>dbj|D88272.1| Hordeum vulgare mRNA for formate dehydrogenase, complete cds
          Length = 1380

 Score =  141 bits (71), Expect = 3e-31
 Identities = 78/81 (96%)
 Strand = Plus / Plus

                                                                       
Query: 1   ataacgctcggggcgcaatcatggatacccaggctgctgctgangctngctccagcggtc 60
           |||||||||||||||||||||||||||||||||||| |||||| ||| ||||||||||||
Sbjct: 909 ataacgctcggggcgcaatcatggatacccaggctgttgctgatgcttgctccagcggtc 968

                                
Query: 61  acattgctggatacggaggtg 81
           |||||||||||||||||||||
Sbjct: 969 acattgctggatacggaggtg 989

>dbj|AK064610.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-113-B06, full
            insert sequence
          Length = 1872

 Score = 60.0 bits (30), Expect = 9e-07
 Identities = 58/68 (85%)
 Strand = Plus / Plus

                                                                        
Query: 6    gctcggggcgcaatcatggatacccaggctgctgctgangctngctccagcggtcacatt 65
            ||||| || |||||||||||||||||||| | |||||| ||| || |||| |||||| ||
Sbjct: 1395 gctcgtggagcaatcatggatacccaggcggttgctgacgcttgcgccagtggtcacgtt 1454

                    
Query: 66   gctggata 73
            || |||||
Sbjct: 1455 gcaggata 1462

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 56.0 bits (28), Expect = 1e-05
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                            
Query: 6        gctcggggcgcaatcatggatacccaggctgctgctgangctngctccagcggtcacatt 65
                ||||| || |||||||||||||||||||| | |||||| ||| || |||| |||||| ||
Sbjct: 16463470 gctcgtggagcaatcatggatacccaggcggttgctgacgcttgcgccagtggtcacgtt 16463529

                  
Query: 66       gc 67
                ||
Sbjct: 16463530 gc 16463531



 Score = 46.1 bits (23), Expect = 0.014
 Identities = 51/61 (83%)
 Strand = Plus / Plus

                                                                            
Query: 1        ataacgctcggggcgcaatcatggatacccaggctgctgctgangctngctccagcggtc 60
                |||| ||||| || |||||||||||||||||||| | ||| || ||| |||| || ||||
Sbjct: 16433475 ataatgctcgaggagcaatcatggatacccaggcggttgcagacgcttgctctagtggtc 16433534

                 
Query: 61       a 61
                |
Sbjct: 16433535 a 16433535

>dbj|AP005656.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0404G03
          Length = 135225

 Score = 56.0 bits (28), Expect = 1e-05
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                         
Query: 6     gctcggggcgcaatcatggatacccaggctgctgctgangctngctccagcggtcacatt 65
             ||||| || |||||||||||||||||||| | |||||| ||| || |||| |||||| ||
Sbjct: 72788 gctcgtggagcaatcatggatacccaggcggttgctgacgcttgcgccagtggtcacgtt 72847

               
Query: 66    gc 67
             ||
Sbjct: 72848 gc 72849



 Score = 46.1 bits (23), Expect = 0.014
 Identities = 51/61 (83%)
 Strand = Plus / Plus

                                                                         
Query: 1     ataacgctcggggcgcaatcatggatacccaggctgctgctgangctngctccagcggtc 60
             |||| ||||| || |||||||||||||||||||| | ||| || ||| |||| || ||||
Sbjct: 42793 ataatgctcgaggagcaatcatggatacccaggcggttgcagacgcttgctctagtggtc 42852

              
Query: 61    a 61
             |
Sbjct: 42853 a 42853

>gb|BT016309.1| Zea mays clone Contig142 mRNA sequence
          Length = 1507

 Score = 48.1 bits (24), Expect = 0.003
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                        
Query: 54   agcggtcacattgctggatacggaggtg 81
            ||||||||||||||||||||||| ||||
Sbjct: 987  agcggtcacattgctggatacggtggtg 1014

>gb|AF439732.1|AF439732 Zea mays formate dehydrogenase mRNA, partial cds
          Length = 597

 Score = 48.1 bits (24), Expect = 0.003
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                       
Query: 54  agcggtcacattgctggatacggaggtg 81
           ||||||||||||||||||||||| ||||
Sbjct: 538 agcggtcacattgctggatacggtggtg 565

>gb|AY111955.1| Zea mays CL15209_1 mRNA sequence
          Length = 1667

 Score = 48.1 bits (24), Expect = 0.003
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                        
Query: 54   agcggtcacattgctggatacggaggtg 81
            ||||||||||||||||||||||| ||||
Sbjct: 992  agcggtcacattgctggatacggtggtg 1019

>dbj|AP003518.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0008F02
          Length = 139655

 Score = 46.1 bits (23), Expect = 0.014
 Identities = 51/61 (83%)
 Strand = Plus / Plus

                                                                          
Query: 1      ataacgctcggggcgcaatcatggatacccaggctgctgctgangctngctccagcggtc 60
              |||| ||||| || |||||||||||||||||||| | ||| || ||| |||| || ||||
Sbjct: 110038 ataatgctcgaggagcaatcatggatacccaggcggttgcagacgcttgctctagtggtc 110097

               
Query: 61     a 61
              |
Sbjct: 110098 a 110098

>dbj|AK104788.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-E04, full
           insert sequence
          Length = 1637

 Score = 46.1 bits (23), Expect = 0.014
 Identities = 51/61 (83%)
 Strand = Plus / Plus

                                                                       
Query: 1   ataacgctcggggcgcaatcatggatacccaggctgctgctgangctngctccagcggtc 60
           |||| ||||| || |||||||||||||||||||| | ||| || ||| |||| || ||||
Sbjct: 921 ataatgctcgaggagcaatcatggatacccaggcggttgcagacgcttgctctagtggtc 980

            
Query: 61  a 61
           |
Sbjct: 981 a 981

>dbj|AK065872.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013048A01, full
           insert sequence
          Length = 1648

 Score = 46.1 bits (23), Expect = 0.014
 Identities = 51/61 (83%)
 Strand = Plus / Plus

                                                                       
Query: 1   ataacgctcggggcgcaatcatggatacccaggctgctgctgangctngctccagcggtc 60
           |||| ||||| || |||||||||||||||||||| | ||| || ||| |||| || ||||
Sbjct: 932 ataatgctcgaggagcaatcatggatacccaggcggttgcagacgcttgctctagtggtc 991

            
Query: 61  a 61
           |
Sbjct: 992 a 992

>dbj|AB019533.1| Oryza sativa mRNA for Nad-dependent formate dehydrogenase, complete
           cds
          Length = 1449

 Score = 46.1 bits (23), Expect = 0.014
 Identities = 51/61 (83%)
 Strand = Plus / Plus

                                                                       
Query: 1   ataacgctcggggcgcaatcatggatacccaggctgctgctgangctngctccagcggtc 60
           |||| ||||| || |||||||||||||||||||| | ||| || ||| |||| || ||||
Sbjct: 935 ataatgctcgaggagcaatcatggatacccaggcggttgcagacgcttgctctagtggtc 994

            
Query: 61  a 61
           |
Sbjct: 995 a 995

>gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome
          Length = 4406967

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 49      gctccagcggtcacattgc 67
               |||||||||||||||||||
Sbjct: 4231324 gctccagcggtcacattgc 4231342

>gb|AC024937.21| Homo sapiens 3 BAC RP11-480A16 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 157198

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 24     gatacccaggctgctgctg 42
              |||||||||||||||||||
Sbjct: 151018 gatacccaggctgctgctg 151036


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 489,649
Number of Sequences: 3902068
Number of extensions: 489649
Number of successful extensions: 30587
Number of sequences better than 10.0: 13
Number of HSP's better than 10.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 30555
Number of HSP's gapped (non-prelim): 32
length of query: 81
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 60
effective length of database: 17,151,101,840
effective search space: 1029066110400
effective search space used: 1029066110400
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)