ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags16b18
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC123933.4| Mus musculus BAC clone RP23-339F7 from chromosome... 48 0.039
2emb|AL583836.18| Human DNA sequence from clone RP11-466J14 on ch... 48 0.039
3emb|AL928991.9| Mouse DNA sequence from clone RP23-455F5 on chro... 48 0.039
4gb|AC153371.7| Mus musculus 6 BAC RP23-304H3 (Roswell Park Cance... 46 0.15
5gb|AC153991.3| Mus musculus 6 BAC RP24-541D10 (Roswell Park Canc... 46 0.15
6gb|AC164110.4| Mus musculus BAC clone RP23-307N19 from chromosom... 44 0.60
7gb|AE017355.1| Bacillus thuringiensis serovar konkukian str. 97-... 44 0.60
8gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete... 44 0.60
9gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome 44 0.60
10gb|AC134596.3| Mus musculus BAC clone RP23-435C1 from chromosome... 44 0.60
11gb|AC111091.8| Mus musculus chromosome 3, clone RP23-165D1, comp... 44 0.60
12gb|CP000001.1| Bacillus cereus E33L, complete genome 44 0.60
13emb|CR848664.5| Zebrafish DNA sequence from clone CH211-169I9 in... 44 0.60
14gb|AE016879.1| Bacillus anthracis str. Ames, complete genome 44 0.60
15gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome 44 0.60
16gb|AE014827.1| Plasmodium falciparum 3D7 chromosome 14 section 1... 42 2.4
17gb|AC136730.9| Mus musculus chromosome 19, clone RP23-76E22, com... 42 2.4
18gb|AC119905.11| Mus musculus chromosome 17, clone RP24-238N14, c... 42 2.4
19gb|AC165233.6| Mus musculus chromosome 8, clone RP23-307O2, comp... 42 2.4
20gb|AY518540.1| Homo sapiens CDC5 cell division cycle 5-like (S. ... 42 2.4
21gb|AC163221.4| Mus musculus chromosome 19, clone RP23-376A6, com... 42 2.4
22emb|AL513549.13| Human DNA sequence from clone RP11-424H23 on ch... 42 2.4
23emb|AL449104.5| Human DNA sequence from clone RP1-173P22 on chro... 42 2.4
24emb|AL354871.12| Human DNA sequence from clone RP11-66G15 on chr... 42 2.4
25emb|AL138882.8| Human DNA sequence from clone RP1-195K21 on chro... 42 2.4
26emb|AL136091.6| Human DNA sequence from clone RP1-80E10 on chrom... 42 2.4
27emb|AL133262.8| Human DNA sequence from clone RP1-319D22 on chro... 42 2.4
28gb|AC023831.9| Homo sapiens chromosome 16 clone RP11-74E23, comp... 42 2.4
29gb|AC108050.5| Homo sapiens BAC clone RP11-331M18 from 4, comple... 42 2.4
30gb|AY062031.1| Homo sapiens hypocretin receptor 2 (HCRTR2) gene,... 42 2.4
31gb|AC068304.33| Homo sapiens 12 BAC RP11-515A6 (Roswell Park Can... 42 2.4
32ref|XM_688948.1| PREDICTED: Danio rerio collagen, type IV, alpha... 42 2.4
33ref|XM_626936.1| Cryptosporidium parvum Iowa II hypothetical pro... 42 2.4
34emb|BX248117.9| Zebrafish DNA sequence from clone CH211-226D5, c... 42 2.4
35gb|AC009133.7| Homo sapiens chromosome 16 clone RP11-504I2, comp... 42 2.4
36dbj|AB028622.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 42 2.4
37emb|BX664610.10| Zebrafish DNA sequence from clone DKEY-11N6 in ... 42 2.4
38gb|AC007446.8|AC007446 Homo sapiens, clone hRPK.67_A_1, complete... 42 2.4
39emb|AL935294.6| Zebrafish DNA sequence from clone CH211-239I4, c... 42 2.4
40ref|XM_639864.1| Dictyostelium discoideum hypothetical protein (... 40 9.4
41gb|AC151731.4| Mus musculus BAC clone RP23-401H13 from chromosom... 40 9.4
42ref|NM_001002979.1| Canis familiaris collagen, type IV, alpha 5 ... 40 9.4
43gb|CP000141.1| Carboxydothermus hydrogenoformans Z-2901, complet... 40 9.4
44gb|AF074021.1| Arabidopsis thaliana BAC F4H6, chromosome IV, com... 40 9.4
45gb|AC150888.5| Bos taurus BAC CH240-475A10 (Children's Hospital... 40 9.4
46gb|AC115145.5| Rattus norvegicus 1 BAC CH230-201L12 (Children's ... 40 9.4
47ref|XM_610590.2| PREDICTED: Bos taurus similar to Exosome comple... 40 9.4
48gb|AC113176.8| Mus musculus chromosome 3, clone RP23-453A2, comp... 40 9.4
49gb|AF470624.2| Canis familiaris type IV collagen alpha 5 (COL4A5... 40 9.4
50gb|AC110038.25| Mus musculus chromosome 1, clone RP23-258M15, co... 40 9.4
51gb|AC121290.6| Mus musculus chromosome 16, clone RP23-84N4, comp... 40 9.4
52gb|AC099735.47| Mus musculus chromosome 1, clone RP23-218I9, com... 40 9.4
53gb|AC140373.2| Mus musculus BAC clone RP23-197O10 from chromosom... 40 9.4
54gb|AY208849.1| Dictyostelium discoideum putative FHA-HIT mRNA, c... 40 9.4
55gb|AC148217.15| Medicago truncatula clone mth2-20c19, complete s... 40 9.4
56emb|AL593844.4| Human DNA sequence from clone RP11-406O16 on chr... 40 9.4
57emb|AL590381.4| Human DNA sequence from clone RP11-373O10 on chr... 40 9.4
58emb|AL450312.10| Human DNA sequence from clone RP11-138L24 on ch... 40 9.4
59emb|AL353756.5| Human DNA sequence from clone RP11-415D9 on chro... 40 9.4
60emb|AL138706.9| Human DNA sequence from clone RP11-421P11 on chr... 40 9.4
61emb|AL049696.9|HSJ279A18 Human DNA sequence from clone RP1-279A1... 40 9.4
62gb|AC158972.4| Mus musculus chromosome 15, clone RP24-225M16, co... 40 9.4
63emb|AL034452.8|HS682J15 Human DNA sequence from clone RP4-682J15... 40 9.4
64gb|AC159969.4| Mus musculus chromosome 3, clone RP23-301F20, com... 40 9.4
65gb|AC116544.1| Homo sapiens 3 BAC RP11-21M4 (Roswell Park Cancer... 40 9.4
66emb|Z99110.2|BSUB0007 Bacillus subtilis complete genome (section... 40 9.4
67emb|Z70177.1|BSPBSXSE B.subtilis DNA (28 kb PBSX/skin element re... 40 9.4
68emb|Z34287.1|BSGENDNA B.subtilis (SO113) genomic DNA (5425bp) 40 9.4
69gb|AC162867.5| Mus musculus chromosome 8, clone RP24-363D7, comp... 40 9.4
70gb|AC162519.4| Mus musculus chromosome 8, clone RP24-146M21, com... 40 9.4
71emb|AL831789.6| Zebrafish DNA sequence from clone CH211-207O21 i... 40 9.4
72emb|AL161501.2|ATCHRIV13 Arabidopsis thaliana DNA chromosome 4, ... 40 9.4
73gb|AF054982.1| Caenorhabditis briggsae putative PP2C protein pho... 40 9.4
74gb|AC109633.5| Homo sapiens chromosome 8, clone CTD-2024D23, com... 40 9.4
75gb|AF411809.1| Lycopersicon esculentum BAC clone FW2.2, complete... 40 9.4
76gb|AC105917.5| Homo sapiens BAC clone RP11-395C17 from 4, comple... 40 9.4
77gb|AC008492.3| Homo sapiens chromosome 5 clone CTC-427F23, compl... 40 9.4
78gb|AF438327.1| Homo sapiens alpha 1 type XXI collagen precursor ... 40 9.4
79gb|AC097067.3| Homo sapiens BAC clone RP11-558N14 from 4, comple... 40 9.4
80gb|AC011196.7| Homo sapiens chromosome , clone RP11-48J4, comple... 40 9.4
81gb|AC008621.8| Homo sapiens chromosome 5 clone CTB-147K10, compl... 40 9.4
82gb|AC157661.2| Mus musculus BAC clone RP23-233F23 from chromosom... 40 9.4
83gb|AC022603.5|AC022603 Homo sapiens chromosome 15, clone RP11-20... 40 9.4
84gb|AC008486.6|AC008486 Homo sapiens chromosome 5 clone CTC-421B9... 40 9.4
85gb|AC063979.4|AC063979 Homo sapiens chromosome 5 clone RP11-474H... 40 9.4
86ref|XM_624733.1| PREDICTED: Apis mellifera similar to ENSANGP000... 40 9.4
87gb|AC090883.1|AC090883 Homo sapiens chromosome 3 clone RP11-117G... 40 9.4
88gb|AC068660.3|AC068660 Homo sapiens chromosome 5 clone CTC-349J2... 40 9.4
89gb|AC069137.6| Homo sapiens BAC clone RP11-750D14 from 2, comple... 40 9.4
90gb|AC154545.2| Mus musculus BAC clone RP23-431G16 from chromosom... 40 9.4
91gb|AC117075.2| Dictyostelium discoideum chromosome 2 map 5201047... 40 9.4
92gb|AC115682.2| Dictyostelium discoideum chromosome 2 map 4101105... 40 9.4
93gb|AC084647.1|CBRG45M10 Caenorhabditis briggsae cosmid G45M10, c... 40 9.4
94gb|AY078501.1| Canis familiaris type IV collagen alpha 5 chain (... 40 9.4
95gb|AC079437.2| Rattus norvegicus strain Brown Norway chromosome ... 40 9.4
96ref|XM_222675.3| PREDICTED: Rattus norvegicus crumbs homolog 1 (... 40 9.4
97gb|AC083811.22| Homo sapiens 12 BAC RP11-810G6 (Roswell Park Can... 40 9.4
98gb|AC027125.5| Homo sapiens chromosome 3 clone RP11-584M7 map 3p... 40 9.4
99gb|AC136365.5| Homo sapiens chromosome 8, clone RP11-97P4, compl... 40 9.4
100gb|AC025416.4|AC025416 Genomic sequence for Arabidopsis thaliana... 40 9.4
101gb|AC008843.5|AC008843 Homo sapiens chromosome 5 clone CTD-2156N... 40 9.4
102emb|CR392368.7| Zebrafish DNA sequence from clone DKEY-86E18 in ... 40 9.4
103gb|AC110174.10| Mus musculus chromosome 3, clone RP23-293K21, co... 40 9.4
104dbj|AP001034.5| Homo sapiens genomic DNA, chromosome 11q clone:R... 40 9.4
105emb|BX511083.17| Zebrafish DNA sequence from clone CH211-195F22 ... 40 9.4
106dbj|AB010875.1| Arabidopsis thaliana gene for PHR1, complete cds 40 9.4
107gb|U07888.1|CFU07888 Canis familiaris Samoyed collagen type IV A... 40 9.4
108gb|AC102591.14| Mus musculus chromosome 3, clone RP23-336B10, co... 40 9.4
109emb|AL663048.12| Mouse DNA sequence from clone RP23-166N12 on ch... 40 9.4
110dbj|AP000945.5| Homo sapiens genomic DNA, chromosome 18p clone:R... 40 9.4

>gb|AC123933.4| Mus musculus BAC clone RP23-339F7 from chromosome 2, complete sequence
          Length = 201267

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 91    ctggattttgttgattttgatgtt 114
             ||||||||||||||||||||||||
Sbjct: 27551 ctggattttgttgattttgatgtt 27574



to top

>emb|AL583836.18| Human DNA sequence from clone RP11-466J14 on chromosome 10 Contains the
             CYP2C18 gene for  cytochrome P450 family 2 subfamily C
             polypeptide 18, a pseudogene similar to part of NADH
             dehydrogenase 4 (MTND4) and the 5' end of the CYP2C19 gene
             for cytochrome P450 family 2 subfamily C polypeptide 19,
             complete sequence
          Length = 115177

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 95    attttgttgattttgatgttattg 118
             ||||||||||||||||||||||||
Sbjct: 25137 attttgttgattttgatgttattg 25160



to top

>emb|AL928991.9| Mouse DNA sequence from clone RP23-455F5 on chromosome 2, complete
              sequence
          Length = 149871

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 91     ctggattttgttgattttgatgtt 114
              ||||||||||||||||||||||||
Sbjct: 143788 ctggattttgttgattttgatgtt 143765



to top

>gb|AC153371.7| Mus musculus 6 BAC RP23-304H3 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 206412

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 512   aattctgcttacaagacaccaat 534
             |||||||||||||||||||||||
Sbjct: 62202 aattctgcttacaagacaccaat 62224



to top

>gb|AC153991.3| Mus musculus 6 BAC RP24-541D10 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 202289

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 512    aattctgcttacaagacaccaat 534
              |||||||||||||||||||||||
Sbjct: 161954 aattctgcttacaagacaccaat 161976



to top

>gb|AC164110.4| Mus musculus BAC clone RP23-307N19 from chromosome 12, complete sequence
          Length = 201050

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 659    aatgaaaataggagttttataa 680
              ||||||||||||||||||||||
Sbjct: 105046 aatgaaaataggagttttataa 105067



to top

>gb|AE017355.1| Bacillus thuringiensis serovar konkukian str. 97-27, complete genome
          Length = 5237682

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 464    gaaccaaaagttgaaaacattg 485
              ||||||||||||||||||||||
Sbjct: 725871 gaaccaaaagttgaaaacattg 725892



to top

>gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete genome
          Length = 5227419

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 464    gaaccaaaagttgaaaacattg 485
              ||||||||||||||||||||||
Sbjct: 734981 gaaccaaaagttgaaaacattg 735002



to top

>gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome
          Length = 5228663

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 464    gaaccaaaagttgaaaacattg 485
              ||||||||||||||||||||||
Sbjct: 734876 gaaccaaaagttgaaaacattg 734897



to top

>gb|AC134596.3| Mus musculus BAC clone RP23-435C1 from chromosome 12, complete
            sequence
          Length = 193068

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 659  aatgaaaataggagttttataa 680
            ||||||||||||||||||||||
Sbjct: 3185 aatgaaaataggagttttataa 3164



to top

>gb|AC111091.8| Mus musculus chromosome 3, clone RP23-165D1, complete sequence
          Length = 188735

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 594    aacctaagcaggaagaaaagaa 615
              ||||||||||||||||||||||
Sbjct: 109494 aacctaagcaggaagaaaagaa 109515



to top

>gb|CP000001.1| Bacillus cereus E33L, complete genome
          Length = 5300915

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 464    gaaccaaaagttgaaaacattg 485
              ||||||||||||||||||||||
Sbjct: 724885 gaaccaaaagttgaaaacattg 724906



to top

>emb|CR848664.5| Zebrafish DNA sequence from clone CH211-169I9 in linkage group 15,
            complete sequence
          Length = 139504

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 594  aacctaagcaggaagaaaagaa 615
            ||||||||||||||||||||||
Sbjct: 6204 aacctaagcaggaagaaaagaa 6225



to top

>gb|AE016879.1| Bacillus anthracis str. Ames, complete genome
          Length = 5227293

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 464    gaaccaaaagttgaaaacattg 485
              ||||||||||||||||||||||
Sbjct: 734980 gaaccaaaagttgaaaacattg 735001



to top

>gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome
          Length = 5224283

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 464    gaaccaaaagttgaaaacattg 485
              ||||||||||||||||||||||
Sbjct: 811576 gaaccaaaagttgaaaacattg 811597



to top

>gb|AE014827.1| Plasmodium falciparum 3D7 chromosome 14 section 12 of 13 of the
             complete sequence
          Length = 254436

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 298   attttttcattgtttattctt 318
             |||||||||||||||||||||
Sbjct: 86607 attttttcattgtttattctt 86587



to top

>gb|AC136730.9| Mus musculus chromosome 19, clone RP23-76E22, complete sequence
          Length = 146616

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 95    attttgttgattttgatgttattga 119
             ||||||||| |||||||||||||||
Sbjct: 78701 attttgttgtttttgatgttattga 78677



to top

>gb|AC119905.11| Mus musculus chromosome 17, clone RP24-238N14, complete sequence
          Length = 179042

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 477   aaaacattgttgatgttaagaacaa 501
             |||||||||||||| ||||||||||
Sbjct: 98449 aaaacattgttgatattaagaacaa 98473



to top

>gb|AC165233.6| Mus musculus chromosome 8, clone RP23-307O2, complete sequence
          Length = 158925

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 102   tgattttgatgttattgagaa 122
             |||||||||||||||||||||
Sbjct: 70482 tgattttgatgttattgagaa 70502



to top

>gb|AY518540.1| Homo sapiens CDC5 cell division cycle 5-like (S. pombe) (CDC5L) gene,
             complete cds
          Length = 63393

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                              
Query: 81    aatcatttatctggattttgttgattttgatgt 113
             |||||||| ||| |||||||| |||||||||||
Sbjct: 42709 aatcatttctcttgattttgtagattttgatgt 42741



to top

>gb|AC163221.4| Mus musculus chromosome 19, clone RP23-376A6, complete sequence
          Length = 188740

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 95     attttgttgattttgatgttattga 119
              ||||||||| |||||||||||||||
Sbjct: 143197 attttgttgtttttgatgttattga 143173



to top

>emb|AL513549.13| Human DNA sequence from clone RP11-424H23 on chromosome 6 Contains part
             of a novel gene (FLJ20342), complete sequence
          Length = 131374

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 641   aatttttcaactggaatgaat 661
             |||||||||||||||||||||
Sbjct: 14048 aatttttcaactggaatgaat 14028



to top

>emb|AL449104.5| Human DNA sequence from clone RP1-173P22 on chromosome 6 Contains the
             3' end of the HCRTR2 gene for hypocretin (orexin) receptor
             2, complete sequence
          Length = 120466

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                              
Query: 599   aagcaggaagaaaagaatcgatcacctccaagt 631
             |||||||||||||| |||  |||||||||||||
Sbjct: 48710 aagcaggaagaaaaaaatgcatcacctccaagt 48678



to top

>emb|AL354871.12| Human DNA sequence from clone RP11-66G15 on chromosome 13, complete
             sequence
          Length = 96159

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 105   ttttgatgttattgagaatca 125
             |||||||||||||||||||||
Sbjct: 25206 ttttgatgttattgagaatca 25186



to top

>emb|AL138882.8| Human DNA sequence from clone RP1-195K21 on chromosome 6 Contains part
             of the KHDRBS2 gene for KH domain containing RNA binding
             signal transduction associated protein 2, complete
             sequence
          Length = 75512

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 213   tgagtctaagaaagcatttggaatt 237
             ||||||||||| |||||||||||||
Sbjct: 67018 tgagtctaagacagcatttggaatt 66994



to top

>emb|AL136091.6| Human DNA sequence from clone RP1-80E10 on chromosome 6 Contains the
            3' end of a ribosomal protein S15a (RPS15A) pseudogene,
            complete sequence
          Length = 16242

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 281  agttttttagctccagtattttttc 305
            ||||||| |||||||||||||||||
Sbjct: 4939 agtttttcagctccagtattttttc 4963



to top

>emb|AL133262.8| Human DNA sequence from clone RP1-319D22 on chromosome 6 Contains the
            3' end of a novel gene (possible ortholog of rodent
            CDC5-like protein), complete sequence
          Length = 86372

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                             
Query: 81   aatcatttatctggattttgttgattttgatgt 113
            |||||||| ||| |||||||| |||||||||||
Sbjct: 5837 aatcatttctcttgattttgtagattttgatgt 5869



to top

>gb|AC023831.9| Homo sapiens chromosome 16 clone RP11-74E23, complete sequence
          Length = 174007

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 295    agtattttttcattgtttattcttc 319
              |||||||||||||||| ||||||||
Sbjct: 105377 agtattttttcattgtctattcttc 105401



to top

>gb|AC108050.5| Homo sapiens BAC clone RP11-331M18 from 4, complete sequence
          Length = 214250

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 425    gaggttcgtgtggaagaaact 445
              |||||||||||||||||||||
Sbjct: 168787 gaggttcgtgtggaagaaact 168807



to top

>gb|AY062031.1| Homo sapiens hypocretin receptor 2 (HCRTR2) gene, complete cds
          Length = 168575

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                              
Query: 599   aagcaggaagaaaagaatcgatcacctccaagt 631
             |||||||||||||| |||  |||||||||||||
Sbjct: 83306 aagcaggaagaaaaaaatgcatcacctccaagt 83274



to top

>gb|AC068304.33| Homo sapiens 12 BAC RP11-515A6 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 155413

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 213    tgagtctaagaaagcatttggaatt 237
              ||||||||||| |||||||||||||
Sbjct: 112276 tgagtctaagacagcatttggaatt 112252



to top

>ref|XM_688948.1| PREDICTED: Danio rerio collagen, type IV, alpha 5 (col4a5), mRNA
          Length = 4876

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 470  aaagttgaaaacattgttgatgtta 494
            ||||||| |||||||||||||||||
Sbjct: 3648 aaagttgcaaacattgttgatgtta 3624



to top

>ref|XM_626936.1| Cryptosporidium parvum Iowa II hypothetical protein (cgd3_3900),
           partial mRNA
          Length = 3024

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 115 attgagaatcatcaatcaatt 135
           |||||||||||||||||||||
Sbjct: 727 attgagaatcatcaatcaatt 747



to top

>emb|BX248117.9| Zebrafish DNA sequence from clone CH211-226D5, complete sequence
          Length = 181542

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 656    atgaatgaaaataggagttttataa 680
              ||||||||||||||||||| |||||
Sbjct: 102769 atgaatgaaaataggagttatataa 102745



to top

>gb|AC009133.7| Homo sapiens chromosome 16 clone RP11-504I2, complete sequence
          Length = 174363

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 295    agtattttttcattgtttattcttc 319
              |||||||||||||||| ||||||||
Sbjct: 164784 agtattttttcattgtctattcttc 164808



to top

>dbj|AB028622.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MZN24
          Length = 82348

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 467   ccaaaagttgaaaacattgtt 487
             |||||||||||||||||||||
Sbjct: 38044 ccaaaagttgaaaacattgtt 38024



to top

>emb|BX664610.10| Zebrafish DNA sequence from clone DKEY-11N6 in linkage group 22, complete
              sequence
          Length = 206964

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 295    agtattttttcattgtttatt 315
              |||||||||||||||||||||
Sbjct: 127317 agtattttttcattgtttatt 127337



to top

>gb|AC007446.8|AC007446 Homo sapiens, clone hRPK.67_A_1, complete sequence
          Length = 177471

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 213   tgagtctaagaaagcatttggaatt 237
             ||||||||||| |||||||||||||
Sbjct: 32957 tgagtctaagacagcatttggaatt 32981



to top

>emb|AL935294.6| Zebrafish DNA sequence from clone CH211-239I4, complete sequence
          Length = 168302

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 656    atgaatgaaaataggagttttataa 680
              ||||||||||||||||||| |||||
Sbjct: 102530 atgaatgaaaataggagttatataa 102554



to top

>ref|XM_639864.1| Dictyostelium discoideum hypothetical protein (DDB0201560), partial
           mRNA
          Length = 1173

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 99  tgttgattttgatgttattg 118
           ||||||||||||||||||||
Sbjct: 597 tgttgattttgatgttattg 578



to top

>gb|AC151731.4| Mus musculus BAC clone RP23-401H13 from chromosome 9, complete sequence
          Length = 193536

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 471    aagttgaaaacattgttgatgtta 494
              ||||||||||||||||| ||||||
Sbjct: 167825 aagttgaaaacattgtttatgtta 167802



to top

>ref|NM_001002979.1| Canis familiaris collagen, type IV, alpha 5 (Alport syndrome)
            (COL4A5), mRNA
          Length = 5681

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 470  aaagttgaaaacattgttgatgtt 493
            ||||||| ||||||||||||||||
Sbjct: 4781 aaagttgcaaacattgttgatgtt 4758



to top

>gb|CP000141.1| Carboxydothermus hydrogenoformans Z-2901, complete genome
          Length = 2401520

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 99      tgttgattttgatgttattgagaa 122
               |||||||||||||| |||||||||
Sbjct: 2355748 tgttgattttgatgctattgagaa 2355725



to top

>gb|AF074021.1| Arabidopsis thaliana BAC F4H6, chromosome IV, complete sequence
          Length = 103632

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 95     attttgttgattttgatgtt 114
              ||||||||||||||||||||
Sbjct: 101759 attttgttgattttgatgtt 101740



to top

>gb|AC150888.5| Bos taurus  BAC CH240-475A10 (Children's Hospital Oakland Research
             Institute Bovine BAC Library (male)) complete sequence
          Length = 186059

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 561   acatatattctcttgatcaa 580
             ||||||||||||||||||||
Sbjct: 57691 acatatattctcttgatcaa 57672



to top

>gb|AC115145.5| Rattus norvegicus 1 BAC CH230-201L12 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 129506

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 299   ttttttcattgtttattctt 318
             ||||||||||||||||||||
Sbjct: 40093 ttttttcattgtttattctt 40112



to top

>ref|XM_610590.2| PREDICTED: Bos taurus similar to Exosome complex exonuclease RRP43
           (Ribosomal RNA processing protein 43) (Exosome component
           8) (p9) (Opa-interacting protein 2) (LOC532080), partial
           mRNA
          Length = 629

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 403 gtttctttcagttccttatgtgga 426
           |||||||||||||||| |||||||
Sbjct: 128 gtttctttcagttcctaatgtgga 151



to top

>gb|AC113176.8| Mus musculus chromosome 3, clone RP23-453A2, complete sequence
          Length = 217606

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 633   ctcatgagaatttttcaact 652
             ||||||||||||||||||||
Sbjct: 64452 ctcatgagaatttttcaact 64471



to top

>gb|AF470624.2| Canis familiaris type IV collagen alpha 5 (COL4A5) mRNA, complete cds
          Length = 5681

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 470  aaagttgaaaacattgttgatgtt 493
            ||||||| ||||||||||||||||
Sbjct: 4781 aaagttgcaaacattgttgatgtt 4758



to top

>gb|AC110038.25| Mus musculus chromosome 1, clone RP23-258M15, complete sequence
          Length = 232830

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 547    tccttcagttttgaacatat 566
              ||||||||||||||||||||
Sbjct: 142319 tccttcagttttgaacatat 142338



to top

>gb|AC121290.6| Mus musculus chromosome 16, clone RP23-84N4, complete sequence
          Length = 241184

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 90    tctggattttgttgattttg 109
             ||||||||||||||||||||
Sbjct: 31550 tctggattttgttgattttg 31569



to top

>gb|AC099735.47| Mus musculus chromosome 1, clone RP23-218I9, complete sequence
          Length = 207768

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 547   tccttcagttttgaacatat 566
             ||||||||||||||||||||
Sbjct: 11974 tccttcagttttgaacatat 11993



to top

>gb|AC140373.2| Mus musculus BAC clone RP23-197O10 from chromosome 15, complete
             sequence
          Length = 215314

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 96    ttttgttgattttgatgttattga 119
             |||||||||||||| |||||||||
Sbjct: 89301 ttttgttgattttgttgttattga 89278



to top

>gb|AY208849.1| Dictyostelium discoideum putative FHA-HIT mRNA, complete cds
          Length = 1318

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 99  tgttgattttgatgttattg 118
           ||||||||||||||||||||
Sbjct: 642 tgttgattttgatgttattg 623



to top

>gb|AC148217.15| Medicago truncatula clone mth2-20c19, complete sequence
          Length = 113210

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 92    tggattttgttgattttgat 111
             ||||||||||||||||||||
Sbjct: 54416 tggattttgttgattttgat 54435



to top

>emb|AL593844.4| Human DNA sequence from clone RP11-406O16 on chromosome 6 Contains the 3'
              part of a novel gene, complete sequence
          Length = 157929

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 96     ttttgttgattttgatgttattga 119
              ||||||||||||||||| ||||||
Sbjct: 101626 ttttgttgattttgatgctattga 101603



to top

>emb|AL590381.4| Human DNA sequence from clone RP11-373O10 on chromosome 9, complete
             sequence
          Length = 182430

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 649   aactggaatgaatgaaaata 668
             ||||||||||||||||||||
Sbjct: 56399 aactggaatgaatgaaaata 56380



to top

>emb|AL450312.10| Human DNA sequence from clone RP11-138L24 on chromosome 9, complete
             sequence
          Length = 164559

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 97    tttgttgattttgatgttat 116
             ||||||||||||||||||||
Sbjct: 64291 tttgttgattttgatgttat 64272



to top

>emb|AL353756.5| Human DNA sequence from clone RP11-415D9 on chromosome 9, complete
             sequence
          Length = 146155

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 96    ttttgttgattttgatgttattga 119
             |||||||||| |||||||||||||
Sbjct: 80945 ttttgttgatgttgatgttattga 80968



to top

>emb|AL138706.9| Human DNA sequence from clone RP11-421P11 on chromosome 13 Contains the
              MADH9 gene for MAD (mothers against decapentaplegic homolog
              9 (Drosophila), the gene for dolichyl-phosphate
              beta-glucosyltransferase (ALG5), the gene for
              Opa-interacting protein 2 (OIP2), the 3' end of the gene
              for transcription factor (p38 interacting protein)
              (P38IP)part of as novel gene, a RPL29 pseudogene, a
              MAP2K1IP1 pseudogene and a CpG island, complete sequence
          Length = 195032

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 403    gtttctttcagttccttatgtgga 426
              |||||||||||||||| |||||||
Sbjct: 162953 gtttctttcagttcctaatgtgga 162976



to top

>emb|AL049696.9|HSJ279A18 Human DNA sequence from clone RP1-279A18 on chromosome 6q13-15 Contains
             the 3' part of the BCKDHB gene for branched chain keto
             acid dehydrogenase E1, beta polypeptide (maple syrup urine
             disease), complete sequence
          Length = 142707

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 299   ttttttcattgtttattctt 318
             ||||||||||||||||||||
Sbjct: 77236 ttttttcattgtttattctt 77217



to top

>gb|AC158972.4| Mus musculus chromosome 15, clone RP24-225M16, complete sequence
          Length = 163900

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 547   tccttcagttttgaacatatattctctt 574
             |||||||||||| | |||||||||||||
Sbjct: 90533 tccttcagttttaagcatatattctctt 90506



to top

>emb|AL034452.8|HS682J15 Human DNA sequence from clone RP4-682J15 on chromosome 6p11.2-12.3
              Contains the 3' end of the COL21A1 gene for collagen, type
              XXI, alpha 1 (collagen XXI, collagen, type XX, alpha 1,
              COLA1L, COL20A1, DKFZp564B052), complete sequence
          Length = 118431

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 637    tgagaatttttcaactggaa 656
              ||||||||||||||||||||
Sbjct: 108171 tgagaatttttcaactggaa 108152



to top

>gb|AC159969.4| Mus musculus chromosome 3, clone RP23-301F20, complete sequence
          Length = 187487

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 633   ctcatgagaatttttcaact 652
             ||||||||||||||||||||
Sbjct: 96761 ctcatgagaatttttcaact 96742



to top

>gb|AC116544.1| Homo sapiens 3 BAC RP11-21M4 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 112189

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Plus

                                          
Query: 652    tggaatgaatga-aaataggagttttat 678
              |||||||||||| |||||||||||||||
Sbjct: 106338 tggaatgaatgataaataggagttttat 106365



to top

>emb|Z99110.2|BSUB0007 Bacillus subtilis complete genome (section 7 of 21): from 1209742 to
              1410982
          Length = 201241

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 600    agcaggaagaaaagaatcgatcac 623
              |||||||||||| |||||||||||
Sbjct: 114516 agcaggaagaaatgaatcgatcac 114539



to top

>emb|Z70177.1|BSPBSXSE B.subtilis DNA (28 kb PBSX/skin element region)
          Length = 28000

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 600  agcaggaagaaaagaatcgatcac 623
            |||||||||||| |||||||||||
Sbjct: 4077 agcaggaagaaatgaatcgatcac 4100



to top

>emb|Z34287.1|BSGENDNA B.subtilis (SO113) genomic DNA (5425bp)
          Length = 5245

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 600  agcaggaagaaaagaatcgatcac 623
            |||||||||||| |||||||||||
Sbjct: 4078 agcaggaagaaatgaatcgatcac 4101



to top

>gb|AC162867.5| Mus musculus chromosome 8, clone RP24-363D7, complete sequence
          Length = 187070

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 302    tttcattgtttattcttctttcat 325
              ||||||| ||||||||||||||||
Sbjct: 175638 tttcattttttattcttctttcat 175615



to top

>gb|AC162519.4| Mus musculus chromosome 8, clone RP24-146M21, complete sequence
          Length = 150115

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 302    tttcattgtttattcttctttcat 325
              ||||||| ||||||||||||||||
Sbjct: 148112 tttcattttttattcttctttcat 148135



to top

>emb|AL831789.6| Zebrafish DNA sequence from clone CH211-207O21 in linkage group 14
             Contains the zebrafish fgf24 gene for fibroblast growth
             factor 24, a novel gene for a RING finger protein, the
             lbx1h gene for lady bird-like homeobox 1 homolog,
             (Drosophila) and eight CpG islands, complete sequence
          Length = 217649

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 657   tgaatgaaaataggagttttataa 680
             |||||||||||||||||| |||||
Sbjct: 11293 tgaatgaaaataggagttatataa 11316



to top

>emb|AL161501.2|ATCHRIV13 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 13
          Length = 200001

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 95    attttgttgattttgatgtt 114
             ||||||||||||||||||||
Sbjct: 68430 attttgttgattttgatgtt 68411



to top

>gb|AF054982.1| Caenorhabditis briggsae putative PP2C protein phosphatase FEM-2
            (fem-2) gene, complete cds
          Length = 3766

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 660  atgaaaataggagttttata 679
            ||||||||||||||||||||
Sbjct: 2426 atgaaaataggagttttata 2445



to top

>gb|AC109633.5| Homo sapiens chromosome 8, clone CTD-2024D23, complete sequence
          Length = 134242

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 158   taactcatattaagaatgat 177
             ||||||||||||||||||||
Sbjct: 12721 taactcatattaagaatgat 12702



to top

>gb|AF411809.1| Lycopersicon esculentum BAC clone FW2.2, complete sequence
          Length = 127892

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 302   tttcattgtttattcttctt 321
             ||||||||||||||||||||
Sbjct: 94374 tttcattgtttattcttctt 94355



to top

>gb|AC105917.5| Homo sapiens BAC clone RP11-395C17 from 4, complete sequence
          Length = 191323

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 96    ttttgttgattttgatgttattga 119
             |||||||||| |||||||||||||
Sbjct: 70319 ttttgttgatgttgatgttattga 70296



to top

>gb|AC008492.3| Homo sapiens chromosome 5 clone CTC-427F23, complete sequence
          Length = 138127

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 310   tttattcttctttcatttgtagct 333
             |||| |||||||||||||||||||
Sbjct: 66015 tttaatcttctttcatttgtagct 65992



to top

>gb|AF438327.1| Homo sapiens alpha 1 type XXI collagen precursor (COL21A1) gene, complete
              cds, alternatively spliced
          Length = 381696

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 637    tgagaatttttcaactggaa 656
              ||||||||||||||||||||
Sbjct: 337996 tgagaatttttcaactggaa 338015



to top

>gb|AC097067.3| Homo sapiens BAC clone RP11-558N14 from 4, complete sequence
          Length = 136500

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 307    ttgtttattcttctttcatt 326
              ||||||||||||||||||||
Sbjct: 113069 ttgtttattcttctttcatt 113088



to top

>gb|AC011196.7| Homo sapiens chromosome , clone RP11-48J4, complete sequence
          Length = 144138

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 654   gaatgaatgaaaataggagt 673
             ||||||||||||||||||||
Sbjct: 16731 gaatgaatgaaaataggagt 16750



to top

>gb|AC008621.8| Homo sapiens chromosome 5 clone CTB-147K10, complete sequence
          Length = 67086

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 310   tttattcttctttcatttgtagct 333
             |||| |||||||||||||||||||
Sbjct: 39526 tttaatcttctttcatttgtagct 39503



to top

>gb|AC157661.2| Mus musculus BAC clone RP23-233F23 from chromosome 3, complete sequence
          Length = 195603

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 94     gattttgttgattttgatgttatt 117
              |||||||||||||| |||||||||
Sbjct: 118777 gattttgttgatttagatgttatt 118800



to top

>gb|AC022603.5|AC022603 Homo sapiens chromosome 15, clone RP11-20B10, complete sequence
          Length = 153223

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 654    gaatgaatgaaaataggagt 673
              ||||||||||||||||||||
Sbjct: 141744 gaatgaatgaaaataggagt 141763



to top

>gb|AC008486.6|AC008486 Homo sapiens chromosome 5 clone CTC-421B9, complete sequence
          Length = 124124

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 310  tttattcttctttcatttgtagct 333
            |||| |||||||||||||||||||
Sbjct: 5157 tttaatcttctttcatttgtagct 5180



to top

>gb|AC063979.4|AC063979 Homo sapiens chromosome 5 clone RP11-474H20, complete sequence
          Length = 173660

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 597   ctaagcaggaagaaaagaat 616
             ||||||||||||||||||||
Sbjct: 56827 ctaagcaggaagaaaagaat 56846



to top

>ref|XM_624733.1| PREDICTED: Apis mellifera similar to ENSANGP00000017682
           (LOC552357), mRNA
          Length = 1722

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 465 aaccaaaagttgaaaacatt 484
           ||||||||||||||||||||
Sbjct: 656 aaccaaaagttgaaaacatt 637



to top

>gb|AC090883.1|AC090883 Homo sapiens chromosome 3 clone RP11-117G9 map 3p, complete sequence
          Length = 172400

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 542    gttcgtccttcagttttgaa 561
              ||||||||||||||||||||
Sbjct: 108751 gttcgtccttcagttttgaa 108770



to top

>gb|AC068660.3|AC068660 Homo sapiens chromosome 5 clone CTC-349J2, complete sequence
          Length = 172188

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 310    tttattcttctttcatttgtagct 333
              |||| |||||||||||||||||||
Sbjct: 167925 tttaatcttctttcatttgtagct 167902



to top

>gb|AC069137.6| Homo sapiens BAC clone RP11-750D14 from 2, complete sequence
          Length = 108836

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 297   tattttttcattgtttattcttct 320
             |||||||| |||||||||||||||
Sbjct: 67431 tattttttaattgtttattcttct 67454



to top

>gb|AC154545.2| Mus musculus BAC clone RP23-431G16 from chromosome 16, complete sequence
          Length = 202933

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 90     tctggattttgttgattttg 109
              ||||||||||||||||||||
Sbjct: 202700 tctggattttgttgattttg 202719



to top

>gb|AC117075.2| Dictyostelium discoideum chromosome 2 map 5201047-5455781 strain AX4,
             complete sequence
          Length = 254733

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 99    tgttgattttgatgttattg 118
             ||||||||||||||||||||
Sbjct: 65456 tgttgattttgatgttattg 65437



to top

>gb|AC115682.2| Dictyostelium discoideum chromosome 2 map 4101105-4158643 strain AX4,
            complete sequence
          Length = 57538

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 299  ttttttcattgtttattcttcttt 322
            |||||||||| |||||||||||||
Sbjct: 2989 ttttttcattttttattcttcttt 2966



to top

>gb|AC084647.1|CBRG45M10 Caenorhabditis briggsae cosmid G45M10, complete sequence
          Length = 39742

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 660  atgaaaataggagttttata 679
            ||||||||||||||||||||
Sbjct: 3099 atgaaaataggagttttata 3080



to top

>gb|AY078501.1| Canis familiaris type IV collagen alpha 5 chain (COL4A5) mRNA,
            partial cds
          Length = 5073

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 470  aaagttgaaaacattgttgatgtt 493
            ||||||| ||||||||||||||||
Sbjct: 4625 aaagttgcaaacattgttgatgtt 4602



to top

>gb|AC079437.2| Rattus norvegicus strain Brown Norway chromosome 4 clone RP31-275K4,
             complete sequence
          Length = 109809

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 557   ttgaacatatattctcttga 576
             ||||||||||||||||||||
Sbjct: 59788 ttgaacatatattctcttga 59769



to top

>ref|XM_222675.3| PREDICTED: Rattus norvegicus crumbs homolog 1 (Drosophila)
            (predicted) (Crb1_predicted), mRNA
          Length = 4236

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 115  attgagaatcatcaatcaat 134
            ||||||||||||||||||||
Sbjct: 1519 attgagaatcatcaatcaat 1538



to top

>gb|AC083811.22| Homo sapiens 12 BAC RP11-810G6 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 173067

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 475    tgaaaacattgttgatgttaagaa 498
              |||||||||| |||||||||||||
Sbjct: 113983 tgaaaacatttttgatgttaagaa 113960



to top

>gb|AC027125.5| Homo sapiens chromosome 3 clone RP11-584M7 map 3p, complete sequence
          Length = 173842

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 542   gttcgtccttcagttttgaa 561
             ||||||||||||||||||||
Sbjct: 50232 gttcgtccttcagttttgaa 50251



to top

>gb|AC136365.5| Homo sapiens chromosome 8, clone RP11-97P4, complete sequence
          Length = 143756

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 158    taactcatattaagaatgat 177
              ||||||||||||||||||||
Sbjct: 143002 taactcatattaagaatgat 142983



to top

>gb|AC025416.4|AC025416 Genomic sequence for Arabidopsis thaliana BAC F5O11 from chromosome I,
             complete sequence
          Length = 118374

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 81    aatcatttatctggattttg 100
             ||||||||||||||||||||
Sbjct: 36428 aatcatttatctggattttg 36409



to top

>gb|AC008843.5|AC008843 Homo sapiens chromosome 5 clone CTD-2156N14, complete sequence
          Length = 121063

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 597  ctaagcaggaagaaaagaat 616
            ||||||||||||||||||||
Sbjct: 3887 ctaagcaggaagaaaagaat 3906



to top

>emb|CR392368.7| Zebrafish DNA sequence from clone DKEY-86E18 in linkage group 20,
            complete sequence
          Length = 87973

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 299  ttttttcattgtttattcttctttcatttgta 330
            |||||||||  ||||||||| |||||||||||
Sbjct: 4192 ttttttcataatttattcttatttcatttgta 4161



to top

>gb|AC110174.10| Mus musculus chromosome 3, clone RP23-293K21, complete sequence
          Length = 253469

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 547  tccttcagttttgaacatatattc 570
            ||||||||||||||||||| ||||
Sbjct: 5481 tccttcagttttgaacatacattc 5458



to top

>dbj|AP001034.5| Homo sapiens genomic DNA, chromosome 11q clone:RP11-729B4, complete
              sequence
          Length = 167934

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 82     atcatttatctggattttgt 101
              ||||||||||||||||||||
Sbjct: 115740 atcatttatctggattttgt 115721



to top

>emb|BX511083.17| Zebrafish DNA sequence from clone CH211-195F22 in linkage group 1,
             complete sequence
          Length = 211668

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 452   gaagagccagcagaaccaaaagtt 475
             |||||||||||| |||||||||||
Sbjct: 31996 gaagagccagcacaaccaaaagtt 31973



to top

>dbj|AB010875.1| Arabidopsis thaliana gene for PHR1, complete cds
          Length = 3980

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 81   aatcatttatctggattttg 100
            ||||||||||||||||||||
Sbjct: 3101 aatcatttatctggattttg 3120



to top

>gb|U07888.1|CFU07888 Canis familiaris Samoyed collagen type IV A5 chain mRNA, partial cds
          Length = 2263

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 470  aaagttgaaaacattgttgatgtt 493
            ||||||| ||||||||||||||||
Sbjct: 1815 aaagttgcaaacattgttgatgtt 1792



to top

>gb|AC102591.14| Mus musculus chromosome 3, clone RP23-336B10, complete sequence
          Length = 216906

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 547    tccttcagttttgaacatatattc 570
              ||||||||||||||||||| ||||
Sbjct: 163790 tccttcagttttgaacatacattc 163767



to top

>emb|AL663048.12| Mouse DNA sequence from clone RP23-166N12 on chromosome X, complete
              sequence
          Length = 234817

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 257    actctattacatgtctttac 276
              ||||||||||||||||||||
Sbjct: 200472 actctattacatgtctttac 200491



to top

>dbj|AP000945.5| Homo sapiens genomic DNA, chromosome 18p clone:RP11-870F11, complete
             sequences
          Length = 216975

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 476   gaaaacattgttgatgttaa 495
             ||||||||||||||||||||
Sbjct: 62816 gaaaacattgttgatgttaa 62835


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 8,357,570
Number of Sequences: 3902068
Number of extensions: 8357570
Number of successful extensions: 193977
Number of sequences better than 10.0: 110
Number of HSP's better than 10.0 without gapping: 109
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 193127
Number of HSP's gapped (non-prelim): 851
length of query: 687
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 664
effective length of database: 17,143,297,704
effective search space: 11383149675456
effective search space used: 11383149675456
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top