ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal9o01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BC109074.1| Homo sapiens death-associated protein 6, mRNA (cD... 42 2.1
2gb|BC109073.1| Homo sapiens death-associated protein 6, mRNA (cD... 42 2.1
3ref|NM_001350.3| Homo sapiens death-associated protein 6 (DAXX),... 42 2.1
4gb|BC073776.1| Homo sapiens cDNA clone IMAGE:2988484, containing... 42 2.1
5emb|BX248088.18| Human DNA sequence from clone DAQB-126H3 on chr... 42 2.1
6emb|Z97183.1|HSICB2046 Human DNA sequence from clone ICRF6c-CB20... 42 2.1
7emb|Z97184.1|HSF0811 Human DNA sequence from clone ICRF6c-CF0811... 42 2.1
8emb|AL662820.6| Human DNA sequence from clone XXbac-185D15 on ch... 42 2.1
9emb|AL662827.3| Human DNA sequence from clone XXbac-165D10 on ch... 42 2.1
10emb|CR759786.5| Human DNA sequence from clone DAMC-227D19 on chr... 42 2.1
11emb|CR759817.3| Human DNA sequence from clone DADB-159G18 on chr... 42 2.1
12gb|AF015956.2| Homo sapiens Fas-binding protein Daxx mRNA, compl... 42 2.1
13emb|CR457085.1| Homo sapiens full open reading frame cDNA clone ... 42 2.1
14gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome 42 2.1
15gb|BC000220.1|BC000220 Homo sapiens, clone IMAGE:3353019, mRNA, ... 42 2.1
16dbj|AK223404.1| Homo sapiens mRNA for death-associated protein 6... 42 2.1
17gb|AF097742.1|AF097742 Homo sapiens ETS1 associated protein EAP1... 42 2.1
18gb|AF050179.1|AF050179 Homo sapiens CENP-C binding protein (DAXX... 42 2.1
19gb|AF039136.1|AF039136 Homo sapiens Fas binding protein (hDaxx) ... 42 2.1
20gb|AF006041.1|AF006041 Homo sapiens Fas-binding protein (DAXX) m... 42 2.1
21emb|CT025606.10| Mouse DNA sequence from clone RP24-120D14 on ch... 42 2.1
22dbj|AB209493.1| Homo sapiens mRNA for death-associated protein 6... 42 2.1
23dbj|AB015051.1| Homo sapiens mRNA for Daxx, complete cds 42 2.1
24ref|XM_450395.1| Oryza sativa (japonica cultivar-group), mRNA 40 8.4
25gb|AF101236.1| Naja sputatrix neutral phospholipase A2 (NPLA2) g... 40 8.4
26gb|AF101235.1| Naja sputatrix acidic phospholipase A2 (APLA2) ge... 40 8.4
27ref|XM_708690.1| Candida albicans SC5314 hypothetical protein (C... 40 8.4
28ref|XM_708656.1| Candida albicans SC5314 hypothetical protein (C... 40 8.4
29emb|AL033522.1|HS451B21 Human DNA sequence from clone RP3-451B21... 40 8.4
30gb|CP000089.1| Dechloromonas aromatica RCB, complete genome 40 8.4
31gb|DQ225176.1| Coccidioides posadasii peroxisomal matrix protein... 40 8.4
32gb|CP000249.1| Frankia sp. CcI3, complete genome 40 8.4
33emb|BX957286.14| Zebrafish DNA sequence from clone CH211-119B12 ... 40 8.4
34emb|AL358275.4|CNS05TDY Human chromosome 14 DNA sequence BAC R-6... 40 8.4
35gb|U01096.1|U01096 Streptomyces aureofaciens bromoperoxidase BPO... 40 8.4
36emb|AL672073.8| Mouse DNA sequence from clone RP23-333P16 on chr... 40 8.4

>gb|BC109074.1| Homo sapiens death-associated protein 6, mRNA (cDNA clone MGC:126246
            IMAGE:40034219), complete cds
          Length = 2388

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 320  gatctccaatgaaaagaacct 340
            |||||||||||||||||||||
Sbjct: 1593 gatctccaatgaaaagaacct 1613



to top

>gb|BC109073.1| Homo sapiens death-associated protein 6, mRNA (cDNA clone MGC:126245
            IMAGE:40034214), complete cds
          Length = 2388

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 320  gatctccaatgaaaagaacct 340
            |||||||||||||||||||||
Sbjct: 1593 gatctccaatgaaaagaacct 1613



to top

>ref|NM_001350.3| Homo sapiens death-associated protein 6 (DAXX), mRNA
          Length = 2477

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 320  gatctccaatgaaaagaacct 340
            |||||||||||||||||||||
Sbjct: 1618 gatctccaatgaaaagaacct 1638



to top

>gb|BC073776.1| Homo sapiens cDNA clone IMAGE:2988484, containing frame-shift errors
          Length = 2491

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 320  gatctccaatgaaaagaacct 340
            |||||||||||||||||||||
Sbjct: 1637 gatctccaatgaaaagaacct 1657



to top

>emb|BX248088.18| Human DNA sequence from clone DAQB-126H3 on chromosome 6 Contains the
             TAPBP gene for TAP binding protein (tapasin), the ZNF297
             gene for zinc finger protein 297, the DAXX gene for
             death-associated protein 6, the MYL8P pseudogene for
             myosin, light polypeptide 8, the LYPLA2P1 pseudogene for
             lysophospholipase II pseudogene 1, the KIFC1 gene for
             kinesin family member C1, the RPL12P1 pseudogene for
             ribosomal protein L12 pseudogene 1, the 5'end of the PHF1
             gene for PHD finger protein 1, and 6 CpG islands, complete
             sequence
          Length = 114575

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 320   gatctccaatgaaaagaacct 340
             |||||||||||||||||||||
Sbjct: 22434 gatctccaatgaaaagaacct 22414



to top

>emb|Z97183.1|HSICB2046 Human DNA sequence from clone ICRF6c-CB2046 on chromosome 6 Contains a
             myosin regulatory light chain 2 pseudogene, the DAXX gene
             for death-associated protein 6 (Fas-binding protein), the
             ZNF297 gene for zinc finger protein 297 (BING1), the 5'
             end of the TAPBP gene for TAP binding protein (tapasin).
             Contains ESTs, STSs, GSSs and three CpG islands, complete
             sequence
          Length = 39872

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 320   gatctccaatgaaaagaacct 340
             |||||||||||||||||||||
Sbjct: 31147 gatctccaatgaaaagaacct 31167



to top

>emb|Z97184.1|HSF0811 Human DNA sequence from clone ICRF6c-CF0811 on chromosome 6 Contains
            the 3' end of the DAXX gene for death-associated protein
            6 (Fas-binding protein), the ZNF297 gene for zinc finger
            protein 297 (BING1), the TAPBP gene for TAP-binding
            protein (tapasin), the RAB2L gene for RAB2 protein
            (member of RAS oncogene family)-like protein, the HKE2
            gene for HLA class II region protein KE2, the 5' end of
            the C6ORF11 gene for chromosome 6 open reading frame 11
            (BING4) and four CpG islands, complete sequence
          Length = 40127

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 320  gatctccaatgaaaagaacct 340
            |||||||||||||||||||||
Sbjct: 1263 gatctccaatgaaaagaacct 1283



to top

>emb|AL662820.6| Human DNA sequence from clone XXbac-185D15 on chromosome 6 contains the
             RPS18 gene for ribosomal protein S18, the B3GALT4 gene for
             UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase,
             polypeptide 4,  the C6ORF11 gene for chromosome 6 open
             reading frame 11, the HKE2 gene for HLA class II region
             expressed gene 2, the RAB2L gene for RAB2, member RAS
             oncogene family-like, the TAPBP gene for  TAP binding
             protein (tapasin), the ZNF297 gene for zinc finger protein
             297, the DAXX gene for death-associated protein 6, a
             myosin, light polypeptide 8, pseudogene (MYL8P) and seven
             CpG islands, complete sequence
          Length = 78635

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 320   gatctccaatgaaaagaacct 340
             |||||||||||||||||||||
Sbjct: 48821 gatctccaatgaaaagaacct 48801



to top

>emb|AL662827.3| Human DNA sequence from clone XXbac-165D10 on chromosome 6 contains the
             3' end of the RPS18 gene for ribosomal protein S18, the
             gene for chromosome 6 open reading frame 11, the HKE2 gene
             for HLA class II region expressed gene 2, the RAB2L gene
             for RAB2, member RAS oncogene family-like, the TAPBP gene
             for TAP binding protein (tapasin), the DAXX gene for
             death-associated protein 6, a myosin, light polypeptide 8,
             pseudogene, a novel protein similar to lysophospholipase
             II (LYPLA2) and six CpG islands, complete sequence
          Length = 110794

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 320   gatctccaatgaaaagaacct 340
             |||||||||||||||||||||
Sbjct: 46833 gatctccaatgaaaagaacct 46813



to top

>emb|CR759786.5| Human DNA sequence from clone DAMC-227D19 on chromosome 6, complete
              sequence
          Length = 123399

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 320    gatctccaatgaaaagaacct 340
              |||||||||||||||||||||
Sbjct: 118521 gatctccaatgaaaagaacct 118501



to top

>emb|CR759817.3| Human DNA sequence from clone DADB-159G18 on chromosome 6, complete
             sequence
          Length = 108902

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 320   gatctccaatgaaaagaacct 340
             |||||||||||||||||||||
Sbjct: 67425 gatctccaatgaaaagaacct 67405



to top

>gb|AF015956.2| Homo sapiens Fas-binding protein Daxx mRNA, complete cds
          Length = 2462

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 320  gatctccaatgaaaagaacct 340
            |||||||||||||||||||||
Sbjct: 1557 gatctccaatgaaaagaacct 1577



to top

>emb|CR457085.1| Homo sapiens full open reading frame cDNA clone RZPDo834B036D for
            gene DAXX, death-associated protein 6; complete cds,
            incl. stopcodon
          Length = 2223

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 320  gatctccaatgaaaagaacct 340
            |||||||||||||||||||||
Sbjct: 1503 gatctccaatgaaaagaacct 1523



to top

>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome
          Length = 4352825

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 109     ccgtcgggcaaaacatcgaat 129
               |||||||||||||||||||||
Sbjct: 3471626 ccgtcgggcaaaacatcgaat 3471606



to top

>gb|BC000220.1|BC000220 Homo sapiens, clone IMAGE:3353019, mRNA, partial cds
          Length = 1653

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 320 gatctccaatgaaaagaacct 340
           |||||||||||||||||||||
Sbjct: 505 gatctccaatgaaaagaacct 525



to top

>dbj|AK223404.1| Homo sapiens mRNA for death-associated protein 6 variant, clone:
            FCC108C03
          Length = 2633

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 320  gatctccaatgaaaagaacct 340
            |||||||||||||||||||||
Sbjct: 1708 gatctccaatgaaaagaacct 1728



to top

>gb|AF097742.1|AF097742 Homo sapiens ETS1 associated protein EAP1/Daxx mRNA, complete cds
          Length = 2360

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 320  gatctccaatgaaaagaacct 340
            |||||||||||||||||||||
Sbjct: 1510 gatctccaatgaaaagaacct 1530



to top

>gb|AF050179.1|AF050179 Homo sapiens CENP-C binding protein (DAXX) mRNA, complete cds
          Length = 2477

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 320  gatctccaatgaaaagaacct 340
            |||||||||||||||||||||
Sbjct: 1618 gatctccaatgaaaagaacct 1638



to top

>gb|AF039136.1|AF039136 Homo sapiens Fas binding protein (hDaxx) mRNA, complete cds
          Length = 2487

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 320  gatctccaatgaaaagaacct 340
            |||||||||||||||||||||
Sbjct: 1650 gatctccaatgaaaagaacct 1670



to top

>gb|AF006041.1|AF006041 Homo sapiens Fas-binding protein (DAXX) mRNA, partial cds
          Length = 865

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 320 gatctccaatgaaaagaacct 340
           |||||||||||||||||||||
Sbjct: 28  gatctccaatgaaaagaacct 48



to top

>emb|CT025606.10| Mouse DNA sequence from clone RP24-120D14 on chromosome 12, complete
              sequence
          Length = 164251

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 75     atttttggacacatgaattgc 95
              |||||||||||||||||||||
Sbjct: 112480 atttttggacacatgaattgc 112500



to top

>dbj|AB209493.1| Homo sapiens mRNA for death-associated protein 6 variant protein
          Length = 3366

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 320  gatctccaatgaaaagaacct 340
            |||||||||||||||||||||
Sbjct: 2175 gatctccaatgaaaagaacct 2195



to top

>dbj|AB015051.1| Homo sapiens mRNA for Daxx, complete cds
          Length = 2549

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 320  gatctccaatgaaaagaacct 340
            |||||||||||||||||||||
Sbjct: 1615 gatctccaatgaaaagaacct 1635



to top

>ref|XM_450395.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 222

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 304 ctccttccctctgctggatctcca 327
           ||||| ||||||||||||||||||
Sbjct: 182 ctcctcccctctgctggatctcca 159



to top

>gb|AF101236.1| Naja sputatrix neutral phospholipase A2 (NPLA2) gene, complete cds
          Length = 5879

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 466 tgagagaaagagtttgagaa 485
           ||||||||||||||||||||
Sbjct: 980 tgagagaaagagtttgagaa 999



to top

>gb|AF101235.1| Naja sputatrix acidic phospholipase A2 (APLA2) gene, complete cds
          Length = 5879

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 466 tgagagaaagagtttgagaa 485
           ||||||||||||||||||||
Sbjct: 980 tgagagaaagagtttgagaa 999



to top

>ref|XM_708690.1| Candida albicans SC5314 hypothetical protein (CaO19.3689), mRNA
          Length = 582

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 425 aattcaatgcttattcaaat 444
           ||||||||||||||||||||
Sbjct: 527 aattcaatgcttattcaaat 546



to top

>ref|XM_708656.1| Candida albicans SC5314 hypothetical protein (CaO19.11173), mRNA
          Length = 582

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 425 aattcaatgcttattcaaat 444
           ||||||||||||||||||||
Sbjct: 527 aattcaatgcttattcaaat 546



to top

>emb|AL033522.1|HS451B21 Human DNA sequence from clone RP3-451B21 on chromosome 6q24 Contains
             the HSPC228 gene for hypothetical protein HSPC228 and  a
             novel gene, complete sequence
          Length = 135162

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 49    acacaatgactgatttgggctaaa 72
             |||||||| |||||||||||||||
Sbjct: 95404 acacaatgcctgatttgggctaaa 95381



to top

>gb|CP000089.1| Dechloromonas aromatica RCB, complete genome
          Length = 4501104

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 512    gatgccgtagcgggcggcga 531
              ||||||||||||||||||||
Sbjct: 589419 gatgccgtagcgggcggcga 589438



to top

>gb|DQ225176.1| Coccidioides posadasii peroxisomal matrix protein (pmp1) mRNA,
           complete cds
          Length = 674

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 478 tttgagaacttagcttccgg 497
           ||||||||||||||||||||
Sbjct: 471 tttgagaacttagcttccgg 452



to top

>gb|CP000249.1| Frankia sp. CcI3, complete genome
          Length = 5433628

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 515     gccgtagcgggcggcgagct 534
               ||||||||||||||||||||
Sbjct: 2340203 gccgtagcgggcggcgagct 2340222



to top

>emb|BX957286.14| Zebrafish DNA sequence from clone CH211-119B12 in linkage group 20,
              complete sequence
          Length = 161104

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 61     atttgggctaaataatttttggac 84
              |||||||||| |||||||||||||
Sbjct: 105784 atttgggctacataatttttggac 105761



to top

>emb|AL358275.4|CNS05TDY Human chromosome 14 DNA sequence BAC R-666E17 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 178651

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 252    aatctgacagacccgacatt 271
              ||||||||||||||||||||
Sbjct: 163538 aatctgacagacccgacatt 163519



to top

>gb|U01096.1|U01096 Streptomyces aureofaciens bromoperoxidase BPO-A1 (bpoA1) gene,
            complete cds
          Length = 2112

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 556  gttccttcgtcgtcctgggc 575
            ||||||||||||||||||||
Sbjct: 1956 gttccttcgtcgtcctgggc 1937



to top

>emb|AL672073.8| Mouse DNA sequence from clone RP23-333P16 on chromosome X, complete
             sequence
          Length = 216812

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 161   aaggactaactgactgtaac 180
             ||||||||||||||||||||
Sbjct: 72396 aaggactaactgactgtaac 72415


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,093,988
Number of Sequences: 3902068
Number of extensions: 5093988
Number of successful extensions: 81834
Number of sequences better than 10.0: 36
Number of HSP's better than 10.0 without gapping: 36
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 81697
Number of HSP's gapped (non-prelim): 137
length of query: 620
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 597
effective length of database: 17,143,297,704
effective search space: 10234548729288
effective search space used: 10234548729288
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top