>emb|AL591985.1|RME591985 Sinorhizobium meliloti 1021 complete pSymB
          Length = 1683333

 Score = 42.1 bits (21), Expect = 0.49
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 69     gtatgcagattggtaatcacg 89
              |||||||||||||||||||||
Sbjct: 923500 gtatgcagattggtaatcacg 923520

>gb|U59229.1|RMU59229 Rhizobium meliloti megaplasmid pRmeSU47b phosphate transport system
           PhoC (phoC), PhoD precursor (phoD), PhoE (phoE), and
           PhoT (phoT) genes, complete cds
          Length = 5705

 Score = 42.1 bits (21), Expect = 0.49
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 69  gtatgcagattggtaatcacg 89
           |||||||||||||||||||||
Sbjct: 898 gtatgcagattggtaatcacg 878

>gb|AC093255.2| Homo sapiens chromosome 5 clone RP11-181G6, complete sequence
          Length = 95597

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 89    gtctcaagcacttgttaaat 108
             ||||||||||||||||||||
Sbjct: 47766 gtctcaagcacttgttaaat 47747

>ref|NM_113228.1| Arabidopsis thaliana Ran GTPase binding / chromatin binding / zinc
           ion binding AT3G23270 mRNA, complete cds
          Length = 3138

 Score = 38.2 bits (19), Expect = 7.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 12  gaatttaggtttccctttc 30
           |||||||||||||||||||
Sbjct: 117 gaatttaggtttccctttc 99

>gb|AC137842.8| Mus musculus chromosome 15, clone RP23-91M6, complete sequence
          Length = 230609

 Score = 38.2 bits (19), Expect = 7.6
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 56     ccactagcaccatgtatgcagat 78
              |||||||||||||| ||||||||
Sbjct: 221113 ccactagcaccatggatgcagat 221091

>gb|AC144933.4| Mus musculus BAC clone RP24-531B24 from chromosome 8, complete sequence
          Length = 169667

 Score = 38.2 bits (19), Expect = 7.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 11     tgaatttaggtttcccttt 29
              |||||||||||||||||||
Sbjct: 128720 tgaatttaggtttcccttt 128702

>gb|AC118248.11| Mus musculus chromosome 8, clone RP23-379H17, complete sequence
          Length = 182510

 Score = 38.2 bits (19), Expect = 7.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 11     tgaatttaggtttcccttt 29
              |||||||||||||||||||
Sbjct: 131512 tgaatttaggtttcccttt 131530

>gb|AC115735.8| Mus musculus chromosome 15, clone RP23-470I4, complete sequence
          Length = 177117

 Score = 38.2 bits (19), Expect = 7.6
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 56    ccactagcaccatgtatgcagat 78
             |||||||||||||| ||||||||
Sbjct: 30495 ccactagcaccatggatgcagat 30473

>gb|AC023698.4| Drosophila melanogaster X BAC RP98-17C9 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 160023

 Score = 38.2 bits (19), Expect = 7.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 33    aaggaacaactaactaacg 51
             |||||||||||||||||||
Sbjct: 48757 aaggaacaactaactaacg 48739

>gb|AC110761.3| Homo sapiens BAC clone RP11-45C13 from 4, complete sequence
          Length = 153458

 Score = 38.2 bits (19), Expect = 7.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 58    actagcaccatgtatgcag 76
             |||||||||||||||||||
Sbjct: 58942 actagcaccatgtatgcag 58924

>dbj|AB025608.1| Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone:K14B15
          Length = 83689

 Score = 38.2 bits (19), Expect = 7.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 12    gaatttaggtttccctttc 30
             |||||||||||||||||||
Sbjct: 75493 gaatttaggtttccctttc 75475

>gb|AE003439.3| Drosophila melanogaster chromosome X, section 23 of 74 of the complete
              sequence
          Length = 331952

 Score = 38.2 bits (19), Expect = 7.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 33     aaggaacaactaactaacg 51
              |||||||||||||||||||
Sbjct: 182419 aaggaacaactaactaacg 182401


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 760,542
Number of Sequences: 3902068
Number of extensions: 760542
Number of successful extensions: 45403
Number of sequences better than 10.0: 12
Number of HSP's better than 10.0 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 45387
Number of HSP's gapped (non-prelim): 16
length of query: 158
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 136
effective length of database: 17,147,199,772
effective search space: 2332019168992
effective search space used: 2332019168992
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)