>emb|AL354709.15| Human DNA sequence from clone RP11-145E5 on chromosome 9 Contains the 5'
              end of the CDKN2B gene for cyclin-dependent kinase
              inhibitor 2B (p15, inhibits CDK4), a ubiquitin A-52 residue
              ribosomal protein fusion product 1 (UBA52) (RPL40)
              pseudogene, the 3' end of a variant of the MTAP gene for
              methylthioadenosine phosphorylase (MSAP), a novel gene and
              a CpG island, complete sequence
          Length = 157533

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 87     ctatatattccagtggtgaa 106
              ||||||||||||||||||||
Sbjct: 120097 ctatatattccagtggtgaa 120116

>gb|AC011697.9| Drosophila melanogaster clone BACR12J05, complete sequence
          Length = 203498

 Score = 38.2 bits (19), Expect = 9.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 83     cgtgctatatattccagtg 101
              |||||||||||||||||||
Sbjct: 120209 cgtgctatatattccagtg 120227

>emb|AL031287.3|HS703H14 Human DNA sequence from clone RP4-703H14 on chromosome 1q23.2-24.3
             Contains part of a novel gene, complete sequence
          Length = 74729

 Score = 38.2 bits (19), Expect = 9.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 104   gaaaaaatgtacaactgag 122
             |||||||||||||||||||
Sbjct: 27336 gaaaaaatgtacaactgag 27354

>gb|AF416502.1| Tursiops truncatus polymorphic microsatellite TtruAAT116 sequence
          Length = 374

 Score = 38.2 bits (19), Expect = 9.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 92  tattccagtggtgaaaaaa 110
           |||||||||||||||||||
Sbjct: 321 tattccagtggtgaaaaaa 339

>gb|AE003495.4| Drosophila melanogaster chromosome X, section 47 of 74 of the complete
             sequence
          Length = 314743

 Score = 38.2 bits (19), Expect = 9.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 83    cgtgctatatattccagtg 101
             |||||||||||||||||||
Sbjct: 63094 cgtgctatatattccagtg 63112


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 981,754
Number of Sequences: 3902068
Number of extensions: 981754
Number of successful extensions: 58627
Number of sequences better than 10.0: 5
Number of HSP's better than 10.0 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 58622
Number of HSP's gapped (non-prelim): 5
length of query: 183
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 161
effective length of database: 17,147,199,772
effective search space: 2760699163292
effective search space used: 2760699163292
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)