ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags16f16
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AE017180.1| Geobacter sulfurreducens PCA, complete genome 42 2.4
2emb|AL445591.10| Human DNA sequence from clone RP11-314N2 on chr... 42 2.4
3emb|AM180252.1| Lawsonia intracellularis PHE/MN1-00 42 2.4
4gb|AC166364.2| Mus musculus BAC clone RP24-394E6 from chromosome... 40 9.3
5gb|AY587061.1| Sus scrofa ataxia-telangiectasia mutated protein ... 40 9.3
6gb|AC103605.8| Mus musculus chromosome 3, clone RP23-335H1, comp... 40 9.3
7gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 40 9.3
8gb|AC120538.4| Oryza sativa chromosome 3 BAC OSJNBb0059G13 genom... 40 9.3
9emb|AJ632303.1| Sus scrofa partial ICAM3 gene, TYK2, CDC37, PDE4... 40 9.3
10gb|BC026096.1| Homo sapiens glucuronyl C5-epimerase, mRNA (cDNA ... 40 9.3
11gb|AC006350.2| Homo sapiens PAC clone RP5-998H4 from 7, complete... 40 9.3
12gb|AC130801.16| Medicago truncatula clone mth2-12p19, complete s... 40 9.3
13ref|XM_790854.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 9.3
14emb|AL022146.1|HS780M13 Human DNA sequence from clone RP4-780M13... 40 9.3
15gb|AF542391.1| Homo sapiens selectin P (granule membrane protein... 40 9.3
16emb|BX571857.1| Staphylococcus aureus strain MSSA476, complete g... 40 9.3
17emb|BX569691.1| Synechococcus sp. WH8102 complete genome; segmen... 40 9.3
18dbj|AB192509.2| Sus scrofa genomic DNA, chromosome 7, BAC clone:... 40 9.3
19dbj|BA000017.4| Staphylococcus aureus subsp. aureus Mu50 DNA, co... 40 9.3
20gb|AC112184.2| Homo sapiens chromosome 5 clone RP11-168A11, comp... 40 9.3
21gb|AC026992.12| Homo sapiens chromosome 15, clone RP11-352D13, c... 40 9.3
22gb|CP000046.1| Staphylococcus aureus subsp. aureus COL, complete... 40 9.3
23gb|AC158676.12| Mus musculus 6 BAC RP23-146N13 (Roswell Park Can... 40 9.3
24gb|CP000253.1| Staphylococcus aureus subsp. aureus NCTC 8325, co... 40 9.3
25gb|CP000255.1| Staphylococcus aureus subsp. aureus USA300, compl... 40 9.3
26gb|AC012636.5|AC012636 Homo sapiens chromosome 5 clone CTD-2201I... 40 9.3
27gb|AY033081.1| Staphylococcus aureus putative fatty acid degrada... 40 9.3
28dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 40 9.3
29gb|AC093159.3| Homo sapiens BAC clone RP11-642D6 from 2, complet... 40 9.3
30dbj|AB158555.1| Staphylococcus aureus genes for hypothetical pro... 40 9.3
31dbj|AB158553.1| Staphylococcus aureus genes for hypothetical pro... 40 9.3
32dbj|AB158552.1| Staphylococcus aureus genes for hypothetical pro... 40 9.3
33dbj|AB158550.1| Staphylococcus aureus genes for hypothetical pro... 40 9.3
34dbj|AB158549.1| Staphylococcus aureus genes for hypothetical pro... 40 9.3
35gb|AC025591.8| Staphylococcus aureus clone sabac-134, complete s... 40 9.3
36dbj|BA000033.2| Staphylococcus aureus subsp. aureus MW2 DNA, com... 40 9.3
37dbj|BA000018.3| Staphylococcus aureus subsp. aureus N315 genomic... 40 9.3
38emb|X16457.1|SASTPHLC Staphylococcus aureus gene for staphylocoa... 40 9.3
39emb|CT025895.11| Zebrafish DNA sequence from clone DKEY-273E13 i... 40 9.3
40ref|NM_015554.1| Homo sapiens glucuronyl C5-epimerase (GLCE), mRNA 40 9.3
41emb|BX571856.1| Staphylococcus aureus subsp. aureus strain MRSA2... 40 9.3
42gb|AC104327.6| Mus musculus strain C57BL/6J clone rp23-295a4 map... 40 9.3
43emb|AJ938182.1| Staphylococcus aureus RF122 complete genome 40 9.3
44dbj|AB020643.1| Homo sapiens mRNA for KIAA0836 protein, partial cds 40 9.3 
>gb|AE017180.1| Geobacter sulfurreducens PCA, complete genome
          Length = 3814139

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 372     ccccttcgagagcgaacggct 392
               |||||||||||||||||||||
Sbjct: 3328201 ccccttcgagagcgaacggct 3328221
to top
>emb|AL445591.10| Human DNA sequence from clone RP11-314N2 on chromosome 1 Contains a
             novel processed pseudogene, the GJA8 gene for gap junction
             protein alpha 8, 50kDa (connexin 50) protein,  the 5' end
             of the gene for putative G-protein coupled receptor
             (SH120) and a CpG island, complete sequence
          Length = 140092

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 116   gggattagtggaagcatattt 136
             |||||||||||||||||||||
Sbjct: 47774 gggattagtggaagcatattt 47794
to top
>emb|AM180252.1| Lawsonia intracellularis PHE/MN1-00
          Length = 1457619

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 207    tgaaagcataaacgttggaaa 227
              |||||||||||||||||||||
Sbjct: 566810 tgaaagcataaacgttggaaa 566790
to top
>gb|AC166364.2| Mus musculus BAC clone RP24-394E6 from chromosome 3, complete sequence
          Length = 227070

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 105    gcccgctgactgggattagt 124
              ||||||||||||||||||||
Sbjct: 103152 gcccgctgactgggattagt 103171
to top
>gb|AY587061.1| Sus scrofa ataxia-telangiectasia mutated protein gene, exons 1 through
             64 and complete cds
          Length = 153745

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 357   gtagctccgattcagcccct 376
             ||||||||||||||||||||
Sbjct: 67781 gtagctccgattcagcccct 67762
to top
>gb|AC103605.8| Mus musculus chromosome 3, clone RP23-335H1, complete sequence
          Length = 222210

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 105   gcccgctgactgggattagt 124
             ||||||||||||||||||||
Sbjct: 81323 gcccgctgactgggattagt 81342
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 63       ccacgtgggcccccatgtca 82
                ||||||||||||||||||||
Sbjct: 17015304 ccacgtgggcccccatgtca 17015323
to top
>gb|AC120538.4| Oryza sativa chromosome 3 BAC OSJNBb0059G13 genomic sequence, complete
             sequence
          Length = 157662

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 63    ccacgtgggcccccatgtca 82
             ||||||||||||||||||||
Sbjct: 46050 ccacgtgggcccccatgtca 46069
to top
>emb|AJ632303.1| Sus scrofa partial ICAM3 gene, TYK2, CDC37, PDE4A, KEAP1, EDG8 and
             APG4D genes and partial FLJ12949 gene
          Length = 185331

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 357   gtagctccgattcagcccct 376
             ||||||||||||||||||||
Sbjct: 98852 gtagctccgattcagcccct 98871
to top
>gb|BC026096.1| Homo sapiens glucuronyl C5-epimerase, mRNA (cDNA clone
           IMAGE:4295078), partial cds
          Length = 1239

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 228 ggctccttctcctttctcag 247
           ||||||||||||||||||||
Sbjct: 865 ggctccttctcctttctcag 884
to top
>gb|AC006350.2| Homo sapiens PAC clone RP5-998H4 from 7, complete sequence
          Length = 96958

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 625  taacagaaatgcatgtgttc 644
            ||||||||||||||||||||
Sbjct: 4665 taacagaaatgcatgtgttc 4684
to top
>gb|AC130801.16| Medicago truncatula clone mth2-12p19, complete sequence
          Length = 119328

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 659   aatgcacatgcgagagtgat 678
             ||||||||||||||||||||
Sbjct: 45574 aatgcacatgcgagagtgat 45593
to top
>ref|XM_790854.1| PREDICTED: Strongylocentrotus purpuratus similar to CG2747-PB,
            isoform B (LOC591286), mRNA
          Length = 3468

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 645  atgatacttgttgtaatgcacatg 668
            |||||||||||||||||| |||||
Sbjct: 3246 atgatacttgttgtaatgaacatg 3269
to top
>emb|AL022146.1|HS780M13 Human DNA sequence from clone RP4-780M13 on chromosome 1q24-25 Contains
             the 5' end of the SELP gene for selectin P (granule
             membrane protein 140kDa, antigen CD62) and the 5' end of a
             variant of a novel gene (FLJ45155), complete sequence
          Length = 78025

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 634   tgcatgtgttcatgatactt 653
             ||||||||||||||||||||
Sbjct: 44701 tgcatgtgttcatgatactt 44720
to top
>gb|AF542391.1| Homo sapiens selectin P (granule membrane protein 140kDa, antigen
            CD62) (SELP) gene, complete cds
          Length = 44381

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 634  tgcatgtgttcatgatactt 653
            ||||||||||||||||||||
Sbjct: 5697 tgcatgtgttcatgatactt 5716
to top
>emb|BX571857.1| Staphylococcus aureus strain MSSA476, complete genome
          Length = 2799802

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 125    ggaagcatatttctaaatta 144
              ||||||||||||||||||||
Sbjct: 243433 ggaagcatatttctaaatta 243452
to top
>emb|BX569691.1| Synechococcus sp. WH8102 complete genome; segment 3/7
          Length = 347365

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 360   gctccgattcagccccttcg 379
             ||||||||||||||||||||
Sbjct: 89028 gctccgattcagccccttcg 89047
to top
>dbj|AB192509.2| Sus scrofa genomic DNA, chromosome 7, BAC clone: L139G16, complete
             sequence
          Length = 157870

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 357   gtagctccgattcagcccct 376
             ||||||||||||||||||||
Sbjct: 41925 gtagctccgattcagcccct 41906
to top
>dbj|BA000017.4| Staphylococcus aureus subsp. aureus Mu50 DNA, complete genome
          Length = 2878529

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 125    ggaagcatatttctaaatta 144
              ||||||||||||||||||||
Sbjct: 266723 ggaagcatatttctaaatta 266742
to top
>gb|AC112184.2| Homo sapiens chromosome 5 clone RP11-168A11, complete sequence
          Length = 173346

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 228   ggctccttctcctttctcag 247
             ||||||||||||||||||||
Sbjct: 83354 ggctccttctcctttctcag 83373
to top
>gb|AC026992.12| Homo sapiens chromosome 15, clone RP11-352D13, complete sequence
          Length = 177902

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    ggctccttctcctttctcag 247
              ||||||||||||||||||||
Sbjct: 100836 ggctccttctcctttctcag 100855
to top
>gb|CP000046.1| Staphylococcus aureus subsp. aureus COL, complete genome
          Length = 2809422

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 125    ggaagcatatttctaaatta 144
              ||||||||||||||||||||
Sbjct: 247666 ggaagcatatttctaaatta 247685
to top
>gb|AC158676.12| Mus musculus 6 BAC RP23-146N13 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 204560

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 447    cccaggttcacataaggatc 466
              ||||||||||||||||||||
Sbjct: 190370 cccaggttcacataaggatc 190389
to top
>gb|CP000253.1| Staphylococcus aureus subsp. aureus NCTC 8325, complete genome
          Length = 2821361

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 125    ggaagcatatttctaaatta 144
              ||||||||||||||||||||
Sbjct: 213753 ggaagcatatttctaaatta 213772
to top
>gb|CP000255.1| Staphylococcus aureus subsp. aureus USA300, complete genome
          Length = 2872769

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 125    ggaagcatatttctaaatta 144
              ||||||||||||||||||||
Sbjct: 268343 ggaagcatatttctaaatta 268362
to top
>gb|AC012636.5|AC012636 Homo sapiens chromosome 5 clone CTD-2201I18, complete sequence
          Length = 175561

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 228  ggctccttctcctttctcag 247
            ||||||||||||||||||||
Sbjct: 2231 ggctccttctcctttctcag 2250
to top
>gb|AY033081.1| Staphylococcus aureus putative fatty acid degradation operon,
            complete sequence
          Length = 10173

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 125  ggaagcatatttctaaatta 144
            ||||||||||||||||||||
Sbjct: 9677 ggaagcatatttctaaatta 9658
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 63       ccacgtgggcccccatgtca 82
                ||||||||||||||||||||
Sbjct: 17008873 ccacgtgggcccccatgtca 17008892
to top
>gb|AC093159.3| Homo sapiens BAC clone RP11-642D6 from 2, complete sequence
          Length = 186561

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 195   gcttttggttactgaaagca 214
             ||||||||||||||||||||
Sbjct: 91561 gcttttggttactgaaagca 91542
to top
>dbj|AB158555.1| Staphylococcus aureus genes for hypothetical proteins,
            staphylocoagulase, acetyl-CoA acetyltransferase
            homologue, complete cds, strain:19
          Length = 6164

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 125  ggaagcatatttctaaatta 144
            ||||||||||||||||||||
Sbjct: 4508 ggaagcatatttctaaatta 4527
to top
>dbj|AB158553.1| Staphylococcus aureus genes for hypothetical proteins,
            staphylocoagulase, acetyl-CoA acetyltransferase
            homologue, complete cds, strain:Ku
          Length = 6510

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 125  ggaagcatatttctaaatta 144
            ||||||||||||||||||||
Sbjct: 4852 ggaagcatatttctaaatta 4871
to top
>dbj|AB158552.1| Staphylococcus aureus genes for hypothetical proteins,
            staphylocoagulase, acetyl-CoA acetyltransferase
            homologue, complete cds, strain:Stp-12
          Length = 6221

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 125  ggaagcatatttctaaatta 144
            ||||||||||||||||||||
Sbjct: 4561 ggaagcatatttctaaatta 4580
to top
>dbj|AB158550.1| Staphylococcus aureus genes for hypothetical proteins,
            staphylocoagulase, acetyl-CoA acetyltransferase
            homologue, complete cds, strain:Stp-28
          Length = 6224

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 125  ggaagcatatttctaaatta 144
            ||||||||||||||||||||
Sbjct: 4564 ggaagcatatttctaaatta 4583
to top
>dbj|AB158549.1| Staphylococcus aureus genes for hypothetical proteins,
            staphylocoagulase, acetyl-CoA acetyltransferase
            homologue, complete cds, strain:104
          Length = 6289

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 125  ggaagcatatttctaaatta 144
            ||||||||||||||||||||
Sbjct: 4633 ggaagcatatttctaaatta 4652
to top
>gb|AC025591.8| Staphylococcus aureus clone sabac-134, complete sequence
          Length = 58431

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 125   ggaagcatatttctaaatta 144
             ||||||||||||||||||||
Sbjct: 56268 ggaagcatatttctaaatta 56287
to top
>dbj|BA000033.2| Staphylococcus aureus subsp. aureus MW2 DNA, complete genome, strain:MW2
          Length = 2820462

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 125    ggaagcatatttctaaatta 144
              ||||||||||||||||||||
Sbjct: 244733 ggaagcatatttctaaatta 244752
to top
>dbj|BA000018.3| Staphylococcus aureus subsp. aureus N315 genomic DNA, complete genome
          Length = 2814816

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 125    ggaagcatatttctaaatta 144
              ||||||||||||||||||||
Sbjct: 266763 ggaagcatatttctaaatta 266782
to top
>emb|X16457.1|SASTPHLC Staphylococcus aureus gene for staphylocoagulase
          Length = 2906

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 125  ggaagcatatttctaaatta 144
            ||||||||||||||||||||
Sbjct: 2181 ggaagcatatttctaaatta 2200
to top
>emb|CT025895.11| Zebrafish DNA sequence from clone DKEY-273E13 in linkage group 13,
             complete sequence
          Length = 56618

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 648   atacttgttgtaatgcacat 667
             ||||||||||||||||||||
Sbjct: 29793 atacttgttgtaatgcacat 29774
to top
>ref|NM_015554.1| Homo sapiens glucuronyl C5-epimerase (GLCE), mRNA
          Length = 5043

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 228  ggctccttctcctttctcag 247
            ||||||||||||||||||||
Sbjct: 4699 ggctccttctcctttctcag 4718
to top
>emb|BX571856.1| Staphylococcus aureus subsp. aureus strain MRSA252, complete genome
          Length = 2902619

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 125    ggaagcatatttctaaatta 144
              ||||||||||||||||||||
Sbjct: 260326 ggaagcatatttctaaatta 260345
to top
>gb|AC104327.6| Mus musculus strain C57BL/6J clone rp23-295a4 map 3, complete sequence
          Length = 193174

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 105   gcccgctgactgggattagt 124
             ||||||||||||||||||||
Sbjct: 93473 gcccgctgactgggattagt 93492
to top
>emb|AJ938182.1| Staphylococcus aureus RF122 complete genome
          Length = 2742531

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 125    ggaagcatatttctaaatta 144
              ||||||||||||||||||||
Sbjct: 211123 ggaagcatatttctaaatta 211142
to top
>dbj|AB020643.1| Homo sapiens mRNA for KIAA0836 protein, partial cds
          Length = 4791

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 228  ggctccttctcctttctcag 247
            ||||||||||||||||||||
Sbjct: 4447 ggctccttctcctttctcag 4466


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 9,155,561
Number of Sequences: 3902068
Number of extensions: 9155561
Number of successful extensions: 119477
Number of sequences better than 10.0: 44
Number of HSP's better than 10.0 without gapping: 44
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 119075
Number of HSP's gapped (non-prelim): 402
length of query: 682
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 659
effective length of database: 17,143,297,704
effective search space: 11297433186936
effective search space used: 11297433186936
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top