ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags16i10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AF262984.1|AF262984 Triticum aestivum cyclophilin A-3 (CyP3) ... 547 e-153
2gb|AF262982.1|AF262982 Triticum aestivum cyclophilin A-1 (CyP1) ... 547 e-153
3gb|AF262983.1|AF262983 Triticum aestivum cyclophilin A-2 (CyP2) ... 539 e-150
4gb|AY456122.1| Triticum aestivum cyclophilin A (CYP18-2) gene, c... 539 e-150
5gb|BT016412.1| Zea mays clone Contig245 mRNA sequence 321 1e-84
6emb|X68678.1|ZMCYCL Z.mays gene for cyclophilin 313 2e-82
7gb|M55021.1|MZECYP Zea mays cyclophilin (CyP) mRNA, complete cds 313 2e-82
8gb|BT017873.1| Zea mays clone EL01N0513A10.c mRNA sequence 305 6e-80
9ref|XM_463914.1| Oryza sativa (japonica cultivar-group), mRNA 303 2e-79
10ref|XM_506694.1| PREDICTED Oryza sativa (japonica cultivar-group... 303 2e-79
11gb|DQ480736.1| Oryza sativa (indica cultivar-group) cyclophilinA... 303 2e-79
12dbj|AK061894.1| Oryza sativa (japonica cultivar-group) cDNA clon... 303 2e-79
13dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 303 2e-79
14dbj|AP004078.3| Oryza sativa (japonica cultivar-group) genomic D... 303 2e-79
15dbj|AP005851.2| Oryza sativa (japonica cultivar-group) genomic D... 303 2e-79
16dbj|AK098919.1| Oryza sativa (japonica cultivar-group) cDNA clon... 303 2e-79
17gb|L29470.1|RICCYP2R Oryza sativa cyclophilin 2 (Cyp2) mRNA, com... 303 2e-79
18gb|L29469.1|RICCYP2G Oryza sativa cyclophilin 2 (Cyp2) gene, com... 303 2e-79
19gb|BT016413.1| Zea mays clone Contig246 mRNA sequence 297 1e-77
20gb|AF384147.1|AF384147 Triticum aestivum cyclophilin mRNA, parti... 297 1e-77
21gb|AF263544.1| Oryza sativa clone 20CAC microsatellite sequence 293 2e-76
22gb|AY456123.1| Triticum aestivum cyclophilin A (CYP18-1) gene, p... 184 1e-43
23gb|AY456124.1| Triticum aestivum cyclophilin A (CYP18-3) gene, p... 182 6e-43
24gb|AF052206.2| Chlamydomonas reinhardtii cyclophilin 1 (cyp1) mR... 178 9e-42
25gb|AF424658.1| Phytophthora infestans clone MY-08-C-01 peptidylp... 174 1e-40
26gb|AY109901.1| Zea mays CL2214_-5 mRNA sequence 174 1e-40
27dbj|AK105186.1| Oryza sativa (japonica cultivar-group) cDNA clon... 167 3e-38
28gb|AY105212.1| Zea mays PCO124469 mRNA sequence 165 1e-37
29dbj|AB020612.1| Vigna radiata mRNA for CYP1, complete cds 163 5e-37
30dbj|AK062540.1| Oryza sativa (japonica cultivar-group) cDNA clon... 161 2e-36
31emb|Y08320.1|DLCYCLO D.lanata mRNA for cyclophilin 159 8e-36
32gb|AY705800.1| Pinus halepensis clone 17r cyclophilin mRNA, comp... 157 3e-35
33dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 157 3e-35
34dbj|AP006162.2| Oryza sativa (japonica cultivar-group) genomic D... 157 3e-35
35dbj|AK103109.1| Oryza sativa (japonica cultivar-group) cDNA clon... 157 3e-35
36gb|L29471.1|RICCYP1R Oryza sativa cyclophilin 1 (Cyp1) mRNA, com... 157 3e-35
37emb|Y08273.1|DLCYP18 D.lanata CYP18 gene 145 1e-31
38gb|AF456323.1|AF456323 Glycine max cyclophilin (Cyp) mRNA, compl... 145 1e-31
39gb|AF055990.1|AF055990 Fucus distichus cyclophilin mRNA, partial... 133 5e-28
40gb|AC010707.17| Drosophila melanogaster clone BACR06P10, complet... 121 2e-24
41gb|AC010846.13| Drosophila melanogaster clone BACR13G13, complet... 121 2e-24
42gb|AY232025.1| Drosophila yakuba clone yak-ad_Cyp1 mRNA sequence 121 2e-24
43gb|AY231912.1| Drosophila yakuba clone yak-em_Cyp1 mRNA sequence 121 2e-24
44gb|BT009946.1| Drosophila melanogaster SD01793 full insert cDNA 121 2e-24
45ref|NM_078642.3| Drosophila melanogaster Cyclophilin 1 CG9916-RA... 121 2e-24
46gb|DQ066345.1| Ixodes scapularis isolate IS-6-12-J-cluster-190 c... 121 2e-24
47gb|AE003501.4| Drosophila melanogaster chromosome X, section 53 ... 121 2e-24
48gb|M62398.1|DROCYP1 Drosophila melanogaster CYP-1 protein mRNA, ... 121 2e-24
49ref|XM_366228.1| Magnaporthe grisea 70-15 hypothetical protein (... 119 7e-24
50emb|Z15137.1|SCCYCLOA Streptomyces chrysomallus orfA, estA, cypA... 119 7e-24
51dbj|AB062457.1| Magnaporthe grisea CYP1 mRNA for cyclophilin, co... 119 7e-24
52gb|DQ012959.1| Streptomyces antibioticus strain ETH7451 cyclophi... 115 1e-22
53emb|AJ862840.1| Streptomyces griseus subsp. griseus streptomycin... 111 2e-21
54dbj|AB231815.1| Malassezia yamatoensis CYP mRNA for cyclophilin,... 111 2e-21
55dbj|AB231812.1| Malassezia obtusa CYP mRNA for cyclophilin, part... 111 2e-21
56gb|DQ012958.1| Streptomyces antibioticus strain ATCC 11891 cyclo... 107 3e-20
57emb|AJ271126.1|PAB271126 Picea abies mRNA for putative cyclospor... 105 1e-19
58gb|AF178458.1|AF178458 Lupinus luteus cytosolic cyclophilin gene... 100 7e-18
59gb|AE016817.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 100 7e-18
60ref|NM_209536.1| Eremothecium gossypii ADR087Cp (ADR087C), mRNA 100 7e-18
61ref|XM_959286.1| Neurospora crassa OR74A hypothetical protein ( ... 98 3e-17
62ref|XM_324905.1| Neurospora crassa OR74A hypothetical protein ( ... 98 3e-17
63emb|AJ311666.1|BVE311666 Betula verrucosa mRNA for peptidylproly... 98 3e-17
64gb|J03963.1|NEUCYCLO N.crassa cytosolic cyclosporin A-binding pr... 98 3e-17
65ref|XM_323171.1| Neurospora crassa OR74A hypothetical protein ( ... 96 1e-16
66ref|XM_950770.1| Neurospora crassa OR74A hypothetical protein ( ... 96 1e-16
67emb|AJ292563.1|NCR292563 Neurospora crassa mRNA for cyclophilin41 96 1e-16
68gb|AF542516.1| Beauveria bassiana cyclophilin A mRNA, complete cds 96 1e-16
69gb|AF242312.1|AF242312 Euphorbia esula cyclophilin mRNA, partial... 94 4e-16
70emb|Y13576.1|LMCYCL Leishmania major mRNA for cyclophilin 92 2e-15
71emb|AL939131.1|SCO939131 Streptomyces coelicolor A3(2) complete ... 92 2e-15
72dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 92 2e-15
73dbj|AP004741.3| Oryza sativa (japonica cultivar-group) genomic D... 92 2e-15
74emb|Y16088.1|LLCYCLOPH Lupinus luteus mRNA for cyclophilin 92 2e-15
75dbj|AK068112.1| Oryza sativa (japonica cultivar-group) cDNA clon... 92 2e-15
76emb|BX045917.1|CNS097LD Single read from an extremity of a full-... 90 6e-15
77emb|BX045916.1|CNS097LC Single read from an extremity of a full-... 90 6e-15
78emb|BX032973.1|CNS08XLT Single read from an extremity of a full-... 90 6e-15
79emb|BX032972.1|CNS08XLS Single read from an extremity of a full-... 90 6e-15
80emb|BX027426.1|CNS08TBQ Single read from an extremity of a full-... 90 6e-15
81emb|BX027425.1|CNS08TBP Single read from an extremity of a full-... 90 6e-15
82emb|BX023395.1|CNS08Q7R Single read from an extremity of a full-... 90 6e-15
83emb|BX023394.1|CNS08Q7Q Single read from an extremity of a full-... 90 6e-15
84emb|BX010692.1|CNS08GEW Single read from an extremity of a full-... 90 6e-15
85emb|BX010691.1|CNS08GEV Single read from an extremity of a full-... 90 6e-15
86ref|XM_308669.2| Anopheles gambiae str. PEST ENSANGP00000011257 ... 90 6e-15
87dbj|AB012947.1| Vicia faba vcCyP mRNA, complete cds 90 6e-15
88ref|XM_380953.1| Gibberella zeae PH-1 chromosome 1 hypothetical ... 88 3e-14
89dbj|AB231810.1| Malassezia japonica CYP mRNA for cyclophilin, pa... 88 3e-14
90gb|AF025803.1|AF025803 Drosophila pseudoobscura cyclophilin 1 (C... 88 3e-14
91gb|AY754447.1| Drosophila affinis cyclophylin 1 (Cyp1) gene, exo... 88 3e-14
92ref|NM_166539.1| Drosophila melanogaster CG2852-RB, transcript v... 86 1e-13
93ref|NM_137851.2| Drosophila melanogaster CG2852-RA, transcript v... 86 1e-13
94gb|AC008350.4|AC008350 Drosophila melanogaster, chromosome 2R, r... 86 1e-13
95gb|BT021266.1| Drosophila melanogaster RE50843 full insert cDNA 86 1e-13
96gb|AE003458.3| Drosophila melanogaster chromosome 2R, section 66... 86 1e-13
97gb|AC004377.1|AC004377 Drosophila melanogaster DNA sequence (P1 ... 86 1e-13
98ref|XM_362521.1| Magnaporthe grisea 70-15 hypothetical protein (... 84 4e-13
99ref|XM_851866.1| PREDICTED: Canis familiaris similar to Peptidyl... 84 4e-13
100ref|XM_843646.1| PREDICTED: Canis familiaris similar to Peptidyl... 84 4e-13
101ref|XM_467917.1| Oryza sativa (japonica cultivar-group), mRNA 82 2e-12
102emb|BX053495.1|CNS09DFV Single read from an extremity of a full-... 82 2e-12
103emb|BX053494.1|CNS09DFU Single read from an extremity of a full-... 82 2e-12
104emb|BX059546.1|CNS09I3Y Single read from an extremity of a full-... 82 2e-12
105emb|BX043476.1|CNS095PK Single read from an extremity of a full-... 82 2e-12
106emb|BX043545.1|CNS095RH Single read from an extremity of a full-... 82 2e-12
107emb|BX043544.1|CNS095RG Single read from an extremity of a full-... 82 2e-12
108emb|BX025264.1|CNS08RNO Single read from an extremity of a full-... 82 2e-12
109emb|BX025263.1|CNS08RNN Single read from an extremity of a full-... 82 2e-12
110gb|DQ122910.1| Chlamydomonas incerta peptidylprolyl isomerase/cy... 82 2e-12
111gb|AF182826.1| Drosophila melanogaster cyclophilin-33 (cyp33) mR... 82 2e-12
112dbj|AP004159.3| Oryza sativa (japonica cultivar-group) genomic D... 82 2e-12
113dbj|AP005002.3| Oryza sativa (japonica cultivar-group) genomic D... 82 2e-12
114dbj|AK070404.1| Oryza sativa (japonica cultivar-group) cDNA clon... 82 2e-12
115ref|XM_568796.1| Cryptococcus neoformans var. neoformans JEC21 c... 80 6e-12
116ref|XM_568801.1| Cryptococcus neoformans var. neoformans JEC21 c... 80 6e-12
117gb|AY232181.1| Drosophila yakuba clone yak-ad_CG2852 mRNA sequence 80 6e-12
118emb|AJ417659.1|POS417659 Pleurotus ostreatus partial mRNA for pu... 80 6e-12
119gb|U68268.1|TCU68268 Trypanosoma congolense cyclophilin A (cypA)... 80 6e-12
120gb|AF025804.1|AF025804 Drosophila subobscura cyclophilin 1 (Cyp1... 80 6e-12
121gb|AF158368.1|AF158368 Leishmania donovani cyclophilin (CYP) gen... 80 6e-12
122gb|AY389742.1| Hyacinthus orientalis cyclophilin mRNA, complete cds 78 2e-11
123gb|AY325152.1| Rattus norvegicus Ab1-210 mRNA, complete cds 76 1e-10
124emb|BX072404.1|CNS09S14 Single read from an extremity of a full-... 76 1e-10
125emb|BX069873.1|CNS09Q2T Single read from an extremity of a full-... 76 1e-10
126emb|BX057302.1|CNS09GDM Single read from an extremity of a full-... 76 1e-10
127emb|BX050608.1|CNS09B7O Single read from an extremity of a full-... 76 1e-10
128emb|BX046149.1|CNS097RT Single read from an extremity of a full-... 76 1e-10
129emb|BX036923.1|CNS090NJ Single read from an extremity of a full-... 76 1e-10
130emb|BX024694.1|CNS08R7U Single read from an extremity of a full-... 76 1e-10
131emb|BX016404.1|CNS08KTK Single read from an extremity of a full-... 76 1e-10
132emb|BX014873.1|CNS08JN1 Single read from an extremity of a full-... 76 1e-10
133emb|BX013233.1|CNS08IDH Single read from an extremity of a full-... 76 1e-10
134emb|BX011227.1|CNS08GTR Single read from an extremity of a full-... 76 1e-10
135emb|BX008702.1|CNS08EVM Single read from an extremity of a full-... 76 1e-10
136emb|BX006580.1|CNS08D8O Single read from an extremity of a full-... 76 1e-10
137gb|AE016814.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 76 1e-10
138ref|XM_216524.3| PREDICTED: Rattus norvegicus peptidylprolyl iso... 76 1e-10
139ref|XM_310632.2| Anopheles gambiae str. PEST ENSANGP00000020778 ... 76 1e-10
140ref|NM_207839.1| Eremothecium gossypii AAL056Cp (AAL056C), mRNA 76 1e-10
141ref|XM_586293.2| PREDICTED: Bos taurus similar to Peptidyl-proly... 74 4e-10
142emb|CR956427.7| Pig DNA sequence from clone CH242-51O7 on chromo... 74 4e-10
143ref|XM_504296.1| Yarrowia lipolytica CLIB122, YALI0E23155g predi... 74 4e-10
144emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB ... 74 4e-10
145gb|DQ440048.1| Aedes aegypti clone AE-296 cyclophylin isoform mR... 72 1e-09
146gb|AY368274.1| Nicotiana tabacum cyclophilin-like (CYP1) mRNA, c... 72 1e-09
147gb|AY134669.1| Drosophila melanogaster peptidylprolyl cis-trans ... 72 1e-09
148emb|CR715907.2|CNS0GFCF Tetraodon nigroviridis full-length cDNA 72 1e-09
149emb|CR711184.2|CNS0GBP8 Tetraodon nigroviridis full-length cDNA 72 1e-09
150emb|CR708069.2|CNS0G9AP Tetraodon nigroviridis full-length cDNA 72 1e-09
151emb|CR706426.2|CNS0G812 Tetraodon nigroviridis full-length cDNA 72 1e-09
152emb|AJ011956.1|MFU011956 Malassezia sympodialis mRNA for allerge... 72 1e-09
153gb|AY346337.1| Branchiostoma belcheri tsingtaunese cyclophilin A... 72 1e-09
154emb|AJ238310.1|LRU238310 Lumbricus rubellus mRNA for cyclophilin A 72 1e-09
155emb|CR938346.1| Single read from an extremity of a full-length c... 72 1e-09
156emb|CR938040.1| Single read from an extremity of a full-length c... 72 1e-09
157ref|NM_170367.1| Drosophila melanogaster Moca-cyp CG1866-RA, tra... 72 1e-09
158ref|NM_143361.3| Drosophila melanogaster Moca-cyp CG1866-RB, tra... 72 1e-09
159gb|AY051595.1| Drosophila melanogaster GH23813 full length cDNA 72 1e-09
160gb|AC009345.7|AC009345 Drosophila melanogaster, chromosome 3R, r... 72 1e-09
161gb|AC008028.3|AC008028 Drosophila melanogaster, chromosome 3R, r... 72 1e-09
162gb|AE003765.3| Drosophila melanogaster chromosome 3R, section 10... 72 1e-09
163gb|BT001578.1| Drosophila melanogaster RE23622 full insert cDNA 72 1e-09
164gb|M55018.1|BNACYP Brassica napus cyclophilin (CyP) mRNA, 3' end 72 1e-09
165gb|AY150052.1| Kandelia candel cyclophilin (Cyp1) mRNA, complete... 70 6e-09
166gb|AE017342.1| Cryptococcus neoformans var. neoformans JEC21 chr... 70 6e-09
167gb|AF333997.1|AF333997 Filobasidiella neoformans var. neoformans... 70 6e-09
168gb|AF333996.1|AF333996 Filobasidiella neoformans var. neoformans... 70 6e-09
169gb|CP000081.1| Leishmania major chromosome 35, complete sequence 68 2e-08
170ref|XM_838488.1| Leishmania major strain Friedlin peptidyl-proly... 68 2e-08
171emb|Z48002.1|TNCYCABPR T.niveum gene for cyclophilin A-binding p... 68 2e-08
172emb|Z32674.1|TNCPTAG T.niveum (ATCC34921) cptA gene for cyclophilin 68 2e-08
173emb|X74403.1|PVCYCGNA P.vulgaris gene for cyclophilin 68 2e-08
174dbj|AB254820.1| Cryptomeria japonica mRNA for putative peptidyl-... 66 9e-08
175ref|NM_079049.2| Drosophila melanogaster cyclophilin-33 CG4886-R... 66 9e-08
176gb|AY061421.1| Drosophila melanogaster LD35248 full length cDNA 66 9e-08
177ref|NM_194920.1| Oryza sativa (japonica cultivar-group) putative... 64 4e-07
178gb|AC091724.3| Oryza sativa (japonica cultivar-group) chromosome... 64 4e-07
179ref|XM_676782.1| Aspergillus nidulans FGSC A4 hypothetical prote... 64 4e-07
180gb|AF291180.1| Capsicum annuum cyclophilin CACYP1 mRNA, complete... 64 4e-07
181emb|CR720665.2|CNS0GJ0F Tetraodon nigroviridis full-length cDNA 64 4e-07
182emb|CR701424.2|CNS0G464 Tetraodon nigroviridis full-length cDNA 64 4e-07
183emb|CR694759.2|CNS0FZ0Z Tetraodon nigroviridis full-length cDNA 64 4e-07
184emb|CR680608.2|CNS0FO3W Tetraodon nigroviridis full-length cDNA 64 4e-07
185emb|CR680454.2|CNS0FNZM Tetraodon nigroviridis full-length cDNA 64 4e-07
186emb|CR679705.2|CNS0FNET Tetraodon nigroviridis full-length cDNA 64 4e-07
187emb|CR679007.2|CNS0FMVF Tetraodon nigroviridis full-length cDNA 64 4e-07
188emb|CR672286.2|CNS0FHPG Tetraodon nigroviridis full-length cDNA 64 4e-07
189emb|CR664740.2|CNS0FBVU Tetraodon nigroviridis full-length cDNA 64 4e-07
190emb|CR659051.2|CNS0F7HT Tetraodon nigroviridis full-length cDNA 64 4e-07
191emb|CR658192.2|CNS0F6TY Tetraodon nigroviridis full-length cDNA 64 4e-07
192emb|CR653466.2|CNS0F36O Tetraodon nigroviridis full-length cDNA 64 4e-07
193emb|CR650031.2|CNS0F0J9 Tetraodon nigroviridis full-length cDNA 64 4e-07
194emb|CR646067.2|CNS0EXH5 Tetraodon nigroviridis full-length cDNA 64 4e-07
195emb|CR642611.2|CNS0EUT5 Tetraodon nigroviridis full-length cDNA 64 4e-07
196ref|XM_501673.1| Yarrowia lipolytica CLIB122, YALI0C10230g predi... 64 4e-07
197emb|X17692.1|NCCYCGEN Neurospora crassa cyclophilin gene 64 4e-07
198dbj|AB231814.1| Malassezia slooffiae CYP mRNA for cyclophilin, p... 64 4e-07
199dbj|AB231813.1| Malassezia restricta CYP mRNA for cyclophilin, p... 64 4e-07
200gb|AC122145.1| Oryza sativa (japonica cultivar-group) chromosome... 64 4e-07
201gb|AF096318.1|AF096318 Aspergillus niger cyclophilin-like peptid... 64 4e-07
202gb|AF180337.1|AF180337 Filobasidiella neoformans var. neoformans... 64 4e-07
203dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 64 4e-07
204ref|NM_199957.1| Danio rerio peptidylprolyl isomerase A, like (p... 64 4e-07
205gb|BC071370.1| Danio rerio peptidylprolyl isomerase A, like, mRN... 64 4e-07
206dbj|AK058898.1| Oryza sativa (japonica cultivar-group) cDNA clon... 64 4e-07
207gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 64 4e-07
208emb|CR956622.12| Pig DNA sequence from clone PigE-219N9 on chrom... 64 4e-07
209emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB1... 64 4e-07
210gb|BC059470.1| Danio rerio peptidylprolyl isomerase A, like, mRN... 64 4e-07
211ref|XM_754780.1| Ustilago maydis 521 hypothetical protein (UM037... 62 1e-06
212ref|XM_749773.1| Aspergillus fumigatus Af293 peptidyl-prolyl cis... 62 1e-06
213emb|CR660141.2|CNS0F8C3 Tetraodon nigroviridis full-length cDNA 62 1e-06
214ref|XM_501664.1| Yarrowia lipolytica CLIB122, YALI0C09988g predi... 62 1e-06
215emb|AJ245940.1|RCO245940 Ricinus communis mRNA for cyclophilin (... 62 1e-06
216gb|AF293848.1| Pyricularia grisea cyclophilin (CYP1) gene, compl... 62 1e-06
217gb|AF180336.1|AF180336 Filobasidiella neoformans var. neoformans... 62 1e-06
218emb|AJ937743.1| Aspergillus fumigatus mRNA for cyclophilin (asp ... 62 1e-06
219gb|DQ079281.1| Drosophila arizonae strain 15081-1271.13 moj29 (m... 62 1e-06
220dbj|AB062672.1| Magnaporthe grisea CYP1 gene for cyclophilin, co... 62 1e-06
221ref|XM_513346.1| PREDICTED: Pan troglodytes similar to peptidylp... 60 6e-06
222ref|XM_816485.1| Trypanosoma cruzi strain CL Brener cyclophilin ... 60 6e-06
223emb|CR860299.1| Pongo pygmaeus mRNA; cDNA DKFZp459B225 (from clo... 60 6e-06
224emb|BX933768.2| Gallus gallus finished cDNA, clone ChEST34h10 60 6e-06
225gb|AF191832.1|AF191832 Trypanosoma cruzi cyclophilin A (CYP A) m... 60 6e-06
226ref|NM_074348.4| Caenorhabditis elegans CYclophyliN family membe... 60 6e-06
227emb|AL115635.1|CNS01CKB Botrytis cinerea strain T4 cDNA library 60 6e-06
228emb|AL116652.1|CNS01DCK Botrytis cinerea strain T4 cDNA library 60 6e-06
229emb|AL116469.1|CNS01D7H Botrytis cinerea strain T4 cDNA library 60 6e-06
230emb|AL116187.1|CNS01CZN Botrytis cinerea strain T4 cDNA library 60 6e-06
231emb|AL115447.1|CNS01CF3 Botrytis cinerea strain T4 cDNA library 60 6e-06
232emb|AL115226.1|CNS01C8Y Botrytis cinerea strain T4 cDNA library 60 6e-06
233emb|AL112224.1|CNS019XK Botrytis cinerea strain T4 cDNA library 60 6e-06
234emb|AL112374.1|CNS01A1Q Botrytis cinerea strain T4 cDNA library 60 6e-06
235emb|AL112297.1|CNS019ZL Botrytis cinerea strain T4 cDNA library 60 6e-06
236emb|AL111927.1|CNS019PB Botrytis cinerea strain T4 cDNA library 60 6e-06
237emb|AL111642.1|CNS019HE Botrytis cinerea strain T4 cDNA library 60 6e-06
238emb|AL111866.1|CNS019NM Botrytis cinerea strain T4 cDNA library 60 6e-06
239emb|AL111766.1|CNS019KU Botrytis cinerea strain T4 cDNA library 60 6e-06
240emb|AL111458.1|CNS019CA Botrytis cinerea strain T4 cDNA library 60 6e-06
241emb|AL111202.1|CNS01956 Botrytis cinerea strain T4 cDNA library 60 6e-06
242emb|AL111165.1|CNS01946 Botrytis cinerea strain T4 cDNA library 60 6e-06
243gb|AY942800.1| Cucumis sativus cyclophilin (M2) mRNA, complete cds 60 6e-06
244gb|AY106356.1| Zea mays PCO149745 mRNA sequence 60 6e-06
245gb|AF041412.1|AF041412 Periplaneta americana peptidyl-prolyl cis... 60 6e-06
246emb|AL032663.1|CEY75B12B Caenorhabditis elegans YAC Y75B12B, com... 60 6e-06
247gb|U27559.1|CEU27559 Caenorhabditis elegans cyclophilin (cyp-7) ... 60 6e-06
248gb|AY392408.1| Thellungiella halophila cyclophilin mRNA, complet... 58 2e-05
249ref|XM_571478.1| Cryptococcus neoformans var. neoformans JEC21 p... 58 2e-05
250dbj|AB226263.1| Aspergillus oryzae cDNA, contig sequence: AoEST3122 58 2e-05
251ref|NM_067427.3| Caenorhabditis elegans CYclophyliN family membe... 58 2e-05
252gb|AY229877.1| Populus tremuloides cyclophilin mRNA, complete cds 58 2e-05
253gb|AY391451.1| Danio rerio peptidylprolyl isomerase A (PPIA-1) m... 56 9e-05
254emb|CR663102.2|CNS0FAMC Tetraodon nigroviridis full-length cDNA 56 9e-05
255emb|CR656960.2|CNS0F5VQ Tetraodon nigroviridis full-length cDNA 56 9e-05
256ref|XM_501918.1| Yarrowia lipolytica CLIB122, YALI0C16775g predi... 56 9e-05
257ref|XM_785050.1| PREDICTED: Strongylocentrotus purpuratus simila... 56 9e-05
258emb|BX069275.1|CNS09PM7 Single read from an extremity of a full-... 56 9e-05
259emb|BX014874.1|CNS08JN2 Single read from an extremity of a full-... 56 9e-05
260emb|AJ609278.1| Cicer arietinum partial mRNA for cyclophilin-typ... 56 9e-05
261dbj|AB231808.1| Malassezia dermatis CYP mRNA for cyclophilin, pa... 56 9e-05
262gb|AF411956.1| Takifugu rubripes lck gene locus, partial sequence 56 9e-05
263gb|BC107736.1| Homo sapiens peptidylprolyl isomerase E (cyclophi... 54 3e-04
264ref|XM_507866.1| PREDICTED: Pan troglodytes similar to Peptidyl-... 54 3e-04
265gb|AE017346.1| Cryptococcus neoformans var. neoformans JEC21 chr... 54 3e-04
266gb|AC091701.3| Trypanosoma brucei chromosome 8 clone RPCI93-26N1... 54 3e-04
267gb|CP000071.1| Trypanosoma brucei chromosome 8, complete sequence 54 3e-04
268gb|BC008451.1| Homo sapiens peptidylprolyl isomerase E (cyclophi... 54 3e-04
269gb|BC004898.2| Homo sapiens peptidylprolyl isomerase E (cyclophi... 54 3e-04
270gb|DQ160195.1| Homo sapiens cyclophilin-33B mRNA, complete cds, ... 54 3e-04
271ref|XM_820486.1| Trypanosoma brucei TREU927 clone RPCI93-26N11 c... 54 3e-04
272gb|AY231875.1| Drosophila yakuba clone yak-em_CG2852 mRNA sequence 54 3e-04
273ref|XM_774688.1| Giardia lamblia ATCC 50803 cyclophilin (GLP_170... 54 3e-04
274emb|CR703044.2|CNS0G5F4 Tetraodon nigroviridis full-length cDNA 54 3e-04
275emb|CR700424.2|CNS0G3EC Tetraodon nigroviridis full-length cDNA 54 3e-04
276emb|CR698177.2|CNS0G1NX Tetraodon nigroviridis full-length cDNA 54 3e-04
277emb|CR692157.2|CNS0FX0P Tetraodon nigroviridis full-length cDNA 54 3e-04
278emb|CR693402.1|CNS0FXZA Tetraodon nigroviridis full-length cDNA 54 3e-04
279emb|CR691999.2|CNS0FWWB Tetraodon nigroviridis full-length cDNA 54 3e-04
280emb|CR684939.2|CNS0FRG7 Tetraodon nigroviridis full-length cDNA 54 3e-04
281emb|CR684835.2|CNS0FRDB Tetraodon nigroviridis full-length cDNA 54 3e-04
282emb|AL049824.4|HSJ117L23 Human DNA sequence from clone RP1-117L2... 54 3e-04
283emb|CR625617.1| full-length cDNA clone CS0DC021YB24 of Neuroblas... 54 3e-04
284emb|CR617834.1| full-length cDNA clone XCL0BA001ZG09 of Placenta... 54 3e-04
285dbj|AK094660.1| Homo sapiens cDNA FLJ37341 fis, clone BRAMY20207... 54 3e-04
286emb|CR595696.1| full-length cDNA clone CS0DL005YD19 of B cells (... 54 3e-04
287emb|CR592103.1| full-length cDNA clone CS0DA010YP14 of Neuroblas... 54 3e-04
288dbj|AP007171.1| Aspergillus oryzae RIB40 genomic DNA, SC011 54 3e-04
289dbj|AB169314.1| Macaca fascicularis testis cDNA, clone: QtsA-188... 54 3e-04
290emb|AL116618.1|CNS01DBM Botrytis cinerea strain T4 cDNA library 54 3e-04
291dbj|D29701.1|RICYK13 Oryza sativa mRNA, partial homologous to cy... 54 3e-04
292dbj|AK130628.1| Homo sapiens cDNA FLJ27118 fis, clone SPL06417, ... 54 3e-04
293gb|AF104013.1|AF104013 Homo sapiens peptidyl-prolyl cis-trans is... 54 3e-04
294gb|AF104012.1|AF104012 Homo sapiens peptidyl-prolyl cis-trans is... 54 3e-04
295emb|AL833576.1|HSM804889 Homo sapiens mRNA; cDNA DKFZp686F0856 (... 54 3e-04
296gb|AF042386.1|AF042386 Homo sapiens cyclophilin-33B (CYP-33) mRN... 54 3e-04
297gb|AF042385.1|AF042385 Homo sapiens cyclophilin-33A (CYP-33) mRN... 54 3e-04
298ref|NM_203456.1| Homo sapiens peptidylprolyl isomerase E (cyclop... 54 3e-04
299ref|NM_203457.1| Homo sapiens peptidylprolyl isomerase E (cyclop... 54 3e-04
300ref|NM_006112.2| Homo sapiens peptidylprolyl isomerase E (cyclop... 54 3e-04
301gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete ... 52 0.001
302ref|XM_850619.1| PREDICTED: Canis familiaris peptidylprolyl isom... 52 0.001
303ref|XM_850591.1| PREDICTED: Canis familiaris peptidylprolyl isom... 52 0.001
304ref|XM_537928.2| PREDICTED: Canis familiaris peptidylprolyl isom... 52 0.001
305ref|NM_205461.1| Gallus gallus peptidylprolyl isomerase B (cyclo... 52 0.001
306gb|AE011730.1| Xanthomonas axonopodis pv. citri str. 306, secti... 52 0.001
307gb|AF243140.1| Canis familiaris cyclophilin A mRNA, partial cds 52 0.001
308ref|NM_074350.4| Caenorhabditis elegans CYclophyliN family membe... 52 0.001
309emb|AL117008.1|CNS01DMG Botrytis cinerea strain T4 cDNA library 52 0.001
310gb|AF139893.1|AF139893 Oryctolagus cuniculus cyclophilin 18 mRNA... 52 0.001
311gb|U31077.1|CEU31077 Caenorhabditis elegans cyclophilin isoform ... 52 0.001
312gb|M63553.1|CHKSCYCLO Chicken S-cyclophilin mRNA, complete cds 52 0.001
313ref|NM_172243.1| Rattus norvegicus peptidylprolyl isomerase F (c... 50 0.005
314gb|AY440343.1| Armigeres subalbatus ASAP ID: 39123 cyclophilin-t... 50 0.005
315gb|AY652862.1| Populus balsamifera subsp. trichocarpa peptidyl-p... 50 0.005
316gb|AY029366.1| Felis catus cyclophilin A (cypA) mRNA, complete cds 50 0.005
317gb|AY231990.1| Drosophila yakuba clone yak-ad_CG7768 mRNA sequence 50 0.005
318emb|CR691294.2|CNS0FWCQ Tetraodon nigroviridis full-length cDNA 50 0.005
319emb|CR662428.2|CNS0FA3M Tetraodon nigroviridis full-length cDNA 50 0.005
320gb|AF542973.1| Triticum aestivum cyclophilin mRNA, partial cds 50 0.005
321gb|AY290733.1| Triticum aestivum cyclophilin mRNA, partial sequence 50 0.005
322emb|BX071482.1|CNS09RBI Single read from an extremity of a full-... 50 0.005
323emb|X53223.1|SPPPCTI Schizosaccharomyces pombe gene for cyclophi... 50 0.005
324emb|AL121795.1|SPBC28F2 S.pombe chromosome II cosmid c28F2 50 0.005
325gb|BC086977.1| Rattus norvegicus peptidylprolyl isomerase F (cyc... 50 0.005
326ref|NM_001021559.1| Schizosaccharomyces pombe 972h- peptidyl-pro... 50 0.005
327ref|NM_061223.4| Caenorhabditis elegans F31C3.1 (cyclophillin) m... 50 0.005
328ref|NM_001009370.1| Felis catus peptidylprolyl isomerase A (PPIA... 50 0.005
329gb|U34354.1|CEU34354 Caenorhabditis elegans cyclophilin isoform ... 50 0.005
330gb|U31948.1|CEU31948 Caenorhabditis elegans cyclophilin isoform ... 50 0.005
331gb|DQ270193.1| Triticum urartu ER-localized cyclophilin (CYP23-b... 50 0.005
332gb|DQ270190.1| Aegilops tauschii ER-localized cyclophilin (CYP23... 50 0.005
333emb|Z92784.1|CEF31C3 Caenorhabditis elegans Cosmid F31C3, comple... 50 0.005
334gb|DQ265737.1| Triticum aestivum cyclophilin (CYP23-f) gene, par... 50 0.005
335gb|DQ265735.1| Triticum aestivum cyclophilin (CYP23-d) gene, par... 50 0.005
336gb|DQ265733.1| Triticum aestivum cyclophilin (CYP23-b) gene, par... 50 0.005
337gb|U68544.1|RNU68544 Rattus norvegicus cyclophilin D mRNA, nucle... 50 0.005
338dbj|D83992.1|YSP972HA Fission yeast DNA for ISP4, peptidyl-proly... 50 0.005
339gb|DQ237914.1| Oryctolagus cuniculus cyclophilin B mRNA, partial... 48 0.022
340gb|AY432659.1| Aedes aegypti ASAP ID: 34009 cyclophilin-type pep... 48 0.022
341gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome 48 0.022
342ref|XM_870824.1| PREDICTED: Bos taurus similar to peptidylprolyl... 48 0.022
343gb|DQ440025.1| Aedes aegypti clone AE-239 cyclophylin mRNA, comp... 48 0.022
344ref|XM_657095.1| Aspergillus nidulans FGSC A4 hypothetical prote... 48 0.022
345ref|XM_533873.2| PREDICTED: Canis familiaris similar to peptidyl... 48 0.022
346ref|XM_746967.1| Aspergillus fumigatus Af293 peptidyl-prolyl cis... 48 0.022
347dbj|AB231811.1| Malassezia nana CYP mRNA for cyclophilin, partia... 48 0.022
348dbj|AB231809.1| Malassezia globosa CYP mRNA for cyclophilin, par... 48 0.022
349ref|NM_205373.1| Gallus gallus sema domain, immunoglobulin domai... 48 0.022
350ref|NM_140251.2| Drosophila melanogaster CG10907-RA (CG10907), mRNA 48 0.022
351gb|AC105263.2| Drosophila melanogaster 3L BAC RP98-48G3 (Roswell... 48 0.022
352gb|AY070988.1| Drosophila melanogaster RE08109 full length cDNA 48 0.022
353gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 48 0.022
354dbj|AB125939.1| Malassezia pachydermatis CYP mRNA for cyclophili... 48 0.022
355ref|NM_210368.1| Eremothecium gossypii AER156Cp (AER156C), mRNA 48 0.022
356gb|AE003543.4| Drosophila melanogaster chromosome 3L, section 42... 48 0.022
357gb|U28240.1|GGU28240 Gallus gallus collapsin-2 mRNA, complete cds 48 0.022
358gb|L13365.1|ALCCYCLOPH Allium cepa cyclophilin mRNA, complete cds 48 0.022
359ref|NM_000942.4| Homo sapiens peptidylprolyl isomerase B (cyclop... 46 0.085
360ref|XM_510471.1| PREDICTED: Pan troglodytes similar to casein ki... 46 0.085
361gb|DQ215080.1| Taeniopygia guttata clone 0058P0004D09 CLE7 prote... 46 0.085
362ref|NM_005729.3| Homo sapiens peptidylprolyl isomerase F (cyclop... 46 0.085
363gb|BT016150.1| Drosophila melanogaster AT16671 full insert cDNA 46 0.085
364gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome 46 0.085
365ref|XM_422376.1| PREDICTED: Gallus gallus similar to RNA process... 46 0.085
366gb|BC008848.2| Homo sapiens peptidylprolyl isomerase B (cyclophi... 46 0.085
367gb|BC005020.1| Homo sapiens peptidylprolyl isomerase F (cyclophi... 46 0.085
368gb|AY429575.1| Populus alba x Populus tremula putative cyclophil... 46 0.085
369gb|AY429574.1| Populus alba x Populus tremula clone INRA 7171-B4... 46 0.085
370ref|XM_854702.1| PREDICTED: Canis familiaris similar to protein ... 46 0.085
371ref|XM_844699.1| PREDICTED: Canis familiaris similar to protein ... 46 0.085
372ref|XM_853487.1| PREDICTED: Canis familiaris similar to peptidyl... 46 0.085
373ref|XM_853443.1| PREDICTED: Canis familiaris similar to peptidyl... 46 0.085
374ref|XM_844247.1| PREDICTED: Canis familiaris similar to peptidyl... 46 0.085
375gb|AY277722.1| Botryotinia fuckeliana cyclophilin 1 (BCP1) gene,... 46 0.085
376emb|Z92822.2|CEZK520 Caenorhabditis elegans Cosmid ZK520, comple... 46 0.085
377emb|CR723470.2|CNS0GL6C Tetraodon nigroviridis full-length cDNA 46 0.085
378emb|CR673836.2|CNS0FIWI Tetraodon nigroviridis full-length cDNA 46 0.085
379ref|XM_787026.1| PREDICTED: Strongylocentrotus purpuratus simila... 46 0.085
380emb|CR456829.1| Homo sapiens full open reading frame cDNA clone ... 46 0.085
381emb|AJ414049.1|SMA414049 Stenotrophomonas maltophilia putative m... 46 0.085
382gb|AC010573.4| Drosophila melanogaster 3L BAC RP98-2M13 (Roswell... 46 0.085
383emb|CR626335.1| full-length cDNA clone CS0DK009YE15 of HeLa cell... 46 0.085
384gb|AC069457.5| Drosophila melanogaster 3L BAC RP98-16J19 (Roswel... 46 0.085
385emb|CR624839.1| full-length cDNA clone CS0DI063YG16 of Placenta ... 46 0.085
386emb|CR623400.1| full-length cDNA clone CS0DI053YB10 of Placenta ... 46 0.085
387emb|CR620127.1| full-length cDNA clone CS0DA002YB11 of Neuroblas... 46 0.085
388emb|CR619563.1| full-length cDNA clone CS0DE011YK24 of Placenta ... 46 0.085
389emb|CR618101.1| full-length cDNA clone CS0DI022YO05 of Placenta ... 46 0.085
390emb|CR617864.1| full-length cDNA clone CS0DG006YH20 of B cells (... 46 0.085
391emb|CR616922.1| full-length cDNA clone CS0DI023YJ19 of Placenta ... 46 0.085
392emb|CR614302.1| full-length cDNA clone CS0DI011YG18 of Placenta ... 46 0.085
393emb|CR613389.1| full-length cDNA clone CS0DM003YJ20 of Fetal liv... 46 0.085
394emb|CR610799.1| full-length cDNA clone CS0DA012YA22 of Neuroblas... 46 0.085
395emb|CR608435.1| full-length cDNA clone CS0DH003YJ03 of T cells (... 46 0.085
396emb|CR608381.1| full-length cDNA clone CS0DM003YH20 of Fetal liv... 46 0.085
397emb|CR607225.1| full-length cDNA clone CS0DC025YM23 of Neuroblas... 46 0.085
398emb|CR601435.1| full-length cDNA clone CS0DM003YM17 of Fetal liv... 46 0.085
399emb|CR600630.1| full-length cDNA clone CS0DI087YG15 of Placenta ... 46 0.085
400emb|CR600263.1| full-length cDNA clone CS0DI018YA03 of Placenta ... 46 0.085
401emb|CR599100.1| full-length cDNA clone CS0DI071YA02 of Placenta ... 46 0.085
402emb|CR596917.1| full-length cDNA clone CS0DC012YC16 of Neuroblas... 46 0.085
403emb|CR596778.1| full-length cDNA clone CS0DE010YE18 of Placenta ... 46 0.085
404emb|CR595940.1| full-length cDNA clone CS0DC005YH23 of Neuroblas... 46 0.085
405emb|CR595750.1| full-length cDNA clone CS0DK007YN21 of HeLa cell... 46 0.085
406emb|CR594186.1| full-length cDNA clone CS0DI040YM02 of Placenta ... 46 0.085
407emb|CR591528.1| full-length cDNA clone CS0DE004YP03 of Placenta ... 46 0.085
408gb|AE012191.1| Xanthomonas campestris pv. campestris str. ATCC 3... 46 0.085
409gb|AC110054.4| Homo sapiens chromosome 15, clone CTD-2116N17, co... 46 0.085
410ref|NM_168584.1| Drosophila melanogaster CG7768-RA, transcript v... 46 0.085
411ref|NM_140440.2| Drosophila melanogaster CG7768-RB, transcript v... 46 0.085
412gb|AC100840.2| Homo sapiens chromosome 15, clone RP11-537K8, com... 46 0.085
413gb|AY005867.1| Aspergillus niger cyclophilin-like peptidyl proly... 46 0.085
414gb|AY060923.1| Drosophila melanogaster GM06533 full length cDNA 46 0.085
415gb|CP000249.1| Frankia sp. CcI3, complete genome 46 0.085
416gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, ... 46 0.085
417gb|AC092247.1|AC092247 Drosophila melanogaster, chromosome 2L, r... 46 0.085
418dbj|AK042165.1| Mus musculus 3 days neonate thymus cDNA, RIKEN f... 46 0.085
419gb|BC001125.2| Homo sapiens peptidylprolyl isomerase B (cyclophi... 46 0.085
420gb|AY900631.1| Drosophila buzzatii clone BAC 5H14, complete sequ... 46 0.085
421gb|AY892416.1| Synthetic construct Homo sapiens clone FLH116767.... 46 0.085
422gb|AY889937.1| Synthetic construct Homo sapiens clone FLH116771.... 46 0.085
423gb|AY962310.1| Homo sapiens peptidylprolyl isomerase B (cyclophi... 46 0.085
424gb|BC032138.2| Homo sapiens peptidylprolyl isomerase B (cyclophi... 46 0.085
425gb|BC020800.1| Homo sapiens peptidylprolyl isomerase B (cyclophi... 46 0.085
426gb|U95646.1|U95646 Homo sapiens drug resistance-associated prote... 46 0.085
427gb|AE003647.3| Drosophila melanogaster chromosome 2L, section 56... 46 0.085
428gb|AE003535.3| Drosophila melanogaster chromosome 3L, section 50... 46 0.085
429gb|BC013204.1| Homo sapiens peptidylprolyl isomerase F (cyclophi... 46 0.085
430gb|DQ079282.1| Drosophila mojavensis strain 15081-1352.01 moj29 ... 46 0.085
431gb|BC110299.1| Homo sapiens cDNA clone MGC:117207 IMAGE:5215228,... 46 0.085
432gb|M80254.1|HUMCYP H.sapiens cyclophilin isoform (hCyP3) mRNA, c... 46 0.085
433gb|M60857.1|HUMCYPBA Human cyclophilin B (hCyPB) mRNA, complete cds 46 0.085
434gb|M63573.1|HUMSCYLP Human secreted cyclophilin-like protein (SC... 46 0.085
435gb|M60457.1|HUMCYCLO Human cyclophilin mRNA, 3' end 46 0.085
436gb|AC154048.1| Drosophila melanogaster clone BACR29A04, complete... 44 0.34
437gb|AC154047.2| Drosophila melanogaster clone BACR26B05, complete... 44 0.34
438gb|AC012647.18| Trypanosoma brucei chromosome 2 clone RPCI93-27H... 44 0.34
439gb|AE017150.2| Trypanosoma brucei chromosome 2, complete sequence 44 0.34
440ref|XM_532723.2| PREDICTED: Canis familiaris similar to peptidyl... 44 0.34
441ref|XM_946410.1| Trypanosoma brucei TREU927 cyclophilin type pep... 44 0.34
442ref|XM_946412.1| Trypanosoma brucei TREU927 cyclophilin-type pep... 44 0.34
443ref|XM_754995.1| Ustilago maydis 521 hypothetical protein (UM039... 44 0.34
444emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete ... 44 0.34
445ref|XM_387615.1| Gibberella zeae PH-1 chromosome 4 conserved hyp... 44 0.34
446emb|AL021346.1|CEH37A05 Caenorhabditis elegans Fosmid H37A05, co... 44 0.34
447emb|Z68280.1|HSL25A3 Human DNA sequence from clone LA04NC01-25A3... 44 0.34
448emb|AL390065.20| Human DNA sequence from clone RP11-520M5 on chr... 44 0.34
449ref|XM_961813.1| PREDICTED: Tribolium castaneum similar to pepti... 44 0.34
450emb|BX640442.1| Bordetella bronchiseptica strain RB50, complete ... 44 0.34
451emb|BX640429.1| Bordetella parapertussis strain 12822, complete ... 44 0.34
452emb|BX640416.1| Bordetella pertussis strain Tohama I, complete g... 44 0.34
453emb|BX284754.1|NCB23G1 Neurospora crassa DNA linkage group II BA... 44 0.34
454dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, c... 44 0.34
455gb|AC091203.3| Drosophila melanogaster 3L BAC RP98-48N8 (Roswell... 44 0.34
456gb|AC010022.8| Drosophila melanogaster 3L BAC RP98-1E12 (Roswell... 44 0.34
457gb|AE005833.1| Caulobacter crescentus CB15 section 159 of 359 of... 44 0.34
458dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ... 44 0.34
459ref|NM_165086.1| Drosophila melanogaster wing blister CG15288-RB... 44 0.34
460ref|NM_078571.2| Drosophila melanogaster Resistance to Juvenile ... 44 0.34
461ref|NM_057442.3| Drosophila melanogaster wing blister CG15288-RA... 44 0.34
462gb|DQ086168.1| Ictalurus punctatus peptidylprolyl isomerase A mR... 44 0.34
463gb|AC008357.8| Drosophila melanogaster, chromosome 3R, region 86... 44 0.34
464gb|S82440.1| cyclophilin [Hemicentrotus pulcherrimus, early plut... 44 0.34
465gb|AC092248.1|AC092248 Drosophila melanogaster, chromosome 2L, r... 44 0.34
466gb|AC092227.1|AC092227 Drosophila melanogaster, chromosome 2L, r... 44 0.34
467emb|AL116509.1|CNS01D8L Botrytis cinerea strain T4 cDNA library 44 0.34
468emb|AL116363.1|CNS01D4J Botrytis cinerea strain T4 cDNA library 44 0.34
469emb|AL114644.1|CNS01BSS Botrytis cinerea strain T4 cDNA library 44 0.34
470gb|BT024194.1| Drosophila melanogaster RE71296 full insert cDNA 44 0.34
471gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 44 0.34
472gb|AF135118.1|AF135118 Drosophila melanogaster laminin alpha1,2 ... 44 0.34
473gb|AE003686.4| Drosophila melanogaster chromosome 3R, section 24... 44 0.34
474gb|AE003643.3| Drosophila melanogaster chromosome 2L, section 52... 44 0.34
475gb|AE003552.4| Drosophila melanogaster chromosome 3L, section 33... 44 0.34
476gb|AE003486.2| Drosophila melanogaster chromosome X, section 38 ... 44 0.34
477gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete... 44 0.34
478gb|AF034859.1|AF034859 Drosophila melanogaster juvenile hormone ... 44 0.34
479gb|U04633.1|TGU04633 Toxoplasma gondii Rh 18 kDa cyclophilin mRN... 44 0.34
480gb|AY739096.1| Takifugu rubripes frRHCE, frSMP1, frNPD014, and f... 42 1.3
481gb|CP000096.1| Pelodictyon luteolum DSM 273, complete genome 42 1.3
482gb|DQ214204.1| Taeniopygia guttata clone 0061P0010D07 DNA direct... 42 1.3
483gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence 42 1.3
484ref|NM_007817.1| Mus musculus cytochrome P450, family 2, subfami... 42 1.3
485gb|AC012162.11| Drosophila melanogaster clone BACR01N10, complet... 42 1.3
486gb|AC011070.8| Drosophila melanogaster clone BACR02B12, complete... 42 1.3
487gb|AC007893.8| Drosophila melanogaster clone BACR02E15, complete... 42 1.3
488gb|AC099038.2| Drosophila melanogaster clone BACR28A23, complete... 42 1.3
489gb|AC009842.9| Drosophila melanogaster clone BACR04C12, complete... 42 1.3
490gb|AC008231.4| Drosophila melanogaster clone BACR12O13, complete... 42 1.3
491ref|XM_591672.2| PREDICTED: Bos taurus similar to sarcalumenin (... 42 1.3
492gb|BC004041.1| Mus musculus peptidylprolyl isomerase F (cyclophi... 42 1.3
493gb|BC024742.1| Mus musculus cytochrome P450, family 2, subfamily... 42 1.3
494ref|XM_656326.1| Aspergillus nidulans FGSC A4 hypothetical prote... 42 1.3
495gb|AY594335.1| Bos taurus cyclophilin F mRNA, complete cds 42 1.3
496ref|XM_884636.2| PREDICTED: Mus musculus similar to neural cell ... 42 1.3
497ref|XM_973563.1| PREDICTED: Mus musculus similar to neural cell ... 42 1.3
498ref|XM_916291.2| PREDICTED: Mus musculus similar to neural cell ... 42 1.3
499gb|BT011029.1| Drosophila melanogaster RE45537 full insert cDNA 42 1.3
500ref|XM_801644.1| Trypanosoma cruzi strain CL Brener cyclophilin ... 42 1.3

>gb|AF262984.1|AF262984 Triticum aestivum cyclophilin A-3 (CyP3) mRNA, complete cds
          Length = 869

 Score =  547 bits (276), Expect = e-153
 Identities = 312/324 (96%)
 Strand = Plus / Plus

                                                                       
Query: 70  cccgatcccggcgagtgagatggccaacccgaaggtgttcttcgacatgacggtgggcgg 129
           ||||||||||||||| |||||||||||||||| |||||||||||||||||| || |||||
Sbjct: 52  cccgatcccggcgagcgagatggccaacccgagggtgttcttcgacatgaccgtcggcgg 111

                                                                       
Query: 130 cgccccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtgga 189
           ||| ||||| || |||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 112 cgcgccggcggggcgcatcgtgatggagctgtacaaggacgcggtgccgcggacggtgga 171

                                                                       
Query: 190 gaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctgca 249
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 172 gaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctgca 231

                                                                       
Query: 250 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 309
           ||||||||||||| | ||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 232 ctacaagggcagcgccttccaccgcgtgatccccgacttcatgtgccagggcggcgactt 291

                                                                       
Query: 310 caccaggggcaacggcaccggcggcgagtccatctacggcgagaagttcgccgacgagaa 369
           ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 292 caccaggggcaacggcaccggaggcgagtccatctacggcgagaagttcgccgacgagaa 351

                                   
Query: 370 gttcgtccacaagcacaccaagcc 393
           ||||||||||||||||||||||||
Sbjct: 352 gttcgtccacaagcacaccaagcc 375



to top

>gb|AF262982.1|AF262982 Triticum aestivum cyclophilin A-1 (CyP1) mRNA, complete cds
          Length = 859

 Score =  547 bits (276), Expect = e-153
 Identities = 312/324 (96%)
 Strand = Plus / Plus

                                                                       
Query: 70  cccgatcccggcgagtgagatggccaacccgaaggtgttcttcgacatgacggtgggcgg 129
           ||||||||||||||| |||||||||||||||| |||||||||||||||||| || |||||
Sbjct: 44  cccgatcccggcgagcgagatggccaacccgagggtgttcttcgacatgaccgtcggcgg 103

                                                                       
Query: 130 cgccccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtgga 189
           ||| |||||||| |||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 104 cgcgccggccgggcgcatcgtgatggagctgtacaaggacgcggtgccgcggacggtgga 163

                                                                       
Query: 190 gaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctgca 249
           ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 164 gaacttccgcgcgctgtgcaccggcgagaagggcgtcggcaagagcggcaagccgctgca 223

                                                                       
Query: 250 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 309
           ||||||||||||| | ||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 224 ctacaagggcagcgccttccaccgcgtgatccccgacttcatgtgccagggcggcgactt 283

                                                                       
Query: 310 caccaggggcaacggcaccggcggcgagtccatctacggcgagaagttcgccgacgagaa 369
           |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 284 cacccggggcaacggcaccggcggcgagtccatctacggcgagaagttcgccgacgagaa 343

                                   
Query: 370 gttcgtccacaagcacaccaagcc 393
           ||||||||||||||||||||||||
Sbjct: 344 gttcgtccacaagcacaccaagcc 367



to top

>gb|AF262983.1|AF262983 Triticum aestivum cyclophilin A-2 (CyP2) mRNA, complete cds
          Length = 845

 Score =  539 bits (272), Expect = e-150
 Identities = 299/308 (97%)
 Strand = Plus / Plus

                                                                       
Query: 86  gagatggccaacccgaaggtgttcttcgacatgacggtgggcggcgccccggccggccgc 145
           |||||||||||||||| |||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 68  gagatggccaacccgagggtgttcttcgacatgaccgtcggcggcgcgccggccgggcgc 127

                                                                       
Query: 146 atcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaacttccgcgcgctc 205
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 128 atcgtgatggagctgtacaaggacgcggtgccgcggacggtggagaacttccgcgcgctc 187

                                                                       
Query: 206 tgcaccggcgagaagggcgtcggcaagagcggcaagccgctgcactacaagggcagctcg 265
           |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 188 tgcaccggcgagaagggcgtcggcaagagcggcaagccactgcactacaagggcagctcg 247

                                                                       
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
           ||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 248 ttccaccgcgtgatccccgacttcatgtgccagggcggcgacttcaccaagggcaacggc 307

                                                                       
Query: 326 accggcggcgagtccatctacggcgagaagttcgccgacgagaagttcgtccacaagcac 385
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 308 accggcggcgagtccatctacggcgagaagttcgccgacgagaagttcgtccacaagcac 367

                   
Query: 386 accaagcc 393
           ||||||||
Sbjct: 368 accaagcc 375



to top

>gb|AY456122.1| Triticum aestivum cyclophilin A (CYP18-2) gene, complete cds
          Length = 781

 Score =  539 bits (272), Expect = e-150
 Identities = 299/308 (97%)
 Strand = Plus / Plus

                                                                       
Query: 86  gagatggccaacccgaaggtgttcttcgacatgacggtgggcggcgccccggccggccgc 145
           |||||||||||||||| |||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 32  gagatggccaacccgagggtgttcttcgacatgaccgtcggcggcgcgccggccgggcgc 91

                                                                       
Query: 146 atcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaacttccgcgcgctc 205
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 92  atcgtgatggagctgtacaaggacgcggtgccgcggacggtggagaacttccgcgcgctc 151

                                                                       
Query: 206 tgcaccggcgagaagggcgtcggcaagagcggcaagccgctgcactacaagggcagctcg 265
           |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 152 tgcaccggcgagaagggcgtcggcaagagcggcaagccactgcactacaagggcagctcg 211

                                                                       
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
           ||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 212 ttccaccgcgtgatccccgacttcatgtgccagggcggcgacttcaccaagggcaacggc 271

                                                                       
Query: 326 accggcggcgagtccatctacggcgagaagttcgccgacgagaagttcgtccacaagcac 385
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 272 accggcggcgagtccatctacggcgagaagttcgccgacgagaagttcgtccacaagcac 331

                   
Query: 386 accaagcc 393
           ||||||||
Sbjct: 332 accaagcc 339



to top

>gb|BT016412.1| Zea mays clone Contig245 mRNA sequence
          Length = 858

 Score =  321 bits (162), Expect = 1e-84
 Identities = 252/282 (89%)
 Strand = Plus / Plus

                                                                       
Query: 107 ttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgtacaag 166
           |||||||||||||| || |||||||||||||| ||||| ||||||||||||||||||   
Sbjct: 82  ttcttcgacatgaccgtcggcggcgccccggcgggccggatcgtgatggagctgtacgcc 141

                                                                       
Query: 167 gacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaagggcgtc 226
            ||| |||||| | ||| | |||||||||||||||||| ||||| |||||||||||||| 
Sbjct: 142 aacgaggtgcccaagaccgcggagaacttccgcgcgctgtgcacgggcgagaagggcgtg 201

                                                                       
Query: 227 ggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccccgac 286
           ||||||  ||| |||||||| ||||||||||||  | | |||||||||||||||||||| 
Sbjct: 202 ggcaagtccgggaagccgctccactacaagggctccaccttccaccgcgtcatccccgag 261

                                                                       
Query: 287 ttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctac 346
           ||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||
Sbjct: 262 ttcatgtgccagggcggcgacttcacccgcggcaacggcaccggcggcgagtccatctac 321

                                                     
Query: 347 ggcgagaagttcgccgacgagaagttcgtccacaagcacacc 388
           |||||||||||| |||||||||||||||| | ||||||||||
Sbjct: 322 ggcgagaagttccccgacgagaagttcgtgcgcaagcacacc 363



to top

>emb|X68678.1|ZMCYCL Z.mays gene for cyclophilin
          Length = 2598

 Score =  313 bits (158), Expect = 2e-82
 Identities = 248/278 (89%)
 Strand = Plus / Plus

                                                                        
Query: 107  ttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgtacaag 166
            |||||||||||||| || |||||||||||||| ||||| ||||||||||||||||||   
Sbjct: 1080 ttcttcgacatgaccgtcggcggcgccccggcgggccggatcgtgatggagctgtacgcc 1139

                                                                        
Query: 167  gacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaagggcgtc 226
             ||| |||||| | ||| | |||||||||||||||||| ||||| |||||||||||||| 
Sbjct: 1140 aacgaggtgcccaagaccgcggagaacttccgcgcgctgtgcacgggcgagaagggcgtg 1199

                                                                        
Query: 227  ggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccccgac 286
            ||||||  ||| |||||||| ||||||||||||  | | |||||||||||||||||||| 
Sbjct: 1200 ggcaagtccgggaagccgctccactacaagggctccaccttccaccgcgtcatccccgag 1259

                                                                        
Query: 287  ttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctac 346
            ||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||
Sbjct: 1260 ttcatgtgccagggcggcgacttcacccgcggcaacggcaccggcggcgagtccatctac 1319

                                                  
Query: 347  ggcgagaagttcgccgacgagaagttcgtccacaagca 384
            |||||||||||| |||||||||||||||| | ||||||
Sbjct: 1320 ggcgagaagttccccgacgagaagttcgtgcgcaagca 1357



to top

>gb|M55021.1|MZECYP Zea mays cyclophilin (CyP) mRNA, complete cds
          Length = 792

 Score =  313 bits (158), Expect = 2e-82
 Identities = 248/278 (89%)
 Strand = Plus / Plus

                                                                       
Query: 107 ttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgtacaag 166
           |||||||||||||| || |||||||||||||| ||||| ||||||||||||||||||   
Sbjct: 43  ttcttcgacatgaccgtcggcggcgccccggcgggccggatcgtgatggagctgtacgcc 102

                                                                       
Query: 167 gacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaagggcgtc 226
            ||| |||||| | ||| | |||||||||||||||||| ||||| |||||||||||||| 
Sbjct: 103 aacgaggtgcccaagaccgcggagaacttccgcgcgctgtgcacgggcgagaagggcgtg 162

                                                                       
Query: 227 ggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccccgac 286
           ||||||  ||| |||||||| ||||||||||||  | | |||||||||||||||||||| 
Sbjct: 163 ggcaagtccgggaagccgctccactacaagggctccaccttccaccgcgtcatccccgag 222

                                                                       
Query: 287 ttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctac 346
           ||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||
Sbjct: 223 ttcatgtgccagggcggcgacttcacccgcggcaacggcaccggcggcgagtccatctac 282

                                                 
Query: 347 ggcgagaagttcgccgacgagaagttcgtccacaagca 384
           |||||||||||| |||||||||||||||| | ||||||
Sbjct: 283 ggcgagaagttccccgacgagaagttcgtgcgcaagca 320



to top

>gb|BT017873.1| Zea mays clone EL01N0513A10.c mRNA sequence
          Length = 978

 Score =  305 bits (154), Expect = 6e-80
 Identities = 250/282 (88%)
 Strand = Plus / Plus

                                                                       
Query: 107 ttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgtacaag 166
           |||||||||||||| || ||||| ||||| |||||||| ||||||||||||||||||   
Sbjct: 183 ttcttcgacatgaccgtcggcggtgccccagccggccggatcgtgatggagctgtacgcc 242

                                                                       
Query: 167 gacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaagggcgtc 226
            ||| |||||| | ||| | |||||||||||||||||| ||||| |||||||||||||| 
Sbjct: 243 aacgaggtgcccaagaccgcggagaacttccgcgcgctgtgcacgggcgagaagggcgtg 302

                                                                       
Query: 227 ggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccccgac 286
           ||||||  ||| |||||||| ||||||||||||    | |||||||||||||||||| | 
Sbjct: 303 ggcaagtccgggaagccgctccactacaagggctctaccttccaccgcgtcatcccccag 362

                                                                       
Query: 287 ttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctac 346
           ||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||
Sbjct: 363 ttcatgtgccagggcggcgacttcacccgcggcaacggcaccggcggcgagtccatctac 422

                                                     
Query: 347 ggcgagaagttcgccgacgagaagttcgtccacaagcacacc 388
           |||||||||||| |||||||||||||||||| ||||||||||
Sbjct: 423 ggcgagaagttccccgacgagaagttcgtccgcaagcacacc 464



to top

>ref|XM_463914.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 885

 Score =  303 bits (153), Expect = 2e-79
 Identities = 237/265 (89%)
 Strand = Plus / Plus

                                                                       
Query: 103 ggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgta 162
           |||||||||||||||||| || ||||| || ||||| || || |||||||||||||||||
Sbjct: 108 ggtgttcttcgacatgaccgtcggcggagctccggcggggcggatcgtgatggagctgta 167

                                                                       
Query: 163 caaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaaggg 222
           |  | | |  |||||| |||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 168 cgcgaaggacgtgccgcggacggcggagaacttccgcgcgctctgcaccggcgagaaggg 227

                                                                       
Query: 223 cgtcggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccc 282
           ||| |||||||||||||||||||||||||||||||| ||| | ||||||||||| |||||
Sbjct: 228 cgtgggcaagagcggcaagccgctgcactacaaggggagcaccttccaccgcgtgatccc 287

                                                                       
Query: 283 cgacttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccat 342
            || ||||||||||||||||||||||||||| | ||||||||||| || || ||||| ||
Sbjct: 288 ggagttcatgtgccagggcggcgacttcacccgcggcaacggcacgggaggggagtcgat 347

                                    
Query: 343 ctacggcgagaagttcgccgacgag 367
           |||||||||||||||||||||||||
Sbjct: 348 ctacggcgagaagttcgccgacgag 372



to top

>ref|XM_506694.1| PREDICTED Oryza sativa (japonica cultivar-group), OSJNBb0088N06.23
           mRNA
          Length = 887

 Score =  303 bits (153), Expect = 2e-79
 Identities = 237/265 (89%)
 Strand = Plus / Plus

                                                                       
Query: 103 ggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgta 162
           |||||||||||||||||| || ||||| || ||||| || || |||||||||||||||||
Sbjct: 109 ggtgttcttcgacatgaccgtcggcggagctccggcggggcggatcgtgatggagctgta 168

                                                                       
Query: 163 caaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaaggg 222
           |  | | |  |||||| |||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 169 cgcgaaggacgtgccgcggacggcggagaacttccgcgcgctctgcaccggcgagaaggg 228

                                                                       
Query: 223 cgtcggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccc 282
           ||| |||||||||||||||||||||||||||||||| ||| | ||||||||||| |||||
Sbjct: 229 cgtgggcaagagcggcaagccgctgcactacaaggggagcaccttccaccgcgtgatccc 288

                                                                       
Query: 283 cgacttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccat 342
            || ||||||||||||||||||||||||||| | ||||||||||| || || ||||| ||
Sbjct: 289 ggagttcatgtgccagggcggcgacttcacccgcggcaacggcacgggaggggagtcgat 348

                                    
Query: 343 ctacggcgagaagttcgccgacgag 367
           |||||||||||||||||||||||||
Sbjct: 349 ctacggcgagaagttcgccgacgag 373



to top

>gb|DQ480736.1| Oryza sativa (indica cultivar-group) cyclophilinA mRNA, complete
           cds
          Length = 588

 Score =  303 bits (153), Expect = 2e-79
 Identities = 237/265 (89%)
 Strand = Plus / Plus

                                                                       
Query: 103 ggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgta 162
           |||||||||||||||||| || ||||| || ||||| || || |||||||||||||||||
Sbjct: 25  ggtgttcttcgacatgaccgtcggcggagctccggcggggcggatcgtgatggagctgta 84

                                                                       
Query: 163 caaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaaggg 222
           |  | | |  |||||| |||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 85  cgcgaaggacgtgccgcggacggcggagaacttccgcgcgctctgcaccggcgagaaggg 144

                                                                       
Query: 223 cgtcggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccc 282
           ||| |||||||||||||||||||||||||||||||| ||| | ||||||||||| |||||
Sbjct: 145 cgtgggcaagagcggcaagccgctgcactacaaggggagcaccttccaccgcgtgatccc 204

                                                                       
Query: 283 cgacttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccat 342
            || ||||||||||||||||||||||||||| | ||||||||||| || || ||||| ||
Sbjct: 205 ggagttcatgtgccagggcggcgacttcacccgcggcaacggcacgggaggggagtcgat 264

                                    
Query: 343 ctacggcgagaagttcgccgacgag 367
           |||||||||||||||||||||||||
Sbjct: 265 ctacggcgagaagttcgccgacgag 289



to top

>dbj|AK061894.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-041-G07, full
           insert sequence
          Length = 887

 Score =  303 bits (153), Expect = 2e-79
 Identities = 237/265 (89%)
 Strand = Plus / Plus

                                                                       
Query: 103 ggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgta 162
           |||||||||||||||||| || ||||| || ||||| || || |||||||||||||||||
Sbjct: 109 ggtgttcttcgacatgaccgtcggcggagctccggcggggcggatcgtgatggagctgta 168

                                                                       
Query: 163 caaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaaggg 222
           |  | | |  |||||| |||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 169 cgcgaaggacgtgccgcggacggcggagaacttccgcgcgctctgcaccggcgagaaggg 228

                                                                       
Query: 223 cgtcggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccc 282
           ||| |||||||||||||||||||||||||||||||| ||| | ||||||||||| |||||
Sbjct: 229 cgtgggcaagagcggcaagccgctgcactacaaggggagcaccttccaccgcgtgatccc 288

                                                                       
Query: 283 cgacttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccat 342
            || ||||||||||||||||||||||||||| | ||||||||||| || || ||||| ||
Sbjct: 289 ggagttcatgtgccagggcggcgacttcacccgcggcaacggcacgggaggggagtcgat 348

                                    
Query: 343 ctacggcgagaagttcgccgacgag 367
           |||||||||||||||||||||||||
Sbjct: 349 ctacggcgagaagttcgccgacgag 373



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score =  303 bits (153), Expect = 2e-79
 Identities = 237/265 (89%)
 Strand = Plus / Plus

                                                                           
Query: 103     ggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgta 162
               |||||||||||||||||| || ||||| || ||||| || || |||||||||||||||||
Sbjct: 1116174 ggtgttcttcgacatgaccgtcggcggagctccggcggggcggatcgtgatggagctgta 1116233

                                                                           
Query: 163     caaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaaggg 222
               |  | | |  |||||| |||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 1116234 cgcgaaggacgtgccgcggacggcggagaacttccgcgcgctctgcaccggcgagaaggg 1116293

                                                                           
Query: 223     cgtcggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccc 282
               ||| |||||||||||||||||||||||||||||||| ||| | ||||||||||| |||||
Sbjct: 1116294 cgtgggcaagagcggcaagccgctgcactacaaggggagcaccttccaccgcgtgatccc 1116353

                                                                           
Query: 283     cgacttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccat 342
                || ||||||||||||||||||||||||||| | ||||||||||| || || ||||| ||
Sbjct: 1116354 ggagttcatgtgccagggcggcgacttcacccgcggcaacggcacgggaggggagtcgat 1116413

                                        
Query: 343     ctacggcgagaagttcgccgacgag 367
               |||||||||||||||||||||||||
Sbjct: 1116414 ctacggcgagaagttcgccgacgag 1116438



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                             
Query: 182      acggtggagaacttccgcgcgctctgcaccggcgagaagggcgtc 226
                |||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 32066599 acggcggagaacttccgcgcgctctgcaccggcgagaagggcgtc 32066643



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 210     ccggcgagaagggcgtcggc 229
               ||||||||||||||||||||
Sbjct: 7760546 ccggcgagaagggcgtcggc 7760565



to top

>dbj|AP004078.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1020_C02
          Length = 124578

 Score =  303 bits (153), Expect = 2e-79
 Identities = 237/265 (89%)
 Strand = Plus / Plus

                                                                         
Query: 103   ggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgta 162
             |||||||||||||||||| || ||||| || ||||| || || |||||||||||||||||
Sbjct: 68698 ggtgttcttcgacatgaccgtcggcggagctccggcggggcggatcgtgatggagctgta 68757

                                                                         
Query: 163   caaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaaggg 222
             |  | | |  |||||| |||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 68758 cgcgaaggacgtgccgcggacggcggagaacttccgcgcgctctgcaccggcgagaaggg 68817

                                                                         
Query: 223   cgtcggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccc 282
             ||| |||||||||||||||||||||||||||||||| ||| | ||||||||||| |||||
Sbjct: 68818 cgtgggcaagagcggcaagccgctgcactacaaggggagcaccttccaccgcgtgatccc 68877

                                                                         
Query: 283   cgacttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccat 342
              || ||||||||||||||||||||||||||| | ||||||||||| || || ||||| ||
Sbjct: 68878 ggagttcatgtgccagggcggcgacttcacccgcggcaacggcacgggaggggagtcgat 68937

                                      
Query: 343   ctacggcgagaagttcgccgacgag 367
             |||||||||||||||||||||||||
Sbjct: 68938 ctacggcgagaagttcgccgacgag 68962



to top

>dbj|AP005851.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OSJNBb0088N06
          Length = 123454

 Score =  303 bits (153), Expect = 2e-79
 Identities = 237/265 (89%)
 Strand = Plus / Plus

                                                                          
Query: 103    ggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgta 162
              |||||||||||||||||| || ||||| || ||||| || || |||||||||||||||||
Sbjct: 104882 ggtgttcttcgacatgaccgtcggcggagctccggcggggcggatcgtgatggagctgta 104941

                                                                          
Query: 163    caaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaaggg 222
              |  | | |  |||||| |||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 104942 cgcgaaggacgtgccgcggacggcggagaacttccgcgcgctctgcaccggcgagaaggg 105001

                                                                          
Query: 223    cgtcggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccc 282
              ||| |||||||||||||||||||||||||||||||| ||| | ||||||||||| |||||
Sbjct: 105002 cgtgggcaagagcggcaagccgctgcactacaaggggagcaccttccaccgcgtgatccc 105061

                                                                          
Query: 283    cgacttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccat 342
               || ||||||||||||||||||||||||||| | ||||||||||| || || ||||| ||
Sbjct: 105062 ggagttcatgtgccagggcggcgacttcacccgcggcaacggcacgggaggggagtcgat 105121

                                       
Query: 343    ctacggcgagaagttcgccgacgag 367
              |||||||||||||||||||||||||
Sbjct: 105122 ctacggcgagaagttcgccgacgag 105146



to top

>dbj|AK098919.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002N03, full
           insert sequence
          Length = 885

 Score =  303 bits (153), Expect = 2e-79
 Identities = 237/265 (89%)
 Strand = Plus / Plus

                                                                       
Query: 103 ggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgta 162
           |||||||||||||||||| || ||||| || ||||| || || |||||||||||||||||
Sbjct: 108 ggtgttcttcgacatgaccgtcggcggagctccggcggggcggatcgtgatggagctgta 167

                                                                       
Query: 163 caaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaaggg 222
           |  | | |  |||||| |||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 168 cgcgaaggacgtgccgcggacggcggagaacttccgcgcgctctgcaccggcgagaaggg 227

                                                                       
Query: 223 cgtcggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccc 282
           ||| |||||||||||||||||||||||||||||||| ||| | ||||||||||| |||||
Sbjct: 228 cgtgggcaagagcggcaagccgctgcactacaaggggagcaccttccaccgcgtgatccc 287

                                                                       
Query: 283 cgacttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccat 342
            || ||||||||||||||||||||||||||| | ||||||||||| || || ||||| ||
Sbjct: 288 ggagttcatgtgccagggcggcgacttcacccgcggcaacggcacgggaggggagtcgat 347

                                    
Query: 343 ctacggcgagaagttcgccgacgag 367
           |||||||||||||||||||||||||
Sbjct: 348 ctacggcgagaagttcgccgacgag 372



to top

>gb|L29470.1|RICCYP2R Oryza sativa cyclophilin 2 (Cyp2) mRNA, complete cds
          Length = 824

 Score =  303 bits (153), Expect = 2e-79
 Identities = 237/265 (89%)
 Strand = Plus / Plus

                                                                       
Query: 103 ggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgta 162
           |||||||||||||||||| || ||||| || ||||| || || |||||||||||||||||
Sbjct: 53  ggtgttcttcgacatgaccgtcggcggagctccggcggggcggatcgtgatggagctgta 112

                                                                       
Query: 163 caaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaaggg 222
           |  | | |  |||||| |||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 113 cgcgaaggacgtgccgcggacggcggagaacttccgcgcgctctgcaccggcgagaaggg 172

                                                                       
Query: 223 cgtcggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccc 282
           ||| |||||||||||||||||||||||||||||||| ||| | ||||||||||| |||||
Sbjct: 173 cgtgggcaagagcggcaagccgctgcactacaaggggagcaccttccaccgcgtgatccc 232

                                                                       
Query: 283 cgacttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccat 342
            || ||||||||||||||||||||||||||| | ||||||||||| || || ||||| ||
Sbjct: 233 ggagttcatgtgccagggcggcgacttcacccgcggcaacggcacgggaggggagtcgat 292

                                    
Query: 343 ctacggcgagaagttcgccgacgag 367
           |||||||||||||||||||||||||
Sbjct: 293 ctacggcgagaagttcgccgacgag 317



to top

>gb|L29469.1|RICCYP2G Oryza sativa cyclophilin 2 (Cyp2) gene, complete cds
          Length = 2323

 Score =  303 bits (153), Expect = 2e-79
 Identities = 237/265 (89%)
 Strand = Plus / Plus

                                                                        
Query: 103  ggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgta 162
            |||||||||||||||||| || ||||| || ||||| || || |||||||||||||||||
Sbjct: 1164 ggtgttcttcgacatgaccgtcggcggagctccggcggggcggatcgtgatggagctgta 1223

                                                                        
Query: 163  caaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaaggg 222
            |  | | |  |||||| |||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 1224 cgcgaaggacgtgccgcggacggcggagaacttccgcgcgctctgcaccggcgagaaggg 1283

                                                                        
Query: 223  cgtcggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccc 282
            ||| |||||||||||||||||||||||||||||||| ||| | ||||||||||| |||||
Sbjct: 1284 cgtgggcaagagcggcaagccgctgcactacaaggggagcaccttccaccgcgtgatccc 1343

                                                                        
Query: 283  cgacttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccat 342
             || ||||||||||||||||||||||||||| | ||||||||||| || || ||||| ||
Sbjct: 1344 ggagttcatgtgccagggcggcgacttcacccgcggcaacggcacgggaggggagtcgat 1403

                                     
Query: 343  ctacggcgagaagttcgccgacgag 367
            |||||||||||||||||||||||||
Sbjct: 1404 ctacggcgagaagttcgccgacgag 1428



to top

>gb|BT016413.1| Zea mays clone Contig246 mRNA sequence
          Length = 868

 Score =  297 bits (150), Expect = 1e-77
 Identities = 249/282 (88%)
 Strand = Plus / Plus

                                                                       
Query: 107 ttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgtacaag 166
           |||||||||||||| || ||||| ||||| |||||||| ||||||||||||| ||||   
Sbjct: 67  ttcttcgacatgaccgtcggcggtgccccagccggccggatcgtgatggagccgtacgcc 126

                                                                       
Query: 167 gacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaagggcgtc 226
            ||| |||||| | ||| | |||||||||||||||||| ||||| |||||||||||||| 
Sbjct: 127 aacgaggtgcccaagaccgcggagaacttccgcgcgctgtgcacgggcgagaagggcgtg 186

                                                                       
Query: 227 ggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccccgac 286
           ||||||  ||| |||||||| ||||||||||||    | |||||||||||||||||| | 
Sbjct: 187 ggcaagtccgggaagccgctccactacaagggctctaccttccaccgcgtcatcccccag 246

                                                                       
Query: 287 ttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctac 346
           ||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||
Sbjct: 247 ttcatgtgccagggcggcgacttcacccgcggcaacggcaccggcggcgagtccatctac 306

                                                     
Query: 347 ggcgagaagttcgccgacgagaagttcgtccacaagcacacc 388
           |||||||||||| |||||||||||||||||| ||||||||||
Sbjct: 307 ggcgagaagttccccgacgagaagttcgtccgcaagcacacc 348



to top

>gb|AF384147.1|AF384147 Triticum aestivum cyclophilin mRNA, partial cds
          Length = 430

 Score =  297 bits (150), Expect = 1e-77
 Identities = 168/174 (96%)
 Strand = Plus / Plus

                                                                       
Query: 220 gggcgtcggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcat 279
           |||||| |||||||||||||||||||||||||||||||| ||| ||||||||||||| ||
Sbjct: 12  gggcgtgggcaagagcggcaagccgctgcactacaaggggagcgcgttccaccgcgtgat 71

                                                                       
Query: 280 ccccgacttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtc 339
           ||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||
Sbjct: 72  ccccgacttcatgtgccagggcggcgacttcaccaggggcaacgggacgggcggcgagtc 131

                                                                 
Query: 340 catctacggcgagaagttcgccgacgagaagttcgtccacaagcacaccaagcc 393
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 132 catctacggcgagaagttcgccgacgagaagttcgtccacaagcacaccaagcc 185



to top

>gb|AF263544.1| Oryza sativa clone 20CAC microsatellite sequence
          Length = 905

 Score =  293 bits (148), Expect = 2e-76
 Identities = 235/264 (89%)
 Strand = Plus / Plus

                                                                       
Query: 103 ggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgta 162
           |||||||||||||||||| || ||||| || ||||| || || |||||||||||||||||
Sbjct: 109 ggtgttcttcgacatgaccgtcggcggagctccggcggggcggatcgtgatggagctgta 168

                                                                       
Query: 163 caaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaaggg 222
           |  | | |  |||||| |||||| ||||||||||||||||||||||||||||||||| ||
Sbjct: 169 cgcgaaggacgtgccgcggacggcggagaacttccgcgcgctctgcaccggcgagaaagg 228

                                                                       
Query: 223 cgtcggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccc 282
           ||| |||||||||||||||||||||||||||||||| ||| | ||||||||||| |||||
Sbjct: 229 cgtgggcaagagcggcaagccgctgcactacaaggggagcaccttccaccgcgtgatccc 288

                                                                       
Query: 283 cgacttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccat 342
            || ||||||||||||||||||||||||||| | ||||||||||| || || ||||| ||
Sbjct: 289 ggagttcatgtgccagggcggcgacttcacccgcggcaacggcacgggaggggagtcgat 348

                                   
Query: 343 ctacggcgagaagttcgccgacga 366
           ||||||||||||||||||||||||
Sbjct: 349 ctacggcgagaagttcgccgacga 372



to top

>gb|AY456123.1| Triticum aestivum cyclophilin A (CYP18-1) gene, partial cds
          Length = 519

 Score =  184 bits (93), Expect = 1e-43
 Identities = 96/97 (98%)
 Strand = Plus / Plus

                                                                       
Query: 297 agggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaagt 356
           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   agggcggcgacttcacccggggcaacggcaccggcggcgagtccatctacggcgagaagt 60

                                                
Query: 357 tcgccgacgagaagttcgtccacaagcacaccaagcc 393
           |||||||||||||||||||||||||||||||||||||
Sbjct: 61  tcgccgacgagaagttcgtccacaagcacaccaagcc 97



to top

>gb|AY456124.1| Triticum aestivum cyclophilin A (CYP18-3) gene, partial cds
          Length = 494

 Score =  182 bits (92), Expect = 6e-43
 Identities = 95/96 (98%)
 Strand = Plus / Plus

                                                                       
Query: 298 gggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaagtt 357
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 1   gggcggcgacttcaccaggggcaacggcaccggaggcgagtccatctacggcgagaagtt 60

                                               
Query: 358 cgccgacgagaagttcgtccacaagcacaccaagcc 393
           ||||||||||||||||||||||||||||||||||||
Sbjct: 61  cgccgacgagaagttcgtccacaagcacaccaagcc 96



to top

>gb|AF052206.2| Chlamydomonas reinhardtii cyclophilin 1 (cyp1) mRNA, complete cds
          Length = 985

 Score =  178 bits (90), Expect = 9e-42
 Identities = 195/230 (84%)
 Strand = Plus / Plus

                                                                       
Query: 140 ggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaacttccgc 199
           |||||||||| |||||||||||||   ||||  ||||| | ||| | |||||||||||||
Sbjct: 74  ggccgcatcgagatggagctgtacgccgacgacgtgcccaagaccgcggagaacttccgc 133

                                                                       
Query: 200 gcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctgcactacaagggc 259
           || || |||||||||||||||||||| |||      |||||||| ||||||| |||||||
Sbjct: 134 gccctgtgcaccggcgagaagggcgttggccgctctggcaagcccctgcacttcaagggc 193

                                                                       
Query: 260 agctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggc 319
             | | |||||||| || |||||| ||||||||||||||||||| ||||||||| | |||
Sbjct: 194 tccaccttccaccgtgtgatccccaacttcatgtgccagggcggtgacttcacccgcggc 253

                                                             
Query: 320 aacggcaccggcggcgagtccatctacggcgagaagttcgccgacgagaa 369
           ||||||||||| || |||||||||||||||||||||||| |||| |||||
Sbjct: 254 aacggcaccggtggtgagtccatctacggcgagaagttccccgatgagaa 303



to top

>gb|AF424658.1| Phytophthora infestans clone MY-08-C-01 peptidylprolyl isomerase
           mRNA, complete cds
          Length = 700

 Score =  174 bits (88), Expect = 1e-40
 Identities = 241/292 (82%)
 Strand = Plus / Plus

                                                                       
Query: 95  aacccgaaggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatg 154
           |||||| ||||||| ||||||||||| || || || ||||| || ||||| |||  | | 
Sbjct: 45  aacccgcaggtgtttttcgacatgaccgttggtggtgcccccgctggccgtatcacgttc 104

                                                                       
Query: 155 gagctgtacaaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggc 214
           ||||||| |   |||  |||||||| |||||  |||||||||||||| || ||||| |||
Sbjct: 105 gagctgttcgccgacaaggtgccgaagacggctgagaacttccgcgctctttgcacaggc 164

                                                                       
Query: 215 gagaagggcgtcggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgc 274
           ||||||||||| |||      |||||||| ||||||| |||||||||||| |||||||| 
Sbjct: 165 gagaagggcgtgggccgttcgggcaagcccctgcacttcaagggcagctctttccaccgt 224

                                                                       
Query: 275 gtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggc 334
           || |||||| |||| |||||||||||||||||||||||  | || |||||||| ||||| 
Sbjct: 225 gtgatccccaactttatgtgccagggcggcgacttcacgcgtggtaacggcacgggcggt 284

                                                               
Query: 335 gagtccatctacggcgagaagttcgccgacgagaagttcgtccacaagcaca 386
           |||||||||||||||||||||||| | |||||||| ||| | | ||||||||
Sbjct: 285 gagtccatctacggcgagaagttcccagacgagaacttcttgctcaagcaca 336



to top

>gb|AY109901.1| Zea mays CL2214_-5 mRNA sequence
          Length = 636

 Score =  174 bits (88), Expect = 1e-40
 Identities = 113/123 (91%)
 Strand = Plus / Plus

                                                                       
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
           ||||||||||||||     | ||||||||||||||||||||||||||| | |||||||||
Sbjct: 33  ttccaccgcgtcatnnnnnagttcatgtgccagggcggcgacttcacccgcggcaacggc 92

                                                                       
Query: 326 accggcggcgagtccatctacggcgagaagttcgccgacgagaagttcgtccacaagcac 385
           ||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||
Sbjct: 93  accggcggcgagtccatctacggcgagaagttccccgacgagaagttcgtccgcaagcac 152

              
Query: 386 acc 388
           |||
Sbjct: 153 acc 155



to top

>dbj|AK105186.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-D12, full
           insert sequence
          Length = 682

 Score =  167 bits (84), Expect = 3e-38
 Identities = 171/200 (85%)
 Strand = Plus / Plus

                                                                       
Query: 187 ggagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgct 246
           |||||||||||||||||| ||||| |||||||||||| | |||      |||||||||||
Sbjct: 154 ggagaacttccgcgcgctttgcacgggcgagaagggcattggccgctcgggcaagccgct 213

                                                                       
Query: 247 gcactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcga 306
            |||| |||||||   ||||||||||| || |||||| ||||||||||||||||||| ||
Sbjct: 214 ccacttcaagggctcgtcgttccaccgtgtgatccccaacttcatgtgccagggcggtga 273

                                                                       
Query: 307 cttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaagttcgccgacga 366
           ||||||  | ||||||||||| ||||||||||| || |||||||||||||||||||||||
Sbjct: 274 cttcacgcgcggcaacggcacgggcggcgagtcgatttacggcgagaagttcgccgacga 333

                               
Query: 367 gaagttcgtccacaagcaca 386
           ||| ||| | | ||||||||
Sbjct: 334 gaacttcctgctcaagcaca 353



to top

>gb|AY105212.1| Zea mays PCO124469 mRNA sequence
          Length = 886

 Score =  165 bits (83), Expect = 1e-37
 Identities = 119/131 (90%)
 Strand = Plus / Plus

                                                                       
Query: 239 aagccgctgcactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccag 298
           |||||||||||||||||||||    | ||||||||||||||||| | |||||||||||||
Sbjct: 415 aagccgctgcactacaagggctcggccttccaccgcgtcatcccgggcttcatgtgccag 474

                                                                       
Query: 299 ggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaagttc 358
           ||||||||||||||| ||||||||||||| ||||||||||||||||||||||  | ||||
Sbjct: 475 ggcggcgacttcacccggggcaacggcacgggcggcgagtccatctacggcgccaggttc 534

                      
Query: 359 gccgacgagaa 369
           |||||||||||
Sbjct: 535 gccgacgagaa 545



to top

>dbj|AB020612.1| Vigna radiata mRNA for CYP1, complete cds
          Length = 823

 Score =  163 bits (82), Expect = 5e-37
 Identities = 174/202 (86%), Gaps = 2/202 (0%)
 Strand = Plus / Plus

                                                                       
Query: 188 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctg 247
           |||||||||||||| ||||||||||| |||||||| ||||| | ||||||||||||||| 
Sbjct: 138 gagaacttccgcgctctctgcaccggtgagaagggagtcggtaggagcggcaagccgctc 197

                                                                       
Query: 248 cactacaagggca-gctcgttccaccgcgtcatccccgacttcatgtgccagggcggcga 306
           ||||||||||||  | || |||||||| || |||||  ||||||||||||| || |||||
Sbjct: 198 cactacaagggctcgatc-ttccaccgtgtgatcccgaacttcatgtgccaaggaggcga 256

                                                                       
Query: 307 cttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaagttcgccgacga 366
           |||||||   || |||||||| ||||||||||| ||||||||||  ||||||||||||||
Sbjct: 257 cttcaccgccggaaacggcacaggcggcgagtcgatctacggcgccaagttcgccgacga 316

                                 
Query: 367 gaagttcgtccacaagcacacc 388
           ||| |||||  | |||||||||
Sbjct: 317 gaacttcgtgaagaagcacacc 338



to top

>dbj|AK062540.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-104-G01, full
           insert sequence
          Length = 749

 Score =  161 bits (81), Expect = 2e-36
 Identities = 153/177 (86%)
 Strand = Plus / Plus

                                                                       
Query: 181 gacggtggagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaa 240
           |||||| ||||||||||||||||||||||| |||||||||||| | |||||||  |||||
Sbjct: 204 gacggtcgagaacttccgcgcgctctgcacgggcgagaagggcatgggcaagaagggcaa 263

                                                                       
Query: 241 gccgctgcactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccaggg 300
           |||||| ||||||||||||||| | ||||||||| | |||||| |||| |||  ||||||
Sbjct: 264 gccgctccactacaagggcagcactttccaccgcattatccccaactttatgatccaggg 323

                                                                    
Query: 301 cggcgacttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaagtt 357
           ||| ||||| ||    ||||||||||  ||||||||||| |||||||||||||||||
Sbjct: 324 cggtgactttacggacggcaacggcatgggcggcgagtcgatctacggcgagaagtt 380



to top

>emb|Y08320.1|DLCYCLO D.lanata mRNA for cyclophilin
          Length = 765

 Score =  159 bits (80), Expect = 8e-36
 Identities = 161/188 (85%)
 Strand = Plus / Plus

                                                                       
Query: 188 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctg 247
           |||||||||||||| |||||||| |||||||| ||||||||||| | |||||||||||| 
Sbjct: 146 gagaacttccgcgctctctgcactggcgagaaaggcgtcggcaaaaccggcaagccgctc 205

                                                                       
Query: 248 cactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgac 307
           |||||||| |||    |||| |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 206 cactacaaaggctcggcgtttcaccgcgtgatccccgggttcatgtgccagggaggcgac 265

                                                                       
Query: 308 ttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaagttcgccgacgag 367
           ||||||   || ||||||||||| ||||| || |||||||||| ||| ||||| ||||||
Sbjct: 266 ttcaccgccggaaacggcaccggaggcgaatctatctacggcgcgaaattcgcggacgag 325

                   
Query: 368 aagttcgt 375
           || |||||
Sbjct: 326 aacttcgt 333



to top

>gb|AY705800.1| Pinus halepensis clone 17r cyclophilin mRNA, complete cds
          Length = 1080

 Score =  157 bits (79), Expect = 3e-35
 Identities = 226/275 (82%)
 Strand = Plus / Plus

                                                                       
Query: 95  aacccgaaggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatg 154
           ||||| ||||| ||||| || |||  ||| ||||| ||||| |||||||| |||||||||
Sbjct: 88  aacccaaaggttttctttgatatgcaggtcggcggtgccccagccggccggatcgtgatg 147

                                                                       
Query: 155 gagctgtacaaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggc 214
           ||||| ||   ||| | |||||||| |||||  ||||||||||||||| | || ||||||
Sbjct: 148 gagctctatgcggatgtggtgccgaagacggctgagaacttccgcgcgttgtgtaccggc 207

                                                                       
Query: 215 gagaagggcgtcggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgc 274
           ||||| |||  ||||      |||||||| ||||||| ||||||    ||||||||||||
Sbjct: 208 gagaaaggcaccggccgctcaggcaagcctctgcacttcaagggttcgtcgttccaccgc 267

                                                                       
Query: 275 gtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggc 334
           || ||||| |  ||||||||||||||||| |||||||| ||||||||||| ||||| || 
Sbjct: 268 gtgatcccagggttcatgtgccagggcggtgacttcacaaggggcaacggtaccggtgga 327

                                              
Query: 335 gagtccatctacggcgagaagttcgccgacgagaa 369
           ||||| ||||||||||||||||| ||||| |||||
Sbjct: 328 gagtctatctacggcgagaagtttgccgatgagaa 362



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score =  157 bits (79), Expect = 3e-35
 Identities = 145/167 (86%)
 Strand = Plus / Plus

                                                                            
Query: 203      ctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctgcactacaagggcagc 262
                ||||||||||||||||||||| |||||     ||||||||||||||| ||||||||    
Sbjct: 22509020 ctctgcaccggcgagaagggcctcggcgcctccggcaagccgctgcattacaagggttct 22509079

                                                                            
Query: 263      tcgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaac 322
                 | ||||||||  |||| ||| ||||||||||||||||||||||||||||| | ||||||
Sbjct: 22509080 gccttccaccgtatcatacccaacttcatgtgccagggcggcgacttcacccgcggcaac 22509139

                                                               
Query: 323      ggcaccggcggcgagtccatctacggcgagaagttcgccgacgagaa 369
                ||||||||||||||||||||||||||||| | ||| |||||||||||
Sbjct: 22509140 ggcaccggcggcgagtccatctacggcgacaggtttgccgacgagaa 22509186



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 60     cgatcccgatcccgatcccg 79
              ||||||||||||||||||||
Sbjct: 392141 cgatcccgatcccgatcccg 392160



to top

>dbj|AP006162.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:B1331F11
          Length = 132205

 Score =  157 bits (79), Expect = 3e-35
 Identities = 145/167 (86%)
 Strand = Plus / Plus

                                                                         
Query: 203   ctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctgcactacaagggcagc 262
             ||||||||||||||||||||| |||||     ||||||||||||||| ||||||||    
Sbjct: 24221 ctctgcaccggcgagaagggcctcggcgcctccggcaagccgctgcattacaagggttct 24280

                                                                         
Query: 263   tcgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaac 322
              | ||||||||  |||| ||| ||||||||||||||||||||||||||||| | ||||||
Sbjct: 24281 gccttccaccgtatcatacccaacttcatgtgccagggcggcgacttcacccgcggcaac 24340

                                                            
Query: 323   ggcaccggcggcgagtccatctacggcgagaagttcgccgacgagaa 369
             ||||||||||||||||||||||||||||| | ||| |||||||||||
Sbjct: 24341 ggcaccggcggcgagtccatctacggcgacaggtttgccgacgagaa 24387



to top

>dbj|AK103109.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033119A20, full
           insert sequence
          Length = 757

 Score =  157 bits (79), Expect = 3e-35
 Identities = 145/167 (86%)
 Strand = Plus / Plus

                                                                       
Query: 203 ctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctgcactacaagggcagc 262
           ||||||||||||||||||||| |||||     ||||||||||||||| ||||||||    
Sbjct: 186 ctctgcaccggcgagaagggcctcggcgcctccggcaagccgctgcattacaagggttct 245

                                                                       
Query: 263 tcgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaac 322
            | ||||||||  |||| ||| ||||||||||||||||||||||||||||| | ||||||
Sbjct: 246 gccttccaccgtatcatacccaacttcatgtgccagggcggcgacttcacccgcggcaac 305

                                                          
Query: 323 ggcaccggcggcgagtccatctacggcgagaagttcgccgacgagaa 369
           ||||||||||||||||||||||||||||| | ||| |||||||||||
Sbjct: 306 ggcaccggcggcgagtccatctacggcgacaggtttgccgacgagaa 352



to top

>gb|L29471.1|RICCYP1R Oryza sativa cyclophilin 1 (Cyp1) mRNA, complete cds
          Length = 590

 Score =  157 bits (79), Expect = 3e-35
 Identities = 145/167 (86%)
 Strand = Plus / Plus

                                                                       
Query: 203 ctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctgcactacaagggcagc 262
           ||||||||||||||||||||| |||||     ||||||||||||||| ||||||||    
Sbjct: 167 ctctgcaccggcgagaagggcctcggcgcctccggcaagccgctgcattacaagggttct 226

                                                                       
Query: 263 tcgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaac 322
            | ||||||||  |||| ||| ||||||||||||||||||||||||||||| | ||||||
Sbjct: 227 gccttccaccgtatcatacccaacttcatgtgccagggcggcgacttcacccgcggcaac 286

                                                          
Query: 323 ggcaccggcggcgagtccatctacggcgagaagttcgccgacgagaa 369
           ||||||||||||||||||||||||||||| | ||| |||||||||||
Sbjct: 287 ggcaccggcggcgagtccatctacggcgacaggtttgccgacgagaa 333



to top

>emb|Y08273.1|DLCYP18 D.lanata CYP18 gene
          Length = 1363

 Score =  145 bits (73), Expect = 1e-31
 Identities = 157/185 (84%)
 Strand = Plus / Plus

                                                                       
Query: 191 aacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctgcac 250
           ||||||||||| ||||||||||| ||||| ||||| ||||||  |||||||||||| |||
Sbjct: 611 aacttccgcgctctctgcaccggtgagaaaggcgtaggcaagtccggcaagccgctccac 670

                                                                       
Query: 251 tacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttc 310
           ||||| |||    |||||||||| || |||||||  |||||||| ||||||||||| |||
Sbjct: 671 tacaaaggctcggcgttccaccgagtgatccccgggttcatgtgtcagggcggcgatttc 730

                                                                       
Query: 311 accaggggcaacggcaccggcggcgagtccatctacggcgagaagttcgccgacgagaag 370
           |||   || ||||||||||| ||||| || |||||||||| ||| |||||||||||||| 
Sbjct: 731 accgctggaaacggcaccggaggcgaatcgatctacggcgcgaaattcgccgacgagaac 790

                
Query: 371 ttcgt 375
           |||||
Sbjct: 791 ttcgt 795



to top

>gb|AF456323.1|AF456323 Glycine max cyclophilin (Cyp) mRNA, complete cds
          Length = 873

 Score =  145 bits (73), Expect = 1e-31
 Identities = 169/201 (84%)
 Strand = Plus / Plus

                                                                       
Query: 188 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctg 247
           ||||||||||||||||| |||||||||||||||||||| ||   |||||||||||| || 
Sbjct: 168 gagaacttccgcgcgctttgcaccggcgagaagggcgtagggcggagcggcaagcccctc 227

                                                                       
Query: 248 cactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgac 307
           ||||||||||||   || ||||||||||| |||||    |||||||| ||||| ||||||
Sbjct: 228 cactacaagggctcgtccttccaccgcgtgatcccgagtttcatgtgtcagggtggcgac 287

                                                                       
Query: 308 ttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaagttcgccgacgag 367
           ||||||   || ||||| |||||||||||||| || || ||||  |||||||||||||||
Sbjct: 288 ttcaccgccggaaacggaaccggcggcgagtcgatttatggcgccaagttcgccgacgag 347

                                
Query: 368 aagttcgtccacaagcacacc 388
           || |||||  | |||||||||
Sbjct: 348 aacttcgtgaagaagcacacc 368



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 140 ggccgcatcgtgatggagct 159
           ||||||||||||||||||||
Sbjct: 120 ggccgcatcgtgatggagct 139



to top

>gb|AF055990.1|AF055990 Fucus distichus cyclophilin mRNA, partial cds
          Length = 417

 Score =  133 bits (67), Expect = 5e-28
 Identities = 94/103 (91%)
 Strand = Plus / Plus

                                                                       
Query: 267 tccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggca 326
           |||||||||| ||||| ||||||||||||||||| |||||||||||  | || ||||| |
Sbjct: 1   tccaccgcgtgatcccggacttcatgtgccagggtggcgacttcactcgtggaaacggta 60

                                                      
Query: 327 ccggcggcgagtccatctacggcgagaagttcgccgacgagaa 369
           |||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 61  ccggcggcgagtccatctacggggagaagttcgccgacgagaa 103



to top

>gb|AC010707.17| Drosophila melanogaster clone BACR06P10, complete sequence
          Length = 176969

 Score =  121 bits (61), Expect = 2e-24
 Identities = 97/109 (88%)
 Strand = Plus / Minus

                                                                          
Query: 266    ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
              |||||||||||||||||| ||||||||||||||||||||||||||||||    |||||||
Sbjct: 159821 ttccaccgcgtcatccccaacttcatgtgccagggcggcgacttcaccaaccacaacggc 159762

                                                               
Query: 326    accggcggcgagtccatctacggcgagaagttcgccgacgagaagttcg 374
              || |||||| |||||||||||||| | |||||| |||| ||||| ||||
Sbjct: 159761 actggcggcaagtccatctacggcaacaagttccccgatgagaacttcg 159713



 Score = 46.1 bits (23), Expect = 0.085
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                 
Query: 188    gagaacttccgcgcgctctgcaccggcgagaaggg 222
              ||||||||||||||  | |||||||||||||||||
Sbjct: 159878 gagaacttccgcgccttgtgcaccggcgagaaggg 159844



to top

>gb|AC010846.13| Drosophila melanogaster clone BACR13G13, complete sequence
          Length = 192540

 Score =  121 bits (61), Expect = 2e-24
 Identities = 97/109 (88%)
 Strand = Plus / Minus

                                                                         
Query: 266   ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
             |||||||||||||||||| ||||||||||||||||||||||||||||||    |||||||
Sbjct: 62385 ttccaccgcgtcatccccaacttcatgtgccagggcggcgacttcaccaaccacaacggc 62326

                                                              
Query: 326   accggcggcgagtccatctacggcgagaagttcgccgacgagaagttcg 374
             || |||||| |||||||||||||| | |||||| |||| ||||| ||||
Sbjct: 62325 actggcggcaagtccatctacggcaacaagttccccgatgagaacttcg 62277



 Score = 46.1 bits (23), Expect = 0.085
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                
Query: 188   gagaacttccgcgcgctctgcaccggcgagaaggg 222
             ||||||||||||||  | |||||||||||||||||
Sbjct: 62442 gagaacttccgcgccttgtgcaccggcgagaaggg 62408



to top

>gb|AY232025.1| Drosophila yakuba clone yak-ad_Cyp1 mRNA sequence
          Length = 456

 Score =  121 bits (61), Expect = 2e-24
 Identities = 97/109 (88%)
 Strand = Plus / Plus

                                                                       
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
           |||||||||||||||||| ||||||||||||||||||||||||||||||    |||||||
Sbjct: 160 ttccaccgcgtcatccccaacttcatgtgccagggcggcgacttcaccaaccacaacggc 219

                                                            
Query: 326 accggcggcgagtccatctacggcgagaagttcgccgacgagaagttcg 374
           || |||||| |||||||||||||| | |||||| |||| ||||| ||||
Sbjct: 220 actggcggcaagtccatctacggcaacaagttccccgatgagaacttcg 268



 Score = 46.1 bits (23), Expect = 0.085
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 188 gagaacttccgcgcgctctgcaccggcgagaaggg 222
           ||||||||||||||  | |||||||||||||||||
Sbjct: 103 gagaacttccgcgccttgtgcaccggcgagaaggg 137



to top

>gb|AY231912.1| Drosophila yakuba clone yak-em_Cyp1 mRNA sequence
          Length = 399

 Score =  121 bits (61), Expect = 2e-24
 Identities = 97/109 (88%)
 Strand = Plus / Plus

                                                                       
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
           |||||||||||||||||| ||||||||||||||||||||||||||||||    |||||||
Sbjct: 64  ttccaccgcgtcatccccaacttcatgtgccagggcggcgacttcaccaaccacaacggc 123

                                                            
Query: 326 accggcggcgagtccatctacggcgagaagttcgccgacgagaagttcg 374
           || |||||| |||||||||||||| | |||||| |||| ||||| ||||
Sbjct: 124 actggcggcaagtccatctacggcaacaagttccccgatgagaacttcg 172



 Score = 46.1 bits (23), Expect = 0.085
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 188 gagaacttccgcgcgctctgcaccggcgagaaggg 222
           ||||||||||||||  | |||||||||||||||||
Sbjct: 7   gagaacttccgcgccttgtgcaccggcgagaaggg 41



to top

>gb|BT009946.1| Drosophila melanogaster SD01793 full insert cDNA
          Length = 796

 Score =  121 bits (61), Expect = 2e-24
 Identities = 97/109 (88%)
 Strand = Plus / Plus

                                                                       
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
           |||||||||||||||||| ||||||||||||||||||||||||||||||    |||||||
Sbjct: 294 ttccaccgcgtcatccccaacttcatgtgccagggcggcgacttcaccaaccacaacggc 353

                                                            
Query: 326 accggcggcgagtccatctacggcgagaagttcgccgacgagaagttcg 374
           || |||||| |||||||||||||| | |||||| |||| ||||| ||||
Sbjct: 354 actggcggcaagtccatctacggcaacaagttccccgatgagaacttcg 402



 Score = 46.1 bits (23), Expect = 0.085
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 188 gagaacttccgcgcgctctgcaccggcgagaaggg 222
           ||||||||||||||  | |||||||||||||||||
Sbjct: 237 gagaacttccgcgccttgtgcaccggcgagaaggg 271



to top

>ref|NM_078642.3| Drosophila melanogaster Cyclophilin 1 CG9916-RA (Cyp1), mRNA
          Length = 1269

 Score =  121 bits (61), Expect = 2e-24
 Identities = 97/109 (88%)
 Strand = Plus / Plus

                                                                       
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
           |||||||||||||||||| ||||||||||||||||||||||||||||||    |||||||
Sbjct: 422 ttccaccgcgtcatccccaacttcatgtgccagggcggcgacttcaccaaccacaacggc 481

                                                            
Query: 326 accggcggcgagtccatctacggcgagaagttcgccgacgagaagttcg 374
           || |||||| |||||||||||||| | |||||| |||| ||||| ||||
Sbjct: 482 actggcggcaagtccatctacggcaacaagttccccgatgagaacttcg 530



 Score = 46.1 bits (23), Expect = 0.085
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 188 gagaacttccgcgcgctctgcaccggcgagaaggg 222
           ||||||||||||||  | |||||||||||||||||
Sbjct: 365 gagaacttccgcgccttgtgcaccggcgagaaggg 399



to top

>gb|DQ066345.1| Ixodes scapularis isolate IS-6-12-J-cluster-190 cyclophilin A mRNA,
           complete cds
          Length = 498

 Score =  121 bits (61), Expect = 2e-24
 Identities = 97/109 (88%)
 Strand = Plus / Plus

                                                                       
Query: 251 tacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttc 310
           ||||||||||||   |||||||| ||||||||| |||||||||||||||| || ||||||
Sbjct: 142 tacaagggcagcattttccaccgagtcatccccaacttcatgtgccagggaggagacttc 201

                                                            
Query: 311 accaggggcaacggcaccggcggcgagtccatctacggcgagaagttcg 359
           ||| ||  ||||||||| |||||| ||||||||||||||||||||||||
Sbjct: 202 acccggcacaacggcacgggcggcaagtccatctacggcgagaagttcg 250



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 191 aacttccgcgcgctctgcaccggcgagaagggcgtcgg 228
           ||||||||||| || |||||||||||||||||| ||||
Sbjct: 103 aacttccgcgccctgtgcaccggcgagaagggcttcgg 140



to top

>gb|AE003501.4| Drosophila melanogaster chromosome X, section 53 of 74 of the complete
              sequence
          Length = 323840

 Score =  121 bits (61), Expect = 2e-24
 Identities = 97/109 (88%)
 Strand = Plus / Minus

                                                                          
Query: 266    ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
              |||||||||||||||||| ||||||||||||||||||||||||||||||    |||||||
Sbjct: 309493 ttccaccgcgtcatccccaacttcatgtgccagggcggcgacttcaccaaccacaacggc 309434

                                                               
Query: 326    accggcggcgagtccatctacggcgagaagttcgccgacgagaagttcg 374
              || |||||| |||||||||||||| | |||||| |||| ||||| ||||
Sbjct: 309433 actggcggcaagtccatctacggcaacaagttccccgatgagaacttcg 309385



 Score = 46.1 bits (23), Expect = 0.085
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                 
Query: 188    gagaacttccgcgcgctctgcaccggcgagaaggg 222
              ||||||||||||||  | |||||||||||||||||
Sbjct: 309550 gagaacttccgcgccttgtgcaccggcgagaaggg 309516



to top

>gb|M62398.1|DROCYP1 Drosophila melanogaster CYP-1 protein mRNA, complete cds
          Length = 707

 Score =  121 bits (61), Expect = 2e-24
 Identities = 97/109 (88%)
 Strand = Plus / Plus

                                                                       
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
           |||||||||||||||||| ||||||||||||||||||||||||||||||    |||||||
Sbjct: 192 ttccaccgcgtcatccccaacttcatgtgccagggcggcgacttcaccaaccacaacggc 251

                                                            
Query: 326 accggcggcgagtccatctacggcgagaagttcgccgacgagaagttcg 374
           || |||||| |||||||||||||| | |||||| |||| ||||| ||||
Sbjct: 252 actggcggcaagtccatctacggcaacaagttccccgatgagaacttcg 300



 Score = 46.1 bits (23), Expect = 0.085
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 188 gagaacttccgcgcgctctgcaccggcgagaaggg 222
           ||||||||||||||  | |||||||||||||||||
Sbjct: 135 gagaacttccgcgccttgtgcaccggcgagaaggg 169



to top

>ref|XM_366228.1| Magnaporthe grisea 70-15 hypothetical protein (MG10447.4) partial
           mRNA
          Length = 648

 Score =  119 bits (60), Expect = 7e-24
 Identities = 93/104 (89%)
 Strand = Plus / Plus

                                                                       
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
           ||||||||  |||||||||||||||||  ||||||||| ||||||||| | |||||||||
Sbjct: 307 ttccaccgtatcatccccgacttcatgctccagggcggtgacttcacccgtggcaacggc 366

                                                       
Query: 326 accggcggcgagtccatctacggcgagaagttcgccgacgagaa 369
           ||||| ||| ||||| |||||||||||||||| |||||||||||
Sbjct: 367 accggtggcaagtccgtctacggcgagaagtttgccgacgagaa 410



to top

>emb|Z15137.1|SCCYCLOA Streptomyces chrysomallus orfA, estA, cypA genes
          Length = 3538

 Score =  119 bits (60), Expect = 7e-24
 Identities = 93/104 (89%)
 Strand = Plus / Plus

                                                                        
Query: 266  ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
            ||||||||||||||| | |||||||||  ||||||||||||||||||| | ||  |||||
Sbjct: 2587 ttccaccgcgtcatcacggacttcatgctccagggcggcgacttcacccgcggtgacggc 2646

                                                        
Query: 326  accggcggcgagtccatctacggcgagaagttcgccgacgagaa 369
            ||||||||| ||  ||||||||||||||||||||||||||||||
Sbjct: 2647 accggcggcaagagcatctacggcgagaagttcgccgacgagaa 2690



 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 45/49 (91%)
 Strand = Plus / Plus

                                                             
Query: 181  gacggtggagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 229
            ||||| |||||||||||||||||||  |||||||||||||||| |||||
Sbjct: 2523 gacggcggagaacttccgcgcgctcgccaccggcgagaagggcttcggc 2571



to top

>dbj|AB062457.1| Magnaporthe grisea CYP1 mRNA for cyclophilin, complete cds
          Length = 775

 Score =  119 bits (60), Expect = 7e-24
 Identities = 93/104 (89%)
 Strand = Plus / Plus

                                                                       
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
           ||||||||  |||||||||||||||||  ||||||||| ||||||||| | |||||||||
Sbjct: 210 ttccaccgtatcatccccgacttcatgctccagggcggtgacttcacccgtggcaacggc 269

                                                       
Query: 326 accggcggcgagtccatctacggcgagaagttcgccgacgagaa 369
           ||||| ||| ||||| |||||||||||||||| |||||||||||
Sbjct: 270 accggtggcaagtccgtctacggcgagaagtttgccgacgagaa 313



to top

>gb|DQ012959.1| Streptomyces antibioticus strain ETH7451 cyclophilin gene, partial
           cds
          Length = 393

 Score =  115 bits (58), Expect = 1e-22
 Identities = 94/106 (88%)
 Strand = Plus / Plus

                                                                       
Query: 264 cgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacg 323
           |||||||||||||||||||  ||||||||  ||||||||||||||| |||   |||||||
Sbjct: 110 cgttccaccgcgtcatcccgaacttcatgctccagggcggcgactttacccaaggcaacg 169

                                                         
Query: 324 gcaccggcggcgagtccatctacggcgagaagttcgccgacgagaa 369
           ||||||||||| ||  ||||||||||||||||||||| ||||||||
Sbjct: 170 gcaccggcggcaagagcatctacggcgagaagttcgcggacgagaa 215



to top

>emb|AJ862840.1| Streptomyces griseus subsp. griseus streptomycin gene cluster, strain
             DSM 40236
          Length = 90600

 Score =  111 bits (56), Expect = 2e-21
 Identities = 92/104 (88%)
 Strand = Plus / Plus

                                                                         
Query: 266   ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
             |||||||| |||||| |||||||||||   |||||||||||||||||| | ||  |||||
Sbjct: 55880 ttccaccgtgtcatcaccgacttcatgcttcagggcggcgacttcacccgcggtgacggc 55939

                                                         
Query: 326   accggcggcgagtccatctacggcgagaagttcgccgacgagaa 369
             ||||||||| ||  ||||||||||||||||||||||||||||||
Sbjct: 55940 accggcggcaagagcatctacggcgagaagttcgccgacgagaa 55983



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 40/43 (93%)
 Strand = Plus / Plus

                                                        
Query: 187   ggagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 229
             |||||||||||||||||||  |||||||||||||||| |||||
Sbjct: 55822 ggagaacttccgcgcgctcgccaccggcgagaagggcttcggc 55864



to top

>dbj|AB231815.1| Malassezia yamatoensis CYP mRNA for cyclophilin, partial cds
          Length = 423

 Score =  111 bits (56), Expect = 2e-21
 Identities = 110/128 (85%)
 Strand = Plus / Plus

                                                                       
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
           |||||||| || |||||||||||||||  ||||||||| |||||||||   |||||||||
Sbjct: 151 ttccaccgtgtgatccccgacttcatgctccagggcggtgacttcaccgccggcaacggc 210

                                                                       
Query: 326 accggcggcgagtccatctacggcgagaagttcgccgacgagaagttcgtccacaagcac 385
           || |||||| |||| ||||||||| |||||||||| |||||||| |||  || |||||||
Sbjct: 211 acgggcggcaagtcgatctacggccagaagttcgctgacgagaacttcaacctcaagcac 270

                   
Query: 386 accaagcc 393
           | ||||||
Sbjct: 271 aacaagcc 278



to top

>dbj|AB231812.1| Malassezia obtusa CYP mRNA for cyclophilin, partial cds
          Length = 486

 Score =  111 bits (56), Expect = 2e-21
 Identities = 110/128 (85%)
 Strand = Plus / Plus

                                                                       
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
           |||||||| || |||||||||||||||  ||||||||| |||||||||   |||||||||
Sbjct: 151 ttccaccgtgtgatccccgacttcatgctccagggcggtgacttcaccgctggcaacggc 210

                                                                       
Query: 326 accggcggcgagtccatctacggcgagaagttcgccgacgagaagttcgtccacaagcac 385
           || |||||| |||| ||||||||| |||||||||| |||||||| |||  || |||||||
Sbjct: 211 actggcggcaagtcgatctacggccagaagttcgctgacgagaacttcaacctcaagcac 270

                   
Query: 386 accaagcc 393
           | ||||||
Sbjct: 271 aacaagcc 278



to top

>gb|DQ012958.1| Streptomyces antibioticus strain ATCC 11891 cyclophilin gene,
           partial cds
          Length = 457

 Score =  107 bits (54), Expect = 3e-20
 Identities = 97/109 (88%), Gaps = 3/109 (2%)
 Strand = Plus / Plus

                                                                       
Query: 264 cgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt-ca--ccaggggca 320
           |||||||||||||||||||  ||||||||  ||||||||||||||| ||  |||||| ||
Sbjct: 107 cgttccaccgcgtcatcccgaacttcatgctccagggcggcgactttcaacccagggtca 166

                                                            
Query: 321 acggcaccggcggcgagtccatctacggcgagaagttcgccgacgagaa 369
           |||||||||||||| ||  ||||||||||||||||||||| ||||||||
Sbjct: 167 acggcaccggcggcaagagcatctacggcgagaagttcgcggacgagaa 215



to top

>emb|AJ271126.1|PAB271126 Picea abies mRNA for putative cyclosporin A-binding protein,
           (pPA0005 gene)
          Length = 1026

 Score =  105 bits (53), Expect = 1e-19
 Identities = 95/109 (87%)
 Strand = Plus / Plus

                                                                       
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
           ||||||||||| ||||| |  ||||||||||| ||||||||||||||  | || ||||| 
Sbjct: 279 ttccaccgcgtgatcccagggttcatgtgccaaggcggcgacttcacgcgtggtaacggt 338

                                                            
Query: 326 accggcggcgagtccatctacggcgagaagttcgccgacgagaagttcg 374
           |||||||| ||||| ||||||||||||||||| ||||||||||| ||||
Sbjct: 339 accggcggggagtcgatctacggcgagaagtttgccgacgagaacttcg 387



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 104/124 (83%)
 Strand = Plus / Plus

                                                                       
Query: 95  aacccgaaggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatg 154
           ||||| ||||| ||||| ||||||  ||| ||||||||||| |||||||| |||||||||
Sbjct: 108 aacccaaaggttttctttgacatgcaggtcggcggcgccccagccggccggatcgtgatg 167

                                                                       
Query: 155 gagctgtacaaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggc 214
           ||||| |||   || | |||||||| |||||  |||||||| || ||||| |||||||||
Sbjct: 168 gagctctacgccgatgtggtgccgaagacggccgagaactttcgtgcgctgtgcaccggc 227

               
Query: 215 gaga 218
           ||||
Sbjct: 228 gaga 231



to top

>gb|AF178458.1|AF178458 Lupinus luteus cytosolic cyclophilin gene, complete cds
          Length = 1968

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 107/126 (84%)
 Strand = Plus / Plus

                                                                        
Query: 188  gagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctg 247
            ||||||||||| || |||||||||||||||||||| ||||||   ||||||||||| || 
Sbjct: 1198 gagaacttccgtgccctctgcaccggcgagaagggagtcggccgcagcggcaagccactc 1257

                                                                        
Query: 248  cactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgac 307
            || ||||||||   | | ||||||||||| |||||  ||||||||||||||||||| || 
Sbjct: 1258 cattacaagggatccaccttccaccgcgtgatccctaacttcatgtgccagggcggtgat 1317

                  
Query: 308  ttcacc 313
            ||||||
Sbjct: 1318 ttcacc 1323



 Score = 46.1 bits (23), Expect = 0.085
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 137  gccggccgcatcgtgatggagctgtac 163
            |||||||||||||| ||||||||||||
Sbjct: 1147 gccggccgcatcgtcatggagctgtac 1173



to top

>gb|AE016817.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome IV,
              complete sequence
          Length = 1466886

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 95/110 (86%)
 Strand = Plus / Minus

                                                                          
Query: 265    gttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacgg 324
              |||||||||||| |||   | |||||||||||||  ||||||||||||||  ||| ||||
Sbjct: 867232 gttccaccgcgtgatcaagggcttcatgtgccagttcggcgacttcaccaacggcgacgg 867173

                                                                
Query: 325    caccggcggcgagtccatctacggcgagaagttcgccgacgagaagttcg 374
              ||| || ||||||||||||||||||||||||||||  |||||||| ||||
Sbjct: 867172 cacgggtggcgagtccatctacggcgagaagttcgaggacgagaacttcg 867123



to top

>ref|NM_209536.1| Eremothecium gossypii ADR087Cp (ADR087C), mRNA
          Length = 1110

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 95/110 (86%)
 Strand = Plus / Plus

                                                                       
Query: 265 gttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacgg 324
           |||||||||||| |||   | |||||||||||||  ||||||||||||||  ||| ||||
Sbjct: 186 gttccaccgcgtgatcaagggcttcatgtgccagttcggcgacttcaccaacggcgacgg 245

                                                             
Query: 325 caccggcggcgagtccatctacggcgagaagttcgccgacgagaagttcg 374
           ||| || ||||||||||||||||||||||||||||  |||||||| ||||
Sbjct: 246 cacgggtggcgagtccatctacggcgagaagttcgaggacgagaacttcg 295



to top

>ref|XM_959286.1| Neurospora crassa OR74A hypothetical protein ( (X17692) cyclophilin
           (cytosolic form) [Neurospora crassa OR74A]  )
           (NCU00726.1) partial mRNA
          Length = 543

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 94/109 (86%)
 Strand = Plus / Plus

                                                                       
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
           ||||||||| | |||||||| ||||||  |||||| || ||||||||| | || ||||||
Sbjct: 193 ttccaccgcattatccccgagttcatgctccagggtggtgacttcacccgtggtaacggc 252

                                                            
Query: 326 accggcggcgagtccatctacggcgagaagttcgccgacgagaagttcg 374
           || || ||| |||||||||||||||||||||||||||| ||||| ||||
Sbjct: 253 actggtggcaagtccatctacggcgagaagttcgccgatgagaacttcg 301



to top

>ref|XM_324905.1| Neurospora crassa OR74A hypothetical protein ( (X17692) cyclophilin
           (cytosolic form) [Neurospora crassa OR74A]  )
           (NCU00726.1) partial mRNA
          Length = 543

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 94/109 (86%)
 Strand = Plus / Plus

                                                                       
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
           ||||||||| | |||||||| ||||||  |||||| || ||||||||| | || ||||||
Sbjct: 193 ttccaccgcattatccccgagttcatgctccagggtggtgacttcacccgtggtaacggc 252

                                                            
Query: 326 accggcggcgagtccatctacggcgagaagttcgccgacgagaagttcg 374
           || || ||| |||||||||||||||||||||||||||| ||||| ||||
Sbjct: 253 actggtggcaagtccatctacggcgagaagttcgccgatgagaacttcg 301



to top

>emb|AJ311666.1|BVE311666 Betula verrucosa mRNA for peptidylprolyl isomerase (cyclophilin),
           ppiase gene (CyP)
          Length = 823

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 163/201 (81%)
 Strand = Plus / Plus

                                                                       
Query: 188 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctg 247
           ||||||||||| || ||||||||||| |||||||||  ||||     ||||||||| || 
Sbjct: 137 gagaacttccgggccctctgcaccggtgagaagggcaacggccgctccggcaagcccctc 196

                                                                       
Query: 248 cactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgac 307
           |||||||||      || |||||| | || |||||||  |||||||||||||| ||||||
Sbjct: 197 cactacaagaaatcgtccttccacagggtgatccccgggttcatgtgccaggggggcgac 256

                                                                       
Query: 308 ttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaagttcgccgacgag 367
           |||||    || ||||||||||| |||||||||||||||||||  ||||||||||| |||
Sbjct: 257 ttcactgccggaaacggcaccggtggcgagtccatctacggcgccaagttcgccgatgag 316

                                
Query: 368 aagttcgtccacaagcacacc 388
           || ||| || | |||||||||
Sbjct: 317 aacttcatcaagaagcacacc 337



to top

>gb|J03963.1|NEUCYCLO N.crassa cytosolic cyclosporin A-binding protein mRNA, complete cds
          Length = 928

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 94/109 (86%)
 Strand = Plus / Plus

                                                                       
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
           ||||||||| | |||||||| ||||||  |||||| || ||||||||| | || ||||||
Sbjct: 459 ttccaccgcattatccccgagttcatgctccagggtggtgacttcacccgtggtaacggc 518

                                                            
Query: 326 accggcggcgagtccatctacggcgagaagttcgccgacgagaagttcg 374
           || || ||| |||||||||||||||||||||||||||| ||||| ||||
Sbjct: 519 actggtggcaagtccatctacggcgagaagttcgccgatgagaacttcg 567



to top

>ref|XM_323171.1| Neurospora crassa OR74A hypothetical protein ( (AJ292563)
           peptidyl-prolyl cis-trans isomerase [Neurospora crassa
           OR74A]  ) (NCU03853.1) partial mRNA
          Length = 1128

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 141/172 (81%)
 Strand = Plus / Plus

                                                                       
Query: 188 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctg 247
           ||||||||||||||  | ||||||||||||||||| || ||||||   ||||||||||| 
Sbjct: 124 gagaacttccgcgctttgtgcaccggcgagaagggtgttggcaagttgggcaagccgcta 183

                                                                       
Query: 248 cactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgac 307
           |||||||||||   | |||||||||| ||||||    | ||||||  |||||| || |||
Sbjct: 184 cactacaagggttccacgttccaccgtgtcatcaagcagttcatgatccagggtggtgac 243

                                                               
Query: 308 ttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaagttcg 359
           ||||||   || |||||||| || |||||||||||||||||||  |||||||
Sbjct: 244 ttcaccgctggaaacggcactggtggcgagtccatctacggcgcaaagttcg 295



to top

>ref|XM_950770.1| Neurospora crassa OR74A hypothetical protein ( (AJ292563)
           peptidyl-prolyl cis-trans isomerase [Neurospora crassa
           OR74A]  ) (NCU03853.1) partial mRNA
          Length = 1128

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 141/172 (81%)
 Strand = Plus / Plus

                                                                       
Query: 188 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctg 247
           ||||||||||||||  | ||||||||||||||||| || ||||||   ||||||||||| 
Sbjct: 124 gagaacttccgcgctttgtgcaccggcgagaagggtgttggcaagttgggcaagccgcta 183

                                                                       
Query: 248 cactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgac 307
           |||||||||||   | |||||||||| ||||||    | ||||||  |||||| || |||
Sbjct: 184 cactacaagggttccacgttccaccgtgtcatcaagcagttcatgatccagggtggtgac 243

                                                               
Query: 308 ttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaagttcg 359
           ||||||   || |||||||| || |||||||||||||||||||  |||||||
Sbjct: 244 ttcaccgctggaaacggcactggtggcgagtccatctacggcgcaaagttcg 295



to top

>emb|AJ292563.1|NCR292563 Neurospora crassa mRNA for cyclophilin41
          Length = 1632

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 141/172 (81%)
 Strand = Plus / Plus

                                                                       
Query: 188 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctg 247
           ||||||||||||||  | ||||||||||||||||| || ||||||   ||||||||||| 
Sbjct: 359 gagaacttccgcgctttgtgcaccggcgagaagggtgttggcaagttgggcaagccgcta 418

                                                                       
Query: 248 cactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgac 307
           |||||||||||   | |||||||||| ||||||    | ||||||  |||||| || |||
Sbjct: 419 cactacaagggttccacgttccaccgtgtcatcaagcagttcatgatccagggtggtgac 478

                                                               
Query: 308 ttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaagttcg 359
           ||||||   || |||||||| || |||||||||||||||||||  |||||||
Sbjct: 479 ttcaccgctggaaacggcactggtggcgagtccatctacggcgcaaagttcg 530



to top

>gb|AF542516.1| Beauveria bassiana cyclophilin A mRNA, complete cds
          Length = 705

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 90/104 (86%)
 Strand = Plus / Plus

                                                                       
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
           ||||||||||||||||||| |||||||||||||||||| || ||||| |     ||||||
Sbjct: 196 ttccaccgcgtcatccccggcttcatgtgccagggcggtgatttcacgaaccataacggc 255

                                                       
Query: 326 accggcggcgagtccatctacggcgagaagttcgccgacgagaa 369
           || || ||| ||||||||||||||||||||||||| || |||||
Sbjct: 256 actggtggcaagtccatctacggcgagaagttcgctgatgagaa 299



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 34/35 (97%)
 Strand = Plus / Plus

                                              
Query: 188 gagaacttccgcgcgctctgcaccggcgagaaggg 222
           |||||||||||||| ||||||||||||||||||||
Sbjct: 139 gagaacttccgcgctctctgcaccggcgagaaggg 173



to top

>gb|AF242312.1|AF242312 Euphorbia esula cyclophilin mRNA, partial cds
          Length = 695

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 167/207 (80%)
 Strand = Plus / Plus

                                                                       
Query: 182 acggtggagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaag 241
           |||| ||||||||||||||| || |||||||||||||| ||||||||    ||| |||| 
Sbjct: 60  acggcggagaacttccgcgctctttgcaccggcgagaaaggcgtcgggcgcagccgcaaa 119

                                                                       
Query: 242 ccgctgcactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggc 301
           || || |||| ||| ||    |||||||||||||| ||||| |  ||||||||||| || 
Sbjct: 120 cctctccacttcaaaggatcatcgttccaccgcgtgatccctggattcatgtgccaagga 179

                                                                       
Query: 302 ggcgacttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaagttcgcc 361
           ||||| |||||    || ||||||||||| ||||| || |||||||| |  |||||||||
Sbjct: 180 ggcgatttcactgccggaaacggcaccggaggcgaatcgatctacggagctaagttcgcc 239

                                      
Query: 362 gacgagaagttcgtccacaagcacacc 388
           |||||||| ||| || | |||||||||
Sbjct: 240 gacgagaacttcatcaagaagcacacc 266



to top

>emb|Y13576.1|LMCYCL Leishmania major mRNA for cyclophilin
          Length = 2165

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 76/86 (88%)
 Strand = Plus / Plus

                                                                       
Query: 264 cgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacg 323
           |||||||||| || ||||| || |||||||||||||| || ||||||||||  |||||||
Sbjct: 312 cgttccaccgtgtgatcccggatttcatgtgccagggtggtgacttcaccaacggcaacg 371

                                     
Query: 324 gcaccggcggcgagtccatctacggc 349
           |||| |||||| ||||||||||||||
Sbjct: 372 gcactggcggcaagtccatctacggc 397



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 67/79 (84%)
 Strand = Plus / Plus

                                                                       
Query: 151 gatggagctgtacaaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcac 210
           ||||||||| | ||||||||| || ||   |||||  ||||||||||||||||| |||||
Sbjct: 220 gatggagctcttcaaggacgccgttccccagacggccgagaacttccgcgcgctgtgcac 279

                              
Query: 211 cggcgagaagggcgtcggc 229
            |||||||||||| |||||
Sbjct: 280 gggcgagaagggcttcggc 298



to top

>emb|AL939131.1|SCO939131 Streptomyces coelicolor A3(2) complete genome; segment 28/29
          Length = 303550

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 91/106 (85%)
 Strand = Plus / Minus

                                                                          
Query: 264    cgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacg 323
              |||||||||| || |||||  | ||||||  ||||||||| ||||||||||  |||||||
Sbjct: 263153 cgttccaccgtgtgatcccgcagttcatgctccagggcggtgacttcaccaacggcaacg 263094

                                                            
Query: 324    gcaccggcggcgagtccatctacggcgagaagttcgccgacgagaa 369
              ||||||| ||| ||  ||||||||||||||||||||| ||||||||
Sbjct: 263093 gcaccgggggcaagagcatctacggcgagaagttcgcggacgagaa 263048



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 55/58 (94%)
 Strand = Plus / Minus

                                                                         
Query: 172     ggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 229
               ||||||| |||||| ||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 5950025 ggtgccgcggacggcggagaacttccgcgcgctctgcaccggggagaagggcgtcggc 5949968



to top

>dbj|AP004741.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OSJNBb0024N18
          Length = 128739

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 55/58 (94%)
 Strand = Plus / Minus

                                                                       
Query: 172   ggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 229
             ||||||| |||||| ||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 71677 ggtgccgcggacggcggagaacttccgcgcgctctgcaccggggagaagggcgtcggc 71620



to top

>emb|Y16088.1|LLCYCLOPH Lupinus luteus mRNA for cyclophilin
          Length = 758

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 106/126 (84%)
 Strand = Plus / Plus

                                                                       
Query: 188 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctg 247
           ||||||||||| || |||||||||||||||||||| ||||||   ||||||||||| || 
Sbjct: 129 gagaacttccgtgccctctgcaccggcgagaagggagtcggccgcagcggcaagccactc 188

                                                                       
Query: 248 cactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgac 307
           || ||||||||     | ||||||||||| |||||  ||||||||||||||||||| || 
Sbjct: 189 cattacaagggatcgaccttccaccgcgtgatccctaacttcatgtgccagggcggtgat 248

                 
Query: 308 ttcacc 313
           ||||||
Sbjct: 249 ttcacc 254



 Score = 46.1 bits (23), Expect = 0.085
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 137 gccggccgcatcgtgatggagctgtac 163
           |||||||||||||| ||||||||||||
Sbjct: 78  gccggccgcatcgtcatggagctgtac 104



to top

>dbj|AK068112.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013134M21, full
           insert sequence
          Length = 1633

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 55/58 (94%)
 Strand = Plus / Plus

                                                                     
Query: 172 ggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 229
           ||||||| |||||| ||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 299 ggtgccgcggacggcggagaacttccgcgcgctctgcaccggggagaagggcgtcggc 356



to top

>emb|BX045917.1|CNS097LD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC2BB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 791

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 105/121 (86%), Gaps = 3/121 (2%)
 Strand = Plus / Minus

                                                                       
Query: 250 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 309
           |||||||||||||  ||||||||| || |||| ||||||||||  ||||||||| |||||
Sbjct: 700 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 641

                                                                       
Query: 310 caccaggggcaacggcaccggcgg-cgagtccatctacggcgagaagttcgccgacgaga 368
           ||||| |||  ||||||||||||| ||| || ||||||||||||  ||||||||||||||
Sbjct: 640 caccaagggagacggcaccggcggacga-tcgatctacggcgag-cgttcgccgacgaga 583

            
Query: 369 a 369
           |
Sbjct: 582 a 582



to top

>emb|BX045916.1|CNS097LC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2BB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 862

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 104/121 (85%), Gaps = 2/121 (1%)
 Strand = Plus / Plus

                                                                       
Query: 250 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 309
           |||||||||||||  ||||||||| || |||| ||||||||||  ||||||||| |||||
Sbjct: 308 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 367

                                                                       
Query: 310 caccaggggcaacggcaccggcgg-cgagtccatctacggcgagaagttcgccgacgaga 368
           ||||| |||  ||||||||||||| ||| || ||||||||||||   |||||||||||||
Sbjct: 368 caccaagggagacggcaccggcggacga-tcgatctacggcgagcgcttcgccgacgaga 426

            
Query: 369 a 369
           |
Sbjct: 427 a 427



to top

>emb|BX032973.1|CNS08XLT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49AG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1006

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 105/121 (86%), Gaps = 3/121 (2%)
 Strand = Plus / Minus

                                                                       
Query: 250 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 309
           |||||||||||||  ||||||||| || |||| ||||||||||  ||||||||| |||||
Sbjct: 704 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 645

                                                                       
Query: 310 caccaggggcaacggcaccggcgg-cgagtccatctacggcgagaagttcgccgacgaga 368
           ||||| |||  ||||||||||||| ||| || ||||||||||||  ||||||||||||||
Sbjct: 644 caccaagggagacggcaccggcggacga-tcgatctacggcgag-cgttcgccgacgaga 587

            
Query: 369 a 369
           |
Sbjct: 586 a 586



to top

>emb|BX032972.1|CNS08XLS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49AG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1012

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 104/121 (85%), Gaps = 2/121 (1%)
 Strand = Plus / Plus

                                                                       
Query: 250 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 309
           |||||||||||||  ||||||||| || |||| ||||||||||  ||||||||| |||||
Sbjct: 345 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 404

                                                                       
Query: 310 caccaggggcaacggcaccggcgg-cgagtccatctacggcgagaagttcgccgacgaga 368
           ||||| |||  ||||||||||||| ||| || ||||||||||||   |||||||||||||
Sbjct: 405 caccaagggagacggcaccggcggacga-tcgatctacggcgagcgcttcgccgacgaga 463

            
Query: 369 a 369
           |
Sbjct: 464 a 464



to top

>emb|BX027426.1|CNS08TBQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA41AC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 835

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 105/121 (86%), Gaps = 3/121 (2%)
 Strand = Plus / Minus

                                                                       
Query: 250 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 309
           |||||||||||||  ||||||||| || |||| ||||||||||  ||||||||| |||||
Sbjct: 634 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 575

                                                                       
Query: 310 caccaggggcaacggcaccggcgg-cgagtccatctacggcgagaagttcgccgacgaga 368
           ||||| |||  ||||||||||||| ||| || ||||||||||||  ||||||||||||||
Sbjct: 574 caccaagggagacggcaccggcggacga-tcgatctacggcgag-cgttcgccgacgaga 517

            
Query: 369 a 369
           |
Sbjct: 516 a 516



to top

>emb|BX027425.1|CNS08TBP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA41AC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 870

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 104/121 (85%), Gaps = 2/121 (1%)
 Strand = Plus / Plus

                                                                       
Query: 250 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 309
           |||||||||||||  ||||||||| || |||| ||||||||||  ||||||||| |||||
Sbjct: 284 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 343

                                                                       
Query: 310 caccaggggcaacggcaccggcgg-cgagtccatctacggcgagaagttcgccgacgaga 368
           ||||| |||  ||||||||||||| ||| || ||||||||||||   |||||||||||||
Sbjct: 344 caccaagggagacggcaccggcggacga-tcgatctacggcgagcgcttcgccgacgaga 402

            
Query: 369 a 369
           |
Sbjct: 403 a 403



to top

>emb|BX023395.1|CNS08Q7R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA35DA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 825

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 105/121 (86%), Gaps = 3/121 (2%)
 Strand = Plus / Minus

                                                                       
Query: 250 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 309
           |||||||||||||  ||||||||| || |||| ||||||||||  ||||||||| |||||
Sbjct: 709 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 650

                                                                       
Query: 310 caccaggggcaacggcaccggcgg-cgagtccatctacggcgagaagttcgccgacgaga 368
           ||||| |||  ||||||||||||| ||| || ||||||||||||  ||||||||||||||
Sbjct: 649 caccaagggagacggcaccggcggacga-tcgatctacggcgag-cgttcgccgacgaga 592

            
Query: 369 a 369
           |
Sbjct: 591 a 591



to top

>emb|BX023394.1|CNS08Q7Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA35DA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 104/121 (85%), Gaps = 2/121 (1%)
 Strand = Plus / Plus

                                                                       
Query: 250 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 309
           |||||||||||||  ||||||||| || |||| ||||||||||  ||||||||| |||||
Sbjct: 349 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 408

                                                                       
Query: 310 caccaggggcaacggcaccggcgg-cgagtccatctacggcgagaagttcgccgacgaga 368
           ||||| |||  ||||||||||||| ||| || ||||||||||||   |||||||||||||
Sbjct: 409 caccaagggagacggcaccggcggacga-tcgatctacggcgagcgcttcgccgacgaga 467

            
Query: 369 a 369
           |
Sbjct: 468 a 468



to top

>emb|BX010692.1|CNS08GEW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA17AF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 935

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 105/121 (86%), Gaps = 3/121 (2%)
 Strand = Plus / Minus

                                                                       
Query: 250 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 309
           |||||||||||||  ||||||||| || |||| ||||||||||  ||||||||| |||||
Sbjct: 722 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 663

                                                                       
Query: 310 caccaggggcaacggcaccggcgg-cgagtccatctacggcgagaagttcgccgacgaga 368
           ||||| |||  ||||||||||||| ||| || ||||||||||||  ||||||||||||||
Sbjct: 662 caccaagggagacggcaccggcggacga-tcgatctacggcgag-cgttcgccgacgaga 605

            
Query: 369 a 369
           |
Sbjct: 604 a 604



to top

>emb|BX010691.1|CNS08GEV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA17AF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 104/121 (85%), Gaps = 2/121 (1%)
 Strand = Plus / Plus

                                                                       
Query: 250 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 309
           |||||||||||||  ||||||||| || |||| ||||||||||  ||||||||| |||||
Sbjct: 346 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 405

                                                                       
Query: 310 caccaggggcaacggcaccggcgg-cgagtccatctacggcgagaagttcgccgacgaga 368
           ||||| |||  ||||||||||||| ||| || ||||||||||||   |||||||||||||
Sbjct: 406 caccaagggagacggcaccggcggacga-tcgatctacggcgagcgcttcgccgacgaga 464

            
Query: 369 a 369
           |
Sbjct: 465 a 465



to top

>ref|XM_308669.2| Anopheles gambiae str. PEST ENSANGP00000011257
           (ENSANGG00000008768), mRNA
          Length = 1064

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 104/121 (85%), Gaps = 2/121 (1%)
 Strand = Plus / Plus

                                                                       
Query: 250 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 309
           |||||||||||||  ||||||||| || |||| ||||||||||  ||||||||| |||||
Sbjct: 349 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 408

                                                                       
Query: 310 caccaggggcaacggcaccggcgg-cgagtccatctacggcgagaagttcgccgacgaga 368
           ||||| |||  ||||||||||||| ||| || ||||||||||||   |||||||||||||
Sbjct: 409 caccaagggagacggcaccggcggacga-tcgatctacggcgagcgcttcgccgacgaga 467

            
Query: 369 a 369
           |
Sbjct: 468 a 468



to top

>dbj|AB012947.1| Vicia faba vcCyP mRNA, complete cds
          Length = 829

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 162/201 (80%)
 Strand = Plus / Plus

                                                                       
Query: 188 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctg 247
           ||||| ||||| || ||||||||||||||||| || |||||    ||||||||||| || 
Sbjct: 146 gagaatttccgtgctctctgcaccggcgagaaaggagtcggtcgtagcggcaagccactc 205

                                                                       
Query: 248 cactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgac 307
           |||| ||||||   ||| |||||||| || |||||  |||||||||||||||| || |||
Sbjct: 206 cacttcaagggatcctccttccaccgtgtgatccctaacttcatgtgccagggaggtgac 265

                                                                       
Query: 308 ttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaagttcgccgacgag 367
           ||||||   || ||||||||||| || || || ||||||||    |||||||| ||||||
Sbjct: 266 ttcaccgccggaaacggcaccggaggagaatcgatctacggttccaagttcgctgacgag 325

                                
Query: 368 aagttcgtccacaagcacacc 388
           || ||| || | |||||||||
Sbjct: 326 aacttcatcaagaagcacacc 346



to top

>ref|XM_380953.1| Gibberella zeae PH-1 chromosome 1 hypothetical protein (FG00777.1)
           partial mRNA
          Length = 675

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 89/104 (85%)
 Strand = Plus / Plus

                                                                       
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
           ||||||||  ||||||| |||||||||   ||||| || ||||||||| | |||||||||
Sbjct: 325 ttccaccgaatcatccctgacttcatgcttcagggtggtgacttcacccgtggcaacggc 384

                                                       
Query: 326 accggcggcgagtccatctacggcgagaagttcgccgacgagaa 369
           || || ||| ||||||||||||| ||||||||||| ||||||||
Sbjct: 385 actggtggcaagtccatctacggtgagaagttcgctgacgagaa 428



 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 188 gagaacttccgcgcgctctgcaccggcgagaaggg 222
           |||||||||||||| |||||||| |||||||||||
Sbjct: 268 gagaacttccgcgctctctgcactggcgagaaggg 302



to top

>dbj|AB231810.1| Malassezia japonica CYP mRNA for cyclophilin, partial cds
          Length = 486

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 92/108 (85%)
 Strand = Plus / Plus

                                                                       
Query: 262 ctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaa 321
           |||||||||||| |||||||||||||| |||  |||||| || ||||||||    |||||
Sbjct: 147 ctcgttccaccgtgtcatccccgactttatgctccagggtggtgacttcactgccggcaa 206

                                                           
Query: 322 cggcaccggcggcgagtccatctacggcgagaagttcgccgacgagaa 369
           ||| ||||| ||| ||||||||||||| |  |||||||||||||||||
Sbjct: 207 cggtaccggtggcaagtccatctacggtgccaagttcgccgacgagaa 254



to top

>gb|AF025803.1|AF025803 Drosophila pseudoobscura cyclophilin 1 (Cyp1) mRNA, partial cds
          Length = 471

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 89/104 (85%)
 Strand = Plus / Plus

                                                                       
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
           ||||| ||||| || ||| ||||||||||||| || |||||||||||||    |||||||
Sbjct: 160 ttccatcgcgttattcccaacttcatgtgccaaggaggcgacttcaccaaccacaacggc 219

                                                       
Query: 326 accggcggcgagtccatctacggcgagaagttcgccgacgagaa 369
           ||||||||| |||||||||||||| | |||||| |||| |||||
Sbjct: 220 accggcggcaagtccatctacggcaacaagttccccgatgagaa 263



to top

>gb|AY754447.1| Drosophila affinis cyclophylin 1 (Cyp1) gene, exons 1, 2 and partial
            cds
          Length = 1783

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 89/104 (85%)
 Strand = Plus / Plus

                                                                        
Query: 266  ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
            ||||| ||||| || ||| |||||||||||||||| |||||||||||||    |||||||
Sbjct: 1472 ttccatcgcgttattcccaacttcatgtgccagggaggcgacttcaccaaccacaacggc 1531

                                                        
Query: 326  accggcggcgagtccatctacggcgagaagttcgccgacgagaa 369
            || |||||| |||||||||||||| | |||||| |||| |||||
Sbjct: 1532 actggcggcaagtccatctacggcaacaagttccccgatgagaa 1575



to top

>ref|NM_166539.1| Drosophila melanogaster CG2852-RB, transcript variant B (CG2852),
           mRNA
          Length = 759

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 88/103 (85%)
 Strand = Plus / Plus

                                                                       
Query: 250 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 309
           |||||||||||||  |||||||||| |||||   |||||||||  ||||||||| |||||
Sbjct: 166 ctacaagggcagcaagttccaccgcatcatcaaggacttcatgatccagggcggtgactt 225

                                                      
Query: 310 caccaggggcaacggcaccggcggcgagtccatctacggcgag 352
           ||||| |||| |||||||||||||    |||||||||||||||
Sbjct: 226 caccaagggcgacggcaccggcggtcgctccatctacggcgag 268



to top

>ref|NM_137851.2| Drosophila melanogaster CG2852-RA, transcript variant A (CG2852),
           mRNA
          Length = 887

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 88/103 (85%)
 Strand = Plus / Plus

                                                                       
Query: 250 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 309
           |||||||||||||  |||||||||| |||||   |||||||||  ||||||||| |||||
Sbjct: 291 ctacaagggcagcaagttccaccgcatcatcaaggacttcatgatccagggcggtgactt 350

                                                      
Query: 310 caccaggggcaacggcaccggcggcgagtccatctacggcgag 352
           ||||| |||| |||||||||||||    |||||||||||||||
Sbjct: 351 caccaagggcgacggcaccggcggtcgctccatctacggcgag 393



to top

>gb|AC008350.4|AC008350 Drosophila melanogaster, chromosome 2R, region 58E-59A, BAC clone
             BACR11M08, complete sequence
          Length = 169534

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 88/103 (85%)
 Strand = Plus / Minus

                                                                         
Query: 250   ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 309
             |||||||||||||  |||||||||| |||||   |||||||||  ||||||||| |||||
Sbjct: 41299 ctacaagggcagcaagttccaccgcatcatcaaggacttcatgatccagggcggtgactt 41240

                                                        
Query: 310   caccaggggcaacggcaccggcggcgagtccatctacggcgag 352
             ||||| |||| |||||||||||||    |||||||||||||||
Sbjct: 41239 caccaagggcgacggcaccggcggtcgctccatctacggcgag 41197



to top

>gb|BT021266.1| Drosophila melanogaster RE50843 full insert cDNA
          Length = 898

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 88/103 (85%)
 Strand = Plus / Plus

                                                                       
Query: 250 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 309
           |||||||||||||  |||||||||| |||||   |||||||||  ||||||||| |||||
Sbjct: 291 ctacaagggcagcaagttccaccgcatcatcaaggacttcatgatccagggcggtgactt 350

                                                      
Query: 310 caccaggggcaacggcaccggcggcgagtccatctacggcgag 352
           ||||| |||| |||||||||||||    |||||||||||||||
Sbjct: 351 caccaagggcgacggcaccggcggtcgctccatctacggcgag 393



to top

>gb|AE003458.3| Drosophila melanogaster chromosome 2R, section 66 of 73 of the complete
             sequence
          Length = 302225

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 88/103 (85%)
 Strand = Plus / Minus

                                                                         
Query: 250   ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 309
             |||||||||||||  |||||||||| |||||   |||||||||  ||||||||| |||||
Sbjct: 51781 ctacaagggcagcaagttccaccgcatcatcaaggacttcatgatccagggcggtgactt 51722

                                                        
Query: 310   caccaggggcaacggcaccggcggcgagtccatctacggcgag 352
             ||||| |||| |||||||||||||    |||||||||||||||
Sbjct: 51721 caccaagggcgacggcaccggcggtcgctccatctacggcgag 51679



to top

>gb|AC004377.1|AC004377 Drosophila melanogaster DNA sequence (P1 DS00837 (D87)), complete
             sequence
          Length = 81677

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 88/103 (85%)
 Strand = Plus / Plus

                                                                         
Query: 250   ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 309
             |||||||||||||  |||||||||| |||||   |||||||||  ||||||||| |||||
Sbjct: 12768 ctacaagggcagcaagttccaccgcatcatcaaggacttcatgatccagggcggtgactt 12827

                                                        
Query: 310   caccaggggcaacggcaccggcggcgagtccatctacggcgag 352
             ||||| |||| |||||||||||||    |||||||||||||||
Sbjct: 12828 caccaagggcgacggcaccggcggtcgctccatctacggcgag 12870



to top

>ref|XM_362521.1| Magnaporthe grisea 70-15 hypothetical protein (MG08104.4) partial
           mRNA
          Length = 1131

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 51/54 (94%)
 Strand = Plus / Plus

                                                                 
Query: 316 gggcaacggcaccggcggcgagtccatctacggcgagaagttcgccgacgagaa 369
           ||||||||| |||||||||||||||||||||||||||||||| | |||||||||
Sbjct: 252 gggcaacggtaccggcggcgagtccatctacggcgagaagtttgacgacgagaa 305



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Plus

                                                                       
Query: 188 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctg 247
           |||||||||||||| || || || |||||||||||  | || |||||||||||||| || 
Sbjct: 124 gagaacttccgcgccctgtgtacgggcgagaaggggattggaaagagcggcaagcccctt 183

                       
Query: 248 cactacaagggc 259
           ||||||||||||
Sbjct: 184 cactacaagggc 195



to top

>ref|XM_851866.1| PREDICTED: Canis familiaris similar to Peptidyl-prolyl cis-trans
           isomerase E (PPIase E) (Rotamase E) (Cyclophilin E)
           (Cyclophilin 33), transcript variant 3 (LOC607232), mRNA
          Length = 1159

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 81/94 (86%)
 Strand = Plus / Plus

                                                                       
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
           ||||||||| |||||||| | |||||||||||||||||||| ||||| |    |||||||
Sbjct: 533 ttccaccgcatcatcccccagttcatgtgccagggcggcgatttcacgaaccacaacggc 592

                                             
Query: 326 accggcggcgagtccatctacggcgagaagttcg 359
           ||||| ||| |||||||||||||  |||||||||
Sbjct: 593 accgggggcaagtccatctacgggaagaagttcg 626



to top

>ref|XM_843646.1| PREDICTED: Canis familiaris similar to Peptidyl-prolyl cis-trans
           isomerase E (PPIase E) (Rotamase E) (Cyclophilin E)
           (Cyclophilin 33), transcript variant 2 (LOC607232), mRNA
          Length = 1216

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 81/94 (86%)
 Strand = Plus / Plus

                                                                       
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
           ||||||||| |||||||| | |||||||||||||||||||| ||||| |    |||||||
Sbjct: 590 ttccaccgcatcatcccccagttcatgtgccagggcggcgatttcacgaaccacaacggc 649

                                             
Query: 326 accggcggcgagtccatctacggcgagaagttcg 359
           ||||| ||| |||||||||||||  |||||||||
Sbjct: 650 accgggggcaagtccatctacgggaagaagttcg 683



to top

>ref|XM_467917.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1722

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                        
Query: 182 acggtggagaacttccgcgcgctctgcaccggcgagaagggcgtc 226
           |||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 342 acggcggagaacttccgcgcgctctgcaccggcgagaagggcgtc 386



to top

>emb|BX053495.1|CNS09DFV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31AG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 821

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/121 (85%), Gaps = 3/121 (2%)
 Strand = Plus / Minus

                                                                       
Query: 250 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 309
           |||||||||||||  ||||||||| || |||| ||||||||||  ||||||||| |||||
Sbjct: 475 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 416

                                                                       
Query: 310 caccaggggcaacggcaccggcgg-cgagtccatctacggcgagaagttcgccgacgaga 368
           ||||| |||  ||| ||||||||| ||| || ||||||||||||  ||||||||||||||
Sbjct: 415 caccaagggagacgacaccggcggacga-tcgatctacggcgag-cgttcgccgacgaga 358

            
Query: 369 a 369
           |
Sbjct: 357 a 357



to top

>emb|BX053494.1|CNS09DFU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31AG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 915

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 103/121 (85%), Gaps = 2/121 (1%)
 Strand = Plus / Plus

                                                                       
Query: 250 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 309
           |||||||||||||  ||||||||| || |||| ||||||||||  ||||||||| |||||
Sbjct: 339 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 398

                                                                       
Query: 310 caccaggggcaacggcaccggcgg-cgagtccatctacggcgagaagttcgccgacgaga 368
           ||||| |||  ||| ||||||||| ||| || ||||||||||||   |||||||||||||
Sbjct: 399 caccaagggagacgacaccggcggacga-tcgatctacggcgagcgcttcgccgacgaga 457

            
Query: 369 a 369
           |
Sbjct: 458 a 458



to top

>emb|BX059546.1|CNS09I3Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4BG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 896

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 103/121 (85%), Gaps = 2/121 (1%)
 Strand = Plus / Plus

                                                                       
Query: 250 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 309
           |||||||||||||  ||||||||| || |||| ||||||||||  ||| ||||| |||||
Sbjct: 335 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccaaggcggtgactt 394

                                                                       
Query: 310 caccaggggcaacggcaccggcgg-cgagtccatctacggcgagaagttcgccgacgaga 368
           ||||| |||  ||||||||||||| ||| || ||||||||||||   |||||||||||||
Sbjct: 395 caccaagggagacggcaccggcggacga-tcgatctacggcgagcgcttcgccgacgaga 453

            
Query: 369 a 369
           |
Sbjct: 454 a 454



to top

>emb|BX043476.1|CNS095PK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC16AD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 872

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/121 (85%), Gaps = 3/121 (2%)
 Strand = Plus / Minus

                                                                       
Query: 250 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 309
           |||||||||||||  ||||||||| || |||| ||||||||||  ||||||||| |||||
Sbjct: 475 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 416

                                                                       
Query: 310 caccaggggcaacggcaccggcgg-cgagtccatctacggcgagaagttcgccgacgaga 368
           ||||| |||  ||| ||||||||| ||| || ||||||||||||  ||||||||||||||
Sbjct: 415 caccaagggagacgacaccggcggacga-tcgatctacggcgag-cgttcgccgacgaga 358

            
Query: 369 a 369
           |
Sbjct: 357 a 357



to top

>emb|BX043545.1|CNS095RH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC16BA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 847

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/121 (85%), Gaps = 3/121 (2%)
 Strand = Plus / Minus

                                                                       
Query: 250 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 309
           |||||||||||||  ||||||||| || |||| ||||||||||  ||||||||| |||||
Sbjct: 475 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 416

                                                                       
Query: 310 caccaggggcaacggcaccggcgg-cgagtccatctacggcgagaagttcgccgacgaga 368
           ||||| |||  ||| ||||||||| ||| || ||||||||||||  ||||||||||||||
Sbjct: 415 caccaagggagacgacaccggcggacga-tcgatctacggcgag-cgttcgccgacgaga 358

            
Query: 369 a 369
           |
Sbjct: 357 a 357



to top

>emb|BX043544.1|CNS095RG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC16BA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 992

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 103/121 (85%), Gaps = 2/121 (1%)
 Strand = Plus / Plus

                                                                       
Query: 250 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 309
           |||||||||||||  ||||||||| || |||| ||||||||||  ||||||||| |||||
Sbjct: 358 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 417

                                                                       
Query: 310 caccaggggcaacggcaccggcgg-cgagtccatctacggcgagaagttcgccgacgaga 368
           ||||| |||  ||| ||||||||| ||| || ||||||||||||   |||||||||||||
Sbjct: 418 caccaagggagacgacaccggcggacga-tcgatctacggcgagcgcttcgccgacgaga 476

            
Query: 369 a 369
           |
Sbjct: 477 a 477



to top

>emb|BX025264.1|CNS08RNO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA38CH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 667

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/121 (85%), Gaps = 3/121 (2%)
 Strand = Plus / Minus

                                                                       
Query: 250 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 309
           |||||||||||||  ||||||||| || |||| ||||||||||  ||||||||| |||||
Sbjct: 475 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 416

                                                                       
Query: 310 caccaggggcaacggcaccggcgg-cgagtccatctacggcgagaagttcgccgacgaga 368
           ||||| |||  ||||||||||||| ||| || ||||||||||||   |||||||||||||
Sbjct: 415 caccaagggagacggcaccggcggacga-tcgatctacggcgag-ccttcgccgacgaga 358

            
Query: 369 a 369
           |
Sbjct: 357 a 357



to top

>emb|BX025263.1|CNS08RNN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA38CH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 804

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 103/121 (85%), Gaps = 2/121 (1%)
 Strand = Plus / Plus

                                                                       
Query: 250 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 309
           |||||||||||||  ||||||||| || |||| ||||||||||  ||| ||||| |||||
Sbjct: 326 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccacggcggtgactt 385

                                                                       
Query: 310 caccaggggcaacggcaccggcgg-cgagtccatctacggcgagaagttcgccgacgaga 368
           ||||| |||  ||||||||||||| ||| || ||||||||||||   |||||||||||||
Sbjct: 386 caccaagggagacggcaccggcggacga-tcgatctacggcgagcgcttcgccgacgaga 444

            
Query: 369 a 369
           |
Sbjct: 445 a 445



to top

>gb|DQ122910.1| Chlamydomonas incerta peptidylprolyl isomerase/cyclophilin-like
           protein mRNA, complete cds
          Length = 739

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 74/85 (87%)
 Strand = Plus / Plus

                                                                       
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
           |||||||||||||||    | ||||||  |||||||||||||||||||   |||||||||
Sbjct: 265 ttccaccgcgtcatcaagcagttcatgatccagggcggcgacttcaccgccggcaacggc 324

                                    
Query: 326 accggcggcgagtccatctacggcg 350
           ||||||||| |||||||||||||||
Sbjct: 325 accggcggcaagtccatctacggcg 349



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 46/49 (93%)
 Strand = Plus / Plus

                                                            
Query: 181 gacggtggagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 229
           |||||||||||||||||||||||| ||||| |||||||||||| |||||
Sbjct: 201 gacggtggagaacttccgcgcgctgtgcacgggcgagaagggcttcggc 249



to top

>gb|AF182826.1| Drosophila melanogaster cyclophilin-33 (cyp33) mRNA, complete cds
          Length = 945

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 92/109 (84%)
 Strand = Plus / Plus

                                                                       
Query: 250 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 309
           |||||| ||| |||| ||||||||||| || ||||| || |||||||| |||||||||||
Sbjct: 553 ctacaaaggctgctccttccaccgcgtgatacccgagtttatgtgccaaggcggcgactt 612

                                                            
Query: 310 caccaggggcaacggcaccggcggcgagtccatctacggcgagaagttc 358
           |||||    ||| |||||||||||| |||||||||| ||| | ||||||
Sbjct: 613 caccaacaacaatggcaccggcggcaagtccatctatggcaaaaagttc 661



to top

>dbj|AP004159.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1175_B01
          Length = 96191

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                          
Query: 182   acggtggagaacttccgcgcgctctgcaccggcgagaagggcgtc 226
             |||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 86974 acggcggagaacttccgcgcgctctgcaccggcgagaagggcgtc 87018



to top

>dbj|AP005002.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
            clone:P0486G03
          Length = 146713

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 182  acggtggagaacttccgcgcgctctgcaccggcgagaagggcgtc 226
            |||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 3255 acggcggagaacttccgcgcgctctgcaccggcgagaagggcgtc 3299



to top

>dbj|AK070404.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023054M07, full
           insert sequence
          Length = 1722

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                        
Query: 182 acggtggagaacttccgcgcgctctgcaccggcgagaagggcgtc 226
           |||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 342 acggcggagaacttccgcgcgctctgcaccggcgagaagggcgtc 386



to top

>ref|XM_568796.1| Cryptococcus neoformans var. neoformans JEC21 cyclophilin A
           (CNB01230) partial mRNA
          Length = 620

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 88/104 (84%)
 Strand = Plus / Plus

                                                                       
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
           |||||||| || |||||| | ||||||  |||||| || ||||||||||    |||||||
Sbjct: 202 ttccaccgagtgatcccccagttcatgctccagggtggtgacttcaccaaccacaacggc 261

                                                       
Query: 326 accggcggcgagtccatctacggcgagaagttcgccgacgagaa 369
           || |||||| |||||||||||||| | |||||||||||||||||
Sbjct: 262 actggcggcaagtccatctacggcaacaagttcgccgacgagaa 305



to top

>ref|XM_568801.1| Cryptococcus neoformans var. neoformans JEC21 cyclophilin A
           (CNB01290) partial mRNA
          Length = 591

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 88/104 (84%)
 Strand = Plus / Plus

                                                                       
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
           |||||||| || |||||| | ||||||  |||||| || ||||||||||    |||||||
Sbjct: 253 ttccaccgagtgatcccccagttcatgctccagggtggtgacttcaccaaccacaacggc 312

                                                       
Query: 326 accggcggcgagtccatctacggcgagaagttcgccgacgagaa 369
           || |||||| |||||||||||||| | |||||||||||||||||
Sbjct: 313 actggcggcaagtccatctacggcaacaagttcgccgacgagaa 356



to top

>gb|AY232181.1| Drosophila yakuba clone yak-ad_CG2852 mRNA sequence
          Length = 417

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 73/84 (86%)
 Strand = Plus / Plus

                                                                       
Query: 250 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 309
           |||||||||||||  |||||||||| |||||   |||||||||  ||||||||| |||||
Sbjct: 216 ctacaagggcagcaagttccaccgcatcatcaaggacttcatgatccagggcggtgactt 275

                                   
Query: 310 caccaggggcaacggcaccggcgg 333
           ||||| |||| |||||||||||||
Sbjct: 276 caccaagggcgacggcaccggcgg 299



to top

>emb|AJ417659.1|POS417659 Pleurotus ostreatus partial mRNA for putative cyclophilin (cpa1
           gene)
          Length = 595

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 79/92 (85%)
 Strand = Plus / Plus

                                                                       
Query: 302 ggcgacttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaagttcgcc 361
           ||||||||||||| |||||||||||| |||||  ||||||||||||| ||||| ||||| 
Sbjct: 195 ggcgacttcaccaagggcaacggcactggcggaaagtccatctacggagagaaattcgca 254

                                           
Query: 362 gacgagaagttcgtccacaagcacaccaagcc 393
           |||||||| |||   |  ||||||||||||||
Sbjct: 255 gacgagaacttccagcttaagcacaccaagcc 286



to top

>gb|U68268.1|TCU68268 Trypanosoma congolense cyclophilin A (cypA) mRNA, complete cds
          Length = 1179

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 79/92 (85%)
 Strand = Plus / Plus

                                                                       
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
           ||||| ||| |||||||| |||||||||||||||| |||||||||||  |   |||||||
Sbjct: 277 ttccatcgcatcatccccaacttcatgtgccagggtggcgacttcactcgtcacaacggc 336

                                           
Query: 326 accggcggcgagtccatctacggcgagaagtt 357
           || |||||| | || |||||||||||||||||
Sbjct: 337 acgggcggcaaatctatctacggcgagaagtt 368



 Score = 48.1 bits (24), Expect = 0.022
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 167 gacgcggtgccgaggacggtggagaacttccgcgcgctctgcac 210
           ||||| ||||||| ||| | |||||||||||||||||| |||||
Sbjct: 199 gacgccgtgccgaagaccgcggagaacttccgcgcgctgtgcac 242



to top

>gb|AF025804.1|AF025804 Drosophila subobscura cyclophilin 1 (Cyp1) mRNA, partial cds
          Length = 471

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 88/104 (84%)
 Strand = Plus / Plus

                                                                       
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
           ||||| ||||| || ||| ||||||||||||| || || ||||||||||    |||||||
Sbjct: 160 ttccatcgcgttattcccaacttcatgtgccaaggaggtgacttcaccaaccacaacggc 219

                                                       
Query: 326 accggcggcgagtccatctacggcgagaagttcgccgacgagaa 369
           || |||||| |||||||||||||| | ||||||||||| |||||
Sbjct: 220 actggcggcaagtccatctacggcaacaagttcgccgatgagaa 263



to top

>gb|AF158368.1|AF158368 Leishmania donovani cyclophilin (CYP) gene, complete cds
          Length = 945

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 88/104 (84%)
 Strand = Plus / Plus

                                                                       
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
           ||||||||||||||||   ||||||||  ||||||||||||||||||||    | | |||
Sbjct: 483 ttccaccgcgtcatccaaaacttcatgatccagggcggcgacttcaccaacttcgatggc 542

                                                       
Query: 326 accggcggcgagtccatctacggcgagaagttcgccgacgagaa 369
           || |||||| |||| ||||||||||| |||||||| ||||||||
Sbjct: 543 acgggcggcaagtcgatctacggcgaaaagttcgcggacgagaa 586



to top

>gb|AY389742.1| Hyacinthus orientalis cyclophilin mRNA, complete cds
          Length = 681

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 60/67 (89%)
 Strand = Plus / Plus

                                                                       
Query: 95  aacccgaaggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatg 154
           |||||||| ||||||||||||||| || | ||||| || ||||| |||||||||||||||
Sbjct: 54  aacccgaaagtgttcttcgacatgtcgatcggcggggctccggcgggccgcatcgtgatg 113

                  
Query: 155 gagctgt 161
           |||||||
Sbjct: 114 gagctgt 120



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Plus

                                                                       
Query: 287 ttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctac 346
           |||||||||||||||||||||||||||   |||||||| |||||||||||||| || |||
Sbjct: 246 ttcatgtgccagggcggcgacttcaccgccggcaacgggaccggcggcgagtctatatac 305

             
Query: 347 gg 348
           ||
Sbjct: 306 gg 307



 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 34/34 (100%)
 Strand = Plus / Plus

                                             
Query: 188 gagaacttccgcgcgctctgcaccggcgagaagg 221
           ||||||||||||||||||||||||||||||||||
Sbjct: 147 gagaacttccgcgcgctctgcaccggcgagaagg 180



to top

>gb|AY325152.1| Rattus norvegicus Ab1-210 mRNA, complete cds
          Length = 814

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 80/94 (85%)
 Strand = Plus / Plus

                                                                       
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
           ||||||||| |||||||| | ||||||||||||||||| |||||||| |    |||||||
Sbjct: 605 ttccaccgcatcatcccccagttcatgtgccagggcggtgacttcacaaaccacaacggc 664

                                             
Query: 326 accggcggcgagtccatctacggcgagaagttcg 359
           || || ||| |||||||||| ||| |||||||||
Sbjct: 665 acagggggcaagtccatctatggcaagaagttcg 698



to top

>emb|BX072404.1|CNS09S14 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAD1BC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 566

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 41/42 (97%)
 Strand = Plus / Minus

                                                     
Query: 188 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 229
           |||||||||||||||||||||||||||||||||||| |||||
Sbjct: 562 gagaacttccgcgcgctctgcaccggcgagaagggcttcggc 521



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 98/120 (81%)
 Strand = Plus / Minus

                                                                       
Query: 269 caccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggcacc 328
           |||||||| |||||  |||||||||||||||| |||||||||   |    ||||||||||
Sbjct: 502 caccgcgtgatcccgaacttcatgtgccaggggggcgacttccagaaccacaacggcacc 443

                                                                       
Query: 329 ggcggcgagtccatctacggcgagaagttcgccgacgagaagttcgtccacaagcacacc 388
           |||||| | || ||||||||| | |||||||  |||||||| ||| |||  |||||||||
Sbjct: 442 ggcggcaaatcgatctacggcaacaagttcgaggacgagaacttcatcctgaagcacacc 383



to top

>emb|BX069873.1|CNS09Q2T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6CH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 41/42 (97%)
 Strand = Plus / Plus

                                                     
Query: 188 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 229
           |||||||||||||||||||||||||||||||||||| |||||
Sbjct: 269 gagaacttccgcgcgctctgcaccggcgagaagggcttcggc 310



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 98/120 (81%)
 Strand = Plus / Plus

                                                                       
Query: 269 caccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggcacc 328
           |||||||| |||||  |||||||||||||||| |||||||||   |    ||||||||||
Sbjct: 329 caccgcgtgatcccgaacttcatgtgccaggggggcgacttccagaaccacaacggcacc 388

                                                                       
Query: 329 ggcggcgagtccatctacggcgagaagttcgccgacgagaagttcgtccacaagcacacc 388
           |||||| | || ||||||||| | |||||||  |||||||| ||| |||  |||||||||
Sbjct: 389 ggcggcaaatcgatctacggcaacaagttcgaggacgagaacttcatcctgaagcacacc 448



to top

>emb|BX057302.1|CNS09GDM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37AG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 564

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 41/42 (97%)
 Strand = Plus / Plus

                                                     
Query: 188 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 229
           |||||||||||||||||||||||||||||||||||| |||||
Sbjct: 258 gagaacttccgcgcgctctgcaccggcgagaagggcttcggc 299



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 98/120 (81%)
 Strand = Plus / Plus

                                                                       
Query: 269 caccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggcacc 328
           |||||||| |||||  |||||||||||||||| |||||||||   |    ||||||||||
Sbjct: 318 caccgcgtgatcccgaacttcatgtgccaggggggcgacttccagaaccacaacggcacc 377

                                                                       
Query: 329 ggcggcgagtccatctacggcgagaagttcgccgacgagaagttcgtccacaagcacacc 388
           |||||| | || ||||||||| | |||||||  |||||||| ||| |||  |||||||||
Sbjct: 378 ggcggcaaatcgatctacggcaacaagttcgaggacgagaacttcatcctgaagcacacc 437



to top

>emb|BX050608.1|CNS09B7O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC27AG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 504

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 41/42 (97%)
 Strand = Plus / Plus

                                                     
Query: 188 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 229
           |||||||||||||||||||||||||||||||||||| |||||
Sbjct: 243 gagaacttccgcgcgctctgcaccggcgagaagggcttcggc 284



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 98/120 (81%)
 Strand = Plus / Plus

                                                                       
Query: 269 caccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggcacc 328
           |||||||| |||||  |||||||||||||||| |||||||||   |    ||||||||||
Sbjct: 303 caccgcgtgatcccgaacttcatgtgccaggggggcgacttccagaaccacaacggcacc 362

                                                                       
Query: 329 ggcggcgagtccatctacggcgagaagttcgccgacgagaagttcgtccacaagcacacc 388
           |||||| | || ||||||||| | |||||||  |||||||| ||| |||  |||||||||
Sbjct: 363 ggcggcaaatcgatctacggcaacaagttcgaggacgagaacttcatcctgaagcacacc 422



to top

>emb|BX046149.1|CNS097RT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2CF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 817

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 41/42 (97%)
 Strand = Plus / Plus

                                                     
Query: 188 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 229
           |||||||||||||||||||||||||||||||||||| |||||
Sbjct: 267 gagaacttccgcgcgctctgcaccggcgagaagggcttcggc 308



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 269 caccgcgtcatccccgacttcatgtgccagggcggcgacttc 310
           |||||||| |||||  |||||||||||||||| |||||||||
Sbjct: 327 caccgcgtgatcccgaacttcatgtgccaggggggcgacttc 368



to top

>emb|BX036923.1|CNS090NJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9AF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1022

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 41/42 (97%)
 Strand = Plus / Plus

                                                     
Query: 188 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 229
           |||||||||||||||||||||||||||||||||||| |||||
Sbjct: 289 gagaacttccgcgcgctctgcaccggcgagaagggcttcggc 330



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 59/70 (84%)
 Strand = Plus / Plus

                                                                       
Query: 319 caacggcaccggcggcgagtccatctacggcgagaagttcgccgacgagaagttcgtcca 378
           |||||||||||||||| | || ||||||||| | |||||||  |||||||| ||| ||| 
Sbjct: 399 caacggcaccggcggcaaatcgatctacggcaacaagttcgaggacgagaacttcatcct 458

                     
Query: 379 caagcacacc 388
            |||||||||
Sbjct: 459 gaagcacacc 468



to top

>emb|BX024694.1|CNS08R7U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37DC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 265

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 41/42 (97%)
 Strand = Plus / Plus

                                                     
Query: 188 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 229
           |||||||||||||||||||||||||||||||||||| |||||
Sbjct: 155 gagaacttccgcgcgctctgcaccggcgagaagggcttcggc 196



to top

>emb|BX016404.1|CNS08KTK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24CE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 859

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 41/42 (97%)
 Strand = Plus / Plus

                                                     
Query: 188 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 229
           |||||||||||||||||||||||||||||||||||| |||||
Sbjct: 287 gagaacttccgcgcgctctgcaccggcgagaagggcttcggc 328



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 98/120 (81%)
 Strand = Plus / Plus

                                                                       
Query: 269 caccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggcacc 328
           |||||||| |||||  |||||||||||||||| |||||||||   |    ||||||||||
Sbjct: 347 caccgcgtgatcccgaacttcatgtgccaggggggcgacttccagaaccacaacggcacc 406

                                                                       
Query: 329 ggcggcgagtccatctacggcgagaagttcgccgacgagaagttcgtccacaagcacacc 388
           |||||| | || ||||||||| | |||||||  |||||||| ||| |||  |||||||||
Sbjct: 407 ggcggcaaatcgatctacggcaacaagttcgaggacgagaacttcatcctgaagcacacc 466



to top

>emb|BX014873.1|CNS08JN1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA22BE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 796

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 41/42 (97%)
 Strand = Plus / Plus

                                                     
Query: 188 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 229
           |||||||||||||||||||||||||||||||||||| |||||
Sbjct: 276 gagaacttccgcgcgctctgcaccggcgagaagggcttcggc 317



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 98/120 (81%)
 Strand = Plus / Plus

                                                                       
Query: 269 caccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggcacc 328
           |||||||| |||||  |||||||||||||||| |||||||||   |    ||||||||||
Sbjct: 336 caccgcgtgatcccgaacttcatgtgccaggggggcgacttccagaaccacaacggcacc 395

                                                                       
Query: 329 ggcggcgagtccatctacggcgagaagttcgccgacgagaagttcgtccacaagcacacc 388
           |||||| | || ||||||||| | |||||||  |||||||| ||| |||  |||||||||
Sbjct: 396 ggcggcaaatcgatctacggcaacaagttcgaggacgagaacttcatcctgaagcacacc 455



to top

>emb|BX013233.1|CNS08IDH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA2DG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 492

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 41/42 (97%)
 Strand = Plus / Plus

                                                     
Query: 188 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 229
           |||||||||||||||||||||||||||||||||||| |||||
Sbjct: 271 gagaacttccgcgcgctctgcaccggcgagaagggcttcggc 312



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 98/120 (81%)
 Strand = Plus / Plus

                                                                       
Query: 269 caccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggcacc 328
           |||||||| |||||  |||||||||||||||| |||||||||   |    ||||||||||
Sbjct: 331 caccgcgtgatcccgaacttcatgtgccaggggggcgacttccagaaccacaacggcacc 390

                                                                       
Query: 329 ggcggcgagtccatctacggcgagaagttcgccgacgagaagttcgtccacaagcacacc 388
           |||||| | || ||||||||| | |||||||  |||||||| ||| |||  |||||||||
Sbjct: 391 ggcggcaaatcgatctacggcaacaagttcgaggacgagaacttcatcctgaagcacacc 450



to top

>emb|BX011227.1|CNS08GTR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA17DG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 810

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 41/42 (97%)
 Strand = Plus / Plus

                                                     
Query: 188 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 229
           |||||||||||||||||||||||||||||||||||| |||||
Sbjct: 265 gagaacttccgcgcgctctgcaccggcgagaagggcttcggc 306



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 98/120 (81%)
 Strand = Plus / Plus

                                                                       
Query: 269 caccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggcacc 328
           |||||||| |||||  |||||||||||||||| |||||||||   |    ||||||||||
Sbjct: 325 caccgcgtgatcccgaacttcatgtgccaggggggcgacttccagaaccacaacggcacc 384

                                                                       
Query: 329 ggcggcgagtccatctacggcgagaagttcgccgacgagaagttcgtccacaagcacacc 388
           |||||| | || ||||||||| | |||||||  |||||||| ||| |||  |||||||||
Sbjct: 385 ggcggcaaatcgatctacggcaacaagttcgaggacgagaacttcatcctgaagcacacc 444



to top

>emb|BX008702.1|CNS08EVM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA14BA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 901

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 41/42 (97%)
 Strand = Plus / Plus

                                                     
Query: 188 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 229
           |||||||||||||||||||||||||||||||||||| |||||
Sbjct: 263 gagaacttccgcgcgctctgcaccggcgagaagggcttcggc 304



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 98/120 (81%)
 Strand = Plus / Plus

                                                                       
Query: 269 caccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggcacc 328
           |||||||| |||||  |||||||||||||||| |||||||||   |    ||||||||||
Sbjct: 323 caccgcgtgatcccgaacttcatgtgccaggggggcgacttccagaaccacaacggcacc 382

                                                                       
Query: 329 ggcggcgagtccatctacggcgagaagttcgccgacgagaagttcgtccacaagcacacc 388
           |||||| | || ||||||||| | |||||||  |||||||| ||| |||  |||||||||
Sbjct: 383 ggcggcaaatcgatctacggcaacaagttcgaggacgagaacttcatcctgaagcacacc 442



to top

>emb|BX006580.1|CNS08D8O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA11AE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 957

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 41/42 (97%)
 Strand = Plus / Plus

                                                     
Query: 188 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 229
           |||||||||||||||||||||||||||||||||||| |||||
Sbjct: 263 gagaacttccgcgcgctctgcaccggcgagaagggcttcggc 304



 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 97/120 (80%)
 Strand = Plus / Plus

                                                                       
Query: 269 caccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggcacc 328
           |||||||| |||||  | |||||||||||||| |||||||||   |    ||||||||||
Sbjct: 323 caccgcgtgatcccgaatttcatgtgccaggggggcgacttccagaaccacaacggcacc 382

                                                                       
Query: 329 ggcggcgagtccatctacggcgagaagttcgccgacgagaagttcgtccacaagcacacc 388
           |||||| | || ||||||||| | |||||||  |||||||| ||| |||  |||||||||
Sbjct: 383 ggcggcaaatcgatctacggcaacaagttcgaggacgagaacttcatcctgaagcacacc 442



to top

>gb|AE016814.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome I,
              complete sequence
          Length = 691920

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 47/50 (94%)
 Strand = Plus / Minus

                                                                
Query: 264    cgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacc 313
              |||||||||||||||||||| ||||||||  |||||||||||||||||||
Sbjct: 250067 cgttccaccgcgtcatccccaacttcatgatccagggcggcgacttcacc 250018



to top

>ref|XM_216524.3| PREDICTED: Rattus norvegicus peptidylprolyl isomerase E
           (cyclophilin E) (predicted) (Ppie_predicted), mRNA
          Length = 944

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 80/94 (85%)
 Strand = Plus / Plus

                                                                       
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
           ||||||||| |||||||| | ||||||||||||||||| |||||||| |    |||||||
Sbjct: 602 ttccaccgcatcatcccccagttcatgtgccagggcggtgacttcacaaaccacaacggc 661

                                             
Query: 326 accggcggcgagtccatctacggcgagaagttcg 359
           || || ||| |||||||||| ||| |||||||||
Sbjct: 662 acagggggcaagtccatctatggcaagaagttcg 695



to top

>ref|XM_310632.2| Anopheles gambiae str. PEST ENSANGP00000020778
           (ENSANGG00000018289), mRNA
          Length = 1289

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 41/42 (97%)
 Strand = Plus / Plus

                                                     
Query: 188 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 229
           |||||||||||||||||||||||||||||||||||| |||||
Sbjct: 584 gagaacttccgcgcgctctgcaccggcgagaagggcttcggc 625



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 98/120 (81%)
 Strand = Plus / Plus

                                                                       
Query: 269 caccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggcacc 328
           |||||||| |||||  |||||||||||||||| |||||||||   |    ||||||||||
Sbjct: 644 caccgcgtgatcccgaacttcatgtgccaggggggcgacttccagaaccacaacggcacc 703

                                                                       
Query: 329 ggcggcgagtccatctacggcgagaagttcgccgacgagaagttcgtccacaagcacacc 388
           |||||| | || ||||||||| | |||||||  |||||||| ||| |||  |||||||||
Sbjct: 704 ggcggcaaatcgatctacggcaacaagttcgaggacgagaacttcatcctgaagcacacc 763



to top

>ref|NM_207839.1| Eremothecium gossypii AAL056Cp (AAL056C), mRNA
          Length = 612

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 47/50 (94%)
 Strand = Plus / Plus

                                                             
Query: 264 cgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacc 313
           |||||||||||||||||||| ||||||||  |||||||||||||||||||
Sbjct: 218 cgttccaccgcgtcatccccaacttcatgatccagggcggcgacttcacc 267



to top

>ref|XM_586293.2| PREDICTED: Bos taurus similar to Peptidyl-prolyl cis-trans
           isomerase E (PPIase E) (Rotamase E) (Cyclophilin E)
           (Cyclophilin 33) (LOC509352), mRNA
          Length = 2522

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 88/105 (83%)
 Strand = Plus / Plus

                                                                       
Query: 253 caagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcac 312
           ||||||||||   ||||||||| |||||||| | ||||||||||||||||| || |||||
Sbjct: 399 caagggcagcagtttccaccgcatcatcccccagttcatgtgccagggcggtgatttcac 458

                                                        
Query: 313 caggggcaacggcaccggcggcgagtccatctacggcgagaagtt 357
           ||    ||| |||||||| ||| |||||||||||||  |||||||
Sbjct: 459 caaccacaatggcaccgggggcaagtccatctacgggaagaagtt 503



to top

>emb|CR956427.7| Pig DNA sequence from clone CH242-51O7 on chromosome 6, complete sequence
          Length = 187800

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 79/93 (84%)
 Strand = Plus / Plus

                                                                          
Query: 253    caagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcac 312
              ||||||||||   ||||||||| |||||||| | |||||||||||||||||||| |||||
Sbjct: 174628 caagggcagcagcttccaccgcatcatcccccagttcatgtgccagggcggcgatttcac 174687

                                               
Query: 313    caggggcaacggcaccggcggcgagtccatcta 345
              ||    ||||||||| || ||| ||||||||||
Sbjct: 174688 caaccacaacggcactgggggcaagtccatcta 174720



to top

>ref|XM_504296.1| Yarrowia lipolytica CLIB122, YALI0E23155g predicted mRNA
          Length = 687

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 91/109 (83%)
 Strand = Plus / Plus

                                                                       
Query: 285 acttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatct 344
           ||||||||  ||||||||| ||||||||| | ||  ||||||| || |||||||||||||
Sbjct: 260 acttcatgatccagggcggagacttcacccgaggagacggcactggaggcgagtccatct 319

                                                            
Query: 345 acggcgagaagttcgccgacgagaagttcgtccacaagcacaccaagcc 393
           |||||   |||||| |||||||||| |||   | |||||||||||||||
Sbjct: 320 acggccgaaagttccccgacgagaacttccagctcaagcacaccaagcc 368



 Score = 44.1 bits (22), Expect = 0.34
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 185 gtggagaacttccgcgcgctctgcaccggcgaga 218
           |||||||||||||| || || |||||||||||||
Sbjct: 181 gtggagaacttccgagctctgtgcaccggcgaga 214



to top

>emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB 122 of Yarrowia lipolytica
          Length = 4224103

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 91/109 (83%)
 Strand = Plus / Plus

                                                                           
Query: 285     acttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatct 344
               ||||||||  ||||||||| ||||||||| | ||  ||||||| || |||||||||||||
Sbjct: 2719818 acttcatgatccagggcggagacttcacccgaggagacggcactggaggcgagtccatct 2719877

                                                                
Query: 345     acggcgagaagttcgccgacgagaagttcgtccacaagcacaccaagcc 393
               |||||   |||||| |||||||||| |||   | |||||||||||||||
Sbjct: 2719878 acggccgaaagttccccgacgagaacttccagctcaagcacaccaagcc 2719926



 Score = 44.1 bits (22), Expect = 0.34
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                                 
Query: 185     gtggagaacttccgcgcgctctgcaccggcgaga 218
               |||||||||||||| || || |||||||||||||
Sbjct: 2719739 gtggagaacttccgagctctgtgcaccggcgaga 2719772



to top

>gb|DQ440048.1| Aedes aegypti clone AE-296 cyclophylin isoform mRNA, complete cds
          Length = 597

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 99/120 (82%)
 Strand = Plus / Plus

                                                                       
Query: 250 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 309
           |||||||||||||  |||||||||||||||||  |||||||||  ||||||||| |||||
Sbjct: 201 ctacaagggcagcaagttccaccgcgtcatccaggacttcatgatccagggcggtgactt 260

                                                                       
Query: 310 caccaggggcaacggcaccggcggcgagtccatctacggcgagaagttcgccgacgagaa 369
           |||| | ||| | || ||||| |||   || |||||||| |||   ||||||||||||||
Sbjct: 261 cacccgtggcgatggaaccggtggccgctcgatctacggtgagcgcttcgccgacgagaa 320



to top

>gb|AY368274.1| Nicotiana tabacum cyclophilin-like (CYP1) mRNA, complete sequence
          Length = 768

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 60/68 (88%)
 Strand = Plus / Plus

                                                                       
Query: 188 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctg 247
           |||||||||||||| ||||||||||||||||| |||||||| | ||  ||||||||  ||
Sbjct: 130 gagaacttccgcgctctctgcaccggcgagaaaggcgtcggaaggatgggcaagcctttg 189

                   
Query: 248 cactacaa 255
           ||||||||
Sbjct: 190 cactacaa 197



to top

>gb|AY134669.1| Drosophila melanogaster peptidylprolyl cis-trans isomerase mRNA,
           complete cds
          Length = 3177

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 42/44 (95%)
 Strand = Plus / Plus

                                                       
Query: 316 gggcaacggcaccggcggcgagtccatctacggcgagaagttcg 359
           ||||||||||||||||||||||||||||||||||| || |||||
Sbjct: 355 gggcaacggcaccggcggcgagtccatctacggcgggacgttcg 398



to top

>emb|CR715907.2|CNS0GFCF Tetraodon nigroviridis full-length cDNA
          Length = 772

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 81/96 (84%)
 Strand = Plus / Plus

                                                                       
Query: 134 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 193
           ||||| ||||||||||||||||||||  ||   |||| ||| || |  || | |||||||
Sbjct: 110 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 169

                                               
Query: 194 ttccgcgcgctctgcaccggcgagaagggcgtcggc 229
           |||||||| ||||||||||||||||||||| |||||
Sbjct: 170 ttccgcgccctctgcaccggcgagaagggcttcggc 205



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 314
           |||||||||||||||||  | |||||||||||||| || || |||||||
Sbjct: 221 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 269



to top

>emb|CR711184.2|CNS0GBP8 Tetraodon nigroviridis full-length cDNA
          Length = 771

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 81/96 (84%)
 Strand = Plus / Plus

                                                                       
Query: 134 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 193
           ||||| ||||||||||||||||||||  ||   |||| ||| || |  || | |||||||
Sbjct: 110 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 169

                                               
Query: 194 ttccgcgcgctctgcaccggcgagaagggcgtcggc 229
           |||||||| ||||||||||||||||||||| |||||
Sbjct: 170 ttccgcgccctctgcaccggcgagaagggcttcggc 205



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 314
           |||||||||||||||||  | |||||||||||||| || || |||||||
Sbjct: 221 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 269



to top

>emb|CR708069.2|CNS0G9AP Tetraodon nigroviridis full-length cDNA
          Length = 772

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 81/96 (84%)
 Strand = Plus / Plus

                                                                       
Query: 134 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 193
           ||||| ||||||||||||||||||||  ||   |||| ||| || |  || | |||||||
Sbjct: 110 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 169

                                               
Query: 194 ttccgcgcgctctgcaccggcgagaagggcgtcggc 229
           |||||||| ||||||||||||||||||||| |||||
Sbjct: 170 ttccgcgccctctgcaccggcgagaagggcttcggc 205



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 314
           |||||||||||||||||  | |||||||||||||| || || |||||||
Sbjct: 221 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 269



to top

>emb|CR706426.2|CNS0G812 Tetraodon nigroviridis full-length cDNA
          Length = 773

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 81/96 (84%)
 Strand = Plus / Plus

                                                                       
Query: 134 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 193
           ||||| ||||||||||||||||||||  ||   |||| ||| || |  || | |||||||
Sbjct: 109 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 168

                                               
Query: 194 ttccgcgcgctctgcaccggcgagaagggcgtcggc 229
           |||||||| ||||||||||||||||||||| |||||
Sbjct: 169 ttccgcgccctctgcaccggcgagaagggcttcggc 204



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 314
           |||||||||||||||||  | |||||||||||||| || || |||||||
Sbjct: 220 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 268



to top

>emb|AJ011956.1|MFU011956 Malassezia sympodialis mRNA for allergen Mal s 6, strain ATCC no.
           42132
          Length = 573

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
           |||||||| || ||||| ||||| |||  |||||| || |||||||||   |||||||||
Sbjct: 166 ttccaccgtgtgatccctgactttatgctccagggtggtgacttcaccgctggcaacggc 225

                                                       
Query: 326 accggcggcgagtccatctacggcgagaagttcgccgacgagaa 369
           || |||||| |||| ||||||||||  |||||||| ||||||||
Sbjct: 226 acgggcggcaagtcgatctacggcgccaagttcgctgacgagaa 269



 Score = 46.1 bits (23), Expect = 0.085
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 191 aacttccgcgcgctctgcaccggcgagaagggcgtcggc 229
           |||||||| || |||||||| |||||||||||| |||||
Sbjct: 112 aacttccgtgctctctgcactggcgagaagggcttcggc 150



to top

>gb|AY346337.1| Branchiostoma belcheri tsingtaunese cyclophilin A mRNA, complete
           cds
          Length = 1358

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 72/84 (85%)
 Strand = Plus / Plus

                                                                       
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
           |||||||||||||| || | ||||||||||||||| || ||||||| ||||||  | |||
Sbjct: 232 ttccaccgcgtcattcctggcttcatgtgccagggaggtgacttcatcaggggagatggc 291

                                   
Query: 326 accggcggcgagtccatctacggc 349
           ||||||||| ||  ||||||||||
Sbjct: 292 accggcggcaagagcatctacggc 315



to top

>emb|AJ238310.1|LRU238310 Lumbricus rubellus mRNA for cyclophilin A
          Length = 1158

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 63/72 (87%)
 Strand = Plus / Plus

                                                                       
Query: 287 ttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctac 346
           ||||||||||||||||| |||||||||| |||| |||||||||| ||  ||  |||||||
Sbjct: 277 ttcatgtgccagggcggtgacttcaccaagggcgacggcaccggtggaaagagcatctac 336

                       
Query: 347 ggcgagaagttc 358
           || |||||||||
Sbjct: 337 ggagagaagttc 348



to top

>emb|CR938346.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YC07AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 845

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 99/120 (82%)
 Strand = Plus / Plus

                                                                       
Query: 250 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 309
           |||||||||||||  |||||||||||||||||  |||||||||  ||||||||| |||||
Sbjct: 371 ctacaagggcagcaagttccaccgcgtcatccaggacttcatgatccagggcggtgactt 430

                                                                       
Query: 310 caccaggggcaacggcaccggcggcgagtccatctacggcgagaagttcgccgacgagaa 369
           |||| | ||| | || ||||| |||   || |||||||| |||   ||||||||||||||
Sbjct: 431 cacccgtggcgatggaaccggtggccgctcgatctacggtgagtgcttcgccgacgagaa 490



to top

>emb|CR938040.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YM12AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 862

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 99/120 (82%)
 Strand = Plus / Plus

                                                                       
Query: 250 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 309
           |||||||||||||  |||||||||||||||||  |||||||||  ||||||||| |||||
Sbjct: 388 ctacaagggcagcaagttccaccgcgtcatccaggacttcatgatccagggcggtgactt 447

                                                                       
Query: 310 caccaggggcaacggcaccggcggcgagtccatctacggcgagaagttcgccgacgagaa 369
           |||| | ||| | || ||||| |||   || |||||||| |||   ||||||||||||||
Sbjct: 448 cacccgtggcgatggaaccggtggccgctcgatctacggtgagcgcttcgccgacgagaa 507



to top

>ref|NM_170367.1| Drosophila melanogaster Moca-cyp CG1866-RA, transcript variant A
           (Moca-cyp), mRNA
          Length = 3162

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 42/44 (95%)
 Strand = Plus / Plus

                                                       
Query: 316 gggcaacggcaccggcggcgagtccatctacggcgagaagttcg 359
           ||||||||||||||||||||||||||||||||||| || |||||
Sbjct: 355 gggcaacggcaccggcggcgagtccatctacggcgggacgttcg 398



to top

>ref|NM_143361.3| Drosophila melanogaster Moca-cyp CG1866-RB, transcript variant B
           (Moca-cyp), mRNA
          Length = 3705

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 42/44 (95%)
 Strand = Plus / Plus

                                                       
Query: 316 gggcaacggcaccggcggcgagtccatctacggcgagaagttcg 359
           ||||||||||||||||||||||||||||||||||| || |||||
Sbjct: 340 gggcaacggcaccggcggcgagtccatctacggcgggacgttcg 383



to top

>gb|AY051595.1| Drosophila melanogaster GH23813 full length cDNA
          Length = 3726

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 42/44 (95%)
 Strand = Plus / Plus

                                                       
Query: 316 gggcaacggcaccggcggcgagtccatctacggcgagaagttcg 359
           ||||||||||||||||||||||||||||||||||| || |||||
Sbjct: 340 gggcaacggcaccggcggcgagtccatctacggcgggacgttcg 383



to top

>gb|AC009345.7|AC009345 Drosophila melanogaster, chromosome 3R, region 98C-98C, BAC clone
              BACR28F20, complete sequence
          Length = 158895

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 42/44 (95%)
 Strand = Plus / Plus

                                                          
Query: 316    gggcaacggcaccggcggcgagtccatctacggcgagaagttcg 359
              ||||||||||||||||||||||||||||||||||| || |||||
Sbjct: 131821 gggcaacggcaccggcggcgagtccatctacggcgggacgttcg 131864



to top

>gb|AC008028.3|AC008028 Drosophila melanogaster, chromosome 3R, region 98C-98D, BAC clone
             BACR14L13, complete sequence
          Length = 197348

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 42/44 (95%)
 Strand = Plus / Plus

                                                         
Query: 316   gggcaacggcaccggcggcgagtccatctacggcgagaagttcg 359
             ||||||||||||||||||||||||||||||||||| || |||||
Sbjct: 35036 gggcaacggcaccggcggcgagtccatctacggcgggacgttcg 35079



to top

>gb|AE003765.3| Drosophila melanogaster chromosome 3R, section 103 of 118 of the
             complete sequence
          Length = 239049

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 42/44 (95%)
 Strand = Plus / Plus

                                                         
Query: 316   gggcaacggcaccggcggcgagtccatctacggcgagaagttcg 359
             ||||||||||||||||||||||||||||||||||| || |||||
Sbjct: 10715 gggcaacggcaccggcggcgagtccatctacggcgggacgttcg 10758



to top

>gb|BT001578.1| Drosophila melanogaster RE23622 full insert cDNA
          Length = 3180

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 42/44 (95%)
 Strand = Plus / Plus

                                                       
Query: 316 gggcaacggcaccggcggcgagtccatctacggcgagaagttcg 359
           ||||||||||||||||||||||||||||||||||| || |||||
Sbjct: 355 gggcaacggcaccggcggcgagtccatctacggcgggacgttcg 398



to top

>gb|M55018.1|BNACYP Brassica napus cyclophilin (CyP) mRNA, 3' end
          Length = 661

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 198/252 (78%)
 Strand = Plus / Plus

                                                                       
Query: 137 gccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaacttc 196
           ||||||||||||||||||||||| |||   ||| | || ||   |||||  |||||||||
Sbjct: 40  gccggccgcatcgtgatggagctttacgccgacacagtccccgagacggccgagaacttc 99

                                                                       
Query: 197 cgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctgcactacaag 256
           || || ||||||||||||||||  ||  |||||||   ||| ||||| || |||||||||
Sbjct: 100 cgtgctctctgcaccggcgagagaggaatcggcaaatccggaaagccactccactacaag 159

                                                                       
Query: 257 ggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccagg 316
           |||    | ||||||||||| |||||| | ||||||||||| || || || ||||||   
Sbjct: 160 ggctcggctttccaccgcgtgatccccaagttcatgtgccaaggaggagatttcaccgcc 219

                                                                       
Query: 317 ggcaacggcaccggcggcgagtccatctacggcgagaagttcgccgacgagaagttcgtc 376
           || ||||| || || || ||||| |||||||||  |||||||   |||||||| || |||
Sbjct: 220 gggaacggaacgggaggagagtcgatctacggcatgaagttcaaagacgagaactttgtc 279

                       
Query: 377 cacaagcacacc 388
            | |||||||||
Sbjct: 280 aagaagcacacc 291



to top

>gb|AY150052.1| Kandelia candel cyclophilin (Cyp1) mRNA, complete cds
          Length = 884

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 148/183 (80%), Gaps = 2/183 (1%)
 Strand = Plus / Plus

                                                                       
Query: 188 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctg 247
           |||||||||||||| ||||| ||||||||||||||    || | ||| || ||||| || 
Sbjct: 124 gagaacttccgcgccctctgtaccggcgagaagggaaaagggaggagtgggaagcctctc 183

                                                                       
Query: 248 cactacaagggcagct-cgttccaccgcgtcatccccgacttcatgtgccagggcggcga 306
           ||||| ||||| | || | |||||||  || |||||| ||||||||||||||||||| ||
Sbjct: 184 cactataaggg-atctaccttccaccttgtaatccccaacttcatgtgccagggcggaga 242

                                                                       
Query: 307 cttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaagttcgccgacga 366
           |||||||   || ||||  ||||| |||||||| ||||||||   |||||| ||||| ||
Sbjct: 243 cttcaccgccggaaacgaaaccggaggcgagtcgatctacggatcgaagtttgccgatga 302

              
Query: 367 gaa 369
           |||
Sbjct: 303 gaa 305



to top

>gb|AE017342.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 2, complete
              sequence
          Length = 1632307

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                                 
Query: 319    caacggcaccggcggcgagtccatctacggcgagaagttcgccgacgagaa 369
              ||||||||| |||||| |||||||||||||| | |||||||||||||||||
Sbjct: 394434 caacggcactggcggcaagtccatctacggcaacaagttcgccgacgagaa 394484



 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                                 
Query: 319    caacggcaccggcggcgagtccatctacggcgagaagttcgccgacgagaa 369
              ||||||||| |||||| |||||||||||||| | |||||||||||||||||
Sbjct: 372716 caacggcactggcggcaagtccatctacggcaacaagttcgccgacgagaa 372666



to top

>gb|AF333997.1|AF333997 Filobasidiella neoformans var. neoformans cyclophilin A (CPA2)
           gene, complete cds
          Length = 762

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 319 caacggcaccggcggcgagtccatctacggcgagaagttcgccgacgagaa 369
           ||||||||| |||||| |||||||||||||| | |||||||||||||||||
Sbjct: 427 caacggcactggcggcaagtccatctacggcaacaagttcgccgacgagaa 477



to top

>gb|AF333996.1|AF333996 Filobasidiella neoformans var. neoformans cyclophilin A (CPA1)
           gene, complete cds
          Length = 716

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 319 caacggcaccggcggcgagtccatctacggcgagaagttcgccgacgagaa 369
           ||||||||| |||||| |||||||||||||| | |||||||||||||||||
Sbjct: 381 caacggcactggcggcaagtccatctacggcaacaagttcgccgacgagaa 431



to top

>gb|CP000081.1| Leishmania major chromosome 35, complete sequence
          Length = 2090491

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 79/94 (84%)
 Strand = Plus / Plus

                                                                           
Query: 266     ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
               |||||||| |||||||| | ||| |||   |||||||| |||||||||| |  |||||||
Sbjct: 1868078 ttccaccgtgtcatcccgggctttatgattcagggcggagacttcaccaagcacaacggc 1868137

                                                 
Query: 326     accggcggcgagtccatctacggcgagaagttcg 359
               ||||||||||  || |||||||||||||| ||||
Sbjct: 1868138 accggcggcgtctctatctacggcgagaaattcg 1868171



to top

>ref|XM_838488.1| Leishmania major strain Friedlin peptidyl-prolyl cis-trans
           isomerase (cyclophilin-40) (LMJ_1407) partial mRNA
          Length = 1065

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 79/94 (84%)
 Strand = Plus / Plus

                                                                       
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
           |||||||| |||||||| | ||| |||   |||||||| |||||||||| |  |||||||
Sbjct: 187 ttccaccgtgtcatcccgggctttatgattcagggcggagacttcaccaagcacaacggc 246

                                             
Query: 326 accggcggcgagtccatctacggcgagaagttcg 359
           ||||||||||  || |||||||||||||| ||||
Sbjct: 247 accggcggcgtctctatctacggcgagaaattcg 280



to top

>emb|Z48002.1|TNCYCABPR T.niveum gene for cyclophilin A-binding protein
          Length = 1750

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 40/42 (95%)
 Strand = Plus / Plus

                                                     
Query: 188 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 229
           |||||||||||||| ||||||||||||||||||||| |||||
Sbjct: 764 gagaacttccgcgctctctgcaccggcgagaagggcttcggc 805



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 323 ggcaccggcggcgagtccatctacggcgagaagttcgccgacgagaa 369
           ||||| |||||| |||||||||||||||||||||| ||||| |||||
Sbjct: 936 ggcactggcggcaagtccatctacggcgagaagtttgccgatgagaa 982



 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                           
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacc 313
           ||||||||  |||||||||| ||||||  |||||||||||||||||||
Sbjct: 821 ttccaccgtatcatccccgagttcatgctccagggcggcgacttcacc 868



to top

>emb|Z32674.1|TNCPTAG T.niveum (ATCC34921) cptA gene for cyclophilin
          Length = 1488

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 40/42 (95%)
 Strand = Plus / Plus

                                                     
Query: 188 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 229
           |||||||||||||| ||||||||||||||||||||| |||||
Sbjct: 878 gagaacttccgcgctctctgcaccggcgagaagggcttcggc 919



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                           
Query: 323  ggcaccggcggcgagtccatctacggcgagaagttcgccgacgagaa 369
            ||||| |||||| |||||||||||||||||||||| ||||| |||||
Sbjct: 1050 ggcactggcggcaagtccatctacggcgagaagtttgccgatgagaa 1096



 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                           
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacc 313
           ||||||||  |||||||||| ||||||  |||||||||||||||||||
Sbjct: 935 ttccaccgtatcatccccgagttcatgctccagggcggcgacttcacc 982



to top

>emb|X74403.1|PVCYCGNA P.vulgaris gene for cyclophilin
          Length = 969

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 162/202 (80%), Gaps = 2/202 (0%)
 Strand = Plus / Plus

                                                                       
Query: 188 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctg 247
           |||||||||||||| || |||||||| |||||||| |||||    |||||||||||  | 
Sbjct: 318 gagaacttccgcgccctttgcaccggtgagaagggagtcggtcgcagcggcaagcccgtc 377

                                                                       
Query: 248 cactacaagggca-gctcgttccaccgcgtcatccccgacttcatgtgccagggcggcga 306
           |||| ||||||   | || ||||| || || |||||  ||||||||||||||||||| ||
Sbjct: 378 cacttcaagggatcgatc-ttccatcgtgtgatccctaacttcatgtgccagggcggtga 436

                                                                       
Query: 307 cttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaagttcgccgacga 366
           ||| ||    || ||||| || || |||||||| ||||||||||  |||||||| |||||
Sbjct: 437 ctttactgccggaaacggtacaggaggcgagtcgatctacggcgccaagttcgcagacga 496

                                 
Query: 367 gaagttcgtccacaagcacacc 388
           ||| |||||  | |||||||||
Sbjct: 497 gaacttcgtgaagaagcacacc 518



to top

>dbj|AB254820.1| Cryptomeria japonica mRNA for putative peptidyl-prolyl cis-trans
           isomerase, complete cds
          Length = 793

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 93/113 (82%)
 Strand = Plus / Plus

                                                                       
Query: 236 ggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgc 295
           |||||||| || |||| |||||||  ||| |||||||| |||||||| | ||| ||||||
Sbjct: 212 ggcaagccccttcacttcaagggctcctccttccaccgggtcatccctggctttatgtgc 271

                                                                
Query: 296 cagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctacgg 348
           |||||||| ||||| ||    || || ||||||||||| |||||||| |||||
Sbjct: 272 cagggcggtgactttactgctggaaatggcaccggcggtgagtccatttacgg 324



to top

>ref|NM_079049.2| Drosophila melanogaster cyclophilin-33 CG4886-RA (cyp33), mRNA
          Length = 1317

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 90/109 (82%)
 Strand = Plus / Plus

                                                                        
Query: 250  ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 309
            |||||| ||| |||| ||||||||||| || ||||| || ||||| || || ||||||||
Sbjct: 943  ctacaaaggctgctccttccaccgcgtgatacccgagtttatgtgtcaaggaggcgactt 1002

                                                             
Query: 310  caccaggggcaacggcaccggcggcgagtccatctacggcgagaagttc 358
            |||||    ||| |||||||||||| |||||||||| ||| | ||||||
Sbjct: 1003 caccaacaacaatggcaccggcggcaagtccatctatggcaaaaagttc 1051



to top

>gb|AY061421.1| Drosophila melanogaster LD35248 full length cDNA
          Length = 946

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 90/109 (82%)
 Strand = Plus / Plus

                                                                       
Query: 250 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 309
           |||||| ||| |||| ||||||||||| || ||||| || ||||| || || ||||||||
Sbjct: 553 ctacaaaggctgctccttccaccgcgtgatacccgagtttatgtgtcaaggaggcgactt 612

                                                            
Query: 310 caccaggggcaacggcaccggcggcgagtccatctacggcgagaagttc 358
           |||||    ||| |||||||||||| |||||||||| ||| | ||||||
Sbjct: 613 caccaacaacaatggcaccggcggcaagtccatctatggcaaaaagttc 661



to top

>ref|NM_194920.1| Oryza sativa (japonica cultivar-group) putative cyclophilin
           (OSJNAa0034B05.5), mRNA
          Length = 546

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 65/76 (85%)
 Strand = Plus / Plus

                                                                       
Query: 264 cgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacg 323
           |||||||||||||  | ||||  ||||||||||||||||||||| ||||    || ||||
Sbjct: 197 cgttccaccgcgtggtgcccgggttcatgtgccagggcggcgacatcacggccgggaacg 256

                           
Query: 324 gcaccggcggcgagtc 339
           ||||||||||||||||
Sbjct: 257 gcaccggcggcgagtc 272



to top

>gb|AC091724.3| Oryza sativa (japonica cultivar-group) chromosome 10 clone
            OSJNBa0004E08, complete sequence
          Length = 158294

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 65/76 (85%)
 Strand = Plus / Plus

                                                                        
Query: 264  cgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacg 323
            |||||||||||||  | ||||  ||||||||||||||||||||| ||||    || ||||
Sbjct: 8927 cgttccaccgcgtggtgcccgggttcatgtgccagggcggcgacatcacggccgggaacg 8986

                            
Query: 324  gcaccggcggcgagtc 339
            ||||||||||||||||
Sbjct: 8987 gcaccggcggcgagtc 9002



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 57/69 (82%)
 Strand = Plus / Plus

                                                                         
Query: 239   aagccgctgcactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccag 298
             |||||||| ||||||||||||    |||||||||| ||  | ||||  ||||||||||||
Sbjct: 16348 aagccgctccactacaagggctcaacgttccaccgggtggtgcccgggttcatgtgccag 16407

                      
Query: 299   ggcggcgac 307
              ||||||||
Sbjct: 16408 agcggcgac 16416



to top

>ref|XM_676782.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN8605.2), mRNA
          Length = 489

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 86/104 (82%)
 Strand = Plus / Plus

                                                                       
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
           |||||||| ||||| ||| | ||||||  |||||| || ||||||||| |    ||||||
Sbjct: 151 ttccaccgtgtcattccccagttcatgctccagggtggtgacttcacccgccagaacggc 210

                                                       
Query: 326 accggcggcgagtccatctacggcgagaagttcgccgacgagaa 369
           || |||||| ||||||||||||| ||||||||||  ||||||||
Sbjct: 211 actggcggcaagtccatctacggtgagaagttcgaggacgagaa 254



to top

>gb|AF291180.1| Capsicum annuum cyclophilin CACYP1 mRNA, complete cds
          Length = 695

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                           
Query: 181 gacggtggagaacttccgcgcgctctgcaccggcgagaagggcgtcgg 228
           ||||| ||| |||||||| || ||||||||||||||||||||||||||
Sbjct: 125 gacggcggaaaacttccgtgcactctgcaccggcgagaagggcgtcgg 172



to top

>emb|CR720665.2|CNS0GJ0F Tetraodon nigroviridis full-length cDNA
          Length = 786

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 80/96 (83%)
 Strand = Plus / Plus

                                                                       
Query: 134 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 193
           ||||| ||||||||||||||||||||  ||   |||| ||| || |  || | |||||||
Sbjct: 110 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 169

                                               
Query: 194 ttccgcgcgctctgcaccggcgagaagggcgtcggc 229
           |||||||| |||||||| |||||||||||| |||||
Sbjct: 170 ttccgcgccctctgcactggcgagaagggcttcggc 205



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 314
           |||||||||||||||||  | |||||||||||||| || || |||||||
Sbjct: 221 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 269



to top

>emb|CR701424.2|CNS0G464 Tetraodon nigroviridis full-length cDNA
          Length = 783

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 80/96 (83%)
 Strand = Plus / Plus

                                                                       
Query: 134 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 193
           ||||| ||||||||||||||||||||  ||   |||| ||| || |  || | |||||||
Sbjct: 111 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 170

                                               
Query: 194 ttccgcgcgctctgcaccggcgagaagggcgtcggc 229
           |||||||| |||||||| |||||||||||| |||||
Sbjct: 171 ttccgcgccctctgcactggcgagaagggcttcggc 206



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 314
           |||||||||||||||||  | |||||||||||||| || || |||||||
Sbjct: 222 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 270



to top

>emb|CR694759.2|CNS0FZ0Z Tetraodon nigroviridis full-length cDNA
          Length = 782

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 80/96 (83%)
 Strand = Plus / Plus

                                                                       
Query: 134 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 193
           ||||| ||||||||||||||||||||  ||   |||| ||| || |  || | |||||||
Sbjct: 109 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 168

                                               
Query: 194 ttccgcgcgctctgcaccggcgagaagggcgtcggc 229
           |||||||| |||||||| |||||||||||| |||||
Sbjct: 169 ttccgcgccctctgcactggcgagaagggcttcggc 204



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 314
           |||||||||||||||||  | |||||||||||||| || || |||||||
Sbjct: 220 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 268



to top

>emb|CR680608.2|CNS0FO3W Tetraodon nigroviridis full-length cDNA
          Length = 764

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 80/96 (83%)
 Strand = Plus / Plus

                                                                       
Query: 134 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 193
           ||||| ||||||||||||||||||||  ||   |||| ||| || |  || | |||||||
Sbjct: 91  ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 150

                                               
Query: 194 ttccgcgcgctctgcaccggcgagaagggcgtcggc 229
           |||||||| |||||||| |||||||||||| |||||
Sbjct: 151 ttccgcgccctctgcactggcgagaagggcttcggc 186



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 314
           |||||||||||||||||  | |||||||||||||| || || |||||||
Sbjct: 202 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 250



to top

>emb|CR680454.2|CNS0FNZM Tetraodon nigroviridis full-length cDNA
          Length = 776

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 80/96 (83%)
 Strand = Plus / Plus

                                                                       
Query: 134 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 193
           ||||| ||||||||||||||||||||  ||   |||| ||| || |  || | |||||||
Sbjct: 104 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 163

                                               
Query: 194 ttccgcgcgctctgcaccggcgagaagggcgtcggc 229
           |||||||| |||||||| |||||||||||| |||||
Sbjct: 164 ttccgcgccctctgcactggcgagaagggcttcggc 199



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 314
           |||||||||||||||||  | |||||||||||||| || || |||||||
Sbjct: 215 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 263



to top

>emb|CR679705.2|CNS0FNET Tetraodon nigroviridis full-length cDNA
          Length = 769

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 80/96 (83%)
 Strand = Plus / Plus

                                                                       
Query: 134 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 193
           ||||| ||||||||||||||||||||  ||   |||| ||| || |  || | |||||||
Sbjct: 97  ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 156

                                               
Query: 194 ttccgcgcgctctgcaccggcgagaagggcgtcggc 229
           |||||||| |||||||| |||||||||||| |||||
Sbjct: 157 ttccgcgccctctgcactggcgagaagggcttcggc 192



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 314
           |||||||||||||||||  | |||||||||||||| || || |||||||
Sbjct: 208 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 256



to top

>emb|CR679007.2|CNS0FMVF Tetraodon nigroviridis full-length cDNA
          Length = 679

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 80/96 (83%)
 Strand = Plus / Plus

                                                                       
Query: 134 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 193
           ||||| ||||||||||||||||||||  ||   |||| ||| || |  || | |||||||
Sbjct: 7   ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 66

                                               
Query: 194 ttccgcgcgctctgcaccggcgagaagggcgtcggc 229
           |||||||| |||||||| |||||||||||| |||||
Sbjct: 67  ttccgcgccctctgcactggcgagaagggcttcggc 102



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 314
           |||||||||||||||||  | |||||||||||||| || || |||||||
Sbjct: 118 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 166



to top

>emb|CR672286.2|CNS0FHPG Tetraodon nigroviridis full-length cDNA
          Length = 781

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 80/96 (83%)
 Strand = Plus / Plus

                                                                       
Query: 134 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 193
           ||||| ||||||||||||||||||||  ||   |||| ||| || |  || | |||||||
Sbjct: 109 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 168

                                               
Query: 194 ttccgcgcgctctgcaccggcgagaagggcgtcggc 229
           |||||||| |||||||| |||||||||||| |||||
Sbjct: 169 ttccgcgccctctgcactggcgagaagggcttcggc 204



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 314
           |||||||||||||||||  | |||||||||||||| || || |||||||
Sbjct: 220 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 268



to top

>emb|CR664740.2|CNS0FBVU Tetraodon nigroviridis full-length cDNA
          Length = 778

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 80/96 (83%)
 Strand = Plus / Plus

                                                                       
Query: 134 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 193
           ||||| ||||||||||||||||||||  ||   |||| ||| || |  || | |||||||
Sbjct: 106 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 165

                                               
Query: 194 ttccgcgcgctctgcaccggcgagaagggcgtcggc 229
           |||||||| |||||||| |||||||||||| |||||
Sbjct: 166 ttccgcgccctctgcactggcgagaagggcttcggc 201



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 314
           |||||||||||||||||  | |||||||||||||| || || |||||||
Sbjct: 217 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 265



to top

>emb|CR659051.2|CNS0F7HT Tetraodon nigroviridis full-length cDNA
          Length = 782

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 80/96 (83%)
 Strand = Plus / Plus

                                                                       
Query: 134 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 193
           ||||| ||||||||||||||||||||  ||   |||| ||| || |  || | |||||||
Sbjct: 110 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 169

                                               
Query: 194 ttccgcgcgctctgcaccggcgagaagggcgtcggc 229
           |||||||| |||||||| |||||||||||| |||||
Sbjct: 170 ttccgcgccctctgcactggcgagaagggcttcggc 205



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 314
           |||||||||||||||||  | |||||||||||||| || || |||||||
Sbjct: 221 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 269



to top

>emb|CR658192.2|CNS0F6TY Tetraodon nigroviridis full-length cDNA
          Length = 783

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 80/96 (83%)
 Strand = Plus / Plus

                                                                       
Query: 134 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 193
           ||||| ||||||||||||||||||||  ||   |||| ||| || |  || | |||||||
Sbjct: 111 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 170

                                               
Query: 194 ttccgcgcgctctgcaccggcgagaagggcgtcggc 229
           |||||||| |||||||| |||||||||||| |||||
Sbjct: 171 ttccgcgccctctgcactggcgagaagggcttcggc 206



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 314
           |||||||||||||||||  | |||||||||||||| || || |||||||
Sbjct: 222 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 270



to top

>emb|CR653466.2|CNS0F36O Tetraodon nigroviridis full-length cDNA
          Length = 780

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 80/96 (83%)
 Strand = Plus / Plus

                                                                       
Query: 134 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 193
           ||||| ||||||||||||||||||||  ||   |||| ||| || |  || | |||||||
Sbjct: 108 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 167

                                               
Query: 194 ttccgcgcgctctgcaccggcgagaagggcgtcggc 229
           |||||||| |||||||| |||||||||||| |||||
Sbjct: 168 ttccgcgccctctgcactggcgagaagggcttcggc 203



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 314
           |||||||||||||||||  | |||||||||||||| || || |||||||
Sbjct: 219 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 267



to top

>emb|CR650031.2|CNS0F0J9 Tetraodon nigroviridis full-length cDNA
          Length = 781

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 80/96 (83%)
 Strand = Plus / Plus

                                                                       
Query: 134 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 193
           ||||| ||||||||||||||||||||  ||   |||| ||| || |  || | |||||||
Sbjct: 109 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 168

                                               
Query: 194 ttccgcgcgctctgcaccggcgagaagggcgtcggc 229
           |||||||| |||||||| |||||||||||| |||||
Sbjct: 169 ttccgcgccctctgcactggcgagaagggcttcggc 204



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 314
           |||||||||||||||||  | |||||||||||||| || || |||||||
Sbjct: 220 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 268



to top

>emb|CR646067.2|CNS0EXH5 Tetraodon nigroviridis full-length cDNA
          Length = 779

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 80/96 (83%)
 Strand = Plus / Plus

                                                                       
Query: 134 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 193
           ||||| ||||||||||||||||||||  ||   |||| ||| || |  || | |||||||
Sbjct: 108 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 167

                                               
Query: 194 ttccgcgcgctctgcaccggcgagaagggcgtcggc 229
           |||||||| |||||||| |||||||||||| |||||
Sbjct: 168 ttccgcgccctctgcactggcgagaagggcttcggc 203



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 314
           |||||||||||||||||  | |||||||||||||| || || |||||||
Sbjct: 219 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 267



to top

>emb|CR642611.2|CNS0EUT5 Tetraodon nigroviridis full-length cDNA
          Length = 780

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 80/96 (83%)
 Strand = Plus / Plus

                                                                       
Query: 134 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 193
           ||||| ||||||||||||||||||||  ||   |||| ||| || |  || | |||||||
Sbjct: 109 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 168

                                               
Query: 194 ttccgcgcgctctgcaccggcgagaagggcgtcggc 229
           |||||||| |||||||| |||||||||||| |||||
Sbjct: 169 ttccgcgccctctgcactggcgagaagggcttcggc 204



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 314
           |||||||||||||||||  | |||||||||||||| || || |||||||
Sbjct: 220 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 268



to top

>ref|XM_501673.1| Yarrowia lipolytica CLIB122, YALI0C10230g predicted mRNA
          Length = 492

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 86/104 (82%)
 Strand = Plus / Plus

                                                                       
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
           |||||||| ||||||||| | ||||||   ||||| || ||||||||| |   |||||| 
Sbjct: 154 ttccaccgagtcatcccccagttcatgctgcagggtggagacttcacccgacacaacgga 213

                                                       
Query: 326 accggcggcgagtccatctacggcgagaagttcgccgacgagaa 369
           ||||| ||| |||||||||||||||  |||||| ||||||||||
Sbjct: 214 accggaggcaagtccatctacggcgccaagttccccgacgagaa 257



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 188 gagaacttccgcgcgctctgcaccggcgagaagggc 223
           ||||||||||| || || |||||||||||| |||||
Sbjct: 97  gagaacttccgagctctgtgcaccggcgagcagggc 132



to top

>emb|X17692.1|NCCYCGEN Neurospora crassa cyclophilin gene
          Length = 2719

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 47/52 (90%)
 Strand = Plus / Plus

                                                                
Query: 323  ggcaccggcggcgagtccatctacggcgagaagttcgccgacgagaagttcg 374
            ||||| || ||| |||||||||||||||||||||||||||| ||||| ||||
Sbjct: 2080 ggcactggtggcaagtccatctacggcgagaagttcgccgatgagaacttcg 2131



to top

>dbj|AB231814.1| Malassezia slooffiae CYP mRNA for cyclophilin, partial cds
          Length = 486

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 89/108 (82%)
 Strand = Plus / Plus

                                                                       
Query: 262 ctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaa 321
           |||||||||||| || ||||| |||||||||  |||||| || ||||||||   ||||||
Sbjct: 147 ctcgttccaccgtgtgatccctgacttcatgctccagggtggtgacttcactgcgggcaa 206

                                                           
Query: 322 cggcaccggcggcgagtccatctacggcgagaagttcgccgacgagaa 369
           ||||||||| ||| ||  ||||||||| |  |||||| | ||||||||
Sbjct: 207 cggcaccggtggcaagagcatctacggtgccaagttcccggacgagaa 254



 Score = 46.1 bits (23), Expect = 0.085
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 187 ggagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 229
           |||||||||||| ||||| ||||| || ||||||||| |||||
Sbjct: 93  ggagaacttccgtgcgctgtgcactggtgagaagggcttcggc 135



to top

>dbj|AB231813.1| Malassezia restricta CYP mRNA for cyclophilin, partial cds
          Length = 486

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 86/104 (82%)
 Strand = Plus / Plus

                                                                       
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
           |||||||| || ||||| ||||| |||  |||||| || |||||||||   |||||||| 
Sbjct: 151 ttccaccgtgtgatccctgactttatgctccagggtggtgacttcaccgccggcaacggt 210

                                                       
Query: 326 accggcggcgagtccatctacggcgagaagttcgccgacgagaa 369
           ||||| ||| |||| |||||||| |  |||||||||||||||||
Sbjct: 211 accggtggcaagtcgatctacggtgccaagttcgccgacgagaa 254



 Score = 48.1 bits (24), Expect = 0.022
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 190 gaacttccgcgcgctctgcaccggcgagaagggcgtcggc 229
           ||||||||| || |||||||| |||||||||||| |||||
Sbjct: 96  gaacttccgtgccctctgcacgggcgagaagggcttcggc 135



to top

>gb|AC122145.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone
             OSJNAa0034B05, complete sequence
          Length = 125655

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 65/76 (85%)
 Strand = Plus / Plus

                                                                         
Query: 264   cgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacg 323
             |||||||||||||  | ||||  ||||||||||||||||||||| ||||    || ||||
Sbjct: 74582 cgttccaccgcgtggtgcccgggttcatgtgccagggcggcgacatcacggccgggaacg 74641

                             
Query: 324   gcaccggcggcgagtc 339
             ||||||||||||||||
Sbjct: 74642 gcaccggcggcgagtc 74657



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 57/69 (82%)
 Strand = Plus / Plus

                                                                         
Query: 239   aagccgctgcactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccag 298
             |||||||| ||||||||||||    |||||||||| ||  | ||||  ||||||||||||
Sbjct: 82003 aagccgctccactacaagggctcaacgttccaccgggtggtgcccgggttcatgtgccag 82062

                      
Query: 299   ggcggcgac 307
              ||||||||
Sbjct: 82063 agcggcgac 82071



to top

>gb|AF096318.1|AF096318 Aspergillus niger cyclophilin-like peptidyl prolyl cis-trans
            isomerase (cypA) gene, complete cds
          Length = 1600

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                    
Query: 338  tccatctacggcgagaagttcgccgacgagaagttcgtccacaagcacaccaagcc 393
            ||||||||||| |||||||||||||| ||||| ||| || ||||||||| ||||||
Sbjct: 1051 tccatctacggtgagaagttcgccgatgagaacttcatctacaagcacaacaagcc 1106



to top

>gb|AF180337.1|AF180337 Filobasidiella neoformans var. neoformans cyclophilin A (CPA2)
           gene, complete cds
          Length = 1620

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                           
Query: 319 caacggcaccggcggcgagtccatctacggcgagaagttcgccgacga 366
           ||||||||| |||||| |||||||||||||| | ||||||||||||||
Sbjct: 542 caacggcactggcggcaagtccatctacggcaacaagttcgccgacga 589



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
               sequence
          Length = 22685906

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 65/76 (85%)
 Strand = Plus / Plus

                                                                           
Query: 264     cgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacg 323
               |||||||||||||  | ||||  ||||||||||||||||||||| ||||    || ||||
Sbjct: 3417798 cgttccaccgcgtggtgcccgggttcatgtgccagggcggcgacatcacggccgggaacg 3417857

                               
Query: 324     gcaccggcggcgagtc 339
               ||||||||||||||||
Sbjct: 3417858 gcaccggcggcgagtc 3417873



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 57/69 (82%)
 Strand = Plus / Plus

                                                                           
Query: 239     aagccgctgcactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccag 298
               |||||||| ||||||||||||    |||||||||| ||  | ||||  ||||||||||||
Sbjct: 3425219 aagccgctccactacaagggctcaacgttccaccgggtggtgcccgggttcatgtgccag 3425278

                        
Query: 299     ggcggcgac 307
                ||||||||
Sbjct: 3425279 agcggcgac 3425287



to top

>ref|NM_199957.1| Danio rerio peptidylprolyl isomerase A, like (ppial), mRNA
          Length = 822

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 71/84 (84%)
 Strand = Plus / Plus

                                                                       
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
           |||||||||||||||||| | |||||||| |||||||| || |||||||    |||||| 
Sbjct: 297 ttccaccgcgtcatcccccaattcatgtgtcagggcggtgatttcaccaatcacaacgga 356

                                   
Query: 326 accggcggcgagtccatctacggc 349
           ||||| ||  ||||||||||||||
Sbjct: 357 accggaggaaagtccatctacggc 380



 Score = 46.1 bits (23), Expect = 0.085
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 188 gagaacttccgcgcgctctgcaccggcgagaaggg 222
           ||||||||||| || ||||||||||| ||||||||
Sbjct: 240 gagaacttccgtgcactctgcaccggagagaaggg 274



to top

>gb|BC071370.1| Danio rerio peptidylprolyl isomerase A, like, mRNA (cDNA clone
           MGC:86688 IMAGE:6895545), complete cds
          Length = 784

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 71/84 (84%)
 Strand = Plus / Plus

                                                                       
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
           |||||||||||||||||| | |||||||| |||||||| || |||||||    |||||| 
Sbjct: 229 ttccaccgcgtcatcccccaattcatgtgtcagggcggtgatttcaccaatcacaacgga 288

                                   
Query: 326 accggcggcgagtccatctacggc 349
           ||||| ||  ||||||||||||||
Sbjct: 289 accggaggaaagtccatctacggc 312



 Score = 46.1 bits (23), Expect = 0.085
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 188 gagaacttccgcgcgctctgcaccggcgagaaggg 222
           ||||||||||| || ||||||||||| ||||||||
Sbjct: 172 gagaacttccgtgcactctgcaccggagagaaggg 206



to top

>dbj|AK058898.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-H03, full
           insert sequence
          Length = 927

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 65/76 (85%)
 Strand = Plus / Plus

                                                                       
Query: 264 cgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacg 323
           |||||||||||||  | ||||  ||||||||||||||||||||| ||||    || ||||
Sbjct: 319 cgttccaccgcgtggtgcccgggttcatgtgccagggcggcgacatcacggccgggaacg 378

                           
Query: 324 gcaccggcggcgagtc 339
           ||||||||||||||||
Sbjct: 379 gcaccggcggcgagtc 394



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 65/76 (85%)
 Strand = Plus / Plus

                                                                           
Query: 264     cgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacg 323
               |||||||||||||  | ||||  ||||||||||||||||||||| ||||    || ||||
Sbjct: 3417719 cgttccaccgcgtggtgcccgggttcatgtgccagggcggcgacatcacggccgggaacg 3417778

                               
Query: 324     gcaccggcggcgagtc 339
               ||||||||||||||||
Sbjct: 3417779 gcaccggcggcgagtc 3417794



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 57/69 (82%)
 Strand = Plus / Plus

                                                                           
Query: 239     aagccgctgcactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccag 298
               |||||||| ||||||||||||    |||||||||| ||  | ||||  ||||||||||||
Sbjct: 3425140 aagccgctccactacaagggctcaacgttccaccgggtggtgcccgggttcatgtgccag 3425199

                        
Query: 299     ggcggcgac 307
                ||||||||
Sbjct: 3425200 agcggcgac 3425208



to top

>emb|CR956622.12| Pig DNA sequence from clone PigE-219N9 on chromosome 6, complete
             sequence
          Length = 174170

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 68/80 (85%)
 Strand = Plus / Minus

                                                                         
Query: 266   ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
             |||||| || |||||||| | |||||||||||||||||||| |||||||    |||||||
Sbjct: 95535 ttccactgcatcatcccccagttcatgtgccagggcggcgatttcaccaaccacaacggc 95476

                                 
Query: 326   accggcggcgagtccatcta 345
             || || ||| ||||||||||
Sbjct: 95475 actgggggcaagtccatcta 95456



to top

>emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB122 of Yarrowia lipolytica
          Length = 3272609

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 86/104 (82%)
 Strand = Plus / Plus

                                                                           
Query: 266     ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
               |||||||| ||||||||| | ||||||   ||||| || ||||||||| |   |||||| 
Sbjct: 1424183 ttccaccgagtcatcccccagttcatgctgcagggtggagacttcacccgacacaacgga 1424242

                                                           
Query: 326     accggcggcgagtccatctacggcgagaagttcgccgacgagaa 369
               ||||| ||| |||||||||||||||  |||||| ||||||||||
Sbjct: 1424243 accggaggcaagtccatctacggcgccaagttccccgacgagaa 1424286



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 58/67 (86%)
 Strand = Plus / Plus

                                                                           
Query: 156     agctgtacaaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcg 215
               ||||||||||||||  |||||| | ||||| |||||||||||| || || ||||| ||||
Sbjct: 1368420 agctgtacaaggaccaggtgcccaagacggcggagaacttccgagctctgtgcactggcg 1368479

                      
Query: 216     agaaggg 222
               |||||||
Sbjct: 1368480 agaaggg 1368486



 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 61/72 (84%)
 Strand = Plus / Minus

                                                                           
Query: 296     cagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaag 355
               ||||| || |||||||||   |||||||| ||||| || |||||||||||||| ||||||
Sbjct: 2361962 cagggaggagacttcaccgctggcaacggtaccggaggagagtccatctacggggagaag 2361903

                           
Query: 356     ttcgccgacgag 367
               ||| | ||||||
Sbjct: 2361902 ttccctgacgag 2361891



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                   
Query: 188     gagaacttccgcgcgctctgcaccggcgagaagggc 223
               ||||||||||| || || ||||| ||||||||||||
Sbjct: 2362070 gagaacttccgagctctgtgcactggcgagaagggc 2362035



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                   
Query: 188     gagaacttccgcgcgctctgcaccggcgagaagggc 223
               ||||||||||| || || |||||||||||| |||||
Sbjct: 1424126 gagaacttccgagctctgtgcaccggcgagcagggc 1424161



to top

>gb|BC059470.1| Danio rerio peptidylprolyl isomerase A, like, mRNA (cDNA clone
           MGC:73102 IMAGE:4786094), complete cds
          Length = 822

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 71/84 (84%)
 Strand = Plus / Plus

                                                                       
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
           |||||||||||||||||| | |||||||| |||||||| || |||||||    |||||| 
Sbjct: 297 ttccaccgcgtcatcccccaattcatgtgtcagggcggtgatttcaccaatcacaacgga 356

                                   
Query: 326 accggcggcgagtccatctacggc 349
           ||||| ||  ||||||||||||||
Sbjct: 357 accggaggaaagtccatctacggc 380



 Score = 46.1 bits (23), Expect = 0.085
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 188 gagaacttccgcgcgctctgcaccggcgagaaggg 222
           ||||||||||| || ||||||||||| ||||||||
Sbjct: 240 gagaacttccgtgcactctgcaccggagagaaggg 274



to top

>ref|XM_754780.1| Ustilago maydis 521 hypothetical protein (UM03726.1) partial mRNA
          Length = 489

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 88/107 (82%)
 Strand = Plus / Plus

                                                                       
Query: 263 tcgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaac 322
           ||||||||||| |||||||| |||||||||   ||||| || |||||||||   || |||
Sbjct: 148 tcgttccaccgtgtcatcccggacttcatgctgcagggtggtgacttcaccgccggtaac 207

                                                          
Query: 323 ggcaccggcggcgagtccatctacggcgagaagttcgccgacgagaa 369
           || ||||| ||| |||| ||||||||||  |||||||  ||||||||
Sbjct: 208 ggtaccggaggcaagtcgatctacggcgccaagttcgaagacgagaa 254



to top

>ref|XM_749773.1| Aspergillus fumigatus Af293 peptidyl-prolyl cis-trans isomerase
           (Afu3g07430) partial mRNA
          Length = 492

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                       
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
           ||||||||| |||||||| | ||||||   ||||| || || ||||||| ||||||||||
Sbjct: 154 ttccaccgcatcatcccccagttcatgctgcagggtggtgatttcaccaagggcaacggc 213

                                  
Query: 326 accggcggcgagtccatctacgg 348
           || || ||| |||||||||||||
Sbjct: 214 actggtggcaagtccatctacgg 236



to top

>emb|CR660141.2|CNS0F8C3 Tetraodon nigroviridis full-length cDNA
          Length = 767

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 40/43 (93%)
 Strand = Plus / Plus

                                                      
Query: 187 ggagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 229
           ||||||||||||||| |||||||| |||||||||||| |||||
Sbjct: 147 ggagaacttccgcgccctctgcactggcgagaagggcttcggc 189



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 314
           |||||||||||||||||  | |||||||||||||| || || |||||||
Sbjct: 205 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 253



to top

>ref|XM_501664.1| Yarrowia lipolytica CLIB122, YALI0C09988g predicted mRNA
          Length = 531

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 58/67 (86%)
 Strand = Plus / Plus

                                                                       
Query: 156 agctgtacaaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcg 215
           ||||||||||||||  |||||| | ||||| |||||||||||| || || ||||| ||||
Sbjct: 104 agctgtacaaggaccaggtgcccaagacggcggagaacttccgagctctgtgcactggcg 163

                  
Query: 216 agaaggg 222
           |||||||
Sbjct: 164 agaaggg 170



to top

>emb|AJ245940.1|RCO245940 Ricinus communis mRNA for cyclophilin (cyp1 gene)
          Length = 679

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 58/67 (86%)
 Strand = Plus / Plus

                                                                       
Query: 95  aacccgaaggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatg 154
           ||||| ||||| ||||| |||||||| || ||||| || ||||| |||||||| ||||||
Sbjct: 10  aaccctaaggtcttctttgacatgactgtcggcggtgctccggcgggccgcatagtgatg 69

                  
Query: 155 gagctgt 161
           |||||||
Sbjct: 70  gagctgt 76



to top

>gb|AF293848.1| Pyricularia grisea cyclophilin (CYP1) gene, complete cds; nuclear
            gene encoding mitochondrial and cytosolic products
          Length = 2215

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                           
Query: 323  ggcaccggcggcgagtccatctacggcgagaagttcgccgacgagaa 369
            |||||||| ||| ||||| |||||||||||||||| |||||||||||
Sbjct: 1090 ggcaccggtggcaagtccgtctacggcgagaagtttgccgacgagaa 1136



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 51/58 (87%)
 Strand = Plus / Plus

                                                                      
Query: 266  ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacg 323
            ||||||||  |||||||||||||||||  ||||||||| ||||||||| | |||||||
Sbjct: 955  ttccaccgtatcatccccgacttcatgctccagggcggtgacttcacccgtggcaacg 1012



to top

>gb|AF180336.1|AF180336 Filobasidiella neoformans var. neoformans cyclophilin A (CPA1)
           gene, complete cds
          Length = 1298

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 319 caacggcaccggcggcgagtccatctacggcgagaagttcgccgacgagaa 369
           ||||||||| |||||| |||||||||||||  | |||||||||||||||||
Sbjct: 457 caacggcactggcggcaagtccatctacggaaacaagttcgccgacgagaa 507



to top

>emb|AJ937743.1| Aspergillus fumigatus mRNA for cyclophilin (asp f 27 gene), strain
           ATCC 42202
          Length = 492

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                       
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
           ||||||||| |||||||| | ||||||   ||||| || || ||||||| ||||||||||
Sbjct: 154 ttccaccgcatcatcccccagttcatgctgcagggtggtgatttcaccaagggcaacggc 213

                                  
Query: 326 accggcggcgagtccatctacgg 348
           || || ||| |||||||||||||
Sbjct: 214 actggtggcaagtccatctacgg 236



to top

>gb|DQ079281.1| Drosophila arizonae strain 15081-1271.13 moj29 (moj29) gene,
           partial cds
          Length = 938

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 85/103 (82%)
 Strand = Plus / Plus

                                                                       
Query: 250 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 309
           |||||||||||||  |||||| ||| |||||   ||||| |||  |||||| ||||||||
Sbjct: 608 ctacaagggcagcaagttccatcgcatcatcaaggactttatgatccagggtggcgactt 667

                                                      
Query: 310 caccaggggcaacggcaccggcggcgagtccatctacggcgag 352
           ||||| |||| ||||||| ||||||   |||||||| ||||||
Sbjct: 668 caccaagggcgacggcactggcggccgttccatctatggcgag 710



to top

>dbj|AB062672.1| Magnaporthe grisea CYP1 gene for cyclophilin, complete cds
          Length = 1652

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 323 ggcaccggcggcgagtccatctacggcgagaagttcgccgacgagaa 369
           |||||||| ||| ||||| |||||||||||||||| |||||||||||
Sbjct: 789 ggcaccggtggcaagtccgtctacggcgagaagtttgccgacgagaa 835



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 51/58 (87%)
 Strand = Plus / Plus

                                                                     
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacg 323
           ||||||||  |||||||||||||||||  ||||||||| ||||||||| | |||||||
Sbjct: 654 ttccaccgtatcatccccgacttcatgctccagggcggtgacttcacccgtggcaacg 711



to top

>ref|XM_513346.1| PREDICTED: Pan troglodytes similar to peptidylprolyl isomerase E
           isoform 2; peptidyl-prolyl cis-trans isomerase E;
           cyclophilin 33; cyclophilin E; PPIase E; rotamase E
           (LOC456784), mRNA
          Length = 1113

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 78/94 (82%)
 Strand = Plus / Plus

                                                                       
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
           ||||||||| |||||||| | ||||||||||||||||| || ||||| |    |||||||
Sbjct: 566 ttccaccgcatcatcccccagttcatgtgccagggcggtgatttcacaaaccacaacggc 625

                                             
Query: 326 accggcggcgagtccatctacggcgagaagttcg 359
           || || ||| |||||||||| ||  |||||||||
Sbjct: 626 actgggggcaagtccatctatgggaagaagttcg 659



to top

>ref|XM_816485.1| Trypanosoma cruzi strain CL Brener cyclophilin A
           (Tc00.1047053506925.300) partial mRNA
          Length = 534

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 75/90 (83%)
 Strand = Plus / Plus

                                                                       
Query: 278 atccccgacttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgag 337
           |||||| | |||||||||||||| || ||||||||||    ||||||||| ||||||  |
Sbjct: 199 atcccccagttcatgtgccaggggggtgacttcaccaatcacaacggcactggcggcagg 258

                                         
Query: 338 tccatctacggcgagaagttcgccgacgag 367
           || |||||||| ||||| || |||||||||
Sbjct: 259 tctatctacggtgagaaatttgccgacgag 288



to top

>emb|CR860299.1| Pongo pygmaeus mRNA; cDNA DKFZp459B225 (from clone DKFZp459B225)
          Length = 4360

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 78/94 (82%)
 Strand = Plus / Plus

                                                                       
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
           ||||||||| |||||||| | ||||||||||||||||| || ||||| |    |||||||
Sbjct: 586 ttccaccgcatcatcccccagttcatgtgccagggcggtgatttcacaaaccacaacggc 645

                                             
Query: 326 accggcggcgagtccatctacggcgagaagttcg 359
           || || ||| |||||||||| ||  |||||||||
Sbjct: 646 actgggggcaagtccatctatgggaagaagttcg 679



to top

>emb|BX933768.2| Gallus gallus finished cDNA, clone ChEST34h10
          Length = 735

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 99/122 (81%)
 Strand = Plus / Plus

                                                                       
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
           ||||||||  ||||||||| ||||||||| ||||| || ||||| ||  |   |||||||
Sbjct: 210 ttccaccggatcatccccggcttcatgtgtcagggtggtgactttacgcgccacaacggc 269

                                                                       
Query: 326 accggcggcgagtccatctacggcgagaagttcgccgacgagaagttcgtccacaagcac 385
           || || ||| | ||||| ||||| |||||||| ||||||||||| ||| |||  ||||||
Sbjct: 270 actggtggcaaatccatttacggggagaagtttgccgacgagaacttcatcctgaagcac 329

             
Query: 386 ac 387
           ||
Sbjct: 330 ac 331



to top

>gb|AF191832.1|AF191832 Trypanosoma cruzi cyclophilin A (CYP A) mRNA, complete cds
          Length = 1098

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 75/90 (83%)
 Strand = Plus / Plus

                                                                       
Query: 278 atccccgacttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgag 337
           |||||| | |||||||||||||| || ||||||||||    ||||||||| ||||||  |
Sbjct: 268 atcccccagttcatgtgccaggggggtgacttcaccaatcacaacggcactggcggcagg 327

                                         
Query: 338 tccatctacggcgagaagttcgccgacgag 367
           || |||||||| ||||| || |||||||||
Sbjct: 328 tctatctacggtgagaaatttgccgacgag 357



to top

>ref|NM_074348.4| Caenorhabditis elegans CYclophyliN family member (cyn-7) (cyn-7)
           mRNA, complete cds
          Length = 644

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 144/182 (79%)
 Strand = Plus / Plus

                                                                       
Query: 188 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctg 247
           ||||||||||| || || ||||| || |||||||| ||||| |||  ||| ||||| || 
Sbjct: 130 gagaacttccgtgctctttgcactggtgagaagggagtcggaaagtccggaaagccactc 189

                                                                       
Query: 248 cactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgac 307
           |||| ||||||   |  |||||| ||  ||||||| || ||||||  |||||| || |||
Sbjct: 190 cacttcaagggatccaagttccatcgtatcatcccagaattcatgatccagggaggagac 249

                                                                       
Query: 308 ttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaagttcgccgacgag 367
           |||||| | || ||||| || || || || ||||||||||| ||||||||| | ||||||
Sbjct: 250 ttcacccgcgggaacggaactggaggagaatccatctacggagagaagttcccagacgag 309

             
Query: 368 aa 369
           ||
Sbjct: 310 aa 311



to top

>emb|AL115635.1|CNS01CKB Botrytis cinerea strain T4 cDNA library
          Length = 600

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 60/70 (85%)
 Strand = Plus / Plus

                                                                       
Query: 305 gacttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaagttcgccgac 364
           ||||||||| | |||||||| ||||| ||  |||| |||||||| |||||||||||||| 
Sbjct: 203 gacttcacccgtggcaacggtaccggtggaaagtcaatctacggtgagaagttcgccgat 262

                     
Query: 365 gagaagttcg 374
           ||||| ||||
Sbjct: 263 gagaacttcg 272



to top

>emb|AL116652.1|CNS01DCK Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 60/70 (85%)
 Strand = Plus / Plus

                                                                       
Query: 305 gacttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaagttcgccgac 364
           ||||||||| | |||||||| ||||| ||  |||| |||||||| |||||||||||||| 
Sbjct: 248 gacttcacccgtggcaacggtaccggtggaaagtcaatctacggtgagaagttcgccgat 307

                     
Query: 365 gagaagttcg 374
           ||||| ||||
Sbjct: 308 gagaacttcg 317



to top

>emb|AL116469.1|CNS01D7H Botrytis cinerea strain T4 cDNA library
          Length = 600

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 60/70 (85%)
 Strand = Plus / Plus

                                                                       
Query: 305 gacttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaagttcgccgac 364
           ||||||||| | |||||||| ||||| ||  |||| |||||||| |||||||||||||| 
Sbjct: 211 gacttcacccgtggcaacggtaccggtggaaagtcaatctacggtgagaagttcgccgat 270

                     
Query: 365 gagaagttcg 374
           ||||| ||||
Sbjct: 271 gagaacttcg 280



to top

>emb|AL116187.1|CNS01CZN Botrytis cinerea strain T4 cDNA library
          Length = 708

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 60/70 (85%)
 Strand = Plus / Plus

                                                                       
Query: 305 gacttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaagttcgccgac 364
           ||||||||| | |||||||| ||||| ||  |||| |||||||| |||||||||||||| 
Sbjct: 273 gacttcacccgtggcaacggtaccggtggaaagtcaatctacggtgagaagttcgccgat 332

                     
Query: 365 gagaagttcg 374
           ||||| ||||
Sbjct: 333 gagaacttcg 342



to top

>emb|AL115447.1|CNS01CF3 Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 60/70 (85%)
 Strand = Plus / Plus

                                                                       
Query: 305 gacttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaagttcgccgac 364
           ||||||||| | |||||||| ||||| ||  |||| |||||||| |||||||||||||| 
Sbjct: 261 gacttcacccgtggcaacggtaccggtggaaagtcaatctacggtgagaagttcgccgat 320

                     
Query: 365 gagaagttcg 374
           ||||| ||||
Sbjct: 321 gagaacttcg 330



to top

>emb|AL115226.1|CNS01C8Y Botrytis cinerea strain T4 cDNA library
          Length = 626

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 60/70 (85%)
 Strand = Plus / Plus

                                                                       
Query: 305 gacttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaagttcgccgac 364
           ||||||||| | |||||||| ||||| ||  |||| |||||||| |||||||||||||| 
Sbjct: 271 gacttcacccgtggcaacggtaccggtggaaagtcaatctacggtgagaagttcgccgat 330

                     
Query: 365 gagaagttcg 374
           ||||| ||||
Sbjct: 331 gagaacttcg 340



to top

>emb|AL112224.1|CNS019XK Botrytis cinerea strain T4 cDNA library
          Length = 696

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 60/70 (85%)
 Strand = Plus / Plus

                                                                       
Query: 305 gacttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaagttcgccgac 364
           ||||||||| | |||||||| ||||| ||  |||| |||||||| |||||||||||||| 
Sbjct: 276 gacttcacccgtggcaacggtaccggtggaaagtcaatctacggtgagaagttcgccgat 335

                     
Query: 365 gagaagttcg 374
           ||||| ||||
Sbjct: 336 gagaacttcg 345



to top

>emb|AL112374.1|CNS01A1Q Botrytis cinerea strain T4 cDNA library
          Length = 530

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 60/70 (85%)
 Strand = Plus / Plus

                                                                       
Query: 305 gacttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaagttcgccgac 364
           ||||||||| | |||||||| ||||| ||  |||| |||||||| |||||||||||||| 
Sbjct: 141 gacttcacccgtggcaacggtaccggtggaaagtcaatctacggtgagaagttcgccgat 200

                     
Query: 365 gagaagttcg 374
           ||||| ||||
Sbjct: 201 gagaacttcg 210



to top

>emb|AL112297.1|CNS019ZL Botrytis cinerea strain T4 cDNA library
          Length = 710

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 60/70 (85%)
 Strand = Plus / Plus

                                                                       
Query: 305 gacttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaagttcgccgac 364
           ||||||||| | |||||||| ||||| ||  |||| |||||||| |||||||||||||| 
Sbjct: 275 gacttcacccgtggcaacggtaccggtggaaagtcaatctacggtgagaagttcgccgat 334

                     
Query: 365 gagaagttcg 374
           ||||| ||||
Sbjct: 335 gagaacttcg 344



to top

>emb|AL111927.1|CNS019PB Botrytis cinerea strain T4 cDNA library
          Length = 756

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 60/70 (85%)
 Strand = Plus / Plus

                                                                       
Query: 305 gacttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaagttcgccgac 364
           ||||||||| | |||||||| ||||| ||  |||| |||||||| |||||||||||||| 
Sbjct: 257 gacttcacccgtggcaacggtaccggtggaaagtcaatctacggtgagaagttcgccgat 316

                     
Query: 365 gagaagttcg 374
           ||||| ||||
Sbjct: 317 gagaacttcg 326



to top

>emb|AL111642.1|CNS019HE Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 60/70 (85%)
 Strand = Plus / Plus

                                                                       
Query: 305 gacttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaagttcgccgac 364
           ||||||||| | |||||||| ||||| ||  |||| |||||||| |||||||||||||| 
Sbjct: 275 gacttcacccgtggcaacggtaccggtggaaagtcaatctacggtgagaagttcgccgat 334

                     
Query: 365 gagaagttcg 374
           ||||| ||||
Sbjct: 335 gagaacttcg 344



to top

>emb|AL111866.1|CNS019NM Botrytis cinerea strain T4 cDNA library
          Length = 576

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 60/70 (85%)
 Strand = Plus / Plus

                                                                       
Query: 305 gacttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaagttcgccgac 364
           ||||||||| | |||||||| ||||| ||  |||| |||||||| |||||||||||||| 
Sbjct: 152 gacttcacccgtggcaacggtaccggtggaaagtcaatctacggtgagaagttcgccgat 211

                     
Query: 365 gagaagttcg 374
           ||||| ||||
Sbjct: 212 gagaacttcg 221



to top

>emb|AL111766.1|CNS019KU Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 60/70 (85%)
 Strand = Plus / Plus

                                                                       
Query: 305 gacttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaagttcgccgac 364
           ||||||||| | |||||||| ||||| ||  |||| |||||||| |||||||||||||| 
Sbjct: 276 gacttcacccgtggcaacggtaccggtggaaagtcaatctacggtgagaagttcgccgat 335

                     
Query: 365 gagaagttcg 374
           ||||| ||||
Sbjct: 336 gagaacttcg 345



to top

>emb|AL111458.1|CNS019CA Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 60/70 (85%)
 Strand = Plus / Plus

                                                                       
Query: 305 gacttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaagttcgccgac 364
           ||||||||| | |||||||| ||||| ||  |||| |||||||| |||||||||||||| 
Sbjct: 243 gacttcacccgtggcaacggtaccggtggaaagtcaatctacggtgagaagttcgccgat 302

                     
Query: 365 gagaagttcg 374
           ||||| ||||
Sbjct: 303 gagaacttcg 312



to top

>emb|AL111202.1|CNS01956 Botrytis cinerea strain T4 cDNA library
          Length = 636

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 60/70 (85%)
 Strand = Plus / Plus

                                                                       
Query: 305 gacttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaagttcgccgac 364
           ||||||||| | |||||||| ||||| ||  |||| |||||||| |||||||||||||| 
Sbjct: 271 gacttcacccgtggcaacggtaccggtggaaagtcaatctacggtgagaagttcgccgat 330

                     
Query: 365 gagaagttcg 374
           ||||| ||||
Sbjct: 331 gagaacttcg 340



to top

>emb|AL111165.1|CNS01946 Botrytis cinerea strain T4 cDNA library
          Length = 396

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 60/70 (85%)
 Strand = Plus / Plus

                                                                       
Query: 305 gacttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaagttcgccgac 364
           ||||||||| | |||||||| ||||| ||  |||| |||||||| |||||||||||||| 
Sbjct: 6   gacttcacccgtggcaacggtaccggtggaaagtcaatctacggtgagaagttcgccgat 65

                     
Query: 365 gagaagttcg 374
           ||||| ||||
Sbjct: 66  gagaacttcg 75



to top

>gb|AY942800.1| Cucumis sativus cyclophilin (M2) mRNA, complete cds
          Length = 814

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 102/126 (80%)
 Strand = Plus / Plus

                                                                       
Query: 188 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctg 247
           ||||||||||| || |||||||| || |||||||| ||||||||  ||||||| || || 
Sbjct: 140 gagaacttccgtgcactctgcactggtgagaagggagtcggcaaaggcggcaaacccctt 199

                                                                       
Query: 248 cactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgac 307
           || ||||| ||   ||| |||||||| || |||||  | |||||||||||||| || || 
Sbjct: 200 cattacaaaggatcctccttccaccgtgtgatccctaatttcatgtgccagggaggtgat 259

                 
Query: 308 ttcacc 313
           ||||||
Sbjct: 260 ttcacc 265



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 107 ttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagct 159
           ||||||||||||||  | |||||| | ||||||||||| ||| | ||||||||
Sbjct: 59  ttcttcgacatgacaatcggcggcacaccggccggccggatcatcatggagct 111



to top

>gb|AY106356.1| Zea mays PCO149745 mRNA sequence
          Length = 1855

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 180 ggacggtggagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 229
           |||||| |||||||||||||||||||||||| || ||||| ||| |||||
Sbjct: 369 ggacggcggagaacttccgcgcgctctgcacaggggagaaaggcatcggc 418



to top

>gb|AF041412.1|AF041412 Periplaneta americana peptidyl-prolyl cis-trans isomerase mRNA,
           partial cds
          Length = 235

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 251 tacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttc 310
           |||||||| ||| | ||||||||||| |||||| |||||||||| ||||| || ||||||
Sbjct: 13  tacaagggtagcaccttccaccgcgttatccccaacttcatgtgtcagggaggagacttc 72

             
Query: 311 ac 312
           ||
Sbjct: 73  ac 74



to top

>emb|AL032663.1|CEY75B12B Caenorhabditis elegans YAC Y75B12B, complete sequence
          Length = 23906

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 144/182 (79%)
 Strand = Plus / Minus

                                                                        
Query: 188  gagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctg 247
            ||||||||||| || || ||||| || |||||||| ||||| |||  ||| ||||| || 
Sbjct: 4018 gagaacttccgtgctctttgcactggtgagaagggagtcggaaagtccggaaagccactc 3959

                                                                        
Query: 248  cactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgac 307
            |||| ||||||   |  |||||| ||  ||||||| || ||||||  |||||| || |||
Sbjct: 3958 cacttcaagggatccaagttccatcgtatcatcccagaattcatgatccagggaggagac 3899

                                                                        
Query: 308  ttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaagttcgccgacgag 367
            |||||| | || ||||| || || || || ||||||||||| ||||||||| | ||||||
Sbjct: 3898 ttcacccgcgggaacggaactggaggagaatccatctacggagagaagttcccagacgag 3839

              
Query: 368  aa 369
            ||
Sbjct: 3838 aa 3837



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 77/94 (81%)
 Strand = Plus / Plus

                                                                        
Query: 276  tcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcg 335
            |||||||  ||||||||  |||||| || ||||||||| | || ||||| || || || |
Sbjct: 6994 tcatcccgaacttcatgatccagggaggagacttcacccgcggaaacggaactggaggag 7053

                                              
Query: 336  agtccatctacggcgagaagttcgccgacgagaa 369
            | ||||||||||| ||||||||| | ||||||||
Sbjct: 7054 aatccatctacggagagaagttcccagacgagaa 7087



to top

>gb|U27559.1|CEU27559 Caenorhabditis elegans cyclophilin (cyp-7) mRNA, complete cds
          Length = 525

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 144/182 (79%)
 Strand = Plus / Plus

                                                                       
Query: 188 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctg 247
           ||||||||||| || || ||||| || |||||||| ||||| |||  ||| ||||| || 
Sbjct: 109 gagaacttccgtgctctttgcactggtgagaagggagtcggaaagtccggaaagccactc 168

                                                                       
Query: 248 cactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgac 307
           |||| ||||||   |  |||||| ||  ||||||| || ||||||  |||||| || |||
Sbjct: 169 cacttcaagggatccaagttccatcgtatcatcccagaattcatgatccagggaggagac 228

                                                                       
Query: 308 ttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaagttcgccgacgag 367
           |||||| | || ||||| || || || || ||||||||||| ||||||||| | ||||||
Sbjct: 229 ttcacccgcgggaacggaactggaggagaatccatctacggagagaagttcccagacgag 288

             
Query: 368 aa 369
           ||
Sbjct: 289 aa 290



to top

>gb|AY392408.1| Thellungiella halophila cyclophilin mRNA, complete cds
          Length = 760

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 107 ttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagct 159
           |||||||||||||| || |||||  | ||||||||||| ||||||||||||||
Sbjct: 75  ttcttcgacatgaccgtcggcggatcaccggccggccgaatcgtgatggagct 127



to top

>ref|XM_571478.1| Cryptococcus neoformans var. neoformans JEC21 peptidyl-prolyl
           cis-trans isomerase (CNF00430) partial mRNA
          Length = 1329

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 305 gacttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaagtt 357
           ||||| ||||||||| |||| ||||| || ||||||||||| |||||||||||
Sbjct: 310 gactttaccaggggcgacggaaccggtggagagtccatctatggcgagaagtt 362



to top

>dbj|AB226263.1| Aspergillus oryzae cDNA, contig sequence: AoEST3122
          Length = 1101

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 77/93 (82%)
 Strand = Plus / Plus

                                                                       
Query: 266 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 325
           |||||||| |||||||||   || |||  |||||| || ||||||||| | |||||||||
Sbjct: 432 ttccaccgtgtcatccccagttttatgctccagggaggtgacttcacccgtggcaacggc 491

                                            
Query: 326 accggcggcgagtccatctacggcgagaagttc 358
           || || ||  ||||||||||||| |||||||||
Sbjct: 492 actggtggtaagtccatctacggtgagaagttc 524


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,976,606
Number of Sequences: 3902068
Number of extensions: 1976606
Number of successful extensions: 44977
Number of sequences better than 10.0: 761
Number of HSP's better than 10.0 without gapping: 761
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 40801
Number of HSP's gapped (non-prelim): 3923
length of query: 393
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 371
effective length of database: 17,147,199,772
effective search space: 6361611115412
effective search space used: 6361611115412
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top