>emb|BX248088.18| Human DNA sequence from clone DAQB-126H3 on chromosome 6 Contains the
TAPBP gene for TAP binding protein (tapasin), the ZNF297
gene for zinc finger protein 297, the DAXX gene for
death-associated protein 6, the MYL8P pseudogene for
myosin, light polypeptide 8, the LYPLA2P1 pseudogene for
lysophospholipase II pseudogene 1, the KIFC1 gene for
kinesin family member C1, the RPL12P1 pseudogene for
ribosomal protein L12 pseudogene 1, the 5'end of the PHF1
gene for PHD finger protein 1, and 6 CpG islands, complete
sequence
Length = 114575
Score = 42.1 bits (21), Expect = 2.1
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 320 gatctccaatgaaaagaacct 340
|||||||||||||||||||||
Sbjct: 22434 gatctccaatgaaaagaacct 22414
>emb|Z97183.1|HSICB2046 Human DNA sequence from clone ICRF6c-CB2046 on chromosome 6 Contains a
myosin regulatory light chain 2 pseudogene, the DAXX gene
for death-associated protein 6 (Fas-binding protein), the
ZNF297 gene for zinc finger protein 297 (BING1), the 5'
end of the TAPBP gene for TAP binding protein (tapasin).
Contains ESTs, STSs, GSSs and three CpG islands, complete
sequence
Length = 39872
Score = 42.1 bits (21), Expect = 2.1
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 320 gatctccaatgaaaagaacct 340
|||||||||||||||||||||
Sbjct: 31147 gatctccaatgaaaagaacct 31167
>emb|Z97184.1|HSF0811 Human DNA sequence from clone ICRF6c-CF0811 on chromosome 6 Contains
the 3' end of the DAXX gene for death-associated protein
6 (Fas-binding protein), the ZNF297 gene for zinc finger
protein 297 (BING1), the TAPBP gene for TAP-binding
protein (tapasin), the RAB2L gene for RAB2 protein
(member of RAS oncogene family)-like protein, the HKE2
gene for HLA class II region protein KE2, the 5' end of
the C6ORF11 gene for chromosome 6 open reading frame 11
(BING4) and four CpG islands, complete sequence
Length = 40127
Score = 42.1 bits (21), Expect = 2.1
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 320 gatctccaatgaaaagaacct 340
|||||||||||||||||||||
Sbjct: 1263 gatctccaatgaaaagaacct 1283
>emb|AL662820.6| Human DNA sequence from clone XXbac-185D15 on chromosome 6 contains the
RPS18 gene for ribosomal protein S18, the B3GALT4 gene for
UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase,
polypeptide 4, the C6ORF11 gene for chromosome 6 open
reading frame 11, the HKE2 gene for HLA class II region
expressed gene 2, the RAB2L gene for RAB2, member RAS
oncogene family-like, the TAPBP gene for TAP binding
protein (tapasin), the ZNF297 gene for zinc finger protein
297, the DAXX gene for death-associated protein 6, a
myosin, light polypeptide 8, pseudogene (MYL8P) and seven
CpG islands, complete sequence
Length = 78635
Score = 42.1 bits (21), Expect = 2.1
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 320 gatctccaatgaaaagaacct 340
|||||||||||||||||||||
Sbjct: 48821 gatctccaatgaaaagaacct 48801
>emb|AL662827.3| Human DNA sequence from clone XXbac-165D10 on chromosome 6 contains the
3' end of the RPS18 gene for ribosomal protein S18, the
gene for chromosome 6 open reading frame 11, the HKE2 gene
for HLA class II region expressed gene 2, the RAB2L gene
for RAB2, member RAS oncogene family-like, the TAPBP gene
for TAP binding protein (tapasin), the DAXX gene for
death-associated protein 6, a myosin, light polypeptide 8,
pseudogene, a novel protein similar to lysophospholipase
II (LYPLA2) and six CpG islands, complete sequence
Length = 110794
Score = 42.1 bits (21), Expect = 2.1
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 320 gatctccaatgaaaagaacct 340
|||||||||||||||||||||
Sbjct: 46833 gatctccaatgaaaagaacct 46813
>emb|AL033522.1|HS451B21 Human DNA sequence from clone RP3-451B21 on chromosome 6q24 Contains
the HSPC228 gene for hypothetical protein HSPC228 and a
novel gene, complete sequence
Length = 135162
Score = 40.1 bits (20), Expect = 8.4
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 49 acacaatgactgatttgggctaaa 72
|||||||| |||||||||||||||
Sbjct: 95404 acacaatgcctgatttgggctaaa 95381
>emb|AL672073.8| Mouse DNA sequence from clone RP23-333P16 on chromosome X, complete
sequence
Length = 216812
Score = 40.1 bits (20), Expect = 8.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 161 aaggactaactgactgtaac 180
||||||||||||||||||||
Sbjct: 72396 aaggactaactgactgtaac 72415
Database: nt
Posted date: May 29, 2006 11:10 AM
Number of letters in database: 3,984,495,279
Number of sequences in database: 917,343
Database: /shigen/export/home/twatanab/db/nt/nt.01
Posted date: May 29, 2006 11:16 AM
Number of letters in database: 3,988,174,986
Number of sequences in database: 835,257
Database: /shigen/export/home/twatanab/db/nt/nt.02
Posted date: May 29, 2006 11:21 AM
Number of letters in database: 3,991,246,324
Number of sequences in database: 771,481
Database: /shigen/export/home/twatanab/db/nt/nt.03
Posted date: May 29, 2006 11:27 AM
Number of letters in database: 3,990,718,311
Number of sequences in database: 977,174
Database: /shigen/export/home/twatanab/db/nt/nt.04
Posted date: May 29, 2006 11:29 AM
Number of letters in database: 1,278,410,368
Number of sequences in database: 400,813
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,093,988
Number of Sequences: 3902068
Number of extensions: 5093988
Number of successful extensions: 81834
Number of sequences better than 10.0: 36
Number of HSP's better than 10.0 without gapping: 36
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 81697
Number of HSP's gapped (non-prelim): 137
length of query: 620
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 597
effective length of database: 17,143,297,704
effective search space: 10234548729288
effective search space used: 10234548729288
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)