ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags16n04
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC099606.13| Mus musculus chromosome 7, clone RP23-360N6, com... 42 1.5
2gb|AC008180.15| Homo sapiens 3 BAC RP11-292L5 (Roswell Park Canc... 42 1.5
3gb|AC156569.3| Mus musculus BAC clone RP23-315K10 from chromosom... 42 1.5
4ref|XM_342595.2| PREDICTED: Rattus norvegicus syntaxin 16 (predi... 42 1.5
5dbj|AB012705.1| Daucus carota mRNA for 85, partial cds 42 1.5
6ref|NM_117629.2| Arabidopsis thaliana ATB' GAMMA AT4G15410 (ATB'... 40 6.0
7gb|U97011.3| Caenorhabditis elegans cosmid F31F7, complete sequence 40 6.0
8gb|AC003067.59| Mus musculus Chromosome 16 BAC Clone tbx3 Synten... 40 6.0
9gb|AF414358.1|AF414356S3 Mus musculus thioredoxin reductase (Trx... 40 6.0
10ref|XM_652579.1| Aspergillus nidulans FGSC A4 hypothetical prote... 40 6.0
11gb|AC160335.6| Mus musculus BAC clone RP23-38N19 from chromosome... 40 6.0
12gb|AC133488.30| Mus musculus strain C57BL/6J clone rp23-432e14, ... 40 6.0
13gb|AC104129.4| Homo sapiens BAC clone RP13-596B14 from 7, comple... 40 6.0
14emb|CR954246.1| Pseudoalteromonas haloplanktis str. TAC125 chrom... 40 6.0
15gb|AC108945.4| Mus musculus BAC clone RP23-119J11 from 15, compl... 40 6.0
16gb|AC012399.40| Mus musculus strain 129S6/SvEvTac clone rp21-184... 40 6.0
17ref|XM_789007.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 6.0
18gb|AY050766.1| Arabidopsis thaliana putative phosphatase (At4g15... 40 6.0
19gb|BT008747.1| Arabidopsis thaliana putative phosphatase (At4g15... 40 6.0
20emb|BX842654.1| Bdellovibrio bacteriovorus complete genome, stra... 40 6.0
21gb|AC007188.7| Arabidopsis thaliana chromosome 2 clone T4D8 map ... 40 6.0
22gb|AC003066.18| Mus musculus Chromosome 16 BAC Clone tbx1 Synten... 40 6.0
23gb|AF310625.1|AF310625 Aspergillus nidulans ribonucleotide reduc... 40 6.0
24gb|AC159812.2| Mus musculus BAC clone RP24-86O15 from chromosome... 40 6.0
25ref|NM_072200.1| Caenorhabditis elegans F31F7.3 (F31F7.3) mRNA, ... 40 6.0
26emb|BX816347.1|CNS0AD3U Arabidopsis thaliana Full-length cDNA Co... 40 6.0
27emb|BX826718.1|CNS0A3AS Arabidopsis thaliana Full-length cDNA Co... 40 6.0
28emb|BX828359.1|CNS0A325 Arabidopsis thaliana Full-length cDNA Co... 40 6.0
29emb|BX828292.1|CNS0A345 Arabidopsis thaliana Full-length cDNA Co... 40 6.0
30emb|BX828216.1|CNS0A2XJ Arabidopsis thaliana Full-length cDNA Co... 40 6.0
31emb|BX827321.1|CNS0A2UK Arabidopsis thaliana Full-length cDNA Co... 40 6.0
32emb|BX826555.1|CNS0A35L Arabidopsis thaliana Full-length cDNA Co... 40 6.0
33emb|BX827832.1|CNS0A29X Arabidopsis thaliana Full-length cDNA Co... 40 6.0
34emb|BX827514.1|CNS0A2DB Arabidopsis thaliana Full-length cDNA Co... 40 6.0
35gb|AC133487.14| Mus musculus strain C57BL/6J clone rp23-285e22, ... 40 6.0
36dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome 40 6.0
37emb|Z97338.2|ATFCA3 Arabidopsis thaliana DNA chromosome 4, ESSA ... 40 6.0
38emb|AL161541.2|ATCHRIV41 Arabidopsis thaliana DNA chromosome 4, ... 40 6.0
39emb|CT030644.8| Mouse DNA sequence from clone RP24-82E11 on chro... 40 6.0
40dbj|AP000344.1| Homo sapiens genomic DNA, chromosome 22q11.2, cl... 40 6.0 
>gb|AC099606.13| Mus musculus chromosome 7, clone RP23-360N6, complete sequence
          Length = 193975

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 163    aaactgagattgaatcagcag 183
              |||||||||||||||||||||
Sbjct: 105526 aaactgagattgaatcagcag 105506
to top
>gb|AC008180.15| Homo sapiens 3 BAC RP11-292L5 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 193035

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 154   agaataaagaaactgagattg 174
             |||||||||||||||||||||
Sbjct: 77377 agaataaagaaactgagattg 77397
to top
>gb|AC156569.3| Mus musculus BAC clone RP23-315K10 from chromosome 13, complete
             sequence
          Length = 165570

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 145   tagaagaagagaataaagaaactgagatt 173
             |||||||||| ||||||||||||| ||||
Sbjct: 68176 tagaagaagacaataaagaaactgggatt 68204
to top
>ref|XM_342595.2| PREDICTED: Rattus norvegicus syntaxin 16 (predicted)
            (Stx16_predicted), mRNA
          Length = 1488

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 25   gatgcaggaaggaggagagta 45
            |||||||||||||||||||||
Sbjct: 1266 gatgcaggaaggaggagagta 1246
to top
>dbj|AB012705.1| Daucus carota mRNA for 85, partial cds
          Length = 688

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 174 gaatcagcagcaatgaatcct 194
           |||||||||||||||||||||
Sbjct: 185 gaatcagcagcaatgaatcct 165
to top
>ref|NM_117629.2| Arabidopsis thaliana ATB' GAMMA AT4G15410 (ATB' GAMMA) mRNA,
           complete cds
          Length = 1523

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 152 agagaataaagaaactgaga 171
           ||||||||||||||||||||
Sbjct: 384 agagaataaagaaactgaga 403
to top
>gb|U97011.3| Caenorhabditis elegans cosmid F31F7, complete sequence
          Length = 18210

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 146  agaagaagagaataaagaaa 165
            ||||||||||||||||||||
Sbjct: 8887 agaagaagagaataaagaaa 8906
to top
>gb|AC003067.59| Mus musculus Chromosome 16 BAC Clone tbx3 Syntenic To Homo sapiens
             22q11.2 DGCR Region, complete sequence
          Length = 262062

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 159   aaagaaactgagattgaatc 178
             ||||||||||||||||||||
Sbjct: 40695 aaagaaactgagattgaatc 40714
to top
>gb|AF414358.1|AF414356S3 Mus musculus thioredoxin reductase (Trxr2) gene, exons 6 through 11
          Length = 22333

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 159   aaagaaactgagattgaatc 178
             ||||||||||||||||||||
Sbjct: 18271 aaagaaactgagattgaatc 18290
to top
>ref|XM_652579.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN0067.2), mRNA
          Length = 1221

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 305 ttttgaagctgccggcaaag 324
           ||||||||||||||||||||
Sbjct: 87  ttttgaagctgccggcaaag 106
to top
>gb|AC160335.6| Mus musculus BAC clone RP23-38N19 from chromosome 15, complete sequence
          Length = 212090

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 371    gaacacagttgctggagtca 390
              ||||||||||||||||||||
Sbjct: 103958 gaacacagttgctggagtca 103939
to top
>gb|AC133488.30| Mus musculus strain C57BL/6J clone rp23-432e14, complete sequence
          Length = 202128

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 159   aaagaaactgagattgaatc 178
             ||||||||||||||||||||
Sbjct: 27281 aaagaaactgagattgaatc 27300
to top
>gb|AC104129.4| Homo sapiens BAC clone RP13-596B14 from 7, complete sequence
          Length = 65189

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 208   gaggtgtgacacagacagta 227
             ||||||||||||||||||||
Sbjct: 34864 gaggtgtgacacagacagta 34883
to top
>emb|CR954246.1| Pseudoalteromonas haloplanktis str. TAC125 chromosome I, complete sequence
          Length = 3214944

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 132     gttattccagatgtagaagaagag 155
               |||||||||||| |||||||||||
Sbjct: 1804870 gttattccagatttagaagaagag 1804847
to top
>gb|AC108945.4| Mus musculus BAC clone RP23-119J11 from 15, complete sequence
          Length = 200294

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 126    cctgaagttattccagatgt 145
              ||||||||||||||||||||
Sbjct: 135555 cctgaagttattccagatgt 135536
to top
>gb|AC012399.40| Mus musculus strain 129S6/SvEvTac clone rp21-184c17 map 16, complete
            sequence
          Length = 146040

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 159  aaagaaactgagattgaatc 178
            ||||||||||||||||||||
Sbjct: 5404 aaagaaactgagattgaatc 5385
to top
>ref|XM_789007.1| PREDICTED: Strongylocentrotus purpuratus similar to Intestinal
           alkaline phosphatase precursor (IAP) (LOC589365),
           partial mRNA
          Length = 713

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 92  tcgagatgacagacagcgac 111
           ||||||||||||||||||||
Sbjct: 232 tcgagatgacagacagcgac 251
to top
>gb|AY050766.1| Arabidopsis thaliana putative phosphatase (At4g15410) mRNA,
           complete cds
          Length = 1544

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 152 agagaataaagaaactgaga 171
           ||||||||||||||||||||
Sbjct: 386 agagaataaagaaactgaga 405
to top
>gb|BT008747.1| Arabidopsis thaliana putative phosphatase (At4g15410) mRNA,
           complete cds
          Length = 1297

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 152 agagaataaagaaactgaga 171
           ||||||||||||||||||||
Sbjct: 336 agagaataaagaaactgaga 355
to top
>emb|BX842654.1| Bdellovibrio bacteriovorus complete genome, strain HD100; segment 9/11
          Length = 344249

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 296    tgaagttgcttttgaagctg 315
              ||||||||||||||||||||
Sbjct: 260815 tgaagttgcttttgaagctg 260796
to top
>gb|AC007188.7| Arabidopsis thaliana chromosome 2 clone T4D8 map mi421, complete
             sequence
          Length = 89836

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 144   gtagaagaagagaataaaga 163
             ||||||||||||||||||||
Sbjct: 47742 gtagaagaagagaataaaga 47761
to top
>gb|AC003066.18| Mus musculus Chromosome 16 BAC Clone tbx1 Syntenic To Homo sapiens
             22q11.2 DGCR Region, complete sequence
          Length = 176974

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 159   aaagaaactgagattgaatc 178
             ||||||||||||||||||||
Sbjct: 28998 aaagaaactgagattgaatc 29017
to top
>gb|AF310625.1|AF310625 Aspergillus nidulans ribonucleotide reductase (rnrA) gene, complete
           cds
          Length = 2197

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 305 ttttgaagctgccggcaaag 324
           ||||||||||||||||||||
Sbjct: 523 ttttgaagctgccggcaaag 542
to top
>gb|AC159812.2| Mus musculus BAC clone RP24-86O15 from chromosome 9, complete sequence
          Length = 204400

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 288    gctgcttgtgaagttgcttt 307
              ||||||||||||||||||||
Sbjct: 177661 gctgcttgtgaagttgcttt 177680
to top
>ref|NM_072200.1| Caenorhabditis elegans F31F7.3 (F31F7.3) mRNA, complete cds
          Length = 525

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 146 agaagaagagaataaagaaa 165
           ||||||||||||||||||||
Sbjct: 351 agaagaagagaataaagaaa 332
to top
>emb|BX816347.1|CNS0AD3U Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTPGH42ZE04 of Hormone Treated Callus of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1800

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 152  agagaataaagaaactgaga 171
            ||||||||||||||||||||
Sbjct: 1501 agagaataaagaaactgaga 1482
to top
>emb|BX826718.1|CNS0A3AS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB57ZE03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1426

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 152 agagaataaagaaactgaga 171
           ||||||||||||||||||||
Sbjct: 360 agagaataaagaaactgaga 379
to top
>emb|BX828359.1|CNS0A325 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH7ZD12 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1347

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 152 agagaataaagaaactgaga 171
           ||||||||||||||||||||
Sbjct: 263 agagaataaagaaactgaga 282
to top
>emb|BX828292.1|CNS0A345 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH71ZH02 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1441

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 152 agagaataaagaaactgaga 171
           ||||||||||||||||||||
Sbjct: 384 agagaataaagaaactgaga 403
to top
>emb|BX828216.1|CNS0A2XJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH64ZD03 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1505

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 152 agagaataaagaaactgaga 171
           ||||||||||||||||||||
Sbjct: 380 agagaataaagaaactgaga 399
to top
>emb|BX827321.1|CNS0A2UK Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS39ZC11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1462

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 152 agagaataaagaaactgaga 171
           ||||||||||||||||||||
Sbjct: 384 agagaataaagaaactgaga 403
to top
>emb|BX826555.1|CNS0A35L Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB3ZF10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1393

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 152 agagaataaagaaactgaga 171
           ||||||||||||||||||||
Sbjct: 382 agagaataaagaaactgaga 401
to top
>emb|BX827832.1|CNS0A29X Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH26ZA07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1447

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 152 agagaataaagaaactgaga 171
           ||||||||||||||||||||
Sbjct: 380 agagaataaagaaactgaga 399
to top
>emb|BX827514.1|CNS0A2DB Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS68ZC11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1501

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 152 agagaataaagaaactgaga 171
           ||||||||||||||||||||
Sbjct: 379 agagaataaagaaactgaga 398
to top
>gb|AC133487.14| Mus musculus strain C57BL/6J clone rp23-285e22, complete sequence
          Length = 158595

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 159   aaagaaactgagattgaatc 178
             ||||||||||||||||||||
Sbjct: 33419 aaagaaactgagattgaatc 33400
to top
>dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome
          Length = 4659019

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 301     ttgcttttgaagctgccggc 320
               ||||||||||||||||||||
Sbjct: 3900246 ttgcttttgaagctgccggc 3900227
to top
>emb|Z97338.2|ATFCA3 Arabidopsis thaliana DNA chromosome 4, ESSA I FCA contig fragment No. 3
          Length = 200252

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 152    agagaataaagaaactgaga 171
              ||||||||||||||||||||
Sbjct: 179846 agagaataaagaaactgaga 179865
to top
>emb|AL161541.2|ATCHRIV41 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 41
          Length = 197419

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 152    agagaataaagaaactgaga 171
              ||||||||||||||||||||
Sbjct: 133323 agagaataaagaaactgaga 133342
to top
>emb|CT030644.8| Mouse DNA sequence from clone RP24-82E11 on chromosome 9, complete
              sequence
          Length = 211707

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 288    gctgcttgtgaagttgcttt 307
              ||||||||||||||||||||
Sbjct: 207084 gctgcttgtgaagttgcttt 207065
to top
>dbj|AP000344.1| Homo sapiens genomic DNA, chromosome 22q11.2, clone KB1269D1
          Length = 186421

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 208    gaggtgtgacacagacagta 227
              ||||||||||||||||||||
Sbjct: 106034 gaggtgtgacacagacagta 106015


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,862,265
Number of Sequences: 3902068
Number of extensions: 3862265
Number of successful extensions: 79531
Number of sequences better than 10.0: 40
Number of HSP's better than 10.0 without gapping: 40
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 79447
Number of HSP's gapped (non-prelim): 84
length of query: 446
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 424
effective length of database: 17,147,199,772
effective search space: 7270412703328
effective search space used: 7270412703328
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top