||| |||||||||||||| ||||||||||| ||||||||| Sbjct: 40945 aacccaaccacgatcaagaactatggcatctggctgcgttaccagagcagaaccggttac 40886 Query: 327 cacaacatgtacaaggagtaccgcgacacgactctgaacggcggtttggagcagatgtac 386 ||||||||||||||||||||||| ||||| || |||| || | |||| ||||||||| Sbjct: 40885 cacaacatgtacaaggagtaccgtgacactacattgaatggtgccgtggaacagatgtac 40826 Query: 387 acggagatggcgtcgcggcaccgcgtgcgttccccgtgcatccagatcatcaagactgcg 446 || |||||||| || || ||||| ||| | | ||| |||||||||||||||||||| || Sbjct: 40825 accgagatggcttctcgccaccgtgtgagattcccttgcatccagatcatcaagaccgcc 40766 Query: 447 acggtggacttcaagctgtgcaagagggacaacacgaagcagttccacaactcgaagatc 506 || || |||||||||| ||||||||||||||||| ||||||||||||||| || ||| Sbjct: 40765 actgtccacttcaagctctgcaagagggacaacaccaagcagttccacaacgggagcatc 40706 Query: 507 aagttcccgctggtgtacc 525 |||||||| || ||||||| Sbjct: 40705 aagttcccccttgtgtacc 40687 Score = 172 bits (87), Expect = 9e-40 Identities = 111/119 (93%) Strand = Plus / Minus Query: 74 gttccaccagtaccaggtggtgggtcgcgcgctgccgaccccgggcgatgagcagcccaa 133 |||||| ||||||||||||||||| ||||||||||||||||| ||||||||||| ||||| Sbjct: 42036 gttccatcagtaccaggtggtggggcgcgcgctgccgacccccggcgatgagcaccccaa 41977 Query: 134 gatctaccgcatgaagctctgggccaccaacgaggtccgcgccaagtccaagttctggt 192 ||||||||| |||||||||||||||||||| ||||||||||||||| ||||||||||| Sbjct: 41976 gatctaccggatgaagctctgggccaccaatgaggtccgcgccaagagcaagttctggt 41918 Score = 105 bits (53), Expect = 2e-19 Identities = 62/65 (95%) Strand = Plus / Minus Query: 190 ggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgccatca 249 ||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| Sbjct: 41817 ggtacttcctgaggaagctgaagaaggtgaagaagagcaacggccagatgctcgccatca 41758 Query: 250 acgag 254 ||||| Sbjct: 41757 acgag 41753
>gb|AY088351.1| Arabidopsis thaliana clone 5961 mRNA, complete sequence Length = 767 Score = 214 bits (108), Expect = 3e-52 Identities = 287/344 (83%), Gaps = 2/344 (0%) Strand = Plus / Plus Query: 172 gcgccaagtccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacg 231 |||||||||||||||||||||||||| |||| || || |||||||||||||| ||||| Sbjct: 189 gcgccaagtccaagttctggtacttcatgagaaaactgaagaaggtgaagaaaagcaacg 248 Query: 232 gccagatgctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaactacg 291 | |||||||| |||||||| ||||| || ||||||||||| || || |||||||| |||| Sbjct: 249 ggcagatgcttgccatcaatgagattttcgagaagaacccaacgacaatcaagaattacg 308 Query: 292 gcatctggctgcgctaccagagcaggaccggttaccacaacatgtacaaggagtaccgcg 351 | |||||| |||| || |||||| | || || |||||||||||||||||||||||||| | Sbjct: 309 ggatctggttgcgttatcagagccgaactgggtaccacaacatgtacaaggagtaccgtg 368 Query: 352 acacgactctgaacggcggtttggagcagatgtacacggagatggcgtcgcggcaccgcg 411 |||| || || || || || |||||||||||||||| ||||| || || || || | | Sbjct: 369 acacaacactcaatggtggagtggagcagatgtacactgagattgcttctcgtcatagag 428 Query: 412 tgcgttccccgtgcatccagatcatcaagactgcgacggtggacttc-aagctgtgcaag 470 || | | ||| ||||| |||||||||||||||||||| || || | ||||| |||||| Sbjct: 429 tgaggttcccttgcattcagatcatcaagactgcgactgt-ccctgcaaagctttgcaag 487 Query: 471 agggacaacacgaagcagttccacaactcgaagatcaagttccc 514 || || | ||| ||||||||||| |||||||||||||||||||| Sbjct: 488 agagagatcaccaagcagttccataactcgaagatcaagttccc 531
>gb|AY389632.1| Hyacinthus orientalis ribosomal protein L18A (RPL18) mRNA, complete cds Length = 710 Score = 206 bits (104), Expect = 7e-50 Identities = 402/501 (80%), Gaps = 2/501 (0%) Strand = Plus / Plus Query: 72 aggttccaccagtaccaggtggtgggtcgcgcgctgccgaccccgggcgatgagcagccc 131 ||||| || ||||| ||||| ||||| || || ||||| ||||| ||||||||| || Sbjct: 19 aggtttcatcagtatcaggttgtgggccgggcactgccaaccccctccgatgagcacccg 78 Query: 132 aagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaagtccaagttctgg 191 ||||||| |||||||||||| ||||| |||||||| || || |||||||||||||| ||| Sbjct: 79 aagatcttccgcatgaagctttgggcaaccaacgaagttcgggccaagtccaagttttgg 138 Query: 192 tacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgccatcaac 251 || |||||||||||||| ||||| ||||||||| || ||||| | || || |||||| Sbjct: 139 tatttcctgaggaagctgaagaaagtgaagaagagtaatggccaagttcttgctatcaac 198 Query: 252 gagatctttgagaagaacccgaccaccatca-agaactacggcatctggctgcgctacca 310 ||||| |||||||||||||| |||| || | ||||||||||||| |||||| | ||||| Sbjct: 199 gagatatttgagaagaaccccaccaaaataatagaactacggcatatggctgaggtacca 258 Query: 311 gagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgactctgaacggcgg 370 |||||| ||||| || || ||||||||||||||||| | ||||| || ||||| || || Sbjct: 259 gagcagaaccggctatca-tacatgtacaaggagtacagggacaccaccctgaatggagg 317 Query: 371 tttggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttccccgtgcatcca 430 |||||||||||||||| || ||||| || || ||| | || | | ||| |||||||| Sbjct: 318 agtggagcagatgtacactgaaatggcatcacgccacagggttaggttcccatgcatcca 377 Query: 431 gatcatcaagactgcgacggtggacttcaagctgtgcaagagggacaacacgaagcagtt 490 |||||||||||| || || | | |||||| |||||| | || | ||| |||||||| Sbjct: 378 gatcatcaagacggccaccatccccgccaagctctgcaagcgcgagagcaccaagcagtt 437 Query: 491 ccacaactcgaagatcaagttcccgctggtgtaccagaaggtgcgnnnnnnnacccgcaa 550 ||| ||||||||||||| ||||| || |||| | ||||||| || ||| | || Sbjct: 438 ccatgactcgaagatcaaattccccctcgtgttcaagaaggtccggccgcccaccaggaa 497 Query: 551 gctcaagaccacctacaaggc 571 |||||||||||||| |||||| Sbjct: 498 gctcaagaccaccttcaaggc 518
>gb|DQ235171.1| Solanum tuberosum clone 155B02 unknown mRNA Length = 722 Score = 188 bits (95), Expect = 2e-44 Identities = 233/279 (83%) Strand = Plus / Plus Query: 119 cgatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaa 178 ||||||||| || ||||| ||||| ||||| |||||||| || || |||||||| ||||| Sbjct: 78 cgatgagcacccaaagatttaccgtatgaaactctgggctacaaatgaggtccgtgccaa 137 Query: 179 gtccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagat 238 ||||||||||||||||||| |||||||||| ||||||||||||||| ||| || ||||| Sbjct: 138 gtccaagttctggtacttcttgaggaagctaaagaaggtgaagaagagcaatggtcagat 197 Query: 239 gctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctg 298 ||| || ||||| ||||| |||||||| |||| || | ||||||||||| || || || Sbjct: 198 gctagctatcaatgagatttttgagaaatacccaacaaaaatcaagaactatggtatttg 257 Query: 299 gctgcgctaccagagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgac 358 |||||| ||||| || ||||| || || || |||||||||||||||||||| ||||| || Sbjct: 258 gctgcgttaccaaagtaggactgggtatcataacatgtacaaggagtaccgtgacaccac 317 Query: 359 tctgaacggcggtttggagcagatgtacacggagatggc 397 |||| || ||| | || ||||||||||| || ||||| Sbjct: 318 attgaatggtggtgtagaacagatgtacactgaaatggc 356 Score = 48.1 bits (24), Expect = 0.037 Identities = 54/64 (84%) Strand = Plus / Plus Query: 459 aagctgtgcaagagggacaacacgaagcagttccacaactcgaagatcaagttcccgctg 518 ||||| |||||| |||| | ||| ||||||||||| |||| || |||||||||||| || Sbjct: 418 aagctctgcaagcgggagagcacaaagcagttccatgactccaaaatcaagttcccgttg 477 Query: 519 gtgt 522 |||| Sbjct: 478 gtgt 481
>gb|DQ200390.1| Solanum tuberosum clone 067G06 unknown mRNA Length = 779 Score = 178 bits (90), Expect = 2e-41 Identities = 231/278 (83%) Strand = Plus / Plus Query: 120 gatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaag 179 |||||||| |||||||| || || |||||| | ||||| || || || || || || ||| Sbjct: 79 gatgagcatcccaagatttatcgtatgaagttgtgggctacaaatgaagttcgtgctaag 138 Query: 180 tccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatg 239 ||||| |||||||| ||| |||||||||| ||||||||||||||| |||||| |||||| Sbjct: 139 tccaaattctggtatttcttgaggaagcttaagaaggtgaagaagagcaacggtcagatg 198 Query: 240 ctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctgg 299 || || || || |||||||| ||||||||||| || || |||||||| || || || ||| Sbjct: 199 ctggctattaatgagatcttcgagaagaacccaacaacaatcaagaattatggtatttgg 258 Query: 300 ctgcgctaccagagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgact 359 || || ||||| || || || || |||||||||||||||||||||||||| ||||| || Sbjct: 259 ctccgttaccaaagtagaactggataccacaacatgtacaaggagtaccgtgacaccaca 318 Query: 360 ctgaacggcggtttggagcagatgtacacggagatggc 397 |||| || ||| |||||||||||||||| |||||||| Sbjct: 319 ttgaatggtggtgtggagcagatgtacactgagatggc 356 Score = 71.9 bits (36), Expect = 3e-09 Identities = 57/64 (89%) Strand = Plus / Plus Query: 459 aagctgtgcaagagggacaacacgaagcagttccacaactcgaagatcaagttcccgctg 518 ||||||||||||||||| | ||| ||||||||||| |||| ||||||||||||||| || Sbjct: 418 aagctgtgcaagagggagagcactaagcagttccatgactccaagatcaagttcccgttg 477 Query: 519 gtgt 522 |||| Sbjct: 478 gtgt 481
>dbj|AP003249.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0435B05 Length = 150997 Score = 174 bits (88), Expect = 2e-40 Identities = 226/272 (83%) Strand = Plus / Minus Query: 253 agatctttgagaagaacccgaccaccatcaagaactacggcatctggctgcgctaccaga 312 |||| |||||||||||||| || || ||||||||||| |||||||||||||| ||||||| Sbjct: 66113 agatttttgagaagaacccaacaactatcaagaactatggcatctggctgcgttaccaga 66054 Query: 313 gcaggaccggttaccacaacatgtacaaggagtaccgcgacacgactctgaacggcggtt 372 | ||||| || |||||||||||||||||||||||||| || || || || || || | Sbjct: 66053 gtaggactggctaccacaacatgtacaaggagtaccgtgataccaccctcaatggtgccg 65994 Query: 373 tggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttccccgtgcatccaga 432 | |||||||||||||| |||||||| || || ||||| || | | ||| ||||| |||| Sbjct: 65993 ttgagcagatgtacactgagatggcttcccgccaccgtgtcagattcccttgcattcaga 65934 Query: 433 tcatcaagactgcgacggtggacttcaagctgtgcaagagggacaacacgaagcagttcc 492 ||||||||||||| || || |||| || || |||||| | |||||||| |||||||||| Sbjct: 65933 tcatcaagactgctactgtccactttaaactctgcaagcgtgacaacactaagcagttcc 65874 Query: 493 acaactcgaagatcaagttcccgctggtgtac 524 |||| || | ||||||||||| ||||||||| Sbjct: 65873 acaagtcagatatcaagttcccactggtgtac 65842 Score = 149 bits (75), Expect = 1e-32 Identities = 108/119 (90%) Strand = Plus / Minus Query: 74 gttccaccagtaccaggtggtgggtcgcgcgctgccgaccccgggcgatgagcagcccaa 133 |||||||||||||||||||||||| | | |||||||| ||| ||| ||||| ||||| Sbjct: 66882 gttccaccagtaccaggtggtggggaggggcctgccgacgccgaccgacgagcaccccaa 66823 Query: 134 gatctaccgcatgaagctctgggccaccaacgaggtccgcgccaagtccaagttctggt 192 |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Sbjct: 66822 gatctaccgcatgaagctctgggctaccaacgaggtccgcgccaagtccaagttctggt 66764 Score = 58.0 bits (29), Expect = 4e-05 Identities = 56/65 (86%) Strand = Plus / Minus Query: 190 ggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgccatca 249 |||||||||| | ||||| ||||||||||||||| |||||| ||||| || ||||||| Sbjct: 66670 ggtacttcctccgcaagctgaagaaggtgaagaagagcaacgggcagatccttgccatca 66611 Query: 250 acgag 254 ||||| Sbjct: 66610 acgag 66606
>dbj|AP003237.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0046E05 Length = 162776 Score = 174 bits (88), Expect = 2e-40 Identities = 226/272 (83%) Strand = Plus / Minus Query: 253 agatctttgagaagaacccgaccaccatcaagaactacggcatctggctgcgctaccaga 312 |||| |||||||||||||| || || ||||||||||| |||||||||||||| ||||||| Sbjct: 147154 agatttttgagaagaacccaacaactatcaagaactatggcatctggctgcgttaccaga 147095 Query: 313 gcaggaccggttaccacaacatgtacaaggagtaccgcgacacgactctgaacggcggtt 372 | ||||| || |||||||||||||||||||||||||| || || || || || || | Sbjct: 147094 gtaggactggctaccacaacatgtacaaggagtaccgtgataccaccctcaatggtgccg 147035 Query: 373 tggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttccccgtgcatccaga 432 | |||||||||||||| |||||||| || || ||||| || | | ||| ||||| |||| Sbjct: 147034 ttgagcagatgtacactgagatggcttcccgccaccgtgtcagattcccttgcattcaga 146975 Query: 433 tcatcaagactgcgacggtggacttcaagctgtgcaagagggacaacacgaagcagttcc 492 ||||||||||||| || || |||| || || |||||| | |||||||| |||||||||| Sbjct: 146974 tcatcaagactgctactgtccactttaaactctgcaagcgtgacaacactaagcagttcc 146915 Query: 493 acaactcgaagatcaagttcccgctggtgtac 524 |||| || | ||||||||||| ||||||||| Sbjct: 146914 acaagtcagatatcaagttcccactggtgtac 146883 Score = 149 bits (75), Expect = 1e-32 Identities = 108/119 (90%) Strand = Plus / Minus Query: 74 gttccaccagtaccaggtggtgggtcgcgcgctgccgaccccgggcgatgagcagcccaa 133 |||||||||||||||||||||||| | | |||||||| ||| ||| ||||| ||||| Sbjct: 147923 gttccaccagtaccaggtggtggggaggggcctgccgacgccgaccgacgagcaccccaa 147864 Query: 134 gatctaccgcatgaagctctgggccaccaacgaggtccgcgccaagtccaagttctggt 192 |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Sbjct: 147863 gatctaccgcatgaagctctgggctaccaacgaggtccgcgccaagtccaagttctggt 147805 Score = 58.0 bits (29), Expect = 4e-05 Identities = 56/65 (86%) Strand = Plus / Minus Query: 190 ggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgccatca 249 |||||||||| | ||||| ||||||||||||||| |||||| ||||| || ||||||| Sbjct: 147711 ggtacttcctccgcaagctgaagaaggtgaagaagagcaacgggcagatccttgccatca 147652 Query: 250 acgag 254 ||||| Sbjct: 147651 acgag 147647
>gb|DQ235168.1| Solanum tuberosum clone 154B10 unknown mRNA Length = 904 Score = 172 bits (87), Expect = 9e-40 Identities = 195/231 (84%) Strand = Plus / Plus Query: 119 cgatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaa 178 |||||| || || |||||||| |||||||| || ||||| ||||| |||||||| || || Sbjct: 105 cgatgaacacccaaagatctatcgcatgaaactttgggctaccaatgaggtccgtgcgaa 164 Query: 179 gtccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagat 238 ||||||||||||||||| |||||||||| |||||||| |||||| |||||| ||||| Sbjct: 165 atccaagttctggtactttttgaggaagctgaagaaggttaagaagagcaacgggcagat 224 Query: 239 gctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctg 298 ||| || || || ||||||||||||||| |||| || | ||||||||||||||||| || Sbjct: 225 gcttgctattaatgagatctttgagaagtaccctactaaaatcaagaactacggcatttg 284 Query: 299 gctgcgctaccagagcaggaccggttaccacaacatgtacaaggagtaccg 349 | |||| || ||||| | || || |||||||||||||||||||||||||| Sbjct: 285 gttgcgttatcagagtcgcactgggtaccacaacatgtacaaggagtaccg 335 Score = 50.1 bits (25), Expect = 0.009 Identities = 46/53 (86%) Strand = Plus / Plus Query: 462 ctgtgcaagagggacaacacgaagcagttccacaactcgaagatcaagttccc 514 |||||||||||||| | ||| ||||||||||| |||| || ||||||||||| Sbjct: 448 ctgtgcaagagggagagcaccaagcagttccatgactccaaaatcaagttccc 500
>ref|NM_179398.1| Arabidopsis thaliana structural constituent of ribosome AT1G29965 mRNA, complete cds Length = 774 Score = 168 bits (85), Expect = 1e-38 Identities = 232/281 (82%) Strand = Plus / Plus Query: 120 gatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaag 179 |||||||| || ||||| ||| | |||||||| ||||| || |||||||| | ||||| Sbjct: 150 gatgagcaaccaaagatttacaggatgaagctatgggcaacgaacgaggttcttgccaaa 209 Query: 180 tccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatg 239 |||||||||||||||| | | |||| || ||||||||||||||| || || |||||| Sbjct: 210 tccaagttctggtactacttaaggaggcaaaagaaggtgaagaagagtaatggacagatg 269 Query: 240 ctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctgg 299 || ||||||||||||||||||||||||||||| || || |||||||| | || |||||| Sbjct: 270 ctagccatcaacgagatctttgagaagaacccaacaacgatcaagaattttggaatctgg 329 Query: 300 ctgcgctaccagagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgact 359 || | ||||||||| | || |||||||| ||||||||||| |||||||| ||||| ||| Sbjct: 330 ttgagataccagagccgtacaggttaccataacatgtacaaagagtaccgtgacactact 389 Query: 360 ctgaacggcggtttggagcagatgtacacggagatggcgtc 400 |||| || | ||||||| |||||||| ||||||||||| Sbjct: 390 ttgaatggagcagtggagcaaatgtacactgagatggcgtc 430 Score = 56.0 bits (28), Expect = 2e-04 Identities = 49/56 (87%) Strand = Plus / Plus Query: 465 tgcaagagggacaacacgaagcagttccacaactcgaagatcaagttcccgctggt 520 ||||||||||| | |||||||||||| |||||| ||||||||||||||| |||| Sbjct: 495 tgcaagagggaaagcacgaagcagtttcacaacagcaagatcaagttcccgttggt 550
>gb|BT000059.1| Arabidopsis thaliana 60S ribosomal protein L18A, putative (At1g29970) mRNA, complete cds Length = 633 Score = 168 bits (85), Expect = 1e-38 Identities = 232/281 (82%) Strand = Plus / Plus Query: 120 gatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaag 179 |||||||| || ||||| ||| | |||||||| ||||| || |||||||| | ||||| Sbjct: 61 gatgagcaaccaaagatttacaggatgaagctatgggcaacgaacgaggttcttgccaaa 120 Query: 180 tccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatg 239 |||||||||||||||| | | |||| || ||||||||||||||| || || |||||| Sbjct: 121 tccaagttctggtactacttaaggaggcaaaagaaggtgaagaagagtaatggacagatg 180 Query: 240 ctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctgg 299 || ||||||||||||||||||||||||||||| || || |||||||| | || |||||| Sbjct: 181 ctagccatcaacgagatctttgagaagaacccaacaacgatcaagaattttggaatctgg 240 Query: 300 ctgcgctaccagagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgact 359 || | ||||||||| | || |||||||| ||||||||||| |||||||| ||||| ||| Sbjct: 241 ttgagataccagagccgtacaggttaccataacatgtacaaagagtaccgtgacactact 300 Query: 360 ctgaacggcggtttggagcagatgtacacggagatggcgtc 400 |||| || | ||||||| |||||||| ||||||||||| Sbjct: 301 ttgaatggagcagtggagcaaatgtacactgagatggcgtc 341 Score = 56.0 bits (28), Expect = 2e-04 Identities = 49/56 (87%) Strand = Plus / Plus Query: 465 tgcaagagggacaacacgaagcagttccacaactcgaagatcaagttcccgctggt 520 ||||||||||| | |||||||||||| |||||| ||||||||||||||| |||| Sbjct: 406 tgcaagagggaaagcacgaagcagtttcacaacagcaagatcaagttcccgttggt 461
>gb|AY128411.1| Arabidopsis thaliana 60S ribosomal protein L18A, putative (At1g29970) mRNA, complete cds Length = 758 Score = 168 bits (85), Expect = 1e-38 Identities = 232/281 (82%) Strand = Plus / Plus Query: 120 gatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaag 179 |||||||| || ||||| ||| | |||||||| ||||| || |||||||| | ||||| Sbjct: 138 gatgagcaaccaaagatttacaggatgaagctatgggcaacgaacgaggttcttgccaaa 197 Query: 180 tccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatg 239 |||||||||||||||| | | |||| || ||||||||||||||| || || |||||| Sbjct: 198 tccaagttctggtactacttaaggaggcaaaagaaggtgaagaagagtaatggacagatg 257 Query: 240 ctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctgg 299 || ||||||||||||||||||||||||||||| || || |||||||| | || |||||| Sbjct: 258 ctagccatcaacgagatctttgagaagaacccaacaacgatcaagaattttggaatctgg 317 Query: 300 ctgcgctaccagagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgact 359 || | ||||||||| | || |||||||| ||||||||||| |||||||| ||||| ||| Sbjct: 318 ttgagataccagagccgtacaggttaccataacatgtacaaagagtaccgtgacactact 377 Query: 360 ctgaacggcggtttggagcagatgtacacggagatggcgtc 400 |||| || | ||||||| |||||||| ||||||||||| Sbjct: 378 ttgaatggagcagtggagcaaatgtacactgagatggcgtc 418 Score = 56.0 bits (28), Expect = 2e-04 Identities = 49/56 (87%) Strand = Plus / Plus Query: 465 tgcaagagggacaacacgaagcagttccacaactcgaagatcaagttcccgctggt 520 ||||||||||| | |||||||||||| |||||| ||||||||||||||| |||| Sbjct: 483 tgcaagagggaaagcacgaagcagtttcacaacagcaagatcaagttcccgttggt 538
>emb|BX816320.1|CNS0AD9L Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH40ZG05 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1162 Score = 168 bits (85), Expect = 1e-38 Identities = 232/281 (82%) Strand = Plus / Plus Query: 120 gatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaag 179 |||||||| || ||||| ||| | |||||||| ||||| || |||||||| | ||||| Sbjct: 579 gatgagcaaccaaagatttacaggatgaagctatgggcaacgaacgaggttcttgccaaa 638 Query: 180 tccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatg 239 |||||||||||||||| | | |||| || ||||||||||||||| || || |||||| Sbjct: 639 tccaagttctggtactacttaaggaggcaaaagaaggtgaagaagagtaatggacagatg 698 Query: 240 ctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctgg 299 || ||||||||||||||||||||||||||||| || || |||||||| | || |||||| Sbjct: 699 ctagccatcaacgagatctttgagaagaacccaacaacgatcaagaattttggaatctgg 758 Query: 300 ctgcgctaccagagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgact 359 || | ||||||||| | || |||||||| ||||||||||| |||||||| ||||| ||| Sbjct: 759 ttgagataccagagccgtacaggttaccataacatgtacaaagagtaccgtgacactact 818 Query: 360 ctgaacggcggtttggagcagatgtacacggagatggcgtc 400 |||| || | ||||||| |||||||| ||||||||||| Sbjct: 819 ttgaatggagcagtggagcaaatgtacactgagatggcgtc 859 Score = 56.0 bits (28), Expect = 2e-04 Identities = 49/56 (87%) Strand = Plus / Plus Query: 465 tgcaagagggacaacacgaagcagttccacaactcgaagatcaagttcccgctggt 520 ||||||||||| | |||||||||||| |||||| ||||||||||||||| |||| Sbjct: 924 tgcaagagggaaagcacgaagcagtttcacaacagcaagatcaagttcccgttggt 979
>gb|BT014521.1| Lycopersicon esculentum clone 133914F, mRNA sequence Length = 810 Score = 159 bits (80), Expect = 1e-35 Identities = 263/324 (81%) Strand = Plus / Plus Query: 119 cgatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaa 178 ||||||||| || ||||| ||||| ||||| |||||||| || || |||||||| || || Sbjct: 96 cgatgagcatccaaagatttaccgtatgaaactctgggctacgaatgaggtccgtgctaa 155 Query: 179 gtccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagat 238 ||||||||| ||||||||| |||||||||| ||||||||||||||| ||| || ||||| Sbjct: 156 gtccaagttttggtacttcttgaggaagctaaagaaggtgaagaagagcaatggtcagat 215 Query: 239 gctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctg 298 ||| || || || ||||| |||||||| |||| || | ||||||||||| || || || Sbjct: 216 gctagctattaatgagatttttgagaaatacccaacaaaaatcaagaactatggtatttg 275 Query: 299 gctgcgctaccagagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgac 358 |||||| ||||| || ||||| || || || |||||||||||||||||||| || || || Sbjct: 276 gctgcgttaccaaagtaggactgggtatcataacatgtacaaggagtaccgtgatacaac 335 Query: 359 tctgaacggcggtttggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttc 418 |||| || ||| | || ||||||||||| || ||||| || || ||| | || ||| Sbjct: 336 attgaatggtggtgtagaacagatgtacactgaaatggcttctcgccacagggtccgtca 395 Query: 419 cccgtgcatccagatcatcaagac 442 | |||||||||||||||||||| Sbjct: 396 tcactgcatccagatcatcaagac 419 Score = 56.0 bits (28), Expect = 2e-04 Identities = 55/64 (85%) Strand = Plus / Plus Query: 459 aagctgtgcaagagggacaacacgaagcagttccacaactcgaagatcaagttcccgctg 518 ||||| |||||| |||| | ||| |||||||||||| |||| || |||||||||||| || Sbjct: 436 aagctctgcaagcgggagagcacaaagcagttccacgactccaaaatcaagttcccgttg 495 Query: 519 gtgt 522 |||| Sbjct: 496 gtgt 499
>dbj|AB023038.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIE1 Length = 84462 Score = 157 bits (79), Expect = 6e-35 Identities = 213/255 (83%), Gaps = 2/255 (0%) Strand = Plus / Plus Query: 261 gagaagaacccgaccaccatcaagaactacggcatctggctgcgctaccagagcaggacc 320 ||||||||||| || ||||||||||||||||| |||||| |||| || |||||| | || Sbjct: 39558 gagaagaacccaacgaccatcaagaactacgggatctggttgcgttatcagagccgaact 39617 Query: 321 ggttaccacaacatgtacaaggagtaccgcgacacgactctgaacggcggtttggagcag 380 || |||||||||||||||||||||||||| ||||| || || || || || |||||||| Sbjct: 39618 gggtaccacaacatgtacaaggagtaccgtgacacaacactcaatggtggagtggagcag 39677 Query: 381 atgtacacggagatggcgtcgcggcaccgcgtgcgttccccgtgcatccagatcatcaag 440 |||||||| |||||||| || || || | ||| | | ||| ||||| |||||||||||| Sbjct: 39678 atgtacactgagatggcttctcgtcatagagtgaggttcccttgcattcagatcatcaag 39737 Query: 441 actgcgacggtggacttc-aagctgtgcaagagggacaacacgaagcagttccacaactc 499 |||||||| || || | ||||| |||||||| || | ||| ||||||||||| ||||| Sbjct: 39738 actgcgactgt-ccctgcaaagctttgcaagagagagatcaccaagcagttccataactc 39796 Query: 500 gaagatcaagttccc 514 ||||||||||||||| Sbjct: 39797 gaagatcaagttccc 39811 Score = 58.0 bits (29), Expect = 4e-05 Identities = 53/61 (86%) Strand = Plus / Plus Query: 190 ggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgccatca 249 |||||||| ||||||| || |||||||||||||| |||||| |||||||| ||||||| Sbjct: 39402 ggtacttcatgaggaaactgaagaaggtgaagaaaagcaacggacagatgcttgccatca 39461 Query: 250 a 250 | Sbjct: 39462 a 39462 Score = 44.1 bits (22), Expect = 0.58 Identities = 61/74 (82%) Strand = Plus / Plus Query: 119 cgatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaa 178 ||||||||| || ||||||||| | |||||||| |||| | || || || ||||||| Sbjct: 39237 cgatgagcaccctaagatctacaggatgaagctttggggtagaaatgaagtatgcgccaa 39296 Query: 179 gtccaagttctggt 192 |||||||||||||| Sbjct: 39297 gtccaagttctggt 39310
>gb|DQ175860.1| Hordeum vulgare clone DsC33 Ds insertion site flanking region genomic sequence Length = 556 Score = 145 bits (73), Expect = 2e-31 Identities = 84/87 (96%), Gaps = 3/87 (3%) Strand = Plus / Minus Query: 185 gttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgc 244 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 555 gttctggtacttcctgaggaagctcaagaaggtgaagaaggccaa---ccagatgctcgc 499 Query: 245 catcaacgagatctttgagaagaaccc 271 ||||||||||||||||||||||||||| Sbjct: 498 catcaacgagatctttgagaagaaccc 472 Score = 111 bits (56), Expect = 3e-21 Identities = 56/56 (100%) Strand = Plus / Minus Query: 604 cccactgcctactgttttagcgtgtgtaagagtttgaatgttttgcatgtggaagt 659 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 149 cccactgcctactgttttagcgtgtgtaagagtttgaatgttttgcatgtggaagt 94
>gb|DQ226673.1| Boechera divaricarpa isolate SLW-348-443-C10 mRNA sequence Length = 312 Score = 137 bits (69), Expect = 5e-29 Identities = 180/217 (82%) Strand = Plus / Minus Query: 120 gatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaag 179 |||||||| || ||||||||| | |||||||| |||| ||| || || || |||||||| Sbjct: 217 gatgagcaccctaagatctacaggatgaagctatggggcacaaatgaagtatgcgccaag 158 Query: 180 tccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatg 239 |||||||| ||||| ||| ||||||| || |||||||||||||| ||| || |||||| Sbjct: 157 tccaagttttggtatttcatgaggaaactgaagaaggtgaagaaaagcaatgggcagatg 98 Query: 240 ctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctgg 299 || |||||||| ||||| || |||||||||||||| || |||||||| || || |||||| Sbjct: 97 cttgccatcaatgagattttcgagaagaacccgacgacaatcaagaattatggtatctgg 38 Query: 300 ctgcgctaccagagcaggaccggttaccacaacatgt 336 ||||| || |||||| | || || ||||| ||||||| Sbjct: 37 ctgcgttatcagagccgaactggataccataacatgt 1
>gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 map ve016, complete sequence Length = 112763 Score = 131 bits (66), Expect = 3e-27 Identities = 213/262 (81%) Strand = Plus / Minus Query: 253 agatctttgagaagaacccgaccaccatcaagaactacggcatctggctgcgctaccaga 312 |||||| |||||||||||| || || |||||||||| ||| || ||| || | ||||||| Sbjct: 103746 agatctatgagaagaacccaacaacgatcaagaacttcggtatttggttgaggtaccaga 103687 Query: 313 gcaggaccggttaccacaacatgtacaaggagtaccgcgacacgactctgaacggcggtt 372 | || || || |||||||||||||||||||||||||| ||||| ||||| ||||| | | Sbjct: 103686 gtagaactgggtaccacaacatgtacaaggagtaccgtgacaccactcttaacggagctg 103627 Query: 373 tggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttccccgtgcatccaga 432 | |||||||||||||| |||||||| || || ||||| || | | ||| ||||| |||| Sbjct: 103626 ttgagcagatgtacactgagatggcatcccgtcaccgtgtcagattcccttgcattcaga 103567 Query: 433 tcatcaagactgcgacggtggacttcaagctgtgcaagagggacaacacgaagcagttcc 492 |||||||||| || || || ||||||||||||||| || | ||| || ||||||| Sbjct: 103566 tcatcaagacagccactgtcccagccaagctgtgcaagagagagagcactaaacagttcc 103507 Query: 493 acaactcgaagatcaagttccc 514 ||||| |||||||||||||| Sbjct: 103506 acaacagcaagatcaagttccc 103485 Score = 73.8 bits (37), Expect = 6e-10 Identities = 64/73 (87%) Strand = Plus / Minus Query: 120 gatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaag 179 |||| |||||| ||||| ||| | |||||||||||||| || |||||||| || |||||| Sbjct: 104480 gatgtgcagcctaagatttacaggatgaagctctgggctacgaacgaggttcgtgccaag 104421 Query: 180 tccaagttctggt 192 ||||||||||||| Sbjct: 104420 tccaagttctggt 104408 Score = 73.8 bits (37), Expect = 6e-10 Identities = 58/65 (89%) Strand = Plus / Minus Query: 190 ggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgccatca 249 |||| ||| |||||||||||||||||||||||||| || || |||||||||||||||| Sbjct: 104312 ggtatttcttgaggaagctcaagaaggtgaagaagagtaatggacagatgctcgccatca 104253 Query: 250 acgag 254 ||||| Sbjct: 104252 acgag 104248
>gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 map ve016, complete sequence Length = 93060 Score = 131 bits (66), Expect = 3e-27 Identities = 213/262 (81%) Strand = Plus / Plus Query: 253 agatctttgagaagaacccgaccaccatcaagaactacggcatctggctgcgctaccaga 312 |||||| |||||||||||| || || |||||||||| ||| || ||| || | ||||||| Sbjct: 70456 agatctatgagaagaacccaacaacgatcaagaacttcggtatttggttgaggtaccaga 70515 Query: 313 gcaggaccggttaccacaacatgtacaaggagtaccgcgacacgactctgaacggcggtt 372 | || || || |||||||||||||||||||||||||| ||||| ||||| ||||| | | Sbjct: 70516 gtagaactgggtaccacaacatgtacaaggagtaccgtgacaccactcttaacggagctg 70575 Query: 373 tggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttccccgtgcatccaga 432 | |||||||||||||| |||||||| || || ||||| || | | ||| ||||| |||| Sbjct: 70576 ttgagcagatgtacactgagatggcatcccgtcaccgtgtcagattcccttgcattcaga 70635 Query: 433 tcatcaagactgcgacggtggacttcaagctgtgcaagagggacaacacgaagcagttcc 492 |||||||||| || || || ||||||||||||||| || | ||| || ||||||| Sbjct: 70636 tcatcaagacagccactgtcccagccaagctgtgcaagagagagagcactaaacagttcc 70695 Query: 493 acaactcgaagatcaagttccc 514 ||||| |||||||||||||| Sbjct: 70696 acaacagcaagatcaagttccc 70717 Score = 73.8 bits (37), Expect = 6e-10 Identities = 58/65 (89%) Strand = Plus / Plus Query: 190 ggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgccatca 249 |||| ||| |||||||||||||||||||||||||| || || |||||||||||||||| Sbjct: 69890 ggtatttcttgaggaagctcaagaaggtgaagaagagtaatggacagatgctcgccatca 69949 Query: 250 acgag 254 ||||| Sbjct: 69950 acgag 69954 Score = 73.8 bits (37), Expect = 6e-10 Identities = 64/73 (87%) Strand = Plus / Plus Query: 120 gatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaag 179 |||| |||||| ||||| ||| | |||||||||||||| || |||||||| || |||||| Sbjct: 69722 gatgtgcagcctaagatttacaggatgaagctctgggctacgaacgaggttcgtgccaag 69781 Query: 180 tccaagttctggt 192 ||||||||||||| Sbjct: 69782 tccaagttctggt 69794
>dbj|AK110262.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-163-B05, full insert sequence Length = 885 Score = 117 bits (59), Expect = 5e-23 Identities = 185/227 (81%) Strand = Plus / Plus Query: 216 gtgaagaaggccaacggccagatgctcgccatcaacgagatctttgagaagaacccgacc 275 ||||||||||||||||||||||| |||| | |||||||| |||||| || || || Sbjct: 205 gtgaagaaggccaacggccagatcatcgcagtgaacgagatttttgagcgcaagcccaca 264 Query: 276 accatcaagaactacggcatctggctgcgctaccagagcaggaccggttaccacaacatg 335 || | ||||||| ||||||||| ||||||||||| | || || |||||||||||| Sbjct: 265 actgtgaagaactttggcatctgggtgcgctaccagtcacgcacaggctaccacaacatg 324 Query: 336 tacaaggagtaccgcgacacgactctgaacggcggtttggagcagatgtacacggagatg 395 |||||||||||||| ||||| || || ||||| | |||| |||||||||| |||||| Sbjct: 325 tacaaggagtaccgtgacaccaccctcaacggtgcagtggaccagatgtacagcgagatg 384 Query: 396 gcgtcgcggcaccgcgtgcgttccccgtgcatccagatcatcaagac 442 || || || ||||||||||| | ||| |||||||||||||||||||| Sbjct: 385 gcatcacgccaccgcgtgcgcttcccttgcatccagatcatcaagac 431 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 74 gttccaccagtaccaggtggtggg 97 |||||| ||||||||||||||||| Sbjct: 63 gttccatcagtaccaggtggtggg 86
>gb|AF334839.1| Castanea sativa ribosomal protein L18a mRNA, complete cds Length = 775 Score = 101 bits (51), Expect = 3e-18 Identities = 195/243 (80%) Strand = Plus / Plus Query: 119 cgatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaa 178 ||||||||| || ||||| || | ||||| || ||||| || || |||||||| ||||| Sbjct: 143 cgatgagcatccaaagatttataggatgaaactttgggctacaaatgaggtccgtgccaa 202 Query: 179 gtccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagat 238 ||| |||||||||||||| |||||||||| ||||| || |||||| ||| || ||||| Sbjct: 203 gtcgaagttctggtactttttgaggaagctgaagaaagttaagaagagcaatgggcagat 262 Query: 239 gctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctg 298 | | || ||||| ||||| ||||||||||| || || | || ||||| || || ||||| Sbjct: 263 gttagctatcaatgagatttttgagaagaatcctacaaagattaagaattatggtatctg 322 Query: 299 gctgcgctaccagagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgac 358 |||||| || || ||| | || || || ||||||||||| |||||||| || ||||| || Sbjct: 323 gctgcggtatcaaagccgaactgggtatcacaacatgtataaggagtatcgagacaccac 382 Query: 359 tct 361 ||| Sbjct: 383 tct 385 Score = 48.1 bits (24), Expect = 0.037 Identities = 48/56 (85%) Strand = Plus / Plus Query: 465 tgcaagagggacaacacgaagcagttccacaactcgaagatcaagttcccgctggt 520 ||||||||||| | | | |||||||||||||| || || ||||||||||| ||||| Sbjct: 489 tgcaagagggagagctctaagcagttccacaattccaaaatcaagttccctctggt 544
>gb|BT016634.1| Zea mays clone Contig467 mRNA sequence Length = 859 Score = 95.6 bits (48), Expect = 2e-16 Identities = 118/140 (84%), Gaps = 1/140 (0%) Strand = Plus / Minus Query: 73 ggttccaccagtaccaggtggtgggtcgcgcgctgccgaccccgggcgatgagcagccca 132 ||||||| |||||||||| | ||||||||||||||| ||| | |||||||| |||| Sbjct: 817 ggttccatcagtaccaggcagcgggtcgcgcgctgccagtccccgctgatgagcacccca 758 Query: 133 agatctaccgcatgaagctctgggccaccaacgaggtccgcgccaagtccaagttctggt 192 |||||||||||||| |||| || || |||||||||||| || |||| ||||| |||||| Sbjct: 757 agatctaccgcatggagct-tgcgctaccaacgaggtctgctccaaatccaatctctggt 699 Query: 193 acttcctgaggaagctcaag 212 ||| ||||||||||||||| Sbjct: 698 actatctgaggaagctcaag 679 Score = 85.7 bits (43), Expect = 2e-13 Identities = 103/123 (83%) Strand = Plus / Minus Query: 227 caacggccagatgctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaa 286 |||||| ||||| |||||||| ||||||| |||||| ||||| || || |||||||| Sbjct: 659 caacggtcagattctcgccatagacgagatatttgagtgtaaccctacaacaatcaagaa 600 Query: 287 ctacggcatctggctgcgctaccagagcaggaccggttaccacaacatgtacaaggagta 346 || |||||||||||| | |||||| ||||||| ||||||||| || || |||||||||| Sbjct: 599 ctgtggcatctggctgtgttaccagtgcaggacaggttaccacgacctgcacaaggagta 540 Query: 347 ccg 349 ||| Sbjct: 539 ccg 537 Score = 69.9 bits (35), Expect = 1e-08 Identities = 71/83 (85%) Strand = Plus / Minus Query: 429 cagatcatcaagactgcgacggtggacttcaagctgtgcaagagggacaacacgaagcag 488 |||||||||||||| || || | |||| ||||| ||||||||||||||||| |||||| Sbjct: 459 cagatcatcaagacggcaacaatcaactttaagctttgcaagagggacaacaccaagcag 400 Query: 489 ttccacaactcgaagatcaagtt 511 |||||||| || ||| ||||||| Sbjct: 399 ttccacaattcaaagttcaagtt 377
>gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P2 genomic sequence, complete sequence Length = 82053 Score = 95.6 bits (48), Expect = 2e-16 Identities = 123/148 (83%) Strand = Plus / Minus Query: 253 agatctttgagaagaacccgaccaccatcaagaactacggcatctggctgcgctaccaga 312 ||||||||||||||||||| || || |||||||| | || |||||| || | ||||||| Sbjct: 20677 agatctttgagaagaacccaacaacgatcaagaattttggaatctggttgagataccaga 20618 Query: 313 gcaggaccggttaccacaacatgtacaaggagtaccgcgacacgactctgaacggcggtt 372 || | || |||||||| ||||||||||| |||||||| ||||| ||| |||| || | Sbjct: 20617 gccgtacaggttaccataacatgtacaaagagtaccgtgacactactttgaatggagcag 20558 Query: 373 tggagcagatgtacacggagatggcgtc 400 ||||||| |||||||| ||||||||||| Sbjct: 20557 tggagcaaatgtacactgagatggcgtc 20530 Score = 56.0 bits (28), Expect = 2e-04 Identities = 49/56 (87%) Strand = Plus / Minus Query: 465 tgcaagagggacaacacgaagcagttccacaactcgaagatcaagttcccgctggt 520 ||||||||||| | |||||||||||| |||||| ||||||||||||||| |||| Sbjct: 20465 tgcaagagggaaagcacgaagcagtttcacaacagcaagatcaagttcccgttggt 20410 Score = 50.1 bits (25), Expect = 0.009 Identities = 61/73 (83%) Strand = Plus / Minus Query: 120 gatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaag 179 |||||||| || ||||| ||| | |||||||| ||||| || |||||||| | ||||| Sbjct: 21075 gatgagcaaccaaagatttacaggatgaagctatgggcaacgaacgaggttcttgccaaa 21016 Query: 180 tccaagttctggt 192 ||||||||||||| Sbjct: 21015 tccaagttctggt 21003 Score = 42.1 bits (21), Expect = 2.3 Identities = 39/45 (86%) Strand = Plus / Minus Query: 210 aagaaggtgaagaaggccaacggccagatgctcgccatcaacgag 254 ||||||||||||||| || || |||||||| |||||||||||| Sbjct: 20890 aagaaggtgaagaagagtaatggacagatgctagccatcaacgag 20846
>emb|BX820914.1|CNS0A9IE Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH81ZB06 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 705 Score = 87.7 bits (44), Expect = 4e-14 Identities = 99/116 (85%), Gaps = 1/116 (0%) Strand = Plus / Plus Query: 174 gccaagtccaagttctggtacttcctgaggaagctcaagaaggtgaaga-aggccaacgg 232 ||||| ||||| |||||||| ||| ||||||| |||||||||||||||| || || || Sbjct: 101 gccaaatccaatttctggtatttcttgaggaaactcaagaaggtgaagacagagtaatgg 160 Query: 233 ccagatgctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaact 288 |||||||||||||||||| |||||| |||||||||||| || || ||||| |||| Sbjct: 161 acagatgctcgccatcaacaagatctatgagaagaacccaacaacgatcaataact 216 Score = 67.9 bits (34), Expect = 4e-08 Identities = 64/74 (86%) Strand = Plus / Plus Query: 324 taccacaacatgtacaaggagtaccgcgacacgactctgaacggcggtttggagcagatg 383 |||||||||||||||||||||||||| ||||| ||||| ||| | | | | || |||||| Sbjct: 252 taccacaacatgtacaaggagtaccgtgacaccactcttaacagagctgttgaacagatg 311 Query: 384 tacacggagatggc 397 ||||| |||||||| Sbjct: 312 tacactgagatggc 325
>gb|AF548319.1| Branchiostoma belcheri ribosomal protein L18a mRNA, complete cds Length = 616 Score = 75.8 bits (38), Expect = 2e-10 Identities = 77/90 (85%) Strand = Plus / Plus Query: 264 aagaacccgaccaccatcaagaactacggcatctggctgcgctaccagagcaggaccggt 323 |||||||| || | ||||||||||||||||||||||||||||||| | ||| | ||| Sbjct: 222 aagaaccccacgagcatcaagaactacggcatctggctgcgctacgactccagaagcgga 281 Query: 324 taccacaacatgtacaaggagtaccgcgac 353 |||||||||||||| ||||||||||||| Sbjct: 282 acccacaacatgtacagggagtaccgcgac 311
>gb|AC146330.33| Medicago truncatula clone mth2-7g7, complete sequence Length = 117139 Score = 67.9 bits (34), Expect = 4e-08 Identities = 64/74 (86%) Strand = Plus / Minus Query: 120 gatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaag 179 ||||| || |||||||| || |||||||| || ||||| ||||||||||| || ||||| Sbjct: 20650 gatgaacatcccaagatttatcgcatgaaactttgggcaaccaacgaggttcgtgccaaa 20591 Query: 180 tccaagttctggta 193 |||||||||||||| Sbjct: 20590 tccaagttctggta 20577 Score = 61.9 bits (31), Expect = 2e-06 Identities = 94/115 (81%) Strand = Plus / Minus Query: 253 agatctttgagaagaacccgaccaccatcaagaactacggcatctggctgcgctaccaga 312 ||||||||||||| || || |||| || ||||||||||| || |||||||| || |||| Sbjct: 19813 agatctttgagaaaaatcctaccaagattaagaactacggaatttggctgcgttatcaga 19754 Query: 313 gcaggaccggttaccacaacatgtacaaggagtaccgcgacacgactctgaacgg 367 | | || ||||| ||||| ||||||||||| ||||| || || ||||| ||||| Sbjct: 19753 gtcgtactggttatcacaatatgtacaaggaataccgtgatactactctaaacgg 19699 Score = 58.0 bits (29), Expect = 4e-05 Identities = 59/69 (85%) Strand = Plus / Minus Query: 462 ctgtgcaagagggacaacacgaagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||| ||||| | ||| |||||||||||||| || || ||||||||||| ||||| Sbjct: 19604 ctgtgcaaaagggagagcactaagcagttccacaattccaaaatcaagttccccttggtg 19545 Query: 522 taccagaag 530 ||| ||||| Sbjct: 19544 tacaagaag 19536
>ref|XM_505817.1| Yarrowia lipolytica CLIB122, YALI0F24123g predicted mRNA Length = 519 Score = 60.0 bits (30), Expect = 1e-05 Identities = 93/114 (81%) Strand = Plus / Plus Query: 186 ttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgcc 245 |||||||||||||||| ||||||||||||| |||||| ||| ||| |||| | ||| Sbjct: 121 ttctggtacttcctgacccagctcaagaaggtcaagaagtccaccggtgagattgttgcc 180 Query: 246 atcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctgg 299 |||||| |||||| ||||||| ||| || | ||||||||| |||||||||| Sbjct: 181 atcaacaagatctccgagaagacccccactaaggtcaagaacttcggcatctgg 234 Score = 46.1 bits (23), Expect = 0.15 Identities = 23/23 (100%) Strand = Plus / Plus Query: 327 cacaacatgtacaaggagtaccg 349 ||||||||||||||||||||||| Sbjct: 262 cacaacatgtacaaggagtaccg 284
>emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB122 of Yarrowia lipolytica Length = 4003362 Score = 60.0 bits (30), Expect = 1e-05 Identities = 93/114 (81%) Strand = Plus / Minus Query: 186 ttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgcc 245 |||||||||||||||| ||||||||||||| |||||| ||| ||| |||| | ||| Sbjct: 3153903 ttctggtacttcctgacccagctcaagaaggtcaagaagtccaccggtgagattgttgcc 3153844 Query: 246 atcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctgg 299 |||||| |||||| ||||||| ||| || | ||||||||| |||||||||| Sbjct: 3153843 atcaacaagatctccgagaagacccccactaaggtcaagaacttcggcatctgg 3153790 Score = 46.1 bits (23), Expect = 0.15 Identities = 23/23 (100%) Strand = Plus / Minus Query: 327 cacaacatgtacaaggagtaccg 349 ||||||||||||||||||||||| Sbjct: 3153762 cacaacatgtacaaggagtaccg 3153740
>emb|AJ718289.1| Nicotiana tabacum cDNA-AFLP-fragment BSTT4-43-380, cultivar Bright Yellow 2 Length = 320 Score = 58.0 bits (29), Expect = 4e-05 Identities = 59/69 (85%) Strand = Plus / Plus Query: 329 caacatgtacaaggagtaccgcgacacgactctgaacggcggtttggagcagatgtacac 388 ||||||||||||||||||||| || || ||| |||| || | | |||| ||||||||||| Sbjct: 41 caacatgtacaaggagtaccgagataccactttgaatggagctgtggaacagatgtacac 100 Query: 389 ggagatggc 397 |||||||| Sbjct: 101 tgagatggc 109 Score = 40.1 bits (20), Expect = 9.0 Identities = 47/56 (83%) Strand = Plus / Plus Query: 459 aagctgtgcaagagggacaacacgaagcagttccacaactcgaagatcaagttccc 514 ||||| || |||||||| | ||| ||||||||||| |||| || ||||||||||| Sbjct: 171 aagctatgtaagagggagagcaccaagcagttccatgactccaaaatcaagttccc 226
>ref|XM_524153.1| PREDICTED: Pan troglodytes similar to ribosomal protein L18a; 60S ribosomal protein L18a (LOC468766), mRNA Length = 390 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctg 518 |||||||||||| |||| |||||||||||||||||| Sbjct: 286 aagcagttccacgactccaagatcaagttcccgctg 321
>ref|NM_000980.2| Homo sapiens ribosomal protein L18a (RPL18A), mRNA Length = 618 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctg 518 |||||||||||| |||| |||||||||||||||||| Sbjct: 462 aagcagttccacgactccaagatcaagttcccgctg 497
>gb|U52111.3| Homo sapiens chromosome X clone Qc-7G6, QLL-F1720, QLL-C1335, Qc-8B7, Qc-11H12, Qc-7F6, QLL-E153, Qc-10E8, Qc-10B7 map q28, complete sequence Length = 247592 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctg 518 |||||||||||| |||| |||||||||||||||||| Sbjct: 45797 aagcagttccacgactccaagatcaagttcccgctg 45832 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Plus Query: 282 aagaactacggcatctggctgcgcta 307 ||||||| |||||||||||||||||| Sbjct: 45596 aagaacttcggcatctggctgcgcta 45621 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 82 agtaccaggtggtgggtcgc 101 |||||||||||||||||||| Sbjct: 45396 agtaccaggtggtgggtcgc 45415
>gb|AC089983.23| Homo sapiens 12 BAC RP11-818F20 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 204505 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctg 518 |||||||||||| |||| |||||||||||||||||| Sbjct: 168520 aagcagttccacgactccaagatcaagttcccgctg 168555
>gb|BC098413.1| Homo sapiens cDNA clone IMAGE:6208834, **** WARNING: chimeric clone **** Length = 1360 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctg 518 |||||||||||| |||| |||||||||||||||||| Sbjct: 1131 aagcagttccacgactccaagatcaagttcccgctg 1166
>gb|BC062307.1| Homo sapiens cDNA clone IMAGE:3504574, **** WARNING: chimeric clone **** Length = 1785 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctg 518 |||||||||||| |||| |||||||||||||||||| Sbjct: 1573 aagcagttccacgactccaagatcaagttcccgctg 1608
>gb|BC071836.1| Homo sapiens cDNA clone IMAGE:6210072, **** WARNING: chimeric clone **** Length = 1360 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctg 518 |||||||||||| |||| |||||||||||||||||| Sbjct: 1131 aagcagttccacgactccaagatcaagttcccgctg 1166
>gb|BC066319.1| Homo sapiens ribosomal protein L18a, mRNA (cDNA clone MGC:87208 IMAGE:5286436), complete cds Length = 632 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctg 518 |||||||||||| |||| |||||||||||||||||| Sbjct: 466 aagcagttccacgactccaagatcaagttcccgctg 501
>gb|BC007512.2| Homo sapiens ribosomal protein L18a, mRNA (cDNA clone MGC:4476 IMAGE:2961519), complete cds Length = 616 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctg 518 |||||||||||| |||| |||||||||||||||||| Sbjct: 446 aagcagttccacgactccaagatcaagttcccgctg 481
>emb|CR615832.1| full-length cDNA clone CS0DL001YB06 of B cells (Ramos cell line) Cot 25-normalized of Homo sapiens (human) Length = 602 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctg 518 |||||||||||| |||| |||||||||||||||||| Sbjct: 446 aagcagttccacgactccaagatcaagttcccgctg 481
>emb|CR624588.1| full-length cDNA clone CS0DI021YD01 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 612 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctg 518 |||||||||||| |||| |||||||||||||||||| Sbjct: 456 aagcagttccacgactccaagatcaagttcccgctg 491
>emb|CR619918.1| full-length cDNA clone CS0DM013YP23 of Fetal liver of Homo sapiens (human) Length = 1921 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctg 518 |||||||||||| |||| |||||||||||||||||| Sbjct: 1767 aagcagttccacgactccaagatcaagttcccgctg 1802
>emb|CR619120.1| full-length cDNA clone CS0DI077YH09 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1912 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctg 518 |||||||||||| |||| |||||||||||||||||| Sbjct: 1767 aagcagttccacgactccaagatcaagttcccgctg 1802
>emb|CR617184.1| full-length cDNA clone CS0DJ005YO06 of T cells (Jurkat cell line) Cot 10-normalized of Homo sapiens (human) Length = 606 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctg 518 |||||||||||| |||| |||||||||||||||||| Sbjct: 449 aagcagttccacgactccaagatcaagttcccgctg 484
>emb|CR606905.1| full-length cDNA clone CS0DC025YL04 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 604 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctg 518 |||||||||||| |||| |||||||||||||||||| Sbjct: 448 aagcagttccacgactccaagatcaagttcccgctg 483
>emb|CR603612.1| full-length cDNA clone CS0DB009YJ04 of Neuroblastoma Cot 10-normalized of Homo sapiens (human) Length = 612 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctg 518 |||||||||||| |||| |||||||||||||||||| Sbjct: 456 aagcagttccacgactccaagatcaagttcccgctg 491
>emb|CR600519.1| full-length cDNA clone CS0DC003YF24 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 605 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctg 518 |||||||||||| |||| |||||||||||||||||| Sbjct: 449 aagcagttccacgactccaagatcaagttcccgctg 484
>emb|CR600845.1| full-length cDNA clone CS0DA007YA19 of Neuroblastoma of Homo sapiens (human) Length = 605 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctg 518 |||||||||||| |||| |||||||||||||||||| Sbjct: 449 aagcagttccacgactccaagatcaagttcccgctg 484
>emb|CR594005.1| full-length cDNA clone CL0BB004ZF10 of Neuroblastoma of Homo sapiens (human) Length = 603 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctg 518 |||||||||||| |||| |||||||||||||||||| Sbjct: 448 aagcagttccacgactccaagatcaagttcccgctg 483
>emb|CR592115.1| full-length cDNA clone CS0DI063YB22 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 601 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctg 518 |||||||||||| |||| |||||||||||||||||| Sbjct: 447 aagcagttccacgactccaagatcaagttcccgctg 482
>ref|NR_001593.1| Homo sapiens similar to ribosomal protein L18a; 60S ribosomal protein L18a (LOC390354) on chromosome 12 Length = 616 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctg 518 |||||||||||| |||| |||||||||||||||||| Sbjct: 466 aagcagttccacgactccaagatcaagttcccgctg 501
>ref|XM_938382.1| PREDICTED: Homo sapiens similar to ribosomal protein L18a (LOC347544), mRNA Length = 574 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctg 518 |||||||||||| |||| |||||||||||||||||| Sbjct: 427 aagcagttccacgactccaagatcaagttcccgctg 462 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Plus Query: 282 aagaactacggcatctggctgcgcta 307 ||||||| |||||||||||||||||| Sbjct: 226 aagaacttcggcatctggctgcgcta 251 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 82 agtaccaggtggtgggtcgc 101 |||||||||||||||||||| Sbjct: 26 agtaccaggtggtgggtcgc 45
>ref|XM_293412.3| PREDICTED: Homo sapiens similar to ribosomal protein L18a (LOC347544), mRNA Length = 574 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctg 518 |||||||||||| |||| |||||||||||||||||| Sbjct: 427 aagcagttccacgactccaagatcaagttcccgctg 462 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Plus Query: 282 aagaactacggcatctggctgcgcta 307 ||||||| |||||||||||||||||| Sbjct: 226 aagaacttcggcatctggctgcgcta 251 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 82 agtaccaggtggtgggtcgc 101 |||||||||||||||||||| Sbjct: 26 agtaccaggtggtgggtcgc 45
>ref|XM_945469.1| PREDICTED: Homo sapiens similar to ribosomal protein L18a, transcript variant 6 (LOC285053), mRNA Length = 588 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctg 518 |||||||||||| |||| |||||||||||||||||| Sbjct: 430 aagcagttccacgactccaagatcaagttcccgctg 465
>ref|XM_945465.1| PREDICTED: Homo sapiens similar to ribosomal protein L18a, transcript variant 5 (LOC285053), mRNA Length = 557 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctg 518 |||||||||||| |||| |||||||||||||||||| Sbjct: 399 aagcagttccacgactccaagatcaagttcccgctg 434
>ref|XM_941835.1| PREDICTED: Homo sapiens similar to ribosomal protein L18a, transcript variant 4 (LOC285053), mRNA Length = 659 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctg 518 |||||||||||| |||| |||||||||||||||||| Sbjct: 476 aagcagttccacgactccaagatcaagttcccgctg 511
>ref|XM_934020.1| PREDICTED: Homo sapiens similar to ribosomal protein L18a, transcript variant 3 (LOC285053), mRNA Length = 588 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctg 518 |||||||||||| |||| |||||||||||||||||| Sbjct: 430 aagcagttccacgactccaagatcaagttcccgctg 465
>ref|XM_934018.1| PREDICTED: Homo sapiens similar to ribosomal protein L18a, transcript variant 2 (LOC285053), mRNA Length = 557 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctg 518 |||||||||||| |||| |||||||||||||||||| Sbjct: 399 aagcagttccacgactccaagatcaagttcccgctg 434
>ref|XM_208281.6| PREDICTED: Homo sapiens similar to ribosomal protein L18a, transcript variant 1 (LOC285053), mRNA Length = 659 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctg 518 |||||||||||| |||| |||||||||||||||||| Sbjct: 476 aagcagttccacgactccaagatcaagttcccgctg 511
>dbj|AK222647.1| Homo sapiens mRNA for ribosomal protein L18a variant, clone: CBL08590 Length = 594 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctg 518 |||||||||||| |||| |||||||||||||||||| Sbjct: 462 aagcagttccacgactccaagatcaagttcccgctg 497
>gb|AC079250.7| Homo sapiens BAC clone RP11-62I18 from 2, complete sequence Length = 82938 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctg 518 |||||||||||| |||| |||||||||||||||||| Sbjct: 78672 aagcagttccacgactccaagatcaagttcccgctg 78637
>gb|L05093.1|HUMRIBPROD Homo sapiens ribosomal protein L18a mRNA, complete cds Length = 602 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctg 518 |||||||||||| |||| |||||||||||||||||| Sbjct: 446 aagcagttccacgactccaagatcaagttcccgctg 481
>dbj|AB180445.1| Plutella xylostella mRNA for Ribosomal protein L18A, complete cds Length = 564 Score = 56.0 bits (28), Expect = 2e-04 Identities = 43/48 (89%) Strand = Plus / Plus Query: 261 gagaagaacccgaccaccatcaagaactacggcatctggctgcgctac 308 ||||||| ||||| || |||||||||| ||||||||||||||||||| Sbjct: 210 gagaagagcccgatcaagatcaagaacttcggcatctggctgcgctac 257
>gb|BC071920.1| Homo sapiens ribosomal protein L18a, mRNA (cDNA clone MGC:88602 IMAGE:6293838), complete cds Length = 622 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctg 518 |||||||||||| |||| |||||||||||||||||| Sbjct: 446 aagcagttccacgactccaagatcaagttcccgctg 481
>gb|AF045188.1|AF045188 Salmo salar ribosomal protein L18a mRNA, complete cds Length = 607 Score = 56.0 bits (28), Expect = 2e-04 Identities = 31/32 (96%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttccc 514 |||||||||||| ||||||||||||||||||| Sbjct: 443 aagcagttccacgactcgaagatcaagttccc 474
>emb|X80822.1|HSPLORF H.sapiens mRNA for ORF Length = 657 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctg 518 |||||||||||| |||| |||||||||||||||||| Sbjct: 452 aagcagttccacgactccaagatcaagttcccgctg 487
>gb|AY232187.1| Drosophila yakuba clone yak-ad_RpL18A mRNA sequence Length = 240 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 482 gaagcagttccacaactcgaagatcaagttcccgctggt 520 ||||||||||||| | ||||||||||||||||| ||||| Sbjct: 135 gaagcagttccacgattcgaagatcaagttccctctggt 173
>gb|AY231805.1| Drosophila yakuba clone yak-em_RpL18A mRNA sequence Length = 528 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 482 gaagcagttccacaactcgaagatcaagttcccgctggt 520 ||||||||||||| |||| |||||||||||||| ||||| Sbjct: 423 gaagcagttccacgactccaagatcaagttccctctggt 461 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Plus Query: 279 atcaagaactacggcatctggctgcg 304 |||||||||| ||||||||||||||| Sbjct: 220 atcaagaacttcggcatctggctgcg 245
>gb|AY048752.1| Blastocystis hominis RAPD fragment Length = 1132 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 327 cacaacatgtacaaggagtaccgcgacacgactct 361 ||||||||||||||||||||||| |||||| |||| Sbjct: 390 cacaacatgtacaaggagtaccgtgacacggctct 356
>emb|BX053393.1|CNS09DD1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC31AB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 165 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 149 aagcagttccacaactcgaagatccgattcccgctggtg 111
>emb|BX072011.1|CNS09RQ7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9DB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 702 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 472 aagcagttccacaactcgaagatccgattcccgctggtg 434
>emb|BX072010.1|CNS09RQ6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9DB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 773 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 468 aagcagttccacaactcgaagatccgattcccgctggtg 506
>emb|BX071935.1|CNS09RO3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9CF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 940 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 452 aagcagttccacaactcgaagatccgattcccgctggtg 414
>emb|BX071934.1|CNS09RO2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9CF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 964 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 454 aagcagttccacaactcgaagatccgattcccgctggtg 492
>emb|BX071198.1|CNS09R3M Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8CE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 951 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 445 aagcagttccacaactcgaagatccgattcccgctggtg 407
>emb|BX071197.1|CNS09R3L Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8CE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 946 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 444 aagcagttccacaactcgaagatccgattcccgctggtg 482
>emb|BX071326.1|CNS09R76 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8DC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 946 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 444 aagcagttccacaactcgaagatccgattcccgctggtg 482
>emb|BX071022.1|CNS09QYQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8BE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 909 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 460 aagcagttccacaactcgaagatccgattcccgctggtg 422
>emb|BX071021.1|CNS09QYP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8BE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 885 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 459 aagcagttccacaactcgaagatccgattcccgctggtg 497
>emb|BX070958.1|CNS09QWY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8BC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 931 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 458 aagcagttccacaactcgaagatccgattcccgctggtg 420
>emb|BX070094.1|CNS09Q8Y Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7AA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 684 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 441 aagcagttccacaactcgaagatccgattcccgctggtg 479
>emb|BX069977.1|CNS09Q5P Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6DD10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 934 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 451 aagcagttccacaactcgaagatccgattcccgctggtg 489
>emb|BX069941.1|CNS09Q4P Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6DC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 694 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 451 aagcagttccacaactcgaagatccgattcccgctggtg 413
>emb|BX069940.1|CNS09Q4O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6DC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 932 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 429 aagcagttccacaactcgaagatccgattcccgctggtg 467
>emb|BX069703.1|CNS09PY3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6BH09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 950 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 430 aagcagttccacaactcgaagatccgattcccgctggtg 392
>emb|BX069702.1|CNS09PY2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6BH09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 940 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 438 aagcagttccacaactcgaagatccgattcccgctggtg 476
>emb|BX060940.1|CNS09J6O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC41CB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 392 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 386 aagcagttccacaactcgaagatccgattcccgctggtg 348
>emb|BX060939.1|CNS09J6N Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41CB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 944 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 438 aagcagttccacaactcgaagatccgattcccgctggtg 476
>emb|BX069369.1|CNS09POT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6AA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 577 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 475 aagcagttccacaactcgaagatccgattcccgctggtg 437
>emb|BX069368.1|CNS09POS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6AA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 976 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 465 aagcagttccacaactcgaagatccgattcccgctggtg 503
>emb|BX069214.1|CNS09PKI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53DB06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 981 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 479 aagcagttccacaactcgaagatccgattcccgctggtg 441
>emb|BX069213.1|CNS09PKH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53DB06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 972 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 455 aagcagttccacaactcgaagatccgattcccgctggtg 493
>emb|BX068918.1|CNS09PCA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53BE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 975 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 481 aagcagttccacaactcgaagatccgattcccgctggtg 443
>emb|BX068917.1|CNS09PC9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53BE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 990 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 478 aagcagttccacaactcgaagatccgattcccgctggtg 516
>emb|BX068781.1|CNS09P8H Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53AG06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 514 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 485 aagcagttccacaactcgaagatccgattcccgctggtg 447
>emb|BX068780.1|CNS09P8G Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53AG06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 974 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 463 aagcagttccacaactcgaagatccgattcccgctggtg 501
>emb|BX068699.1|CNS09P67 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53AC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 896 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 473 aagcagttccacaactcgaagatccgattcccgctggtg 435
>emb|BX068698.1|CNS09P66 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53AC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 966 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 448 aagcagttccacaactcgaagatccgattcccgctggtg 486
>emb|BX068685.1|CNS09P5T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53AC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 796 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 309 aagcagttccacaactcgaagatccgattcccgctggtg 271
>emb|BX068632.1|CNS09P4C Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52DH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 469 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 439 aagcagttccacaactcgaagatccgattcccgctggtg 401
>emb|BX068631.1|CNS09P4B Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52DH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 962 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 456 aagcagttccacaactcgaagatccgattcccgctggtg 494
>emb|BX068389.1|CNS09OXL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52CD01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 968 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 456 aagcagttccacaactcgaagatccgattcccgctggtg 494
>emb|BX068343.1|CNS09OWB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52BH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 894 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 425 aagcagttccacaactcgaagatccgattcccgctggtg 387
>emb|BX068342.1|CNS09OWA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52BH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 858 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 433 aagcagttccacaactcgaagatccgattcccgctggtg 471
>emb|BX068334.1|CNS09OW2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52BH08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 954 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 450 aagcagttccacaactcgaagatccgattcccgctggtg 488
>emb|BX068304.1|CNS09OV8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52BG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 978 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 462 aagcagttccacaactcgaagatccgattcccgctggtg 500
>emb|BX068271.1|CNS09OUB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52BE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 538 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 385 aagcagttccacaactcgaagatccgattcccgctggtg 347
>emb|BX068270.1|CNS09OUA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52BE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 910 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 445 aagcagttccacaactcgaagatccgattcccgctggtg 483
>emb|BX068265.1|CNS09OU5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52BE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 790 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 449 aagcagttccacaactcgaagatccgattcccgctggtg 411
>emb|BX068264.1|CNS09OU4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52BE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 741 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 452 aagcagttccacaactcgaagatccgattcccgctggtg 490
>emb|BX068004.1|CNS09OMW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52AA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 832 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 438 aagcagttccacaactcgaagatccgattcccgctggtg 400
>emb|BX068003.1|CNS09OMV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52AA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 822 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 432 aagcagttccacaactcgaagatccgattcccgctggtg 470
>emb|BX067731.1|CNS09OFB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51CB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 887 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 460 aagcagttccacaactcgaagatccgattcccgctggtg 422
>emb|BX067730.1|CNS09OFA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51CB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 977 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 454 aagcagttccacaactcgaagatccgattcccgctggtg 492
>emb|BX067102.1|CNS09NXU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50CE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 564 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 476 aagcagttccacaactcgaagatccgattcccgctggtg 438
>emb|BX067101.1|CNS09NXT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50CE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 801 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 462 aagcagttccacaactcgaagatccgattcccgctggtg 500
>emb|BX066999.1|CNS09NUZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50CA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 755 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 468 aagcagttccacaactcgaagatccgattcccgctggtg 430
>emb|BX066998.1|CNS09NUY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50CA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 869 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 456 aagcagttccacaactcgaagatccgattcccgctggtg 494
>emb|BX066931.1|CNS09NT3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50BF07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 968 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 453 aagcagttccacaactcgaagatccgattcccgctggtg 491
>emb|BX066843.1|CNS09NQN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50BB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 804 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 467 aagcagttccacaactcgaagatccgattcccgctggtg 429
>emb|BX066842.1|CNS09NQM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50BB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 964 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 461 aagcagttccacaactcgaagatccgattcccgctggtg 499
>emb|BX066697.1|CNS09NML Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50AD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 613 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 457 aagcagttccacaactcgaagatccgattcccgctggtg 495
>emb|BX066444.1|CNS09NFK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5DA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 815 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 448 aagcagttccacaactcgaagatccgattcccgctggtg 486
>emb|BX065769.1|CNS09MWT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49DB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 648 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 457 aagcagttccacaactcgaagatccgattcccgctggtg 419
>emb|BX065768.1|CNS09MWS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49DB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 873 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 459 aagcagttccacaactcgaagatccgattcccgctggtg 497
>emb|BX065563.1|CNS09MR3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49CA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 853 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 439 aagcagttccacaactcgaagatccgattcccgctggtg 401
>emb|BX065562.1|CNS09MR2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49CA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 913 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 484 aagcagttccacaactcgaagatccgattcccgctggtg 522
>emb|BX065379.1|CNS09MLZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49BA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 955 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 463 aagcagttccacaactcgaagatccgattcccgctggtg 425
>emb|BX065287.1|CNS09MJF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49AD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 779 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 448 aagcagttccacaactcgaagatccgattcccgctggtg 410
>emb|BX065286.1|CNS09MJE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49AD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 854 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 442 aagcagttccacaactcgaagatccgattcccgctggtg 480
>emb|BX065104.1|CNS09MEC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC48DD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 814 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 445 aagcagttccacaactcgaagatccgattcccgctggtg 407
>emb|BX065103.1|CNS09MEB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48DD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 943 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 441 aagcagttccacaactcgaagatccgattcccgctggtg 479
>emb|BX065085.1|CNS09MDT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48DC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 681 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 273 aagcagttccacaactcgaagatccgattcccgctggtg 311
>emb|BX065080.1|CNS09MDO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC48DC07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 895 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 440 aagcagttccacaactcgaagatccgattcccgctggtg 402
>emb|BX065079.1|CNS09MDN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48DC07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 928 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 443 aagcagttccacaactcgaagatccgattcccgctggtg 481
>emb|BX065033.1|CNS09MCD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC48DA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 824 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 440 aagcagttccacaactcgaagatccgattcccgctggtg 402
>emb|BX065032.1|CNS09MCC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48DA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 919 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 433 aagcagttccacaactcgaagatccgattcccgctggtg 471
>emb|BX064042.1|CNS09LKU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46AF09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 463 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 65 aagcagttccacaactcgaagatccgattcccgctggtg 27
>emb|BX064041.1|CNS09LKT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46AF09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 964 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 459 aagcagttccacaactcgaagatccgattcccgctggtg 497
>emb|BX063680.1|CNS09LAS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45CF09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 824 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 323 aagcagttccacaactcgaagatccgattcccgctggtg 361
>emb|BX063679.1|CNS09LAR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC45CF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 951 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 450 aagcagttccacaactcgaagatccgattcccgctggtg 412
>emb|BX063678.1|CNS09LAQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45CF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 922 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 438 aagcagttccacaactcgaagatccgattcccgctggtg 476
>emb|BX063630.1|CNS09L9E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC45CC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 555 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 462 aagcagttccacaactcgaagatccgattcccgctggtg 424
>emb|BX063629.1|CNS09L9D Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45CC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 552 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 451 aagcagttccacaactcgaagatccgattcccgctggtg 489
>emb|BX063028.1|CNS09KSO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44CE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 851 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 451 aagcagttccacaactcgaagatccgattcccgctggtg 413
>emb|BX063027.1|CNS09KSN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44CE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 904 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 572 aagcagttccacaactcgaagatccgattcccgctggtg 610
>emb|BX062931.1|CNS09KPZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44BG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 485 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 460 aagcagttccacaactcgaagatccgattcccgctggtg 422
>emb|BX062913.1|CNS09KPH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44BG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 858 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 449 aagcagttccacaactcgaagatccgattcccgctggtg 411
>emb|BX062912.1|CNS09KPG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44BG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 860 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 446 aagcagttccacaactcgaagatccgattcccgctggtg 484
>emb|BX062805.1|CNS09KMH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44BB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 953 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 451 aagcagttccacaactcgaagatccgattcccgctggtg 489
>emb|BX062755.1|CNS09KL3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44AG07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 695 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 312 aagcagttccacaactcgaagatccgattcccgctggtg 350
>emb|BX062625.1|CNS09KHH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44AA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 884 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 443 aagcagttccacaactcgaagatccgattcccgctggtg 405
>emb|BX062624.1|CNS09KHG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44AA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 890 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 442 aagcagttccacaactcgaagatccgattcccgctggtg 480
>emb|BX062166.1|CNS09K4Q Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43BC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 865 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 455 aagcagttccacaactcgaagatccgattcccgctggtg 417
>emb|BX062165.1|CNS09K4P Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43BC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 816 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 452 aagcagttccacaactcgaagatccgattcccgctggtg 490
>emb|BX062118.1|CNS09K3E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43BA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 914 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 448 aagcagttccacaactcgaagatccgattcccgctggtg 486
>emb|BX062090.1|CNS09K2M Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43AH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 921 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 417 aagcagttccacaactcgaagatccgattcccgctggtg 455
>emb|BX061845.1|CNS09JVT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42DD06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 800 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 473 aagcagttccacaactcgaagatccgattcccgctggtg 435
>emb|BX061844.1|CNS09JVS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42DD06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 681 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 437 aagcagttccacaactcgaagatccgattcccgctggtg 475
>emb|BX061453.1|CNS09JKX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42BB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 862 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 343 aagcagttccacaactcgaagatccgattcccgctggtg 305
>emb|BX061452.1|CNS09JKW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42BB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 846 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 354 aagcagttccacaactcgaagatccgattcccgctggtg 392
>emb|BX061383.1|CNS09JIZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42AF09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 931 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 435 aagcagttccacaactcgaagatccgattcccgctggtg 473
>emb|BX061292.1|CNS09JGG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42AA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 916 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 454 aagcagttccacaactcgaagatccgattcccgctggtg 416
>emb|BX061291.1|CNS09JGF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42AA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 916 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 442 aagcagttccacaactcgaagatccgattcccgctggtg 480
>emb|BX061184.1|CNS09JDG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41DD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 947 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 442 aagcagttccacaactcgaagatccgattcccgctggtg 480
>emb|BX060474.1|CNS09ITQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40DD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 892 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 463 aagcagttccacaactcgaagatccgattcccgctggtg 501
>emb|BX060315.1|CNS09IPB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40CE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 801 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 391 aagcagttccacaactcgaagatccgattcccgctggtg 353
>emb|BX060314.1|CNS09IPA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40CE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 596 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 451 aagcagttccacaactcgaagatccgattcccgctggtg 489
>emb|BX060072.1|CNS09IIK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40BC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1043 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 698 aagcagttccacaactcgaagatccgattcccgctggtg 736
>emb|BX059980.1|CNS09IG0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40AF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 947 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 464 aagcagttccacaactcgaagatccgattcccgctggtg 426
>emb|BX059979.1|CNS09IFZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40AF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 755 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 456 aagcagttccacaactcgaagatccgattcccgctggtg 494
>emb|BX059598.1|CNS09I5E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC4CB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 901 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 450 aagcagttccacaactcgaagatccgattcccgctggtg 412
>emb|BX059597.1|CNS09I5D Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4CB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 945 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 454 aagcagttccacaactcgaagatccgattcccgctggtg 492
>emb|BX059276.1|CNS09HWG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4AB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 949 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 436 aagcagttccacaactcgaagatccgattcccgctggtg 474
>emb|BX059262.1|CNS09HW2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4AA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 949 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 461 aagcagttccacaactcgaagatccgattcccgctggtg 499
>emb|BX059231.1|CNS09HV7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39DH06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 437 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 57 aagcagttccacaactcgaagatccgattcccgctggtg 19
>emb|BX059230.1|CNS09HV6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39DH06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 954 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 442 aagcagttccacaactcgaagatccgattcccgctggtg 480
>emb|BX058872.1|CNS09HL8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39BH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 938 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 422 aagcagttccacaactcgaagatccgattcccgctggtg 384
>emb|BX058871.1|CNS09HL7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39BH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 928 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 425 aagcagttccacaactcgaagatccgattcccgctggtg 463
>emb|BX058808.1|CNS09HJG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39BE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 905 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 434 aagcagttccacaactcgaagatccgattcccgctggtg 396
>emb|BX058807.1|CNS09HJF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39BE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 932 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 424 aagcagttccacaactcgaagatccgattcccgctggtg 462
>emb|BX058560.1|CNS09HCK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39AB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 955 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 439 aagcagttccacaactcgaagatccgattcccgctggtg 401
>emb|BX058559.1|CNS09HCJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39AB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 690 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 440 aagcagttccacaactcgaagatccgattcccgctggtg 478
>emb|BX058281.1|CNS09H4T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC38CD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 976 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 458 aagcagttccacaactcgaagatccgattcccgctggtg 420
>emb|BX058280.1|CNS09H4S Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38CD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 958 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 459 aagcagttccacaactcgaagatccgattcccgctggtg 497
>emb|BX058269.1|CNS09H4H Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38CC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 738 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 388 aagcagttccacaactcgaagatccgattcccgctggtg 426
>emb|BX056753.1|CNS09FYD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC36BC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 559 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 455 aagcagttccacaactcgaagatccgattcccgctggtg 417
>emb|BX056602.1|CNS09FU6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC36AB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 575 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 65 aagcagttccacaactcgaagatccgattcccgctggtg 27
>emb|BX056601.1|CNS09FU5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36AB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 925 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 419 aagcagttccacaactcgaagatccgattcccgctggtg 457
>emb|BX057958.1|CNS09GVU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38AE09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 942 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 432 aagcagttccacaactcgaagatccgattcccgctggtg 470
>emb|BX056891.1|CNS09G27 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36CC03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 779 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 453 aagcagttccacaactcgaagatccgattcccgctggtg 491
>emb|BX056571.1|CNS09FTB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35DH08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 896 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 386 aagcagttccacaactcgaagatccgattcccgctggtg 424
>emb|BX056553.1|CNS09FST Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC35DG07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 847 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 448 aagcagttccacaactcgaagatccgattcccgctggtg 410
>emb|BX056552.1|CNS09FSS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35DG07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 739 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 422 aagcagttccacaactcgaagatccgattcccgctggtg 460
>emb|BX056479.1|CNS09FQR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC35DB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 833 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 444 aagcagttccacaactcgaagatccgattcccgctggtg 406
>emb|BX056478.1|CNS09FQQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35DB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 861 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 432 aagcagttccacaactcgaagatccgattcccgctggtg 470
>emb|BX056309.1|CNS09FM1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35CB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 927 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 431 aagcagttccacaactcgaagatccgattcccgctggtg 469
>emb|BX056040.1|CNS09FEK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC34DG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 651 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 453 aagcagttccacaactcgaagatccgattcccgctggtg 415
>emb|BX056039.1|CNS09FEJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC34DG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 844 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 450 aagcagttccacaactcgaagatccgattcccgctggtg 488
>emb|BX055724.1|CNS09F5S Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC34BH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 983 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 473 aagcagttccacaactcgaagatccgattcccgctggtg 435
>emb|BX055723.1|CNS09F5R Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC34BH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 934 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 430 aagcagttccacaactcgaagatccgattcccgctggtg 468
>emb|BX055717.1|CNS09F5L Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC34BG10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 544 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 471 aagcagttccacaactcgaagatccgattcccgctggtg 433
>emb|BX055643.1|CNS09F3J Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC34BD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 911 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 474 aagcagttccacaactcgaagatccgattcccgctggtg 436
>emb|BX055642.1|CNS09F3I Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC34BD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 942 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 448 aagcagttccacaactcgaagatccgattcccgctggtg 486
>emb|BX055566.1|CNS09F1E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC34AH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 474 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 445 aagcagttccacaactcgaagatccgattcccgctggtg 407
>emb|BX055565.1|CNS09F1D Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC34AH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 957 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 470 aagcagttccacaactcgaagatccgattcccgctggtg 508
>emb|BX055542.1|CNS09F0Q Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC34AG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 892 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 453 aagcagttccacaactcgaagatccgattcccgctggtg 415
>emb|BX055541.1|CNS09F0P Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC34AG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 944 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 456 aagcagttccacaactcgaagatccgattcccgctggtg 494
>emb|BX055478.1|CNS09EYY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC34AE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 942 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 434 aagcagttccacaactcgaagatccgattcccgctggtg 396
>emb|BX055405.1|CNS09EWX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC34AA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 432 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 341 aagcagttccacaactcgaagatccgattcccgctggtg 303
>emb|BX055404.1|CNS09EWW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC34AA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 858 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 460 aagcagttccacaactcgaagatccgattcccgctggtg 498
>emb|BX055221.1|CNS09ERT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC33DA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 947 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 446 aagcagttccacaactcgaagatccgattcccgctggtg 484
>emb|BX053165.1|CNS09D6P Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC30CG12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 891 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 412 aagcagttccacaactcgaagatccgattcccgctggtg 450
>emb|BX055118.1|CNS09EOY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC33CD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 692 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 399 aagcagttccacaactcgaagatccgattcccgctggtg 437
>emb|BX054551.1|CNS09E97 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC32DA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 565 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 437 aagcagttccacaactcgaagatccgattcccgctggtg 399
>emb|BX054550.1|CNS09E96 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC32DA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 752 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 438 aagcagttccacaactcgaagatccgattcccgctggtg 476
>emb|BX054490.1|CNS09E7I Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC32CF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 726 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 443 aagcagttccacaactcgaagatccgattcccgctggtg 405
>emb|BX054489.1|CNS09E7H Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC32CF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 775 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 453 aagcagttccacaactcgaagatccgattcccgctggtg 491
>emb|BX054096.1|CNS09DWK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC32AE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 512 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 473 aagcagttccacaactcgaagatccgattcccgctggtg 435
>emb|BX054095.1|CNS09DWJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC32AE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 737 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 452 aagcagttccacaactcgaagatccgattcccgctggtg 490
>emb|BX053786.1|CNS09DNY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC31CF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 716 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 300 aagcagttccacaactcgaagatccgattcccgctggtg 338
>emb|BX052786.1|CNS09CW6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC30AD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 891 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 462 aagcagttccacaactcgaagatccgattcccgctggtg 424
>emb|BX052785.1|CNS09CW5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC30AD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 909 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 455 aagcagttccacaactcgaagatccgattcccgctggtg 493
>emb|BX052679.1|CNS09CT7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC3DF03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 948 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 448 aagcagttccacaactcgaagatccgattcccgctggtg 410
>emb|BX052678.1|CNS09CT6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC3DF03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 734 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 290 aagcagttccacaactcgaagatccgattcccgctggtg 328
>emb|BX052629.1|CNS09CRT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC3DC03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 824 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 444 aagcagttccacaactcgaagatccgattcccgctggtg 406
>emb|BX052628.1|CNS09CRS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC3DC03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 698 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 292 aagcagttccacaactcgaagatccgattcccgctggtg 330
>emb|BX052573.1|CNS09CQ9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC3CH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 950 Score = 54.0 bits (27), Expect = 6e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 483 aagcagttccacaactcgaagatcaagttcccgctggtg 521 |||||||||||||||||||||||| |||||||||||| Sbjct: 450 aagcagttccacaactcgaagatccgattcccgctggtg 412 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,619,953 Number of Sequences: 3902068 Number of extensions: 4619953 Number of successful extensions: 92327 Number of sequences better than 10.0: 653 Number of HSP's better than 10.0 without gapping: 653 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 90214 Number of HSP's gapped (non-prelim): 2077 length of query: 659 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 636 effective length of database: 17,143,297,704 effective search space: 10903137339744 effective search space used: 10903137339744 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
