>gb|CP000070.1| Trypanosoma brucei chromosome 7, complete sequence
          Length = 2205233

 Score = 40.1 bits (20), Expect = 0.82
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 30      cctgctgctgatgttgcagg 49
               ||||||||||||||||||||
Sbjct: 1739763 cctgctgctgatgttgcagg 1739744

>gb|AC091527.21| Trypanosoma brucei chromosome 7 clone RPCI93-33N13, complete sequence
          Length = 114057

 Score = 40.1 bits (20), Expect = 0.82
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 30    cctgctgctgatgttgcagg 49
             ||||||||||||||||||||
Sbjct: 60820 cctgctgctgatgttgcagg 60801

>ref|XM_821159.1| Trypanosoma brucei TREU927 clone RPCI93-33N13 hypothetical protein
            (Tb927.7.6410) partial mRNA
          Length = 4371

 Score = 40.1 bits (20), Expect = 0.82
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 30   cctgctgctgatgttgcagg 49
            ||||||||||||||||||||
Sbjct: 1944 cctgctgctgatgttgcagg 1963

>gb|AC008340.5| Drosophila melanogaster, chromosome 2R, region 42D-42E, BAC clone
             BACR07J20, complete sequence
          Length = 181771

 Score = 38.2 bits (19), Expect = 3.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 31    ctgctgctgatgttgcagg 49
             |||||||||||||||||||
Sbjct: 70627 ctgctgctgatgttgcagg 70609

>gb|AC092246.1|AC092246 Drosophila melanogaster, chromosome 2L, region 36X-36X, BAC clone
              BACR33C24, complete sequence
          Length = 202495

 Score = 38.2 bits (19), Expect = 3.2
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 31     ctgctgctgatgttgcaggcact 53
              |||||||||||||||| ||||||
Sbjct: 112050 ctgctgctgatgttgctggcact 112028

>gb|AC007549.5|AC007549 Drosophila melanogaster, chromosome 2R, region 42D-42E, BAC clone
             BACR04F03, complete sequence
          Length = 150587

 Score = 38.2 bits (19), Expect = 3.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 31    ctgctgctgatgttgcagg 49
             |||||||||||||||||||
Sbjct: 19716 ctgctgctgatgttgcagg 19698

>gb|AE003645.4| Drosophila melanogaster chromosome 2L, section 54 of 83 of the complete
              sequence
          Length = 262207

 Score = 38.2 bits (19), Expect = 3.2
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 31     ctgctgctgatgttgcaggcact 53
              |||||||||||||||| ||||||
Sbjct: 142604 ctgctgctgatgttgctggcact 142582

>gb|AE003790.2| Drosophila melanogaster chromosome 2R, section 7 of 73 of the complete
              sequence
          Length = 348873

 Score = 38.2 bits (19), Expect = 3.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 31     ctgctgctgatgttgcagg 49
              |||||||||||||||||||
Sbjct: 106838 ctgctgctgatgttgcagg 106820

>gb|U78088.1|DMU78088 Drosophila melanogaster cytochrome P450 (Cyp6a2) gene, complete cds
          Length = 5737

 Score = 38.2 bits (19), Expect = 3.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 31   ctgctgctgatgttgcagg 49
            |||||||||||||||||||
Sbjct: 5690 ctgctgctgatgttgcagg 5708


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 355,067
Number of Sequences: 3902068
Number of extensions: 355067
Number of successful extensions: 25855
Number of sequences better than 10.0: 9
Number of HSP's better than 10.0 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 25843
Number of HSP's gapped (non-prelim): 12
length of query: 79
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 58
effective length of database: 17,151,101,840
effective search space: 994763906720
effective search space used: 994763906720
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)