Clone Name	bags18e07
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	ref|NM_192099.1| Oryza sativa (japonica cultivar-group), predic...	196	2e-47
2	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	196	2e-47
3	dbj|AP003452.3| Oryza sativa (japonica cultivar-group) genomic D...	196	2e-47
4	dbj|AP003455.2| Oryza sativa (japonica cultivar-group) genomic D...	196	2e-47
5	dbj|AK121587.1| Oryza sativa (japonica cultivar-group) cDNA clon...	196	2e-47
6	dbj|AK098893.1| Oryza sativa (japonica cultivar-group) cDNA clon...	196	2e-47
7	dbj|AK060428.1| Oryza sativa (japonica cultivar-group) cDNA clon...	196	2e-47
8	dbj|D38231.1|RICGPBSLP Oryza sativa (japonica cultivar-group) RW...	196	2e-47
9	dbj|AK098877.1| Oryza sativa (japonica cultivar-group) cDNA clon...	188	5e-45
10	gb|BT017990.1| Zea mays clone EL01N0526B03.c mRNA sequence	157	2e-35
11	gb|BT016269.1| Zea mays clone Contig102 mRNA sequence	157	2e-35
12	gb|AY103919.1| Zea mays PCO099246 mRNA sequence	157	2e-35
13	gb|BT016705.1| Zea mays clone Contig538 mRNA sequence	129	4e-27
14	ref|XM_475866.1| Oryza sativa (japonica cultivar-group), predic...	84	2e-13
15	gb|AC129717.3| Oryza sativa (japonica cultivar-group) chromosome...	84	2e-13
16	gb|AC135925.2| Oryza sativa (japonica cultivar-group) chromosome...	84	2e-13
17	dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D...	84	2e-13
18	dbj|AK121567.1| Oryza sativa (japonica cultivar-group) cDNA clon...	84	2e-13
19	dbj|AK065272.1| Oryza sativa (japonica cultivar-group) cDNA clon...	84	2e-13
20	dbj|AK062179.1| Oryza sativa (japonica cultivar-group) cDNA clon...	84	2e-13
21	emb|Y08678.1|MSGB1 Medicago sativa mRNA for G protein beta subun...	68	1e-08
22	gb|DQ284489.1| Solanum tuberosum clone 042G03 ArcA2 protein-like...	66	5e-08
23	emb|X53574.1|CRGPLP C. reinhardtii Cblp gene for a G protein bet...	54	2e-04
24	gb|DQ122897.1| Chlamydomonas incerta G protein beta subunit-like...	54	2e-04
25	emb|BX067788.1|CNS09OGW Single read from an extremity of a full-...	52	7e-04
26	gb|BT012967.1| Lycopersicon esculentum clone 114159R, mRNA sequence	48	0.012
27	emb|BX019636.1|CNS08NBC Single read from an extremity of a full-...	48	0.012
28	gb|DQ073456.1| Choristoneura fumiferana activated C kinase 1 rec...	48	0.012
29	gb|DQ073455.1| Choristoneura fumiferana activated C kinase 1 rec...	48	0.012
30	dbj|AB022687.1| Lycopersicon esculentum mRNA for LeArcA2 protein...	48	0.012
31	dbj|AB180244.1| Fusarium oxysporum fgb2 gene for G-protein beta ...	48	0.012
32	emb|BX053466.1|CNS09DF2 Single read from an extremity of a full-...	46	0.046
33	emb|BX053465.1|CNS09DF1 Single read from an extremity of a full-...	46	0.046
34	emb|BX053355.1|CNS09DBZ Single read from an extremity of a full-...	46	0.046
35	emb|BX053354.1|CNS09DBY Single read from an extremity of a full-...	46	0.046
36	emb|BX025426.1|CNS08RS6 Single read from an extremity of a full-...	46	0.046
37	emb|BX024636.1|CNS08R68 Single read from an extremity of a full-...	46	0.046
38	emb|BX072073.1|CNS09RRX Single read from an extremity of a full-...	46	0.046
39	emb|BX071929.1|CNS09RNX Single read from an extremity of a full-...	46	0.046
40	emb|BX071928.1|CNS09RNW Single read from an extremity of a full-...	46	0.046
41	emb|BX071907.1|CNS09RNB Single read from an extremity of a full-...	46	0.046
42	emb|BX071775.1|CNS09RJN Single read from an extremity of a full-...	46	0.046
43	emb|BX071774.1|CNS09RJM Single read from an extremity of a full-...	46	0.046
44	emb|BX071717.1|CNS09RI1 Single read from an extremity of a full-...	46	0.046
45	emb|BX071716.1|CNS09RI0 Single read from an extremity of a full-...	46	0.046
46	emb|BX071585.1|CNS09RED Single read from an extremity of a full-...	46	0.046
47	emb|BX071503.1|CNS09RC3 Single read from an extremity of a full-...	46	0.046
48	emb|BX071502.1|CNS09RC2 Single read from an extremity of a full-...	46	0.046
49	emb|BX071037.1|CNS09QZ5 Single read from an extremity of a full-...	46	0.046
50	emb|BX070960.1|CNS09QX0 Single read from an extremity of a full-...	46	0.046
51	emb|BX070941.1|CNS09QWH Single read from an extremity of a full-...	46	0.046
52	emb|BX070940.1|CNS09QWG Single read from an extremity of a full-...	46	0.046
53	emb|BX070678.1|CNS09QP6 Single read from an extremity of a full-...	46	0.046
54	emb|BX070378.1|CNS09QGU Single read from an extremity of a full-...	46	0.046
55	emb|BX070186.1|CNS09QBI Single read from an extremity of a full-...	46	0.046
56	emb|BX069856.1|CNS09Q2C Single read from an extremity of a full-...	46	0.046
57	emb|BX069855.1|CNS09Q2B Single read from an extremity of a full-...	46	0.046
58	emb|BX069810.1|CNS09Q12 Single read from an extremity of a full-...	46	0.046
59	emb|BX069809.1|CNS09Q11 Single read from an extremity of a full-...	46	0.046
60	emb|BX069778.1|CNS09Q06 Single read from an extremity of a full-...	46	0.046
61	emb|BX069777.1|CNS09Q05 Single read from an extremity of a full-...	46	0.046
62	emb|BX069457.1|CNS09PR9 Single read from an extremity of a full-...	46	0.046
63	emb|BX069079.1|CNS09PGR Single read from an extremity of a full-...	46	0.046
64	emb|BX069078.1|CNS09PGQ Single read from an extremity of a full-...	46	0.046
65	emb|BX068759.1|CNS09P7V Single read from an extremity of a full-...	46	0.046
66	emb|BX068758.1|CNS09P7U Single read from an extremity of a full-...	46	0.046
67	emb|BX068670.1|CNS09P5E Single read from an extremity of a full-...	46	0.046
68	emb|BX068658.1|CNS09P52 Single read from an extremity of a full-...	46	0.046
69	emb|BX068657.1|CNS09P51 Single read from an extremity of a full-...	46	0.046
70	emb|BX068642.1|CNS09P4M Single read from an extremity of a full-...	46	0.046
71	emb|BX068439.1|CNS09OYZ Single read from an extremity of a full-...	46	0.046
72	emb|BX068364.1|CNS09OWW Single read from an extremity of a full-...	46	0.046
73	emb|BX068249.1|CNS09OTP Single read from an extremity of a full-...	46	0.046
74	emb|BX068234.1|CNS09OTA Single read from an extremity of a full-...	46	0.046
75	emb|BX068233.1|CNS09OT9 Single read from an extremity of a full-...	46	0.046
76	emb|BX068228.1|CNS09OT4 Single read from an extremity of a full-...	46	0.046
77	emb|BX068198.1|CNS09OSA Single read from an extremity of a full-...	46	0.046
78	emb|BX068197.1|CNS09OS9 Single read from an extremity of a full-...	46	0.046
79	emb|BX068108.1|CNS09OPS Single read from an extremity of a full-...	46	0.046
80	emb|BX068107.1|CNS09OPR Single read from an extremity of a full-...	46	0.046
81	emb|BX068050.1|CNS09OO6 Single read from an extremity of a full-...	46	0.046
82	emb|BX068049.1|CNS09OO5 Single read from an extremity of a full-...	46	0.046
83	emb|BX068035.1|CNS09ONR Single read from an extremity of a full-...	46	0.046
84	emb|BX068018.1|CNS09ONA Single read from an extremity of a full-...	46	0.046
85	emb|BX068017.1|CNS09ON9 Single read from an extremity of a full-...	46	0.046
86	emb|BX067955.1|CNS09OLJ Single read from an extremity of a full-...	46	0.046
87	emb|BX067894.1|CNS09OJU Single read from an extremity of a full-...	46	0.046
88	emb|BX067874.1|CNS09OJA Single read from an extremity of a full-...	46	0.046
89	emb|BX067850.1|CNS09OIM Single read from an extremity of a full-...	46	0.046
90	emb|BX067849.1|CNS09OIL Single read from an extremity of a full-...	46	0.046
91	emb|BX067804.1|CNS09OHC Single read from an extremity of a full-...	46	0.046
92	emb|BX067803.1|CNS09OHB Single read from an extremity of a full-...	46	0.046
93	emb|BX067787.1|CNS09OGV Single read from an extremity of a full-...	46	0.046
94	emb|BX067705.1|CNS09OEL Single read from an extremity of a full-...	46	0.046
95	emb|BX067646.1|CNS09OCY Single read from an extremity of a full-...	46	0.046
96	emb|BX067645.1|CNS09OCX Single read from an extremity of a full-...	46	0.046
97	emb|BX067635.1|CNS09OCN Single read from an extremity of a full-...	46	0.046
98	emb|BX067585.1|CNS09OB9 Single read from an extremity of a full-...	46	0.046
99	emb|BX067584.1|CNS09OB8 Single read from an extremity of a full-...	46	0.046
100	emb|BX067492.1|CNS09O8O Single read from an extremity of a full-...	46	0.046
101	emb|BX067491.1|CNS09O8N Single read from an extremity of a full-...	46	0.046
102	emb|BX066978.1|CNS09NUE Single read from an extremity of a full-...	46	0.046
103	emb|BX066951.1|CNS09NTN Single read from an extremity of a full-...	46	0.046
104	emb|BX066950.1|CNS09NTM Single read from an extremity of a full-...	46	0.046
105	emb|BX066945.1|CNS09NTH Single read from an extremity of a full-...	46	0.046
106	emb|BX066944.1|CNS09NTG Single read from an extremity of a full-...	46	0.046
107	emb|BX066941.1|CNS09NTD Single read from an extremity of a full-...	46	0.046
108	emb|BX066940.1|CNS09NTC Single read from an extremity of a full-...	46	0.046
109	emb|BX066917.1|CNS09NSP Single read from an extremity of a full-...	46	0.046
110	emb|BX066916.1|CNS09NSO Single read from an extremity of a full-...	46	0.046
111	emb|BX066784.1|CNS09NP0 Single read from an extremity of a full-...	46	0.046
112	emb|BX066716.1|CNS09NN4 Single read from an extremity of a full-...	46	0.046
113	emb|BX066638.1|CNS09NKY Single read from an extremity of a full-...	46	0.046
114	emb|BX066637.1|CNS09NKX Single read from an extremity of a full-...	46	0.046
115	emb|BX066110.1|CNS09N6A Single read from an extremity of a full-...	46	0.046
116	emb|BX066109.1|CNS09N69 Single read from an extremity of a full-...	46	0.046
117	emb|BX066047.1|CNS09N4J Single read from an extremity of a full-...	46	0.046
118	emb|BX066046.1|CNS09N4I Single read from an extremity of a full-...	46	0.046
119	emb|BX065996.1|CNS09N34 Single read from an extremity of a full-...	46	0.046
120	emb|BX065949.1|CNS09N1T Single read from an extremity of a full-...	46	0.046
121	emb|BX065948.1|CNS09N1S Single read from an extremity of a full-...	46	0.046
122	emb|BX065904.1|CNS09N0K Single read from an extremity of a full-...	46	0.046
123	emb|BX065815.1|CNS09MY3 Single read from an extremity of a full-...	46	0.046
124	emb|BX065814.1|CNS09MY2 Single read from an extremity of a full-...	46	0.046
125	emb|BX065711.1|CNS09MV7 Single read from an extremity of a full-...	46	0.046
126	emb|BX065710.1|CNS09MV6 Single read from an extremity of a full-...	46	0.046
127	emb|BX065604.1|CNS09MS8 Single read from an extremity of a full-...	46	0.046
128	emb|BX065506.1|CNS09MPI Single read from an extremity of a full-...	46	0.046
129	emb|BX065505.1|CNS09MPH Single read from an extremity of a full-...	46	0.046
130	emb|BX065387.1|CNS09MM7 Single read from an extremity of a full-...	46	0.046
131	emb|BX065386.1|CNS09MM6 Single read from an extremity of a full-...	46	0.046
132	emb|BX065353.1|CNS09ML9 Single read from an extremity of a full-...	46	0.046
133	emb|BX065352.1|CNS09ML8 Single read from an extremity of a full-...	46	0.046
134	emb|BX065157.1|CNS09MFT Single read from an extremity of a full-...	46	0.046
135	emb|BX065023.1|CNS09MC3 Single read from an extremity of a full-...	46	0.046
136	emb|BX065022.1|CNS09MC2 Single read from an extremity of a full-...	46	0.046
137	emb|BX064965.1|CNS09MAH Single read from an extremity of a full-...	46	0.046
138	emb|BX064964.1|CNS09MAG Single read from an extremity of a full-...	46	0.046
139	emb|BX064854.1|CNS09M7E Single read from an extremity of a full-...	46	0.046
140	emb|BX064853.1|CNS09M7D Single read from an extremity of a full-...	46	0.046
141	emb|BX064529.1|CNS09LYD Single read from an extremity of a full-...	46	0.046
142	emb|BX064405.1|CNS09LUX Single read from an extremity of a full-...	46	0.046
143	emb|BX064360.1|CNS09LTO Single read from an extremity of a full-...	46	0.046
144	emb|BX064271.1|CNS09LR7 Single read from an extremity of a full-...	46	0.046
145	emb|BX064270.1|CNS09LR6 Single read from an extremity of a full-...	46	0.046
146	emb|BX064233.1|CNS09LQ5 Single read from an extremity of a full-...	46	0.046
147	emb|BX064232.1|CNS09LQ4 Single read from an extremity of a full-...	46	0.046
148	emb|BX064196.1|CNS09LP4 Single read from an extremity of a full-...	46	0.046
149	emb|BX064129.1|CNS09LN9 Single read from an extremity of a full-...	46	0.046
150	emb|BX064128.1|CNS09LN8 Single read from an extremity of a full-...	46	0.046
151	emb|BX063936.1|CNS09LHW Single read from an extremity of a full-...	46	0.046
152	emb|BX063919.1|CNS09LHF Single read from an extremity of a full-...	46	0.046
153	emb|BX063918.1|CNS09LHE Single read from an extremity of a full-...	46	0.046
154	emb|BX063471.1|CNS09L4Z Single read from an extremity of a full-...	46	0.046
155	emb|BX063470.1|CNS09L4Y Single read from an extremity of a full-...	46	0.046
156	emb|BX063359.1|CNS09L1V Single read from an extremity of a full-...	46	0.046
157	emb|BX063358.1|CNS09L1U Single read from an extremity of a full-...	46	0.046
158	emb|BX063357.1|CNS09L1T Single read from an extremity of a full-...	46	0.046
159	emb|BX063356.1|CNS09L1S Single read from an extremity of a full-...	46	0.046
160	emb|BX063204.1|CNS09KXK Single read from an extremity of a full-...	46	0.046
161	emb|BX063203.1|CNS09KXJ Single read from an extremity of a full-...	46	0.046
162	emb|BX063052.1|CNS09KTC Single read from an extremity of a full-...	46	0.046
163	emb|BX063051.1|CNS09KTB Single read from an extremity of a full-...	46	0.046
164	emb|BX063016.1|CNS09KSC Single read from an extremity of a full-...	46	0.046
165	emb|BX063014.1|CNS09KSA Single read from an extremity of a full-...	46	0.046
166	emb|BX062938.1|CNS09KQ6 Single read from an extremity of a full-...	46	0.046
167	emb|BX062802.1|CNS09KME Single read from an extremity of a full-...	46	0.046
168	emb|BX062794.1|CNS09KM6 Single read from an extremity of a full-...	46	0.046
169	emb|BX062793.1|CNS09KM5 Single read from an extremity of a full-...	46	0.046
170	emb|BX062775.1|CNS09KLN Single read from an extremity of a full-...	46	0.046
171	emb|BX062774.1|CNS09KLM Single read from an extremity of a full-...	46	0.046
172	emb|BX062707.1|CNS09KJR Single read from an extremity of a full-...	46	0.046
173	emb|BX062706.1|CNS09KJQ Single read from an extremity of a full-...	46	0.046
174	emb|BX062617.1|CNS09KH9 Single read from an extremity of a full-...	46	0.046
175	emb|BX062616.1|CNS09KH8 Single read from an extremity of a full-...	46	0.046
176	emb|BX062615.1|CNS09KH7 Single read from an extremity of a full-...	46	0.046
177	emb|BX062614.1|CNS09KH6 Single read from an extremity of a full-...	46	0.046
178	emb|BX062265.1|CNS09K7H Single read from an extremity of a full-...	46	0.046
179	emb|BX062264.1|CNS09K7G Single read from an extremity of a full-...	46	0.046
180	emb|BX062196.1|CNS09K5K Single read from an extremity of a full-...	46	0.046
181	emb|BX062195.1|CNS09K5J Single read from an extremity of a full-...	46	0.046
182	emb|BX062152.1|CNS09K4C Single read from an extremity of a full-...	46	0.046
183	emb|BX062151.1|CNS09K4B Single read from an extremity of a full-...	46	0.046
184	emb|BX062132.1|CNS09K3S Single read from an extremity of a full-...	46	0.046
185	emb|BX062131.1|CNS09K3R Single read from an extremity of a full-...	46	0.046
186	emb|BX062052.1|CNS09K1K Single read from an extremity of a full-...	46	0.046
187	emb|BX061984.1|CNS09JZO Single read from an extremity of a full-...	46	0.046
188	emb|BX061983.1|CNS09JZN Single read from an extremity of a full-...	46	0.046
189	emb|BX061962.1|CNS09JZ2 Single read from an extremity of a full-...	46	0.046
190	emb|BX061961.1|CNS09JZ1 Single read from an extremity of a full-...	46	0.046
191	emb|BX061891.1|CNS09JX3 Single read from an extremity of a full-...	46	0.046
192	emb|BX061890.1|CNS09JX2 Single read from an extremity of a full-...	46	0.046
193	emb|BX061867.1|CNS09JWF Single read from an extremity of a full-...	46	0.046
194	emb|BX061866.1|CNS09JWE Single read from an extremity of a full-...	46	0.046
195	emb|BX061808.1|CNS09JUS Single read from an extremity of a full-...	46	0.046
196	emb|BX061807.1|CNS09JUR Single read from an extremity of a full-...	46	0.046
197	emb|BX061804.1|CNS09JUO Single read from an extremity of a full-...	46	0.046
198	emb|BX061803.1|CNS09JUN Single read from an extremity of a full-...	46	0.046
199	emb|BX061784.1|CNS09JU4 Single read from an extremity of a full-...	46	0.046
200	emb|BX061783.1|CNS09JU3 Single read from an extremity of a full-...	46	0.046
201	emb|BX061677.1|CNS09JR5 Single read from an extremity of a full-...	46	0.046
202	emb|BX061676.1|CNS09JR4 Single read from an extremity of a full-...	46	0.046
203	emb|BX061589.1|CNS09JOP Single read from an extremity of a full-...	46	0.046
204	emb|BX061588.1|CNS09JOO Single read from an extremity of a full-...	46	0.046
205	emb|BX061562.1|CNS09JNY Single read from an extremity of a full-...	46	0.046
206	emb|BX061561.1|CNS09JNX Single read from an extremity of a full-...	46	0.046
207	emb|BX061522.1|CNS09JMU Single read from an extremity of a full-...	46	0.046
208	emb|BX061521.1|CNS09JMT Single read from an extremity of a full-...	46	0.046
209	emb|BX061174.1|CNS09JD6 Single read from an extremity of a full-...	46	0.046
210	emb|BX061173.1|CNS09JD5 Single read from an extremity of a full-...	46	0.046
211	emb|BX060748.1|CNS09J1C Single read from an extremity of a full-...	46	0.046
212	emb|BX060747.1|CNS09J1B Single read from an extremity of a full-...	46	0.046
213	emb|BX060414.1|CNS09IS2 Single read from an extremity of a full-...	46	0.046
214	emb|BX060410.1|CNS09IRY Single read from an extremity of a full-...	46	0.046
215	emb|BX060409.1|CNS09IRX Single read from an extremity of a full-...	46	0.046
216	emb|BX060393.1|CNS09IRH Single read from an extremity of a full-...	46	0.046
217	emb|BX060392.1|CNS09IRG Single read from an extremity of a full-...	46	0.046
218	emb|BX060282.1|CNS09IOE Single read from an extremity of a full-...	46	0.046
219	emb|BX060281.1|CNS09IOD Single read from an extremity of a full-...	46	0.046
220	emb|BX060076.1|CNS09IIO Single read from an extremity of a full-...	46	0.046
221	emb|BX060049.1|CNS09IHX Single read from an extremity of a full-...	46	0.046
222	emb|BX060048.1|CNS09IHW Single read from an extremity of a full-...	46	0.046
223	emb|BX059646.1|CNS09I6Q Single read from an extremity of a full-...	46	0.046
224	emb|BX059637.1|CNS09I6H Single read from an extremity of a full-...	46	0.046
225	emb|BX059608.1|CNS09I5O Single read from an extremity of a full-...	46	0.046
226	emb|BX059419.1|CNS09I0F Single read from an extremity of a full-...	46	0.046
227	emb|BX059418.1|CNS09I0E Single read from an extremity of a full-...	46	0.046
228	emb|BX059402.1|CNS09HZY Single read from an extremity of a full-...	46	0.046
229	emb|BX059401.1|CNS09HZX Single read from an extremity of a full-...	46	0.046
230	emb|BX059380.1|CNS09HZC Single read from an extremity of a full-...	46	0.046
231	emb|BX059379.1|CNS09HZB Single read from an extremity of a full-...	46	0.046
232	emb|BX059205.1|CNS09HUH Single read from an extremity of a full-...	46	0.046
233	emb|BX059204.1|CNS09HUG Single read from an extremity of a full-...	46	0.046
234	emb|BX059163.1|CNS09HTB Single read from an extremity of a full-...	46	0.046
235	emb|BX059162.1|CNS09HTA Single read from an extremity of a full-...	46	0.046
236	emb|BX059100.1|CNS09HRK Single read from an extremity of a full-...	46	0.046
237	emb|BX059099.1|CNS09HRJ Single read from an extremity of a full-...	46	0.046
238	emb|BX059084.1|CNS09HR4 Single read from an extremity of a full-...	46	0.046
239	emb|BX059083.1|CNS09HR3 Single read from an extremity of a full-...	46	0.046
240	emb|BX058995.1|CNS09HON Single read from an extremity of a full-...	46	0.046
241	emb|BX058994.1|CNS09HOM Single read from an extremity of a full-...	46	0.046
242	emb|BX058960.1|CNS09HNO Single read from an extremity of a full-...	46	0.046
243	emb|BX058959.1|CNS09HNN Single read from an extremity of a full-...	46	0.046
244	emb|BX058601.1|CNS09HDP Single read from an extremity of a full-...	46	0.046
245	emb|BX058573.1|CNS09HCX Single read from an extremity of a full-...	46	0.046
246	emb|BX058506.1|CNS09HB2 Single read from an extremity of a full-...	46	0.046
247	emb|BX058489.1|CNS09HAL Single read from an extremity of a full-...	46	0.046
248	emb|BX058488.1|CNS09HAK Single read from an extremity of a full-...	46	0.046
249	emb|BX058259.1|CNS09H47 Single read from an extremity of a full-...	46	0.046
250	emb|BX058247.1|CNS09H3V Single read from an extremity of a full-...	46	0.046
251	emb|BX058246.1|CNS09H3U Single read from an extremity of a full-...	46	0.046
252	emb|BX058245.1|CNS09H3T Single read from an extremity of a full-...	46	0.046
253	emb|BX058224.1|CNS09H38 Single read from an extremity of a full-...	46	0.046
254	emb|BX058185.1|CNS09H25 Single read from an extremity of a full-...	46	0.046
255	emb|BX058171.1|CNS09H1R Single read from an extremity of a full-...	46	0.046
256	emb|BX058170.1|CNS09H1Q Single read from an extremity of a full-...	46	0.046
257	emb|BX058051.1|CNS09GYF Single read from an extremity of a full-...	46	0.046
258	emb|BX058021.1|CNS09GXL Single read from an extremity of a full-...	46	0.046
259	emb|BX058020.1|CNS09GXK Single read from an extremity of a full-...	46	0.046
260	emb|BX056697.1|CNS09FWT Single read from an extremity of a full-...	46	0.046
261	emb|BX057882.1|CNS09GTQ Single read from an extremity of a full-...	46	0.046
262	emb|BX057881.1|CNS09GTP Single read from an extremity of a full-...	46	0.046
263	emb|BX057715.1|CNS09GP3 Single read from an extremity of a full-...	46	0.046
264	emb|BX057645.1|CNS09GN5 Single read from an extremity of a full-...	46	0.046
265	emb|BX057618.1|CNS09GME Single read from an extremity of a full-...	46	0.046
266	emb|BX057555.1|CNS09GKN Single read from an extremity of a full-...	46	0.046
267	emb|BX057419.1|CNS09GGV Single read from an extremity of a full-...	46	0.046
268	emb|BX057418.1|CNS09GGU Single read from an extremity of a full-...	46	0.046
269	emb|BX057394.1|CNS09GG6 Single read from an extremity of a full-...	46	0.046
270	emb|BX057189.1|CNS09GAH Single read from an extremity of a full-...	46	0.046
271	emb|BX057124.1|CNS09G8O Single read from an extremity of a full-...	46	0.046
272	emb|BX055889.1|CNS09FAD Single read from an extremity of a full-...	46	0.046
273	emb|BX055888.1|CNS09FAC Single read from an extremity of a full-...	46	0.046
274	emb|BX056278.1|CNS09FL6 Single read from an extremity of a full-...	46	0.046
275	emb|BX056277.1|CNS09FL5 Single read from an extremity of a full-...	46	0.046
276	emb|BX056060.1|CNS09FF4 Single read from an extremity of a full-...	46	0.046
277	emb|BX056010.1|CNS09FDQ Single read from an extremity of a full-...	46	0.046
278	emb|BX055974.1|CNS09FCQ Single read from an extremity of a full-...	46	0.046
279	emb|BX055414.1|CNS09EX6 Single read from an extremity of a full-...	46	0.046
280	emb|BX055345.1|CNS09EV9 Single read from an extremity of a full-...	46	0.046
281	emb|BX055344.1|CNS09EV8 Single read from an extremity of a full-...	46	0.046
282	emb|BX055279.1|CNS09ETF Single read from an extremity of a full-...	46	0.046
283	emb|BX053270.1|CNS09D9M Single read from an extremity of a full-...	46	0.046
284	emb|BX053269.1|CNS09D9L Single read from an extremity of a full-...	46	0.046
285	emb|BX053130.1|CNS09D5Q Single read from an extremity of a full-...	46	0.046
286	emb|BX055048.1|CNS09EN0 Single read from an extremity of a full-...	46	0.046
287	emb|BX055047.1|CNS09EMZ Single read from an extremity of a full-...	46	0.046
288	emb|BX054966.1|CNS09EKQ Single read from an extremity of a full-...	46	0.046
289	emb|BX054945.1|CNS09EK5 Single read from an extremity of a full-...	46	0.046
290	emb|BX054931.1|CNS09EJR Single read from an extremity of a full-...	46	0.046
291	emb|BX054767.1|CNS09EF7 Single read from an extremity of a full-...	46	0.046
292	emb|BX054766.1|CNS09EF6 Single read from an extremity of a full-...	46	0.046
293	emb|BX054765.1|CNS09EF5 Single read from an extremity of a full-...	46	0.046
294	emb|BX053033.1|CNS09D31 Single read from an extremity of a full-...	46	0.046
295	emb|BX053032.1|CNS09D30 Single read from an extremity of a full-...	46	0.046
296	emb|BX053000.1|CNS09D24 Single read from an extremity of a full-...	46	0.046
297	emb|BX052999.1|CNS09D23 Single read from an extremity of a full-...	46	0.046
298	emb|BX052963.1|CNS09D13 Single read from an extremity of a full-...	46	0.046
299	emb|BX052919.1|CNS09CZV Single read from an extremity of a full-...	46	0.046
300	emb|BX054709.1|CNS09EDL Single read from an extremity of a full-...	46	0.046
301	emb|BX054708.1|CNS09EDK Single read from an extremity of a full-...	46	0.046
302	emb|BX054600.1|CNS09EAK Single read from an extremity of a full-...	46	0.046
303	emb|BX054576.1|CNS09E9W Single read from an extremity of a full-...	46	0.046
304	emb|BX054529.1|CNS09E8L Single read from an extremity of a full-...	46	0.046
305	emb|BX054528.1|CNS09E8K Single read from an extremity of a full-...	46	0.046
306	emb|BX054523.1|CNS09E8F Single read from an extremity of a full-...	46	0.046
307	emb|BX054522.1|CNS09E8E Single read from an extremity of a full-...	46	0.046
308	emb|BX054497.1|CNS09E7P Single read from an extremity of a full-...	46	0.046
309	emb|BX054389.1|CNS09E4P Single read from an extremity of a full-...	46	0.046
310	emb|BX054388.1|CNS09E4O Single read from an extremity of a full-...	46	0.046
311	emb|BX054299.1|CNS09E27 Single read from an extremity of a full-...	46	0.046
312	emb|BX053999.1|CNS09DTV Single read from an extremity of a full-...	46	0.046
313	emb|BX053716.1|CNS09DM0 Single read from an extremity of a full-...	46	0.046
314	emb|BX053571.1|CNS09DHZ Single read from an extremity of a full-...	46	0.046
315	emb|BX053570.1|CNS09DHY Single read from an extremity of a full-...	46	0.046
316	emb|BX053534.1|CNS09DGY Single read from an extremity of a full-...	46	0.046
317	emb|BX052899.1|CNS09CZB Single read from an extremity of a full-...	46	0.046
318	emb|BX052898.1|CNS09CZA Single read from an extremity of a full-...	46	0.046
319	emb|BX052832.1|CNS09CXG Single read from an extremity of a full-...	46	0.046
320	emb|BX052831.1|CNS09CXF Single read from an extremity of a full-...	46	0.046
321	emb|BX052827.1|CNS09CXB Single read from an extremity of a full-...	46	0.046
322	emb|BX052600.1|CNS09CR0 Single read from an extremity of a full-...	46	0.046
323	emb|BX052449.1|CNS09CMT Single read from an extremity of a full-...	46	0.046
324	emb|BX052448.1|CNS09CMS Single read from an extremity of a full-...	46	0.046
325	emb|BX052291.1|CNS09CIF Single read from an extremity of a full-...	46	0.046
326	emb|BX052243.1|CNS09CH3 Single read from an extremity of a full-...	46	0.046
327	emb|BX052242.1|CNS09CH2 Single read from an extremity of a full-...	46	0.046
328	emb|BX051997.1|CNS09CA9 Single read from an extremity of a full-...	46	0.046
329	emb|BX051743.1|CNS09C37 Single read from an extremity of a full-...	46	0.046
330	emb|BX051668.1|CNS09C14 Single read from an extremity of a full-...	46	0.046
331	emb|BX051623.1|CNS09BZV Single read from an extremity of a full-...	46	0.046
332	emb|BX050241.1|CNS09AXH Single read from an extremity of a full-...	46	0.046
333	emb|BX050240.1|CNS09AXG Single read from an extremity of a full-...	46	0.046
334	emb|BX050169.1|CNS09AVH Single read from an extremity of a full-...	46	0.046
335	emb|BX050139.1|CNS09AUN Single read from an extremity of a full-...	46	0.046
336	emb|BX050138.1|CNS09AUM Single read from an extremity of a full-...	46	0.046
337	emb|BX051263.1|CNS09BPV Single read from an extremity of a full-...	46	0.046
338	emb|BX051262.1|CNS09BPU Single read from an extremity of a full-...	46	0.046
339	emb|BX050756.1|CNS09BBS Single read from an extremity of a full-...	46	0.046
340	emb|BX050728.1|CNS09BB0 Single read from an extremity of a full-...	46	0.046
341	emb|BX050727.1|CNS09BAZ Single read from an extremity of a full-...	46	0.046
342	emb|BX050369.1|CNS09B11 Single read from an extremity of a full-...	46	0.046
343	emb|BX050368.1|CNS09B10 Single read from an extremity of a full-...	46	0.046
344	emb|BX050014.1|CNS09AR6 Single read from an extremity of a full-...	46	0.046
345	emb|BX049964.1|CNS09APS Single read from an extremity of a full-...	46	0.046
346	emb|BX049954.1|CNS09API Single read from an extremity of a full-...	46	0.046
347	emb|BX049953.1|CNS09APH Single read from an extremity of a full-...	46	0.046
348	emb|BX049828.1|CNS09AM0 Single read from an extremity of a full-...	46	0.046
349	emb|BX049827.1|CNS09ALZ Single read from an extremity of a full-...	46	0.046
350	emb|BX049768.1|CNS09AKC Single read from an extremity of a full-...	46	0.046
351	emb|BX049747.1|CNS09AJR Single read from an extremity of a full-...	46	0.046
352	emb|BX049746.1|CNS09AJQ Single read from an extremity of a full-...	46	0.046
353	emb|BX030975.1|CNS08W2B Single read from an extremity of a full-...	46	0.046
354	emb|BX030974.1|CNS08W2A Single read from an extremity of a full-...	46	0.046
355	emb|BX030868.1|CNS08VZC Single read from an extremity of a full-...	46	0.046
356	emb|BX049406.1|CNS09AAA Single read from an extremity of a full-...	46	0.046
357	emb|BX049245.1|CNS09A5T Single read from an extremity of a full-...	46	0.046
358	emb|BX049143.1|CNS09A2Z Single read from an extremity of a full-...	46	0.046
359	emb|BX049053.1|CNS09A0H Single read from an extremity of a full-...	46	0.046
360	emb|BX049052.1|CNS09A0G Single read from an extremity of a full-...	46	0.046
361	emb|BX049001.1|CNS099Z1 Single read from an extremity of a full-...	46	0.046
362	emb|BX048986.1|CNS099YM Single read from an extremity of a full-...	46	0.046
363	emb|BX048977.1|CNS099YD Single read from an extremity of a full-...	46	0.046
364	emb|BX048867.1|CNS099VB Single read from an extremity of a full-...	46	0.046
365	emb|BX048863.1|CNS099V7 Single read from an extremity of a full-...	46	0.046
366	emb|BX048862.1|CNS099V6 Single read from an extremity of a full-...	46	0.046
367	emb|BX048681.1|CNS099Q5 Single read from an extremity of a full-...	46	0.046
368	emb|BX048630.1|CNS099OQ Single read from an extremity of a full-...	46	0.046
369	emb|BX048629.1|CNS099OP Single read from an extremity of a full-...	46	0.046
370	emb|BX048624.1|CNS099OK Single read from an extremity of a full-...	46	0.046
371	emb|BX048623.1|CNS099OJ Single read from an extremity of a full-...	46	0.046
372	emb|BX048591.1|CNS099NN Single read from an extremity of a full-...	46	0.046
373	emb|BX048554.1|CNS099MM Single read from an extremity of a full-...	46	0.046
374	emb|BX046394.1|CNS097YM Single read from an extremity of a full-...	46	0.046
375	emb|BX046393.1|CNS097YL Single read from an extremity of a full-...	46	0.046
376	emb|BX048277.1|CNS099EX Single read from an extremity of a full-...	46	0.046
377	emb|BX048069.1|CNS09995 Single read from an extremity of a full-...	46	0.046
378	emb|BX048011.1|CNS0997J Single read from an extremity of a full-...	46	0.046
379	emb|BX048010.1|CNS0997I Single read from an extremity of a full-...	46	0.046
380	emb|BX047783.1|CNS09917 Single read from an extremity of a full-...	46	0.046
381	emb|BX047723.1|CNS098ZJ Single read from an extremity of a full-...	46	0.046
382	emb|BX047681.1|CNS098YD Single read from an extremity of a full-...	46	0.046
383	emb|BX047543.1|CNS098UJ Single read from an extremity of a full-...	46	0.046
384	emb|BX047542.1|CNS098UI Single read from an extremity of a full-...	46	0.046
385	emb|BX047415.1|CNS098QZ Single read from an extremity of a full-...	46	0.046
386	emb|BX047414.1|CNS098QY Single read from an extremity of a full-...	46	0.046
387	emb|BX047380.1|CNS098Q0 Single read from an extremity of a full-...	46	0.046
388	emb|BX047379.1|CNS098PZ Single read from an extremity of a full-...	46	0.046
389	emb|BX047341.1|CNS098OX Single read from an extremity of a full-...	46	0.046
390	emb|BX046994.1|CNS098FA Single read from an extremity of a full-...	46	0.046
391	emb|BX046993.1|CNS098F9 Single read from an extremity of a full-...	46	0.046
392	emb|BX046983.1|CNS098EZ Single read from an extremity of a full-...	46	0.046
393	emb|BX046982.1|CNS098EY Single read from an extremity of a full-...	46	0.046
394	emb|BX046960.1|CNS098EC Single read from an extremity of a full-...	46	0.046
395	emb|BX046948.1|CNS098E0 Single read from an extremity of a full-...	46	0.046
396	emb|BX046919.1|CNS098D7 Single read from an extremity of a full-...	46	0.046
397	emb|BX046818.1|CNS098AE Single read from an extremity of a full-...	46	0.046
398	emb|BX046778.1|CNS0989A Single read from an extremity of a full-...	46	0.046
399	emb|BX046633.1|CNS09859 Single read from an extremity of a full-...	46	0.046
400	emb|BX046341.1|CNS097X5 Single read from an extremity of a full-...	46	0.046
401	emb|BX046137.1|CNS097RH Single read from an extremity of a full-...	46	0.046
402	emb|BX046044.1|CNS097OW Single read from an extremity of a full-...	46	0.046
403	emb|BX046043.1|CNS097OV Single read from an extremity of a full-...	46	0.046
404	emb|BX046040.1|CNS097OS Single read from an extremity of a full-...	46	0.046
405	emb|BX046039.1|CNS097OR Single read from an extremity of a full-...	46	0.046
406	emb|BX046003.1|CNS097NR Single read from an extremity of a full-...	46	0.046
407	emb|BX045660.1|CNS097E8 Single read from an extremity of a full-...	46	0.046
408	emb|BX045659.1|CNS097E7 Single read from an extremity of a full-...	46	0.046
409	emb|BX045120.1|CNS096Z8 Single read from an extremity of a full-...	46	0.046
410	emb|BX045038.1|CNS096WY Single read from an extremity of a full-...	46	0.046
411	emb|BX045037.1|CNS096WX Single read from an extremity of a full-...	46	0.046
412	emb|BX044960.1|CNS096US Single read from an extremity of a full-...	46	0.046
413	emb|BX044959.1|CNS096UR Single read from an extremity of a full-...	46	0.046
414	emb|BX045186.1|CNS09712 Single read from an extremity of a full-...	46	0.046
415	emb|BX044698.1|CNS096NI Single read from an extremity of a full-...	46	0.046
416	emb|BX044697.1|CNS096NH Single read from an extremity of a full-...	46	0.046
417	emb|BX044664.1|CNS096MK Single read from an extremity of a full-...	46	0.046
418	emb|BX044558.1|CNS096JM Single read from an extremity of a full-...	46	0.046
419	emb|BX044511.1|CNS096IB Single read from an extremity of a full-...	46	0.046
420	emb|BX044478.1|CNS096HE Single read from an extremity of a full-...	46	0.046
421	emb|BX044334.1|CNS096DE Single read from an extremity of a full-...	46	0.046
422	emb|BX044290.1|CNS096C6 Single read from an extremity of a full-...	46	0.046
423	emb|BX044289.1|CNS096C5 Single read from an extremity of a full-...	46	0.046
424	emb|BX043766.1|CNS095XM Single read from an extremity of a full-...	46	0.046
425	emb|BX043765.1|CNS095XL Single read from an extremity of a full-...	46	0.046
426	emb|BX043710.1|CNS095W2 Single read from an extremity of a full-...	46	0.046
427	emb|BX043491.1|CNS095PZ Single read from an extremity of a full-...	46	0.046
428	emb|BX043490.1|CNS095PY Single read from an extremity of a full-...	46	0.046
429	emb|BX043444.1|CNS095OO Single read from an extremity of a full-...	46	0.046
430	emb|BX043443.1|CNS095ON Single read from an extremity of a full-...	46	0.046
431	emb|BX043381.1|CNS095MX Single read from an extremity of a full-...	46	0.046
432	emb|BX043353.1|CNS095M5 Single read from an extremity of a full-...	46	0.046
433	emb|BX043326.1|CNS095LE Single read from an extremity of a full-...	46	0.046
434	emb|BX043325.1|CNS095LD Single read from an extremity of a full-...	46	0.046
435	emb|BX043709.1|CNS095W1 Single read from an extremity of a full-...	46	0.046
436	emb|BX043663.1|CNS095UR Single read from an extremity of a full-...	46	0.046
437	emb|BX043646.1|CNS095UA Single read from an extremity of a full-...	46	0.046
438	emb|BX043645.1|CNS095U9 Single read from an extremity of a full-...	46	0.046
439	emb|BX043549.1|CNS095RL Single read from an extremity of a full-...	46	0.046
440	emb|BX043548.1|CNS095RK Single read from an extremity of a full-...	46	0.046
441	emb|BX043224.1|CNS095IK Single read from an extremity of a full-...	46	0.046
442	emb|BX043223.1|CNS095IJ Single read from an extremity of a full-...	46	0.046
443	emb|BX043198.1|CNS095HU Single read from an extremity of a full-...	46	0.046
444	emb|BX043155.1|CNS095GN Single read from an extremity of a full-...	46	0.046
445	emb|BX043154.1|CNS095GM Single read from an extremity of a full-...	46	0.046
446	emb|BX043130.1|CNS095FY Single read from an extremity of a full-...	46	0.046
447	emb|BX043129.1|CNS095FX Single read from an extremity of a full-...	46	0.046
448	emb|BX042859.1|CNS0958F Single read from an extremity of a full-...	46	0.046
449	emb|BX042858.1|CNS0958E Single read from an extremity of a full-...	46	0.046
450	emb|BX042789.1|CNS0956H Single read from an extremity of a full-...	46	0.046
451	emb|BX042584.1|CNS0950S Single read from an extremity of a full-...	46	0.046
452	emb|BX042419.1|CNS094W7 Single read from an extremity of a full-...	46	0.046
453	emb|BX042365.1|CNS094UP Single read from an extremity of a full-...	46	0.046
454	emb|BX042364.1|CNS094UO Single read from an extremity of a full-...	46	0.046
455	emb|BX042334.1|CNS094TU Single read from an extremity of a full-...	46	0.046
456	emb|BX042320.1|CNS094TG Single read from an extremity of a full-...	46	0.046
457	emb|BX042319.1|CNS094TF Single read from an extremity of a full-...	46	0.046
458	emb|BX042168.1|CNS094P8 Single read from an extremity of a full-...	46	0.046
459	emb|BX042156.1|CNS094OW Single read from an extremity of a full-...	46	0.046
460	emb|BX042155.1|CNS094OV Single read from an extremity of a full-...	46	0.046
461	emb|BX042102.1|CNS094NE Single read from an extremity of a full-...	46	0.046
462	emb|BX042101.1|CNS094ND Single read from an extremity of a full-...	46	0.046
463	emb|BX042051.1|CNS094LZ Single read from an extremity of a full-...	46	0.046
464	emb|BX042050.1|CNS094LY Single read from an extremity of a full-...	46	0.046
465	emb|BX041945.1|CNS094J1 Single read from an extremity of a full-...	46	0.046
466	emb|BX041489.1|CNS0946D Single read from an extremity of a full-...	46	0.046
467	emb|BX041488.1|CNS0946C Single read from an extremity of a full-...	46	0.046
468	emb|BX041443.1|CNS09453 Single read from an extremity of a full-...	46	0.046
469	emb|BX041442.1|CNS09452 Single read from an extremity of a full-...	46	0.046
470	emb|BX041386.1|CNS0943I Single read from an extremity of a full-...	46	0.046
471	emb|BX041385.1|CNS0943H Single read from an extremity of a full-...	46	0.046
472	emb|BX041306.1|CNS0941A Single read from an extremity of a full-...	46	0.046
473	emb|BX041305.1|CNS09419 Single read from an extremity of a full-...	46	0.046
474	emb|BX041209.1|CNS093YL Single read from an extremity of a full-...	46	0.046
475	emb|BX041149.1|CNS093WX Single read from an extremity of a full-...	46	0.046
476	emb|BX041148.1|CNS093WW Single read from an extremity of a full-...	46	0.046
477	emb|BX041077.1|CNS093UX Single read from an extremity of a full-...	46	0.046
478	emb|BX041076.1|CNS093UW Single read from an extremity of a full-...	46	0.046
479	emb|BX040933.1|CNS093QX Single read from an extremity of a full-...	46	0.046
480	emb|BX040789.1|CNS093MX Single read from an extremity of a full-...	46	0.046
481	emb|BX040788.1|CNS093MW Single read from an extremity of a full-...	46	0.046
482	emb|BX040686.1|CNS093K2 Single read from an extremity of a full-...	46	0.046
483	emb|BX040685.1|CNS093K1 Single read from an extremity of a full-...	46	0.046
484	emb|BX040671.1|CNS093JN Single read from an extremity of a full-...	46	0.046
485	emb|BX040670.1|CNS093JM Single read from an extremity of a full-...	46	0.046
486	emb|BX040244.1|CNS0937S Single read from an extremity of a full-...	46	0.046
487	emb|BX040187.1|CNS09367 Single read from an extremity of a full-...	46	0.046
488	emb|BX040032.1|CNS0931W Single read from an extremity of a full-...	46	0.046
489	emb|BX040031.1|CNS0931V Single read from an extremity of a full-...	46	0.046
490	emb|BX040010.1|CNS0931A Single read from an extremity of a full-...	46	0.046
491	emb|BX040009.1|CNS09319 Single read from an extremity of a full-...	46	0.046
492	emb|BX039816.1|CNS092VW Single read from an extremity of a full-...	46	0.046
493	emb|BX039815.1|CNS092VV Single read from an extremity of a full-...	46	0.046
494	emb|BX039789.1|CNS092V5 Single read from an extremity of a full-...	46	0.046
495	emb|BX039622.1|CNS092QI Single read from an extremity of a full-...	46	0.046
496	emb|BX039621.1|CNS092QH Single read from an extremity of a full-...	46	0.046
497	emb|BX039477.1|CNS092MH Single read from an extremity of a full-...	46	0.046
498	emb|BX039271.1|CNS092GR Single read from an extremity of a full-...	46	0.046
499	emb|BX039270.1|CNS092GQ Single read from an extremity of a full-...	46	0.046
500	emb|BX038778.1|CNS09232 Single read from an extremity of a full-...	46	0.046

---

>ref|NM_192099.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1005

 Score =  196 bits (99), Expect = 2e-47
 Identities = 188/218 (86%)
 Strand = Plus / Plus

                                                                       
Query: 3   gacggttcactctgcgcctctggtggcaaggatggcgtcactttgctgtgggatttgacc 62
           |||||||| || ||||| || |||||||| |||||||| ||  |||||||||| ||| | 
Sbjct: 658 gacggttctctgtgcgcgtccggtggcaaagatggcgttaccctgctgtgggacttggct 717

                                                                       
Query: 63  gagggcaagagactctactcgctggatgcgggatccattatcaactcactttgtttctcg 122
           ||||||||||| || |||||||| || ||||| ||||| ||  |||| || || ||||||
Sbjct: 718 gagggcaagaggctgtactcgcttgacgcgggttccatcattcactcgctctgcttctcg 777

                                                                       
Query: 123 ccgaaccgctactggctctgcgcggcgacacaggattccatcaagatctgggatcttgag 182
           || |||||||||||||||||||||||||| ||||| || |||||||||||||||||||||
Sbjct: 778 cccaaccgctactggctctgcgcggcgacccaggactctatcaagatctgggatcttgag 837

                                                 
Query: 183 tcaaagcacatcgngcaggaccttaggcccgaggtccc 220
           ||||||||||| | ||||||||||| ||||||| ||||
Sbjct: 838 tcaaagcacattgtgcaggaccttaagcccgagatccc 875

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  196 bits (99), Expect = 2e-47
 Identities = 188/218 (86%)
 Strand = Plus / Plus

                                                                            
Query: 3        gacggttcactctgcgcctctggtggcaaggatggcgtcactttgctgtgggatttgacc 62
                |||||||| || ||||| || |||||||| |||||||| ||  |||||||||| ||| | 
Sbjct: 28324812 gacggttctctgtgcgcgtccggtggcaaagatggcgttaccctgctgtgggacttggct 28324871

                                                                            
Query: 63       gagggcaagagactctactcgctggatgcgggatccattatcaactcactttgtttctcg 122
                ||||||||||| || |||||||| || ||||| ||||| ||  |||| || || ||||||
Sbjct: 28324872 gagggcaagaggctgtactcgcttgacgcgggttccatcattcactcgctctgcttctcg 28324931

                                                                            
Query: 123      ccgaaccgctactggctctgcgcggcgacacaggattccatcaagatctgggatcttgag 182
                || |||||||||||||||||||||||||| ||||| || |||||||||||||||||||||
Sbjct: 28324932 cccaaccgctactggctctgcgcggcgacccaggactctatcaagatctgggatcttgag 28324991

                                                      
Query: 183      tcaaagcacatcgngcaggaccttaggcccgaggtccc 220
                ||||||||||| | ||||||||||| ||||||| ||||
Sbjct: 28324992 tcaaagcacattgtgcaggaccttaagcccgagatccc 28325029

---

>dbj|AP003452.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0478H03
          Length = 167560

 Score =  196 bits (99), Expect = 2e-47
 Identities = 188/218 (86%)
 Strand = Plus / Plus

                                                                          
Query: 3      gacggttcactctgcgcctctggtggcaaggatggcgtcactttgctgtgggatttgacc 62
              |||||||| || ||||| || |||||||| |||||||| ||  |||||||||| ||| | 
Sbjct: 159319 gacggttctctgtgcgcgtccggtggcaaagatggcgttaccctgctgtgggacttggct 159378

                                                                          
Query: 63     gagggcaagagactctactcgctggatgcgggatccattatcaactcactttgtttctcg 122
              ||||||||||| || |||||||| || ||||| ||||| ||  |||| || || ||||||
Sbjct: 159379 gagggcaagaggctgtactcgcttgacgcgggttccatcattcactcgctctgcttctcg 159438

                                                                          
Query: 123    ccgaaccgctactggctctgcgcggcgacacaggattccatcaagatctgggatcttgag 182
              || |||||||||||||||||||||||||| ||||| || |||||||||||||||||||||
Sbjct: 159439 cccaaccgctactggctctgcgcggcgacccaggactctatcaagatctgggatcttgag 159498

                                                    
Query: 183    tcaaagcacatcgngcaggaccttaggcccgaggtccc 220
              ||||||||||| | ||||||||||| ||||||| ||||
Sbjct: 159499 tcaaagcacattgtgcaggaccttaagcccgagatccc 159536

---

>dbj|AP003455.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0519D04
          Length = 193068

 Score =  196 bits (99), Expect = 2e-47
 Identities = 188/218 (86%)
 Strand = Plus / Plus

                                                                         
Query: 3     gacggttcactctgcgcctctggtggcaaggatggcgtcactttgctgtgggatttgacc 62
             |||||||| || ||||| || |||||||| |||||||| ||  |||||||||| ||| | 
Sbjct: 39912 gacggttctctgtgcgcgtccggtggcaaagatggcgttaccctgctgtgggacttggct 39971

                                                                         
Query: 63    gagggcaagagactctactcgctggatgcgggatccattatcaactcactttgtttctcg 122
             ||||||||||| || |||||||| || ||||| ||||| ||  |||| || || ||||||
Sbjct: 39972 gagggcaagaggctgtactcgcttgacgcgggttccatcattcactcgctctgcttctcg 40031

                                                                         
Query: 123   ccgaaccgctactggctctgcgcggcgacacaggattccatcaagatctgggatcttgag 182
             || |||||||||||||||||||||||||| ||||| || |||||||||||||||||||||
Sbjct: 40032 cccaaccgctactggctctgcgcggcgacccaggactctatcaagatctgggatcttgag 40091

                                                   
Query: 183   tcaaagcacatcgngcaggaccttaggcccgaggtccc 220
             ||||||||||| | ||||||||||| ||||||| ||||
Sbjct: 40092 tcaaagcacattgtgcaggaccttaagcccgagatccc 40129

---

>dbj|AK121587.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033037K24, full
           insert sequence
          Length = 1358

 Score =  196 bits (99), Expect = 2e-47
 Identities = 188/218 (86%)
 Strand = Plus / Plus

                                                                       
Query: 3   gacggttcactctgcgcctctggtggcaaggatggcgtcactttgctgtgggatttgacc 62
           |||||||| || ||||| || |||||||| |||||||| ||  |||||||||| ||| | 
Sbjct: 756 gacggttctctgtgcgcgtccggtggcaaagatggcgttaccctgctgtgggacttggct 815

                                                                       
Query: 63  gagggcaagagactctactcgctggatgcgggatccattatcaactcactttgtttctcg 122
           ||||||||||| || |||||||| || ||||| ||||| ||  |||| || || ||||||
Sbjct: 816 gagggcaagaggctgtactcgcttgacgcgggttccatcattcactcgctctgcttctcg 875

                                                                       
Query: 123 ccgaaccgctactggctctgcgcggcgacacaggattccatcaagatctgggatcttgag 182
           || |||||||||||||||||||||||||| ||||| || |||||||||||||||||||||
Sbjct: 876 cccaaccgctactggctctgcgcggcgacccaggactctatcaagatctgggatcttgag 935

                                                 
Query: 183 tcaaagcacatcgngcaggaccttaggcccgaggtccc 220
           ||||||||||| | ||||||||||| ||||||| ||||
Sbjct: 936 tcaaagcacattgtgcaggaccttaagcccgagatccc 973

---

>dbj|AK098893.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001N15, full
           insert sequence
          Length = 1256

 Score =  196 bits (99), Expect = 2e-47
 Identities = 188/218 (86%)
 Strand = Plus / Plus

                                                                       
Query: 3   gacggttcactctgcgcctctggtggcaaggatggcgtcactttgctgtgggatttgacc 62
           |||||||| || ||||| || |||||||| |||||||| ||  |||||||||| ||| | 
Sbjct: 727 gacggttctctgtgcgcgtccggtggcaaagatggcgttaccctgctgtgggacttggct 786

                                                                       
Query: 63  gagggcaagagactctactcgctggatgcgggatccattatcaactcactttgtttctcg 122
           ||||||||||| || |||||||| || ||||| ||||| ||  |||| || || ||||||
Sbjct: 787 gagggcaagaggctgtactcgcttgacgcgggttccatcattcactcgctctgcttctcg 846

                                                                       
Query: 123 ccgaaccgctactggctctgcgcggcgacacaggattccatcaagatctgggatcttgag 182
           || |||||||||||||||||||||||||| ||||| || |||||||||||||||||||||
Sbjct: 847 cccaaccgctactggctctgcgcggcgacccaggactctatcaagatctgggatcttgag 906

                                                 
Query: 183 tcaaagcacatcgngcaggaccttaggcccgaggtccc 220
           ||||||||||| | ||||||||||| ||||||| ||||
Sbjct: 907 tcaaagcacattgtgcaggaccttaagcccgagatccc 944

---

>dbj|AK060428.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-011-A02, full
           insert sequence
          Length = 1351

 Score =  196 bits (99), Expect = 2e-47
 Identities = 188/218 (86%)
 Strand = Plus / Plus

                                                                       
Query: 3   gacggttcactctgcgcctctggtggcaaggatggcgtcactttgctgtgggatttgacc 62
           |||||||| || ||||| || |||||||| |||||||| ||  |||||||||| ||| | 
Sbjct: 750 gacggttctctgtgcgcgtccggtggcaaagatggcgttaccctgctgtgggacttggct 809

                                                                       
Query: 63  gagggcaagagactctactcgctggatgcgggatccattatcaactcactttgtttctcg 122
           ||||||||||| || |||||||| || ||||| ||||| ||  |||| || || ||||||
Sbjct: 810 gagggcaagaggctgtactcgcttgacgcgggttccatcattcactcgctctgcttctcg 869

                                                                       
Query: 123 ccgaaccgctactggctctgcgcggcgacacaggattccatcaagatctgggatcttgag 182
           || |||||||||||||||||||||||||| ||||| || |||||||||||||||||||||
Sbjct: 870 cccaaccgctactggctctgcgcggcgacccaggactctatcaagatctgggatcttgag 929

                                                 
Query: 183 tcaaagcacatcgngcaggaccttaggcccgaggtccc 220
           ||||||||||| | ||||||||||| ||||||| ||||
Sbjct: 930 tcaaagcacattgtgcaggaccttaagcccgagatccc 967

---

>dbj|D38231.1|RICGPBSLP Oryza sativa (japonica cultivar-group) RWD mRNA for q group of
           receptor for activated C-kinase, complete cds
          Length = 1285

 Score =  196 bits (99), Expect = 2e-47
 Identities = 188/218 (86%)
 Strand = Plus / Plus

                                                                       
Query: 3   gacggttcactctgcgcctctggtggcaaggatggcgtcactttgctgtgggatttgacc 62
           |||||||| || ||||| || |||||||| |||||||| ||  |||||||||| ||| | 
Sbjct: 684 gacggttctctgtgcgcgtccggtggcaaagatggcgttaccctgctgtgggacttggct 743

                                                                       
Query: 63  gagggcaagagactctactcgctggatgcgggatccattatcaactcactttgtttctcg 122
           ||||||||||| || |||||||| || ||||| ||||| ||  |||| || || ||||||
Sbjct: 744 gagggcaagaggctgtactcgcttgacgcgggttccatcattcactcgctctgcttctcg 803

                                                                       
Query: 123 ccgaaccgctactggctctgcgcggcgacacaggattccatcaagatctgggatcttgag 182
           || |||||||||||||||||||||||||| ||||| || |||||||||||||||||||||
Sbjct: 804 cccaaccgctactggctctgcgcggcgacccaggactctatcaagatctgggatcttgag 863

                                                 
Query: 183 tcaaagcacatcgngcaggaccttaggcccgaggtccc 220
           ||||||||||| | ||||||||||| ||||||| ||||
Sbjct: 864 tcaaagcacattgtgcaggaccttaagcccgagatccc 901

---

>dbj|AK098877.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001E12, full
           insert sequence
          Length = 1326

 Score =  188 bits (95), Expect = 5e-45
 Identities = 187/218 (85%)
 Strand = Plus / Plus

                                                                       
Query: 3   gacggttcactctgcgcctctggtggcaaggatggcgtcactttgctgtgggatttgacc 62
           |||||||| || ||||| || |||||||| |||||||| ||  |||||||||| ||| | 
Sbjct: 744 gacggttctctgtgcgcgtccggtggcaaagatggcgttaccctgctgtgggacttggct 803

                                                                       
Query: 63  gagggcaagagactctactcgctggatgcgggatccattatcaactcactttgtttctcg 122
           ||||||||||| || |||||||| || ||||| ||||| ||  |||| || || ||||||
Sbjct: 804 gagggcaagaggctgtactcgcttgacgcgggttccatcattcactcgctctgcttctcg 863

                                                                       
Query: 123 ccgaaccgctactggctctgcgcggcgacacaggattccatcaagatctgggatcttgag 182
           || |||||||||||||||||||||||||| ||||| || ||||||||||||| |||||||
Sbjct: 864 cccaaccgctactggctctgcgcggcgacccaggactctatcaagatctggggtcttgag 923

                                                 
Query: 183 tcaaagcacatcgngcaggaccttaggcccgaggtccc 220
           ||||||||||| | ||||||||||| ||||||| ||||
Sbjct: 924 tcaaagcacattgtgcaggaccttaagcccgagatccc 961

---

>gb|BT017990.1| Zea mays clone EL01N0526B03.c mRNA sequence
          Length = 1281

 Score =  157 bits (79), Expect = 2e-35
 Identities = 165/194 (85%)
 Strand = Plus / Plus

                                                                       
Query: 12  ctctgcgcctctggtggcaaggatggcgtcactttgctgtgggatttgaccgagggcaag 71
           ||||||||||| || || ||||| || || ||| |||||||||||||| | ||||| |||
Sbjct: 742 ctctgcgcctccggcgggaaggacggtgttactctgctgtgggatttggctgaggggaag 801

                                                                       
Query: 72  agactctactcgctggatgcgggatccattatcaactcactttgtttctcgccgaaccgc 131
           || || ||||||||||||||||| ||||| ||| |||| || || |||||||| ||||||
Sbjct: 802 aggctgtactcgctggatgcgggctccatcatccactccctctgcttctcgcccaaccgc 861

                                                                       
Query: 132 tactggctctgcgcggcgacacaggattccatcaagatctgggatcttgagtcaaagcac 191
           |||||||||||||| ||||| ||||| ||  | ||||||||||| |||||||| ||||||
Sbjct: 862 tactggctctgcgctgcgacccaggactctgttaagatctgggaccttgagtcgaagcac 921

                         
Query: 192 atcgngcaggacct 205
            ||| |||||||||
Sbjct: 922 gtcgtgcaggacct 935

---

>gb|BT016269.1| Zea mays clone Contig102 mRNA sequence
          Length = 1254

 Score =  157 bits (79), Expect = 2e-35
 Identities = 165/194 (85%)
 Strand = Plus / Plus

                                                                       
Query: 12  ctctgcgcctctggtggcaaggatggcgtcactttgctgtgggatttgaccgagggcaag 71
           ||||||||||| || || ||||| || || ||| |||||||||||||| | ||||| |||
Sbjct: 733 ctctgcgcctccggcgggaaggacggtgttactctgctgtgggatttggctgaggggaag 792

                                                                       
Query: 72  agactctactcgctggatgcgggatccattatcaactcactttgtttctcgccgaaccgc 131
           || || ||||||||||||||||| ||||| ||| |||| || || |||||||| ||||||
Sbjct: 793 aggctgtactcgctggatgcgggctccatcatccactccctctgcttctcgcccaaccgc 852

                                                                       
Query: 132 tactggctctgcgcggcgacacaggattccatcaagatctgggatcttgagtcaaagcac 191
           |||||||||||||| ||||| ||||| ||  | ||||||||||| |||||||| ||||||
Sbjct: 853 tactggctctgcgctgcgacccaggactctgttaagatctgggaccttgagtcgaagcac 912

                         
Query: 192 atcgngcaggacct 205
            ||| |||||||||
Sbjct: 913 gtcgtgcaggacct 926

---

>gb|AY103919.1| Zea mays PCO099246 mRNA sequence
          Length = 1461

 Score =  157 bits (79), Expect = 2e-35
 Identities = 165/194 (85%)
 Strand = Plus / Plus

                                                                        
Query: 12   ctctgcgcctctggtggcaaggatggcgtcactttgctgtgggatttgaccgagggcaag 71
            ||||||||||| || || ||||| || || ||| |||||||||||||| | ||||| |||
Sbjct: 890  ctctgcgcctccggcgggaaggacggtgttactctgctgtgggatttggctgaggggaag 949

                                                                        
Query: 72   agactctactcgctggatgcgggatccattatcaactcactttgtttctcgccgaaccgc 131
            || || ||||||||||||||||| ||||| ||| |||| || || |||||||| ||||||
Sbjct: 950  aggctgtactcgctggatgcgggctccatcatccactccctctgcttctcgcccaaccgc 1009

                                                                        
Query: 132  tactggctctgcgcggcgacacaggattccatcaagatctgggatcttgagtcaaagcac 191
            |||||||||||||| ||||| ||||| ||  | ||||||||||| |||||||| ||||||
Sbjct: 1010 tactggctctgcgctgcgacccaggactctgttaagatctgggaccttgagtcgaagcac 1069

                          
Query: 192  atcgngcaggacct 205
             ||| |||||||||
Sbjct: 1070 gtcgtgcaggacct 1083

---

>gb|BT016705.1| Zea mays clone Contig538 mRNA sequence
          Length = 1265

 Score =  129 bits (65), Expect = 4e-27
 Identities = 166/200 (83%)
 Strand = Plus / Plus

                                                                       
Query: 15  tgcgcctctggtggcaaggatggcgtcactttgctgtgggatttgaccgagggcaagaga 74
           |||||||| || || ||||| || || ||| |||||||||||||| | ||||| ||||| 
Sbjct: 736 tgcgcctccggcgggaaggacggtgttactctgctgtgggatttggctgaggggaagagg 795

                                                                       
Query: 75  ctctactcgctggatgcgggatccattatcaactcactttgtttctcgccgaaccgctac 134
           || ||||||||||| ||||| ||||| ||| |||| || || ||||| || |||||||||
Sbjct: 796 ctgtactcgctggacgcgggctccatcatccactctctctgcttctcacccaaccgctac 855

                                                                       
Query: 135 tggctctgcgcggcgacacaggattccatcaagatctgggatcttgagtcaaagcacatc 194
           ||||||||||| ||||| ||||| ||  ||||||||||||| || ||||| |||||| | 
Sbjct: 856 tggctctgcgctgcgacgcaggactctgtcaagatctgggacctcgagtcgaagcacgtt 915

                               
Query: 195 gngcaggaccttaggcccga 214
           | ||||||||| | ||||||
Sbjct: 916 gtgcaggacctcaagcccga 935

---

>ref|XM_475866.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1011

 Score = 83.8 bits (42), Expect = 2e-13
 Identities = 77/89 (86%)
 Strand = Plus / Plus

                                                                       
Query: 117 ttctcgccgaaccgctactggctctgcgcggcgacacaggattccatcaagatctgggat 176
           |||||||| |||||||||||||||||||| |||||| |||| ||| ||||||||||||| 
Sbjct: 775 ttctcgcccaaccgctactggctctgcgccgcgacagaggactccgtcaagatctgggac 834

                                        
Query: 177 cttgagtcaaagcacatcgngcaggacct 205
           || ||||| |||| | ||  |||||||||
Sbjct: 835 ctcgagtccaagctcgtcatgcaggacct 863

---

>gb|AC129717.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0079H23,
              complete sequence
          Length = 191765

 Score = 83.8 bits (42), Expect = 2e-13
 Identities = 77/89 (86%)
 Strand = Plus / Minus

                                                                          
Query: 117    ttctcgccgaaccgctactggctctgcgcggcgacacaggattccatcaagatctgggat 176
              |||||||| |||||||||||||||||||| |||||| |||| ||| ||||||||||||| 
Sbjct: 115657 ttctcgcccaaccgctactggctctgcgccgcgacagaggactccgtcaagatctgggac 115598

                                           
Query: 177    cttgagtcaaagcacatcgngcaggacct 205
              || ||||| |||| | ||  |||||||||
Sbjct: 115597 ctcgagtccaagctcgtcatgcaggacct 115569

---

>gb|AC135925.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0560C03,
              complete sequence
          Length = 177861

 Score = 83.8 bits (42), Expect = 2e-13
 Identities = 77/89 (86%)
 Strand = Plus / Minus

                                                                          
Query: 117    ttctcgccgaaccgctactggctctgcgcggcgacacaggattccatcaagatctgggat 176
              |||||||| |||||||||||||||||||| |||||| |||| ||| ||||||||||||| 
Sbjct: 172085 ttctcgcccaaccgctactggctctgcgccgcgacagaggactccgtcaagatctgggac 172026

                                           
Query: 177    cttgagtcaaagcacatcgngcaggacct 205
              || ||||| |||| | ||  |||||||||
Sbjct: 172025 ctcgagtccaagctcgtcatgcaggacct 171997

---

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 83.8 bits (42), Expect = 2e-13
 Identities = 77/89 (86%)
 Strand = Plus / Minus

                                                                            
Query: 117      ttctcgccgaaccgctactggctctgcgcggcgacacaggattccatcaagatctgggat 176
                |||||||| |||||||||||||||||||| |||||| |||| ||| ||||||||||||| 
Sbjct: 27240689 ttctcgcccaaccgctactggctctgcgccgcgacagaggactccgtcaagatctgggac 27240630

                                             
Query: 177      cttgagtcaaagcacatcgngcaggacct 205
                || ||||| |||| | ||  |||||||||
Sbjct: 27240629 ctcgagtccaagctcgtcatgcaggacct 27240601

---

>dbj|AK121567.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034P13, full
           insert sequence
          Length = 1385

 Score = 83.8 bits (42), Expect = 2e-13
 Identities = 77/89 (86%)
 Strand = Plus / Plus

                                                                       
Query: 117 ttctcgccgaaccgctactggctctgcgcggcgacacaggattccatcaagatctgggat 176
           |||||||| |||||||||||||||||||| |||||| |||| ||| ||||||||||||| 
Sbjct: 850 ttctcgcccaaccgctactggctctgcgccgcgacagaggactccgtcaagatctgggac 909

                                        
Query: 177 cttgagtcaaagcacatcgngcaggacct 205
           || ||||| |||| | ||  |||||||||
Sbjct: 910 ctcgagtccaagctcgtcatgcaggacct 938

---

>dbj|AK065272.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002L07, full
           insert sequence
          Length = 1227

 Score = 83.8 bits (42), Expect = 2e-13
 Identities = 77/89 (86%)
 Strand = Plus / Plus

                                                                       
Query: 117 ttctcgccgaaccgctactggctctgcgcggcgacacaggattccatcaagatctgggat 176
           |||||||| |||||||||||||||||||| |||||| |||| ||| ||||||||||||| 
Sbjct: 843 ttctcgcccaaccgctactggctctgcgccgcgacagaggactccgtcaagatctgggac 902

                                        
Query: 177 cttgagtcaaagcacatcgngcaggacct 205
           || ||||| |||| | ||  |||||||||
Sbjct: 903 ctcgagtccaagctcgtcatgcaggacct 931

---

>dbj|AK062179.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-046-D07, full
           insert sequence
          Length = 1412

 Score = 83.8 bits (42), Expect = 2e-13
 Identities = 77/89 (86%)
 Strand = Plus / Plus

                                                                       
Query: 117 ttctcgccgaaccgctactggctctgcgcggcgacacaggattccatcaagatctgggat 176
           |||||||| |||||||||||||||||||| |||||| |||| ||| ||||||||||||| 
Sbjct: 852 ttctcgcccaaccgctactggctctgcgccgcgacagaggactccgtcaagatctgggac 911

                                        
Query: 177 cttgagtcaaagcacatcgngcaggacct 205
           || ||||| |||| | ||  |||||||||
Sbjct: 912 ctcgagtccaagctcgtcatgcaggacct 940

---

>emb|Y08678.1|MSGB1 Medicago sativa mRNA for G protein beta subunit-like protein (gbl
           gene)
          Length = 1259

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 6   ggttcactctgcgcctctggtggcaaggatggcgtcactttgctgtgggatttgaccgag 65
           ||||| ||||| || |||||||| || ||||| || | |||||||||||||||| | |||
Sbjct: 656 ggttctctctgtgcttctggtgggaaagatggagtgattttgctgtgggatttggctgag 715

                                                 
Query: 66  ggcaagagactctactcgctggatgcgggatccattat 103
           || |||||||| ||||| || ||||| || ||||||||
Sbjct: 716 ggaaagagactttactctcttgatgctggttccattat 753

---

>gb|DQ284489.1| Solanum tuberosum clone 042G03 ArcA2 protein-like mRNA, complete
           cds
          Length = 1098

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                       
Query: 27  ggcaaggatggcgtcactttgctgtgggatttgaccgagggcaagagactctactcgctg 86
           ||||||||||| || | |||||| ||||||||| | |||||||||| |||||||||||| 
Sbjct: 713 ggcaaggatggagttattttgctctgggatttggctgagggcaagaaactctactcgctt 772

                
Query: 87  gatgc 91
           |||||
Sbjct: 773 gatgc 777

---

>emb|X53574.1|CRGPLP C. reinhardtii Cblp gene for a G protein beta subunit-like
            polypeptide
          Length = 2314

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                       
Query: 117  ttctcgccgaaccgctactggctctgcgcggcgacacaggattccatcaagatctggga 175
            |||||||| |||||||||||||| ||||| || || |||   |||||||||||||||||
Sbjct: 1578 ttctcgcccaaccgctactggctgtgcgccgccacccagtcctccatcaagatctggga 1636

---

>gb|DQ122897.1| Chlamydomonas incerta G protein beta subunit-like polypeptide
           (cblP) mRNA, partial cds
          Length = 843

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 117 ttctcgccgaaccgctactggctctgcgcggcgacacaggattccatcaagatctggga 175
           |||||||| |||||||||||||| ||||| || || |||   |||||||||||||||||
Sbjct: 736 ttctcgcccaaccgctactggctgtgcgccgccacccagtcctccatcaagatctggga 794

---

>emb|BX067788.1|CNS09OGW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51CE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 230

 Score = 52.0 bits (26), Expect = 7e-04
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 99  attatcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           ||||||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 203 attatcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 158

---

>gb|BT012967.1| Lycopersicon esculentum clone 114159R, mRNA sequence
          Length = 1324

 Score = 48.1 bits (24), Expect = 0.012
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 23  tggtggcaaggatggcgtcactttgctgtgggatttgaccgagggcaagagactctactc 82
           ||||||||||||||| || | |||||| ||||||||| | ||||| ||||  ||||||||
Sbjct: 711 tggtggcaaggatggagttattttgctctgggatttggctgaggggaagaagctctactc 770

---

>emb|BX019636.1|CNS08NBC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA29DH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1006

 Score = 48.1 bits (24), Expect = 0.012
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcgc 145
           |||||| |||| || |||||||| |||||||||||||| |||||
Sbjct: 812 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcgc 855

---

>gb|DQ073456.1| Choristoneura fumiferana activated C kinase 1 receptor (RACK1) gene,
            complete cds
          Length = 2925

 Score = 48.1 bits (24), Expect = 0.012
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 12   ctctgcgcctctggtggcaaggat 35
            ||||||||||||||||||||||||
Sbjct: 1695 ctctgcgcctctggtggcaaggat 1718

---

>gb|DQ073455.1| Choristoneura fumiferana activated C kinase 1 receptor (RACK1)
           mRNA, complete cds
          Length = 1427

 Score = 48.1 bits (24), Expect = 0.012
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 12  ctctgcgcctctggtggcaaggat 35
           ||||||||||||||||||||||||
Sbjct: 705 ctctgcgcctctggtggcaaggat 728

---

>dbj|AB022687.1| Lycopersicon esculentum mRNA for LeArcA2 protein, complete cds
          Length = 1115

 Score = 48.1 bits (24), Expect = 0.012
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 23  tggtggcaaggatggcgtcactttgctgtgggatttgaccgagggcaagagactctactc 82
           ||||||||||||||| || | |||||| ||||||||| | ||||| ||||  ||||||||
Sbjct: 676 tggtggcaaggatggagttattttgctctgggatttggctgaggggaagaagctctactc 735

---

>dbj|AB180244.1| Fusarium oxysporum fgb2 gene for G-protein beta like WD repeat
            protein, complete cds
          Length = 1796

 Score = 48.1 bits (24), Expect = 0.012
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                            
Query: 3    gacggttcactctgcgcctctggtggcaagga 34
            |||||||| || ||||||||||||||||||||
Sbjct: 1190 gacggttctctgtgcgcctctggtggcaagga 1221

---

>emb|BX053466.1|CNS09DF2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 360 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 318

---

>emb|BX053465.1|CNS09DF1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 962

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 813 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 855

---

>emb|BX053355.1|CNS09DBZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30DH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 935

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 346 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 304

---

>emb|BX053354.1|CNS09DBY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30DH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 921

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 801 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 843

---

>emb|BX025426.1|CNS08RS6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA39AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 990

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 803 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 845

---

>emb|BX024636.1|CNS08R68 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37CF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 846

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 788 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 830

---

>emb|BX072073.1|CNS09RRX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9DE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 453

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 349 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 307

---

>emb|BX071929.1|CNS09RNX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9CF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1004

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 343 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 301

---

>emb|BX071928.1|CNS09RNW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9CF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1065

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 799 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 841

---

>emb|BX071907.1|CNS09RNB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9CE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1006

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 335 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 293

---

>emb|BX071775.1|CNS09RJN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9BG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 830

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 341 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 299

---

>emb|BX071774.1|CNS09RJM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9BG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 906

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 809 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 851

---

>emb|BX071717.1|CNS09RI1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9BD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 844

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 346 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 304

---

>emb|BX071716.1|CNS09RI0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9BD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 963

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 803 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 845

---

>emb|BX071585.1|CNS09RED Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9AG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 938

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 350 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 308

---

>emb|BX071503.1|CNS09RC3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9AC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 329 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 287

---

>emb|BX071502.1|CNS09RC2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9AC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 798 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 840

---

>emb|BX071037.1|CNS09QZ5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 912

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 797 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 839

---

>emb|BX070960.1|CNS09QX0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8BC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 956

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 345 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 303

---

>emb|BX070941.1|CNS09QWH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8BB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 806

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 338 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 296

---

>emb|BX070940.1|CNS09QWG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 884

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 796 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 838

---

>emb|BX070678.1|CNS09QP6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC7DE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 555

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 327 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 285

---

>emb|BX070378.1|CNS09QGU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7BG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 797 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 839

---

>emb|BX070186.1|CNS09QBI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC7AF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 385

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 200 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 158

---

>emb|BX069856.1|CNS09Q2C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6CG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 332 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 290

---

>emb|BX069855.1|CNS09Q2B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6CG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 797 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 839

---

>emb|BX069810.1|CNS09Q12 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6CE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 980

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 328 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 286

---

>emb|BX069809.1|CNS09Q11 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6CE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 792 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 834

---

>emb|BX069778.1|CNS09Q06 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6CC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 328

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 200 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 158

---

>emb|BX069777.1|CNS09Q05 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6CC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 924

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 807 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 849

---

>emb|BX069457.1|CNS09PR9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6AE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1038

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 818 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 860

---

>emb|BX069079.1|CNS09PGR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53CD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 575

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 343 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 301

---

>emb|BX069078.1|CNS09PGQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 922

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 832 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 874

---

>emb|BX068759.1|CNS09P7V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53AF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 794

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 360 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 318

---

>emb|BX068758.1|CNS09P7U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53AF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 927

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 814 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 856

---

>emb|BX068670.1|CNS09P5E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53AB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 867

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 795 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 837

---

>emb|BX068658.1|CNS09P52 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53AA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 878

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 354 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 312

---

>emb|BX068657.1|CNS09P51 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53AA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 952

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 810 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 852

---

>emb|BX068642.1|CNS09P4M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 967

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 340 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 298

---

>emb|BX068439.1|CNS09OYZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52CG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 917

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 809 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 851

---

>emb|BX068364.1|CNS09OWW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52CB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 919

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 305 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 263

---

>emb|BX068249.1|CNS09OTP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52BD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 713

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 277 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 235

---

>emb|BX068234.1|CNS09OTA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52BD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 858

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 365 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 323

---

>emb|BX068233.1|CNS09OT9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52BD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 938

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 810 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 852

---

>emb|BX068228.1|CNS09OT4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52BD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 695

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 335 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 293

---

>emb|BX068198.1|CNS09OSA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52BB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 903

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 316 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 274

---

>emb|BX068197.1|CNS09OS9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52BB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 999

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 801 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 843

---

>emb|BX068108.1|CNS09OPS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52AF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 961

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 338 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 296

---

>emb|BX068107.1|CNS09OPR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52AF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 988

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 803 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 845

---

>emb|BX068050.1|CNS09OO6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52AC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 953

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 352 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 310

---

>emb|BX068049.1|CNS09OO5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52AC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1025

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 811 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 853

---

>emb|BX068035.1|CNS09ONR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52AC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 938

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 718 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 760

---

>emb|BX068018.1|CNS09ONA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52AB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 829

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 342 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 300

---

>emb|BX068017.1|CNS09ON9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52AB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 956

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 810 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 852

---

>emb|BX067955.1|CNS09OLJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51DF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 317

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 278 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 236

---

>emb|BX067894.1|CNS09OJU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51DB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 510

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 324 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 282

---

>emb|BX067874.1|CNS09OJA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51DA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 869

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 697 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 739

---

>emb|BX067850.1|CNS09OIM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51CG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 968

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 334 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 292

---

>emb|BX067849.1|CNS09OIL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1000

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 799 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 841

---

>emb|BX067804.1|CNS09OHC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51CE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 898

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 335 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 293

---

>emb|BX067803.1|CNS09OHB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 936

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 805 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 847

---

>emb|BX067787.1|CNS09OGV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 962

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 797 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 839

---

>emb|BX067705.1|CNS09OEL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 955

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 803 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 845

---

>emb|BX067646.1|CNS09OCY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51BF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 957

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 338 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 296

---

>emb|BX067645.1|CNS09OCX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51BF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1040

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 796 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 838

---

>emb|BX067635.1|CNS09OCN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51BF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 909

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 799 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 841

---

>emb|BX067585.1|CNS09OB9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51BD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 464

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 339 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 297

---

>emb|BX067584.1|CNS09OB8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51BD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 968

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 862 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 904

---

>emb|BX067492.1|CNS09O8O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51AG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 343 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 301

---

>emb|BX067491.1|CNS09O8N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51AG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1040

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 794 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 836

---

>emb|BX066978.1|CNS09NUE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50BH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 957

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 765 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 807

---

>emb|BX066951.1|CNS09NTN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50BG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 923

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 360 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 318

---

>emb|BX066950.1|CNS09NTM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50BG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1026

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 824 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 866

---

>emb|BX066945.1|CNS09NTH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 425

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 344 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 302

---

>emb|BX066944.1|CNS09NTG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 968

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 803 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 845

---

>emb|BX066941.1|CNS09NTD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50BF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 877

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 348 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 306

---

>emb|BX066940.1|CNS09NTC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50BF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 909

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 509 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 551

---

>emb|BX066917.1|CNS09NSP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 905

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 354 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 312

---

>emb|BX066916.1|CNS09NSO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1039

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 802 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 844

---

>emb|BX066784.1|CNS09NP0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50AH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 922

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 810 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 852

---

>emb|BX066716.1|CNS09NN4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50AE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 240

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 200 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 158

---

>emb|BX066638.1|CNS09NKY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 988

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 356 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 314

---

>emb|BX066637.1|CNS09NKX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1056

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 809 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 851

---

>emb|BX066110.1|CNS09N6A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5BB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 340 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 298

---

>emb|BX066109.1|CNS09N69 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5BB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1000

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 793 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 835

---

>emb|BX066047.1|CNS09N4J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5AG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 341

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 200 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 158

---

>emb|BX066046.1|CNS09N4I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5AG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 934

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 791 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 833

---

>emb|BX065996.1|CNS09N34 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5AE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 913

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 511 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 553

---

>emb|BX065949.1|CNS09N1T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5AC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 896

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 337 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 295

---

>emb|BX065948.1|CNS09N1S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5AC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 862 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 904

---

>emb|BX065904.1|CNS09N0K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49DH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 648

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 356 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 314

---

>emb|BX065815.1|CNS09MY3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49DD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 935

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 347 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 305

---

>emb|BX065814.1|CNS09MY2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49DD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 982

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 803 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 845

---

>emb|BX065711.1|CNS09MV7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49CH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 633

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 331 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 289

---

>emb|BX065710.1|CNS09MV6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49CH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 860

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 796 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 838

---

>emb|BX065604.1|CNS09MS8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49CC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1041

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 793 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 835

---

>emb|BX065506.1|CNS09MPI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49BG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 351 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 309

---

>emb|BX065505.1|CNS09MPH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49BG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 995

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 799 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 841

---

>emb|BX065387.1|CNS09MM7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49BA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1002

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 337 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 295

---

>emb|BX065386.1|CNS09MM6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49BA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1042

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 800 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 842

---

>emb|BX065353.1|CNS09ML9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49AH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 871

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 338 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 296

---

>emb|BX065352.1|CNS09ML8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49AH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 800 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 842

---

>emb|BX065157.1|CNS09MFT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48DG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 896

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 506 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 548

---

>emb|BX065023.1|CNS09MC3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48CH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 325

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 302 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 260

---

>emb|BX065022.1|CNS09MC2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48CH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1011

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 767 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 809

---

>emb|BX064965.1|CNS09MAH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48CF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 325 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 283

---

>emb|BX064964.1|CNS09MAG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48CF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 955

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 771 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 813

---

>emb|BX064854.1|CNS09M7E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48CA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 739

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 243 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 201

---

>emb|BX064853.1|CNS09M7D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48CA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 902

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 702 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 744

---

>emb|BX064529.1|CNS09LYD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46DD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 811

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 329 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 287

---

>emb|BX064405.1|CNS09LUX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46CF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 988

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 363 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 321

---

>emb|BX064360.1|CNS09LTO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46CD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1034

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 816 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 858

---

>emb|BX064271.1|CNS09LR7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46BH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 989

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 341 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 299

---

>emb|BX064270.1|CNS09LR6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46BH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1037

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 791 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 833

---

>emb|BX064233.1|CNS09LQ5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46BG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 941

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 343 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 301

---

>emb|BX064232.1|CNS09LQ4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46BG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 986

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 806 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 848

---

>emb|BX064196.1|CNS09LP4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46BE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 878

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 798 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 840

---

>emb|BX064129.1|CNS09LN9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46BB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 982

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 324 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 282

---

>emb|BX064128.1|CNS09LN8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46BB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1006

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 791 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 833

---

>emb|BX063936.1|CNS09LHW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46AB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 941

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 797 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 839

---

>emb|BX063919.1|CNS09LHF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46AA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 989

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 366 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 324

---

>emb|BX063918.1|CNS09LHE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46AA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1040

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 816 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 858

---

>emb|BX063471.1|CNS09L4Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45BB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 343 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 301

---

>emb|BX063470.1|CNS09L4Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45BB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 984

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 809 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 851

---

>emb|BX063359.1|CNS09L1V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45AE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 834

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 327 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 285

---

>emb|BX063358.1|CNS09L1U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45AE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1016

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 773 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 815

---

>emb|BX063357.1|CNS09L1T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45AE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 923

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 316 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 274

---

>emb|BX063356.1|CNS09L1S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45AE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 777 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 819

---

>emb|BX063204.1|CNS09KXK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44DF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 344 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 302

---

>emb|BX063203.1|CNS09KXJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44DF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1032

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 803 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 845

---

>emb|BX063052.1|CNS09KTC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44CF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 598

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 338 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 296

---

>emb|BX063051.1|CNS09KTB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44CF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 860

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 732 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 774

---

>emb|BX063016.1|CNS09KSC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44CD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 589

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 358 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 316

---

>emb|BX063014.1|CNS09KSA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44CD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 530

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 358 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 316

---

>emb|BX062938.1|CNS09KQ6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 517

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 330 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 288

---

>emb|BX062802.1|CNS09KME Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44BA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 612

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 352 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 310

---

>emb|BX062794.1|CNS09KM6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44BA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 939

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 331 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 289

---

>emb|BX062793.1|CNS09KM5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44BA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 967

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 788 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 830

---

>emb|BX062775.1|CNS09KLN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44AH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 894

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 333 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 291

---

>emb|BX062774.1|CNS09KLM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44AH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 901

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 798 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 840

---

>emb|BX062707.1|CNS09KJR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44AE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 882

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 335 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 293

---

>emb|BX062706.1|CNS09KJQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44AE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 916

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 699 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 741

---

>emb|BX062617.1|CNS09KH9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43DH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 918

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 336 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 294

---

>emb|BX062616.1|CNS09KH8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43DH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 942

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 789 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 831

---

>emb|BX062615.1|CNS09KH7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43DH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 968

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 340 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 298

---

>emb|BX062614.1|CNS09KH6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43DH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1062

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 788 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 830

---

>emb|BX062265.1|CNS09K7H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43BH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 996

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 333 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 291

---

>emb|BX062264.1|CNS09K7G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 941

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 759 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 801

---

>emb|BX062196.1|CNS09K5K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43BE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1011

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 331 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 289

---

>emb|BX062195.1|CNS09K5J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1076

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 795 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 837

---

>emb|BX062152.1|CNS09K4C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43BC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1028

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 338 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 296

---

>emb|BX062151.1|CNS09K4B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1094

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 793 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 835

---

>emb|BX062132.1|CNS09K3S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43BB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1016

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 342 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 300

---

>emb|BX062131.1|CNS09K3R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1080

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 793 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 835

---

>emb|BX062052.1|CNS09K1K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43AF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 418

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 329 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 287

---

>emb|BX061984.1|CNS09JZO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43AC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 703

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 347 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 305

---

>emb|BX061983.1|CNS09JZN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43AC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 951

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 799 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 841

---

>emb|BX061962.1|CNS09JZ2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 855

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 346 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 304

---

>emb|BX061961.1|CNS09JZ1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 851

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 789 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 831

---

>emb|BX061891.1|CNS09JX3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42DF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1005

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 330 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 288

---

>emb|BX061890.1|CNS09JX2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42DF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1003

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 792 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 834

---

>emb|BX061867.1|CNS09JWF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42DE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 919

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 339 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 297

---

>emb|BX061866.1|CNS09JWE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42DE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 792 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 834

---

>emb|BX061808.1|CNS09JUS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42DB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 874

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 325 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 283

---

>emb|BX061807.1|CNS09JUR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42DB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 941

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 790 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 832

---

>emb|BX061804.1|CNS09JUO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42DB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 980

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 328 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 286

---

>emb|BX061803.1|CNS09JUN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42DB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 987

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 799 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 841

---

>emb|BX061784.1|CNS09JU4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42DA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 962

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 332 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 290

---

>emb|BX061783.1|CNS09JU3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42DA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1010

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 790 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 832

---

>emb|BX061677.1|CNS09JR5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42CE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 338 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 296

---

>emb|BX061676.1|CNS09JR4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42CE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1013

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 819 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 861

---

>emb|BX061589.1|CNS09JOP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42CA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 934

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 340 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 298

---

>emb|BX061588.1|CNS09JOO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42CA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 795 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 837

---

>emb|BX061562.1|CNS09JNY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42BH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 343 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 301

---

>emb|BX061561.1|CNS09JNX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42BH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 803 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 845

---

>emb|BX061522.1|CNS09JMU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42BF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 986

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 346 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 304

---

>emb|BX061521.1|CNS09JMT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42BF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 997

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 788 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 830

---

>emb|BX061174.1|CNS09JD6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41DD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 303 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 261

---

>emb|BX061173.1|CNS09JD5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41DD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 689 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 731

---

>emb|BX060748.1|CNS09J1C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41BA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 880

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 319 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 277

---

>emb|BX060747.1|CNS09J1B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41BA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 937

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 776 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 818

---

>emb|BX060414.1|CNS09IS2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40DB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 654

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 333 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 291

---

>emb|BX060410.1|CNS09IRY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40DA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1017

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 348 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 306

---

>emb|BX060409.1|CNS09IRX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40DA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1056

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 810 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 852

---

>emb|BX060393.1|CNS09IRH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40DA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 966

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 330 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 288

---

>emb|BX060392.1|CNS09IRG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40DA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1011

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 787 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 829

---

>emb|BX060282.1|CNS09IOE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40CD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 605

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 340 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 298

---

>emb|BX060281.1|CNS09IOD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40CD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 768 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 810

---

>emb|BX060076.1|CNS09IIO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 991

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 715 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 757

---

>emb|BX060049.1|CNS09IHX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40BB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 885

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 333 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 291

---

>emb|BX060048.1|CNS09IHW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40BB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 918

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 790 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 832

---

>emb|BX059646.1|CNS09I6Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4CD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 904

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 773 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 815

---

>emb|BX059637.1|CNS09I6H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4CD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 903

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 791 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 833

---

>emb|BX059608.1|CNS09I5O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4CB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 560

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 475 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 517

---

>emb|BX059419.1|CNS09I0F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4BA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 883

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 336 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 294

---

>emb|BX059418.1|CNS09I0E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4BA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 954

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 804 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 846

---

>emb|BX059402.1|CNS09HZY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4AH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 346 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 304

---

>emb|BX059401.1|CNS09HZX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4AH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 954

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 846 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 888

---

>emb|BX059380.1|CNS09HZC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4AG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 350 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 308

---

>emb|BX059379.1|CNS09HZB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4AG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1025

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 800 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 842

---

>emb|BX059205.1|CNS09HUH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 949

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 327 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 285

---

>emb|BX059204.1|CNS09HUG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 796 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 838

---

>emb|BX059163.1|CNS09HTB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39DE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 331 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 289

---

>emb|BX059162.1|CNS09HTA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 988

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 794 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 836

---

>emb|BX059100.1|CNS09HRK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39DB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 895

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 342 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 300

---

>emb|BX059099.1|CNS09HRJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 960

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 806 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 848

---

>emb|BX059084.1|CNS09HR4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39DB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 913

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 338 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 296

---

>emb|BX059083.1|CNS09HR3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 975

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 791 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 833

---

>emb|BX058995.1|CNS09HON Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39CF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 782

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 328 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 286

---

>emb|BX058994.1|CNS09HOM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39CF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 837

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 791 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 833

---

>emb|BX058960.1|CNS09HNO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39CD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 917

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 327 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 285

---

>emb|BX058959.1|CNS09HNN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39CD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 934

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 788 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 830

---

>emb|BX058601.1|CNS09HDP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39AD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 883

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 786 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 828

---

>emb|BX058573.1|CNS09HCX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39AB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 697

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 298 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 256

---

>emb|BX058506.1|CNS09HB2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC38DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 671

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 346 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 304

---

>emb|BX058489.1|CNS09HAL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC38DF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 972

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 341 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 299

---

>emb|BX058488.1|CNS09HAK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38DF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 937

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 818 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 860

---

>emb|BX058259.1|CNS09H47 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38CC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 942

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 778 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 820

---

>emb|BX058247.1|CNS09H3V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38CB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 947

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 102 atcaactcactttgtttctcgccgaaccgctactggctctgcg 144
           |||||| |||| || |||||||| |||||||||||||| ||||
Sbjct: 807 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 849


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,348,677
Number of Sequences: 3902068
Number of extensions: 1348677
Number of successful extensions: 91938
Number of sequences better than 10.0: 1223
Number of HSP's better than 10.0 without gapping: 1223
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 88475
Number of HSP's gapped (non-prelim): 3463
length of query: 223
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 201
effective length of database: 17,147,199,772
effective search space: 3446587154172
effective search space used: 3446587154172
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---