>gb|AC105898.2| Drosophila melanogaster clone BACR25P15, complete sequence
          Length = 169913

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 253   ggaaaaggctcacagtttcaa 273
             |||||||||||||||||||||
Sbjct: 38403 ggaaaaggctcacagtttcaa 38383

>ref|XM_662640.1| Cryptosporidium hominis TU502 hypothetical protein (Chro.10070)
            partial mRNA
          Length = 7941

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 356  aggggtctgaggatgaattat 376
            |||||||||||||||||||||
Sbjct: 5459 aggggtctgaggatgaattat 5479

>gb|AC151744.23| Medicago truncatula clone mth2-32k10, complete sequence
          Length = 110897

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 494   gtgtaatggtatgtagtactt 514
             |||||||||||||||||||||
Sbjct: 60288 gtgtaatggtatgtagtactt 60308

>gb|AC072022.19| Homo sapiens 3 BAC RP11-211G3 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 125395

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 188   agagggaactggttatccttg 208
             |||||||||||||||||||||
Sbjct: 48283 agagggaactggttatccttg 48263

>ref|XM_627913.1| Cryptosporidium parvum Iowa II hypothetical protein (cgd1_590),
            partial mRNA
          Length = 7584

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 356  aggggtctgaggatgaattat 376
            |||||||||||||||||||||
Sbjct: 5456 aggggtctgaggatgaattat 5476

>gb|AE003585.5| Drosophila melanogaster chromosome 2L, section 6 of 83 of the complete
              sequence
          Length = 343161

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 253    ggaaaaggctcacagtttcaa 273
              |||||||||||||||||||||
Sbjct: 221486 ggaaaaggctcacagtttcaa 221466

>gb|AC003945.1|AC003945 Drosophila melanogaster (P1 DS05247 (D90)) DNA sequence, complete
             sequence
          Length = 53865

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 253   ggaaaaggctcacagtttcaa 273
             |||||||||||||||||||||
Sbjct: 38149 ggaaaaggctcacagtttcaa 38129

>gb|AC073363.10| Homo sapiens 3 BAC RP11-293N1 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 184092

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 241    agcatgaggactggaaaagg 260
              ||||||||||||||||||||
Sbjct: 181230 agcatgaggactggaaaagg 181249

>gb|CP000254.1| Methanospirillum hungatei JF-1, complete genome
          Length = 3544738

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 193    gaactggttatccttgatgacaaa 216
              |||||||||||||||||| |||||
Sbjct: 265923 gaactggttatccttgataacaaa 265946

>emb|AL391686.10| Human DNA sequence from clone CTB-BR164I22 on chromosome 10, complete
             sequence
          Length = 59938

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 109   tttgggagggacatgttgct 128
             ||||||||||||||||||||
Sbjct: 52709 tttgggagggacatgttgct 52728

>gb|AC007817.7|AC007817 Drosophila melanogaster, chromosome 3R, region 98A-98B, BAC clone
             BACR15D01, complete sequence
          Length = 180499

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 268   tttcaaaagattccaagaag 287
             ||||||||||||||||||||
Sbjct: 77806 tttcaaaagattccaagaag 77787

>gb|AC007750.3| Homo sapiens BAC clone RP11-576I16 from 2, complete sequence
          Length = 163681

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 221  ctgataagatcatctcagttagca 244
            ||||||||||||||||||| ||||
Sbjct: 1913 ctgataagatcatctcagtgagca 1890

>gb|AE003761.2| Drosophila melanogaster chromosome 3R, section 99 of 118 of the complete
              sequence
          Length = 224910

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 268    tttcaaaagattccaagaag 287
              ||||||||||||||||||||
Sbjct: 126992 tttcaaaagattccaagaag 126973

>emb|AL929178.7| Mouse DNA sequence from clone RP23-77M17 on chromosome 2, complete
             sequence
          Length = 100057

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 160   gattatgacatcatggctgt 179
             ||||||||||||||||||||
Sbjct: 75298 gattatgacatcatggctgt 75317


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,137,481
Number of Sequences: 3902068
Number of extensions: 4137481
Number of successful extensions: 73513
Number of sequences better than 10.0: 14
Number of HSP's better than 10.0 without gapping: 14
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 73478
Number of HSP's gapped (non-prelim): 35
length of query: 586
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 563
effective length of database: 17,143,297,704
effective search space: 9651676607352
effective search space used: 9651676607352
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)