Clone Name	bags15g19
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	dbj|AK061725.1| Oryza sativa (japonica cultivar-group) cDNA clon...	856	0.0
2	ref|XM_481630.1| Oryza sativa (japonica cultivar-group), mRNA	737	0.0
3	ref|XM_507578.1| PREDICTED Oryza sativa (japonica cultivar-group...	737	0.0
4	ref|XM_507194.2| PREDICTED Oryza sativa (japonica cultivar-group...	737	0.0
5	dbj|AK121204.1| Oryza sativa (japonica cultivar-group) cDNA clon...	737	0.0
6	dbj|AK062210.1| Oryza sativa (japonica cultivar-group) cDNA clon...	737	0.0
7	dbj|D12631.1|RICRPL7AB Oryza sativa (japonica cultivar-group) mR...	737	0.0
8	dbj|AK098843.1| Oryza sativa (japonica cultivar-group) cDNA clon...	729	0.0
9	gb|BT016736.1| Zea mays clone Contig569 mRNA sequence	714	0.0
10	gb|BT018084.1| Zea mays clone EL01N0552B03.c mRNA sequence	682	0.0
11	gb|AY105417.1| Zea mays PCO109699 mRNA sequence	668	0.0
12	gb|AY103834.1| Zea mays PCO109701 mRNA sequence	666	0.0
13	ref|XM_463662.1| Oryza sativa (japonica cultivar-group), predic...	329	6e-87
14	gb|AY086353.1| Arabidopsis thaliana clone 24272 mRNA, complete s...	274	3e-70
15	ref|NM_116152.2| Arabidopsis thaliana structural constituent of ...	264	3e-67
16	gb|AY114667.1| Arabidopsis thaliana 60S ribosomal protein L7A pr...	264	3e-67
17	gb|AY062758.1| Arabidopsis thaliana 60S RIBOSOMAL PROTEIN L7A pr...	264	3e-67
18	gb|AY060519.1| Arabidopsis thaliana AT3g62870/F26K9_300 mRNA, co...	264	3e-67
19	gb|AY052264.1| Arabidopsis thaliana AT3g62870/F26K9_300 mRNA, co...	264	3e-67
20	emb|BX825094.1|CNS0A7RE Arabidopsis thaliana Full-length cDNA Co...	264	3e-67
21	emb|BX823982.1|CNS0A6PP Arabidopsis thaliana Full-length cDNA Co...	264	3e-67
22	emb|BX824662.1|CNS0A4TO Arabidopsis thaliana Full-length cDNA Co...	264	3e-67
23	emb|BX824178.1|CNS0A6S9 Arabidopsis thaliana Full-length cDNA Co...	256	7e-65
24	emb|BX822281.1|CNS0A71I Arabidopsis thaliana Full-length cDNA Co...	256	7e-65
25	gb|AC108759.2| Oryza sativa (Japonica cultiva-group) chromosome ...	254	3e-64
26	dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D...	254	3e-64
27	emb|BX824325.1|CNS0A7R8 Arabidopsis thaliana Full-length cDNA Co...	248	2e-62
28	gb|DQ241858.1| Solanum tuberosum clone 014F11 60S ribosomal prot...	236	7e-59
29	ref|NM_130329.2| Arabidopsis thaliana structural constituent of ...	228	2e-56
30	gb|BT000500.1| Arabidopsis thaliana 60S ribosomal protein L7A (...	228	2e-56
31	gb|AY052674.1| Arabidopsis thaliana At2g47610/T30B22.8 mRNA, com...	228	2e-56
32	gb|AF385719.1|AF385719 Arabidopsis thaliana At2g47610/T30B22.8 m...	228	2e-56
33	emb|BX821062.1|CNS0A8OD Arabidopsis thaliana Full-length cDNA Co...	228	2e-56
34	gb|AY088386.1| Arabidopsis thaliana clone 6394 mRNA, complete se...	228	2e-56
35	gb|DQ268850.1| Solanum tuberosum clone 155G10 60S ribosomal prot...	228	2e-56
36	dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D...	226	6e-56
37	emb|BX842094.1|CNS09Y94 Arabidopsis thaliana Full-length cDNA Co...	226	6e-56
38	dbj|AP004637.3| Oryza sativa (japonica cultivar-group) genomic D...	226	6e-56
39	dbj|AP003884.2| Oryza sativa (japonica cultivar-group) genomic D...	226	6e-56
40	emb|BX842006.1|CNS09Y9Z Arabidopsis thaliana Full-length cDNA Co...	222	1e-54
41	emb|BX819217.1|CNS0A8T4 Arabidopsis thaliana Full-length cDNA Co...	220	4e-54
42	gb|BT014547.1| Lycopersicon esculentum clone 133964F, mRNA sequence	204	2e-49
43	dbj|AK220651.1| Arabidopsis thaliana mRNA for 60S ribosomal prot...	188	1e-44
44	emb|BX821934.1|CNS0A88T Arabidopsis thaliana Full-length cDNA Co...	168	1e-38
45	gb|AY496113.1| Capsicum annuum 60S ribosomal protein L7A mRNA, p...	155	2e-34
46	emb|AL162651.1|ATF26K9 Arabidopsis thaliana DNA chromosome 3, BA...	145	2e-31
47	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	135	2e-28
48	dbj|AP004672.3| Oryza sativa (japonica cultivar-group) genomic D...	135	2e-28
49	dbj|AP004223.2| Oryza sativa (japonica cultivar-group) genomic D...	135	2e-28
50	gb|AC155335.1| Brassica rapa subsp. pekinensis chromosome Cytoge...	133	7e-28
51	gb|AC002535.3| Arabidopsis thaliana chromosome 2 clone T30B22 ma...	125	2e-25
52	gb|AC155339.1| Brassica rapa subsp. pekinensis chromosome Cytoge...	119	1e-23
53	gb|BC106480.1| Xenopus laevis cDNA clone IMAGE:7211162	117	4e-23
54	gb|AY393839.1| Xenopus laevis ribosomal protein L7a mRNA, partia...	117	4e-23
55	emb|AJ718619.1| Nicotiana tabacum cDNA-AFLP-fragment BSTC3-31-30...	94	6e-16
56	emb|BX821043.1|CNS0A8L9 Arabidopsis thaliana Full-length cDNA Co...	90	9e-15
57	dbj|AK108838.1| Oryza sativa (japonica cultivar-group) cDNA clon...	82	2e-12
58	gb|AY924998.1| Seculamonas ecuadoriensis Rpl7A mRNA, partial cds	80	9e-12
59	emb|BX825080.1|CNS0A6S2 Arabidopsis thaliana Full-length cDNA Co...	78	4e-11
60	gb|AF401560.1| Ictalurus punctatus ribosomal protein L7a mRNA, c...	78	4e-11
61	gb|AY924997.1| Jakoba libera Rpl7A mRNA, partial cds	70	9e-09
62	gb|AY924999.1| Reclinomonas americana Rpl7A mRNA, partial cds	68	3e-08
63	gb|BC072834.1| Xenopus laevis MGC80199 protein, mRNA (cDNA clone...	64	5e-07
64	gb|AY769275.1| Bombyx mori ribosomal protein L7A (RpL7A) mRNA, c...	62	2e-06
65	gb|DQ118092.1| Trimastix pyriformis ribosomal protein L7A mRNA, ...	62	2e-06
66	gb|AY310805.1| Nicotiana benthamiana clone 12-101 unknown mRNA	62	2e-06
67	gb|AY439881.1| Armigeres subalbatus ASAP ID: 38933 cytosolic lar...	60	8e-06
68	ref|XM_575193.1| PREDICTED: Rattus norvegicus similar to 60S rib...	60	8e-06
69	gb|AC140446.5| Mus musculus BAC clone RP24-114J11 from chromosom...	60	8e-06
70	gb|AY924996.1| Malawimonas jakobiformis Rpl7A mRNA, partial cds	56	1e-04
71	gb|BC076693.1| Xenopus tropicalis hypothetical protein LOC447981...	54	5e-04
72	gb|AY925004.1| Malawimonas jakobiformis isolate MJL00000703 Rpl7...	54	5e-04
73	ref|XM_575291.1| PREDICTED: Rattus norvegicus similar to 60S rib...	54	5e-04
74	emb|AL824703.12| Mouse DNA sequence from clone RP23-317M2 on chr...	54	5e-04
75	gb|AC154486.2| Mus musculus BAC clone RP24-118H13 from chromosom...	52	0.002
76	gb|AC110194.11| Mus musculus chromosome 7, clone RP23-238J3, com...	52	0.002
77	gb|AC182749.2| Mus musculus BAC clone RP23-464D14 from chromosom...	52	0.002
78	ref|XM_909062.2| PREDICTED: Mus musculus similar to 60S ribosoma...	52	0.002
79	ref|XM_921134.2| PREDICTED: Mus musculus similar to 60S ribosoma...	52	0.002
80	ref|XM_193790.7| PREDICTED: Mus musculus similar to 60S ribosoma...	52	0.002
81	ref|XM_898600.2| PREDICTED: Mus musculus similar to 60S ribosoma...	52	0.002
82	gb|AC110262.12| Mus musculus chromosome 17, clone RP23-291L10, c...	52	0.002
83	ref|XR_002714.1| PREDICTED: Mus musculus similar to 60S ribosoma...	52	0.002
84	ref|XM_751458.1| Ustilago maydis 521 hypothetical protein (UM004...	52	0.002
85	gb|AC124412.3| Mus musculus BAC clone RP24-274J3 from chromosome...	52	0.002
86	emb|AM049005.1| Meladema coriacea mRNA for ribosomal protein L7A...	52	0.002
87	gb|AC115304.3| Mus musculus BAC clone RP24-156K1 from 15, comple...	52	0.002
88	gb|AC154411.2| Mus musculus BAC clone RP24-221F4 from chromosome...	52	0.002
89	gb|AC166246.1| Mus musculus BAC clone RP24-80F22 from chromosome...	52	0.002
90	gb|AC093926.6| Genomic sequence for Mus musculus, clone RP23-342...	52	0.002
91	gb|AC154546.2| Mus musculus BAC clone RP23-431I7 from chromosome...	52	0.002
92	dbj|AK034073.1| Mus musculus adult male diencephalon cDNA, RIKEN...	52	0.002
93	gb|AY925007.1| Reclinomonas americana Rpl7A gene, partial cds	52	0.002
94	ref|XM_577004.1| PREDICTED: Rattus norvegicus similar to 60S rib...	52	0.002
95	ref|XM_576987.1| PREDICTED: Rattus norvegicus similar to PRO1477...	52	0.002
96	ref|XM_346319.2| PREDICTED: Rattus norvegicus similar to 60S rib...	52	0.002
97	ref|XM_225910.3| PREDICTED: Rattus norvegicus similar to Rpl7a p...	52	0.002
98	ref|XM_222251.3| PREDICTED: Rattus norvegicus E1A binding protei...	52	0.002
99	ref|XM_573092.1| PREDICTED: Rattus norvegicus similar to 60S rib...	52	0.002
100	ref|XM_575493.1| PREDICTED: Rattus norvegicus similar to 60S rib...	52	0.002
101	ref|XM_345462.2| PREDICTED: Rattus norvegicus similar to Rpl7a p...	52	0.002
102	ref|XM_575149.1| PREDICTED: Rattus norvegicus similar to 60S rib...	52	0.002
103	ref|XM_216024.3| PREDICTED: Rattus norvegicus ribosomal protein ...	52	0.002
104	ref|XM_574881.1| PREDICTED: Rattus norvegicus similar to 60S rib...	52	0.002
105	ref|XM_574302.1| PREDICTED: Rattus norvegicus similar to 60S rib...	52	0.002
106	gb|AC154252.1| Mus musculus BAC clone RP24-197M20 from chromosom...	52	0.002
107	emb|X15013.1|RNPPL7A Rat mRNA for ribosomal protein L7a	52	0.002
108	emb|AL603787.8| Mouse DNA sequence from clone RP23-169J19 on chr...	52	0.002
109	gb|AC147366.5| Mus musculus BAC clone RP23-386J3 from 15, comple...	52	0.002
110	gb|AC171211.1| Mus musculus BAC clone RP23-34I14 from chromosome...	52	0.002
111	emb|AL772228.5| Mouse DNA sequence from clone RP23-236D1 on chro...	52	0.002
112	gb|AC121151.11| Mus musculus chromosome 17, clone RP24-342C2, co...	50	0.008
113	ref|XR_002826.1| PREDICTED: Mus musculus similar to 60S ribosoma...	50	0.008
114	ref|XM_846090.1| PREDICTED: Canis familiaris similar to 60S ribo...	50	0.008
115	emb|AJ718795.1| Nicotiana tabacum cDNA-AFLP-fragment BSTC31-3-31...	50	0.008
116	dbj|AP003158.1| Mus musculus genomic DNA, chromosome 16q clone:R...	50	0.008
117	dbj|AP003156.1| Mus musculus genomic DNA, chromosome 16q clone:R...	50	0.008
118	gb|AY702208.1| Loligo pealei ribosomal protein L7 mRNA, partial cds	48	0.032
119	gb|AY925011.1| Trimastix pyriformis ATCC50562 Rpl7A gene, partia...	48	0.032
120	ref|XM_445858.1| Candida glabrata CBS138, CAGL0E03938g partial mRNA	48	0.032
121	ref|XM_759559.1| Theileria parva strain Muguga 60S ribosomal pro...	48	0.032
122	emb|CR380951.1| Candida glabrata strain CBS138 chromosome E comp...	48	0.032
123	gb|AY130409.1| Scyliorhinus canicula ribosomal protein L7A-like ...	48	0.032
124	gb|AC152111.1| Pichia stipitis clone JGIAHYZ-17L1, complete sequ...	46	0.13
125	gb|DQ214069.1| Taeniopygia guttata clone 0058P0022B08 ribosomal ...	46	0.13
126	gb|AC114662.11| Mus musculus chromosome 1, clone RP24-170M24, co...	46	0.13
127	gb|AY925003.1| Malawimonas californiana Rpl7A gene, partial cds	46	0.13
128	gb|AY925000.1| Acanthamoeba castellanii Rpl7A mRNA, partial cds	46	0.13
129	ref|XR_003122.1| PREDICTED: Mus musculus hypothetical protein LO...	46	0.13
130	ref|XM_746084.1| Aspergillus fumigatus Af293 cytosolic large rib...	46	0.13
131	emb|AM049007.1| Scarabaeus laticollis mRNA for ribosomal protein...	46	0.13
132	ref|XM_644983.1| Entamoeba histolytica HM-1:IMSS 60S ribosomal p...	46	0.13
133	gb|AY925013.1| Capsaspora owczarzaki Rpl7A gene, partial cds	46	0.13
134	gb|AY130406.1| Branchiostoma lanceolatum ribosomal protein L7A-l...	46	0.13
135	ref|XM_223019.3| PREDICTED: Rattus norvegicus hypothetical LOC28...	46	0.13
136	ref|XM_576280.1| PREDICTED: Rattus norvegicus similar to 60S rib...	46	0.13
137	gb|AC107710.5| Mus musculus chromosome 19, clone RP23-269K10, co...	44	0.50
138	gb|AC120404.25| Mus musculus chromosome 6, clone RP24-405O23, co...	44	0.50
139	gb|BC084678.1| Mus musculus ribosomal protein L7a, mRNA (cDNA cl...	44	0.50
140	gb|AE017348.1| Cryptococcus neoformans var. neoformans JEC21 chr...	44	0.50
141	gb|AC128597.3| Rattus norvegicus BAC CH230-62C6 (Children's Hos...	44	0.50
142	gb|AC138741.7| Mus musculus chromosome 1, clone RP24-260D21, com...	44	0.50
143	gb|AC123658.9| Mus musculus chromosome 15, clone RP23-192C13, co...	44	0.50
144	gb|BC065176.1| Mus musculus ribosomal protein L7a, mRNA (cDNA cl...	44	0.50
145	gb|AC140799.6| Mus musculus chromosome 15, clone RP24-147N23, co...	44	0.50
146	ref|NM_013721.2| Mus musculus ribosomal protein L7a (Rpl7a), mRNA	44	0.50
147	gb|AC132575.3| Mus musculus BAC clone RP24-425F2 from chromosome...	44	0.50
148	ref|XM_980392.1| PREDICTED: Mus musculus similar to 60S ribosoma...	44	0.50
149	ref|XM_977480.1| PREDICTED: Mus musculus similar to 60S ribosoma...	44	0.50
150	ref|XM_484651.4| PREDICTED: Mus musculus similar to 60S ribosoma...	44	0.50
151	ref|XM_992217.1| PREDICTED: Mus musculus similar to 60S ribosoma...	44	0.50
152	gb|AC116421.8| Mus musculus chromosome 9, clone RP24-142L1, comp...	44	0.50
153	ref|XR_003588.1| PREDICTED: Mus musculus similar to 60S ribosoma...	44	0.50
154	ref|XR_002452.1| PREDICTED: Mus musculus similar to 60S ribosoma...	44	0.50
155	ref|XR_002706.1| PREDICTED: Mus musculus similar to 60S ribosoma...	44	0.50
156	ref|XM_909282.2| PREDICTED: Mus musculus similar to 60S ribosoma...	44	0.50
157	ref|XM_891531.2| PREDICTED: Mus musculus similar to 60S ribosoma...	44	0.50
158	ref|XR_002439.1| PREDICTED: Mus musculus similar to 60S ribosoma...	44	0.50
159	ref|XM_991689.1| PREDICTED: Mus musculus similar to 60S ribosoma...	44	0.50
160	ref|XM_987783.1| PREDICTED: Mus musculus similar to 60S ribosoma...	44	0.50
161	ref|XM_987455.1| PREDICTED: Mus musculus similar to 60S ribosoma...	44	0.50
162	ref|XM_975817.1| PREDICTED: Mus musculus similar to 60S ribosoma...	44	0.50
163	ref|XM_887179.2| PREDICTED: Mus musculus similar to 60S ribosoma...	44	0.50
164	ref|XM_906238.2| PREDICTED: Mus musculus similar to 60S ribosoma...	44	0.50
165	ref|XM_486245.4| PREDICTED: Mus musculus similar to 60S ribosoma...	44	0.50
166	ref|XM_985293.1| PREDICTED: Mus musculus similar to 60S ribosoma...	44	0.50
167	ref|XR_003443.1| PREDICTED: Mus musculus similar to 60S ribosoma...	44	0.50
168	ref|XM_905543.2| PREDICTED: Mus musculus similar to 60S ribosoma...	44	0.50
169	ref|XM_620604.3| PREDICTED: Mus musculus similar to 60S ribosoma...	44	0.50
170	ref|XM_979771.1| PREDICTED: Mus musculus similar to 60S ribosoma...	44	0.50
171	ref|XR_003274.1| PREDICTED: Mus musculus similar to Ribosomal pr...	44	0.50
172	ref|XR_002857.1| PREDICTED: Mus musculus similar to 60S ribosoma...	44	0.50
173	ref|XM_974409.1| PREDICTED: Mus musculus similar to 60S ribosoma...	44	0.50
174	ref|XR_004630.1| PREDICTED: Mus musculus similar to 60S ribosoma...	44	0.50
175	ref|XR_001873.1| PREDICTED: Mus musculus similar to 60S ribosoma...	44	0.50
176	ref|XM_143236.6| PREDICTED: Mus musculus similar to 60S ribosoma...	44	0.50
177	ref|XR_003744.1| PREDICTED: Mus musculus similar to 60S ribosoma...	44	0.50
178	gb|AC120548.15| Mus musculus chromosome 17, clone RP23-211H11, c...	44	0.50
179	ref|XM_572378.1| Cryptococcus neoformans var. neoformans JEC21 r...	44	0.50
180	gb|AC083890.4| Mus musculus strain C57BL6/J chromosome 5 clone R...	44	0.50
181	gb|AC121580.3| Mus musculus BAC clone RP23-255J21 from 9, comple...	44	0.50
182	gb|AC098705.2| Mus musculus BAC clone RP23-1B19 from 3, complete...	44	0.50
183	gb|AC098724.3| Mus musculus BAC clone RP23-3D14 from 4, complete...	44	0.50
184	gb|BC052339.1| Mus musculus ribosomal protein L7a, mRNA (cDNA cl...	44	0.50
185	gb|BC016489.1| Mus musculus ribosomal protein L7a, mRNA (cDNA cl...	44	0.50
186	emb|CR648468.2|CNS0EZBU Tetraodon nigroviridis full-length cDNA	44	0.50
187	gb|AC115910.6| Mus musculus, clone RP24-480O17, complete sequence	44	0.50
188	gb|AC102675.9| Mus musculus, clone RP23-232O16, complete sequence	44	0.50
189	gb|AC112406.5| Rattus norvegicus 11 BAC CH230-329D3 (Children's ...	44	0.50
190	gb|BC099389.1| Mus musculus ribosomal protein L7a, mRNA (cDNA cl...	44	0.50
191	emb|BX908789.1| Neurospora crassa DNA linkage group VII BAC clon...	44	0.50
192	gb|AC153153.4| Mus musculus BAC clone RP23-79G18 from chromosome...	44	0.50
193	emb|AL606528.7| Mouse DNA sequence from clone RP23-45H23 on chro...	44	0.50
194	dbj|AB246884.1| Lethenteron japonicum RPL7A mRNA for ribosomal p...	44	0.50
195	gb|AC083913.2| Genomic sequence for Mus musculus, clone RP23-376...	44	0.50
196	dbj|AK135447.1| Mus musculus 12 days embryo female mullerian duc...	44	0.50
197	dbj|AK160044.1| Mus musculus osteoclast-like cell cDNA, RIKEN fu...	44	0.50
198	dbj|AK160622.1| Mus musculus 11 days embryo whole body cDNA, RIK...	44	0.50
199	dbj|AK160621.1| Mus musculus 11 days embryo whole body cDNA, RIK...	44	0.50
200	gb|AC162454.3| Mus musculus chromosome 1, clone RP23-7D20, compl...	44	0.50
201	gb|AC119212.15| Mus musculus chromosome 1, clone RP24-192L21, co...	44	0.50
202	gb|BC089624.1| Mus musculus ribosomal protein L7a, mRNA (cDNA cl...	44	0.50
203	gb|AC155934.2| Mus musculus BAC clone RP23-58N8 from chromosome ...	44	0.50
204	gb|AC156637.2| Mus musculus BAC clone RP24-241I18 from chromosom...	44	0.50
205	dbj|AK081115.1| Mus musculus 10 days neonate cerebellum cDNA, RI...	44	0.50
206	gb|AC153869.7| Mus musculus 6 BAC RP23-386A17 (Roswell Park Canc...	44	0.50
207	dbj|AK019449.1| Mus musculus 14, 17 days embryo head cDNA, RIKEN...	44	0.50
208	gb|AC153952.4| Mus musculus 10 BAC RP24-82M14 (Roswell Park Canc...	44	0.50
209	dbj|AK030194.1| Mus musculus adult male testis cDNA, RIKEN full-...	44	0.50
210	dbj|AK014551.1| Mus musculus 0 day neonate skin cDNA, RIKEN full...	44	0.50
211	gb|AY967504.1| Schmidtea mediterranea clone HE.3.01B mRNA sequence	44	0.50
212	gb|AC130530.4| Mus musculus BAC clone RP23-153P2 from chromosome...	44	0.50
213	ref|XM_221603.3| PREDICTED: Rattus norvegicus similar to 60S rib...	44	0.50
214	ref|XM_580204.1| PREDICTED: Rattus norvegicus LOC501505 (LOC5015...	44	0.50
215	ref|XM_221473.3| PREDICTED: Rattus norvegicus similar to 60S rib...	44	0.50
216	ref|XM_576256.1| PREDICTED: Rattus norvegicus similar to 60S rib...	44	0.50
217	ref|XM_578581.1| PREDICTED: Rattus norvegicus similar to 60S rib...	44	0.50
218	ref|XM_576046.1| PREDICTED: Rattus norvegicus similar to 60S rib...	44	0.50
219	ref|XM_574700.1| PREDICTED: Rattus norvegicus similar to Rpl7a p...	44	0.50
220	ref|NM_001013830.1| Mus musculus similar to 60S ribosomal protei...	44	0.50
221	gb|BC091731.1| Mus musculus ribosomal protein L7a, mRNA (cDNA cl...	44	0.50
222	gb|BC091769.1| Mus musculus ribosomal protein L7a, mRNA (cDNA cl...	44	0.50
223	gb|BC080712.1| Mus musculus ribosomal protein L7a, mRNA (cDNA cl...	44	0.50
224	gb|BC080669.1| Mus musculus ribosomal protein L7a, mRNA (cDNA cl...	44	0.50
225	gb|BC080663.1| Mus musculus ribosomal protein L7a, mRNA (cDNA cl...	44	0.50
226	gb|AC154477.2| Mus musculus BAC clone RP24-134B24 from 14, compl...	44	0.50
227	gb|AC133581.22| Mus musculus chromosome 1, clone RP24-395P3, com...	44	0.50
228	gb|AC153627.2| Mus musculus 6 BAC RP23-104H13 (Roswell Park Canc...	44	0.50
229	gb|AC153621.5| Mus musculus 6 BAC RP23-272K20 (Roswell Park Canc...	44	0.50
230	emb|AJ871581.1| Streptomyces achromogenes subsp. rubradiris comp...	44	0.50
231	gb|AC139040.8| Mus musculus chromosome 19, clone RP23-292H20, co...	44	0.50
232	emb|AL671935.30| Mouse DNA sequence from clone RP23-421J13 on ch...	44	0.50
233	gb|AC154649.3| Mus musculus BAC clone RP23-156O5 from chromosome...	44	0.50
234	gb|AC123825.5| Mus musculus BAC clone RP24-93F18 from 8, complet...	44	0.50
235	gb|BC029992.1| Mus musculus ribosomal protein L7a, mRNA (cDNA cl...	44	0.50
236	gb|AC132438.3| Mus musculus BAC clone RP23-234G15 from 3, comple...	44	0.50
237	gb|AC112266.6| Mus musculus BAC clone RP23-422B6 from 13, comple...	44	0.50
238	gb|AC139575.3| Mus musculus BAC clone RP23-430K5 from 8, complet...	44	0.50
239	ref|NG_005356.1| Mus musculus ribosomal protein L7a pseudogene (...	44	0.50
240	emb|AL831733.4| Mouse DNA sequence from clone RP23-109O11 on chr...	44	0.50
241	emb|AL732328.12| Mouse DNA sequence from clone RP23-106P4 on chr...	44	0.50
242	emb|AL670660.8| Mouse DNA sequence from clone RP23-265D6 on chro...	44	0.50
243	emb|AL606915.12| Mouse DNA sequence from clone RP23-185C16 on ch...	44	0.50
244	gb|AY067190.1| Schmidtea mediterranea clone H.16.9f unknown mRNA...	44	0.50
245	gb|M20743.1|MUSSURFC Mouse surfeit locus (Surf-3) processed pseu...	44	0.50
246	gb|M20741.1|MUSSURFB Mouse surfeit locus (Surf-3) processed pseu...	44	0.50
247	ref|NM_023091.1| Rattus norvegicus gamma-aminobutyric acid A rec...	42	2.0
248	ref|NM_017369.1| Mus musculus gamma-aminobutyric acid (GABA-A) r...	42	2.0
249	gb|AY327575.1| Delftia acidovorans strain MC1 carboxymuconolacto...	42	2.0
250	gb|AF131866.2| Mus musculus chromosome X clone CT7-271B7 map qA7...	42	2.0
251	gb|AC124212.2| Mus musculus chromosome X clone CT7-532E7 map qA7...	42	2.0
252	ref|XM_535657.2| PREDICTED: Canis familiaris similar to 60S ribo...	42	2.0
253	emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete ...	42	2.0
254	gb|AC117241.4| Mus musculus BAC clone RP24-147H15 from chromosom...	42	2.0
255	gb|AC147798.30| Mus musculus strain C57BL/6J chromosome 17 clone...	42	2.0
256	gb|AE011984.1| Xanthomonas axonopodis pv. citri str. 306, secti...	42	2.0
257	gb|AE012440.1| Xanthomonas campestris pv. campestris str. ATCC 3...	42	2.0
258	dbj|AB226265.1| Aspergillus oryzae cDNA, contig sequence: AoEST3124	42	2.0
259	gb|CP000133.1| Rhizobium etli CFN 42, complete genome	42	2.0
260	dbj|AP007155.1| Aspergillus oryzae RIB40 genomic DNA, SC003	42	2.0
261	gb|AC102131.20| Mus musculus chromosome 18, clone RP23-223O13, c...	42	2.0
262	gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, ...	42	2.0
263	gb|AC008381.8|AC008381 Homo sapiens chromosome 5 clone CTC-216O1...	42	2.0
264	dbj|AK079258.1| Mus musculus adult male urinary bladder cDNA, RI...	42	2.0
265	emb|AL115993.1|CNS01CU9 Botrytis cinerea strain T4 cDNA library	42	2.0
266	emb|AL116480.1|CNS01D7S Botrytis cinerea strain T4 cDNA library	42	2.0
267	emb|AL114151.1|CNS01BF3 Botrytis cinerea strain T4 cDNA library	42	2.0
268	emb|AL113067.1|CNS01AKZ Botrytis cinerea strain T4 cDNA library	42	2.0
269	emb|AL112537.1|CNS01A69 Botrytis cinerea strain T4 cDNA library	42	2.0
270	gb|AY925005.1| Seculamonas ecuadoriensis Rpl7A gene, partial cds	42	2.0
271	gb|AC148610.9| Mus musculus chromosome 17, clone RP24-260D18, co...	42	2.0
272	ref|XM_221689.3| PREDICTED: Rattus norvegicus similar to 60S rib...	42	2.0
273	gb|AF189265.1|AF189264S2 Mus musculus GABA-A receptor epsilon-li...	42	2.0
274	gb|AF189263.1|AF189263 Mus musculus GABA-A receptor epsilon-like...	42	2.0
275	gb|AF189262.1|AF189262 Rattus norvegicus GABA-A receptor epsilon...	42	2.0
276	dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ...	42	2.0
277	gb|AC174679.2| Mus musculus BAC clone CH36-470B20 from chromosom...	42	2.0
278	gb|AC166099.2| Mus musculus BAC clone RP24-254H22 from chromosom...	42	2.0
279	gb|AC166360.4| Mus musculus BAC clone RP24-497L5 from chromosome...	42	2.0
280	emb|AL807816.7| Mouse DNA sequence from clone RP23-13H12 on chro...	42	2.0
281	gb|AC012166.6| Drosophila melanogaster clone BACR03A06, complete...	40	7.8
282	gb|AC016159.5| Drosophila melanogaster clone BACR48D05, complete...	40	7.8
283	ref|XM_478122.1| Oryza sativa (japonica cultivar-group), mRNA	40	7.8
284	ref|XM_473071.1| Oryza sativa (japonica cultivar-group), predic...	40	7.8
285	gb|AC166493.6| Mus musculus chromosome 1, clone RP24-317E14, com...	40	7.8
286	gb|AC131343.4| Oryza sativa (japonica cultivar-group) chromosome...	40	7.8
287	gb|CP000075.1| Pseudomonas syringae pv. syringae B728a, complete...	40	7.8
288	ref|XM_453972.1| Kluyveromyces lactis NRRL Y-1140, KLLA0E00506g ...	40	7.8
289	gb|CP000058.1| Pseudomonas syringae pv. phaseolicola 1448A, comp...	40	7.8
290	gb|AC114011.5| Oryza sativa (japonica cultivar-group) chromosome...	40	7.8
291	ref|XR_003404.1| PREDICTED: Mus musculus similar to 60S ribosoma...	40	7.8
292	ref|XR_001826.1| PREDICTED: Mus musculus similar to 60S ribosoma...	40	7.8
293	gb|AC114423.16| Mus musculus chromosome 6, clone RP23-461C23, co...	40	7.8
294	emb|CR376767.12| Zebrafish DNA sequence from clone DKEY-86A12 in...	40	7.8
295	emb|CR388052.29| Zebrafish DNA sequence from clone CH211-178J18 ...	40	7.8
296	emb|CR847906.11| Zebrafish DNA sequence from clone DKEYP-4C4 in ...	40	7.8
297	emb|AM049004.1| Curculio glandium mRNA for ribosomal protein L7A...	40	7.8
298	gb|AC122915.2| Mus musculus BAC clone RP23-27G7 from 5, complete...	40	7.8
299	emb|CR699967.2|CNS0G31N Tetraodon nigroviridis full-length cDNA	40	7.8
300	emb|AL590077.19| Human DNA sequence from clone RP11-35F15 on chr...	40	7.8
301	gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, compl...	40	7.8
302	emb|AL049842.5|HSDJ129L7 Human DNA sequence from clone RP1-129L7...	40	7.8
303	emb|CR382125.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso...	40	7.8
304	emb|BX572595.1| Rhodopseudomonas palustris CGA009 complete genom...	40	7.8
305	gb|AC153615.4| Mus musculus 6 BAC RP23-24I14 (Roswell Park Cance...	40	7.8
306	emb|AL606658.5|OSJN00098 Oryza sativa genomic DNA, chromosome 4,...	40	7.8
307	emb|AL662957.2|OSJN00157 Oryza sativa genomic DNA, chromosome 4,...	40	7.8
308	gb|AC154397.8| Mus musculus chromosome 7, clone RP23-53N23, comp...	40	7.8
309	gb|AC101688.13| Mus musculus chromosome 5, clone RP23-212P12, co...	40	7.8
310	gb|AE005872.1| Caulobacter crescentus CB15 section 198 of 359 of...	40	7.8
311	gb|AC010007.4| Drosophila melanogaster 3L BAC RP98-17K17 (Roswel...	40	7.8
312	ref|NM_176271.1| Drosophila melanogaster CG2469-RB, transcript v...	40	7.8
313	ref|NM_176270.1| Drosophila melanogaster CG2469-RA, transcript v...	40	7.8
314	dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ...	40	7.8
315	gb|AC016764.8| Homo sapiens BAC clone RP11-549G13 from 2, comple...	40	7.8
316	gb|AY069525.1| Drosophila melanogaster LD24034 full length cDNA	40	7.8
317	gb|AC148828.2| Pan troglodytes BAC clone CH251-136M2 from chromo...	40	7.8
318	emb|BX530060.6| Zebrafish DNA sequence from clone DKEY-283F16 in...	40	7.8
319	gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome	40	7.8
320	dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D...	40	7.8
321	dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D...	40	7.8
322	dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D...	40	7.8
323	ref|XM_574781.1| PREDICTED: Rattus norvegicus similar to 60S rib...	40	7.8
324	dbj|AP004348.4| Oryza sativa (japonica cultivar-group) genomic D...	40	7.8
325	dbj|AP005250.3| Oryza sativa (japonica cultivar-group) genomic D...	40	7.8
326	gb|AY961486.1| Lysiphlebus testaceipes ribosomal protein L7a (Rp...	40	7.8
327	dbj|AP003849.2| Oryza sativa (japonica cultivar-group) genomic D...	40	7.8
328	dbj|AP005389.3| Oryza sativa (japonica cultivar-group) genomic D...	40	7.8
329	dbj|AP005298.3| Oryza sativa (japonica cultivar-group) genomic D...	40	7.8
330	gb|AC119176.10| Mus musculus chromosome 1, clone RP24-359F24, co...	40	7.8
331	emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,comp...	40	7.8
332	emb|BX890548.9| Zebrafish DNA sequence from clone CH211-238E22 i...	40	7.8
333	gb|AE003789.5| Drosophila melanogaster chromosome 2R, section 6 ...	40	7.8
334	gb|AE003471.3| Drosophila melanogaster chromosome 3L, section 5 ...	40	7.8
335	gb|AC118223.11| Mus musculus chromosome 7, clone RP23-337G6, com...	40	7.8
336	gb|AE015451.1| Pseudomonas putida KT2440 complete genome	40	7.8
337	gb|AC005847.1|AC005847 Drosophila melanogaster DNA sequence (P1s...	40	7.8
338	gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome...	40	7.8
339	emb|AL606604.4| Oryza sativa genomic DNA, chromosome 4, BAC clon...	40	7.8
340	emb|CT033296.1| Platynereis dumerilii EST IB0AAA23AB07EM1	40	7.8
341	emb|CT032318.1| Platynereis dumerilii EST IB0AAA40DB09EM1	40	7.8
342	emb|CT032317.1| Platynereis dumerilii EST IB0AAA40DB09FM1	40	7.8
343	emb|AL732626.8| Mouse DNA sequence from clone RP23-191F22 on chr...	40	7.8

---

>dbj|AK061725.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-B03, full
           insert sequence
          Length = 1055

 Score =  856 bits (432), Expect = 0.0
 Identities = 531/564 (94%)
 Strand = Plus / Plus

                                                                       
Query: 11  gcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcgctcca 70
           ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
Sbjct: 240 gcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggttcccccggcgctcaa 299

                                                                       
Query: 71  ccagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaagatgcttctcaa 130
           ||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||
Sbjct: 300 ccagttcacccgcaccctcgacaagaacctcgcaaccaacctgtttaagatgcttctcaa 359

                                                                       
Query: 131 gtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagagggcacaggctga 190
           ||||||||||||||||||||  || ||||||||||||||| |||||||||| ||||||||
Sbjct: 360 gtaccgccctgaggacaaggctgccaagaaggagaggcttttgaagagggcccaggctga 419

                                                                       
Query: 191 ggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagtatggtcttaacca 250
           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 420 ggctgaagggaaaaccgttgaggccaagaagccaattgttgtgaagtatggtcttaacca 479

                                                                       
Query: 251 tgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgctcatgatgttga 310
            || |||||||| ||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 480 cgtgacttacctcattgagcagagcaaggcccagctggttgtcatcgctcatgatgttga 539

                                                                       
Query: 311 cccaattgagctggttgtgtggctcccagccctatgcaggaagatggaggtcccatactg 370
            ||||||||||||||||||||||| |||||||| || ||||||||||||||||| |||||
Sbjct: 540 tccaattgagctggttgtgtggcttccagccctgtgtaggaagatggaggtcccttactg 599

                                                                       
Query: 371 cattgttaagggaaaatcacgccttggatcgattgttcacaagaagactgcctctgttct 430
           ||| |||||||| ||| | |||||||||||||||||||||||||||||||| ||||||||
Sbjct: 600 catcgttaagggcaaagctcgccttggatcgattgttcacaagaagactgcatctgttct 659

                                                                       
Query: 431 gtgcctcaccactgtgaagaacgaggacaagcttgagttcagcaagatcttggaggctat 490
           |||| | |||||||| ||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 660 gtgcttgaccactgtcaagaacgaggacaagcttgagttcagcaagatcttggaggccat 719

                                                                       
Query: 491 caaggcgaacttcaatgacaagttcgatgaggtcaggaagaagtggggtggtggtgtcat 550
           ||||||||||||||| ||||||||||| |||||||||||||||||||| || || |||||
Sbjct: 720 caaggcgaacttcaacgacaagttcgacgaggtcaggaagaagtggggaggcggcgtcat 779

                                   
Query: 551 gggctccaagtcgcaggcgaagac 574
           ||||||||||||||||||||||||
Sbjct: 780 gggctccaagtcgcaggcgaagac 803

---

>ref|XM_481630.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1023

 Score =  737 bits (372), Expect = 0.0
 Identities = 516/564 (91%)
 Strand = Plus / Plus

                                                                       
Query: 11  gcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcgctcca 70
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 251 gcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcgctcaa 310

                                                                       
Query: 71  ccagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaagatgcttctcaa 130
           ||||||||| ||||||||||||||||||||||| || || ||||| |||||||| |||||
Sbjct: 311 ccagttcactcgcaccctcgacaagaacctcgcaactaatctgtttaagatgctcctcaa 370

                                                                       
Query: 131 gtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagagggcacaggctga 190
           ||||||||||||||||||||  |||||||||||||||||| |||||||||| ||||||||
Sbjct: 371 gtaccgccctgaggacaaggctgctaagaaggagaggcttttgaagagggcccaggctga 430

                                                                       
Query: 191 ggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagtatggtcttaacca 250
           |||||| || |||||||||||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 431 ggctgaaggtaaaaccgttgaggcaaagaaaccaattgttgtgaagtatggtcttaacca 490

                                                                       
Query: 251 tgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgctcatgatgttga 310
           |||||| ||||| ||||||||||||||||| || ||||| ||||| ||||||||||| ||
Sbjct: 491 tgtcacatacctcattgagcagagcaaggcccaactggtcgtcattgctcatgatgtcga 550

                                                                       
Query: 311 cccaattgagctggttgtgtggctcccagccctatgcaggaagatggaggtcccatactg 370
            || |||||||||||||||||||| |||||||| |||||||||||||||||||| |||||
Sbjct: 551 tccgattgagctggttgtgtggcttccagccctgtgcaggaagatggaggtcccttactg 610

                                                                       
Query: 371 cattgttaagggaaaatcacgccttggatcgattgttcacaagaagactgcctctgttct 430
           |||||| || |||||| | || |||||||| |||||||||||||| ||||| ||||| ||
Sbjct: 611 cattgtgaaaggaaaagcccgtcttggatcaattgttcacaagaaaactgcatctgtcct 670

                                                                       
Query: 431 gtgcctcaccactgtgaagaacgaggacaagcttgagttcagcaagatcttggaggctat 490
            ||| | |||||||| ||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 671 ctgcttgaccactgtcaagaacgaggacaagcttgagttcagcaagatcctggaggctat 730

                                                                       
Query: 491 caaggcgaacttcaatgacaagttcgatgaggtcaggaagaagtggggtggtggtgtcat 550
           ||||||||||||||| ||||| ||||||||||| |||||||||||||| || || |||||
Sbjct: 731 caaggcgaacttcaacgacaaattcgatgaggttaggaagaagtggggaggcggcgtcat 790

                                   
Query: 551 gggctccaagtcgcaggcgaagac 574
           ||| ||||||||||||||||||||
Sbjct: 791 gggatccaagtcgcaggcgaagac 814

---

>ref|XM_507578.1| PREDICTED Oryza sativa (japonica cultivar-group), P0703C03.43 mRNA
          Length = 1041

 Score =  737 bits (372), Expect = 0.0
 Identities = 516/564 (91%)
 Strand = Plus / Plus

                                                                       
Query: 11  gcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcgctcca 70
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 252 gcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcgctcaa 311

                                                                       
Query: 71  ccagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaagatgcttctcaa 130
           ||||||||| ||||||||||||||||||||||| || || ||||| |||||||| |||||
Sbjct: 312 ccagttcactcgcaccctcgacaagaacctcgcaactaatctgtttaagatgctcctcaa 371

                                                                       
Query: 131 gtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagagggcacaggctga 190
           ||||||||||||||||||||  |||||||||||||||||| |||||||||| ||||||||
Sbjct: 372 gtaccgccctgaggacaaggctgctaagaaggagaggcttttgaagagggcccaggctga 431

                                                                       
Query: 191 ggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagtatggtcttaacca 250
           |||||| || |||||||||||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 432 ggctgaaggtaaaaccgttgaggcaaagaaaccaattgttgtgaagtatggtcttaacca 491

                                                                       
Query: 251 tgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgctcatgatgttga 310
           |||||| ||||| ||||||||||||||||| || ||||| ||||| ||||||||||| ||
Sbjct: 492 tgtcacatacctcattgagcagagcaaggcccaactggtcgtcattgctcatgatgtcga 551

                                                                       
Query: 311 cccaattgagctggttgtgtggctcccagccctatgcaggaagatggaggtcccatactg 370
            || |||||||||||||||||||| |||||||| |||||||||||||||||||| |||||
Sbjct: 552 tccgattgagctggttgtgtggcttccagccctgtgcaggaagatggaggtcccttactg 611

                                                                       
Query: 371 cattgttaagggaaaatcacgccttggatcgattgttcacaagaagactgcctctgttct 430
           |||||| || |||||| | || |||||||| |||||||||||||| ||||| ||||| ||
Sbjct: 612 cattgtgaaaggaaaagcccgtcttggatcaattgttcacaagaaaactgcatctgtcct 671

                                                                       
Query: 431 gtgcctcaccactgtgaagaacgaggacaagcttgagttcagcaagatcttggaggctat 490
            ||| | |||||||| ||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 672 ctgcttgaccactgtcaagaacgaggacaagcttgagttcagcaagatcctggaggctat 731

                                                                       
Query: 491 caaggcgaacttcaatgacaagttcgatgaggtcaggaagaagtggggtggtggtgtcat 550
           ||||||||||||||| ||||| ||||||||||| |||||||||||||| || || |||||
Sbjct: 732 caaggcgaacttcaacgacaaattcgatgaggttaggaagaagtggggaggcggcgtcat 791

                                   
Query: 551 gggctccaagtcgcaggcgaagac 574
           ||| ||||||||||||||||||||
Sbjct: 792 gggatccaagtcgcaggcgaagac 815

---

>ref|XM_507194.2| PREDICTED Oryza sativa (japonica cultivar-group), P0703C03.43 mRNA
          Length = 1091

 Score =  737 bits (372), Expect = 0.0
 Identities = 516/564 (91%)
 Strand = Plus / Plus

                                                                       
Query: 11  gcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcgctcca 70
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 255 gcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcgctcaa 314

                                                                       
Query: 71  ccagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaagatgcttctcaa 130
           ||||||||| ||||||||||||||||||||||| || || ||||| |||||||| |||||
Sbjct: 315 ccagttcactcgcaccctcgacaagaacctcgcaactaatctgtttaagatgctcctcaa 374

                                                                       
Query: 131 gtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagagggcacaggctga 190
           ||||||||||||||||||||  |||||||||||||||||| |||||||||| ||||||||
Sbjct: 375 gtaccgccctgaggacaaggctgctaagaaggagaggcttttgaagagggcccaggctga 434

                                                                       
Query: 191 ggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagtatggtcttaacca 250
           |||||| || |||||||||||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 435 ggctgaaggtaaaaccgttgaggcaaagaaaccaattgttgtgaagtatggtcttaacca 494

                                                                       
Query: 251 tgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgctcatgatgttga 310
           |||||| ||||| ||||||||||||||||| || ||||| ||||| ||||||||||| ||
Sbjct: 495 tgtcacatacctcattgagcagagcaaggcccaactggtcgtcattgctcatgatgtcga 554

                                                                       
Query: 311 cccaattgagctggttgtgtggctcccagccctatgcaggaagatggaggtcccatactg 370
            || |||||||||||||||||||| |||||||| |||||||||||||||||||| |||||
Sbjct: 555 tccgattgagctggttgtgtggcttccagccctgtgcaggaagatggaggtcccttactg 614

                                                                       
Query: 371 cattgttaagggaaaatcacgccttggatcgattgttcacaagaagactgcctctgttct 430
           |||||| || |||||| | || |||||||| |||||||||||||| ||||| ||||| ||
Sbjct: 615 cattgtgaaaggaaaagcccgtcttggatcaattgttcacaagaaaactgcatctgtcct 674

                                                                       
Query: 431 gtgcctcaccactgtgaagaacgaggacaagcttgagttcagcaagatcttggaggctat 490
            ||| | |||||||| ||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 675 ctgcttgaccactgtcaagaacgaggacaagcttgagttcagcaagatcctggaggctat 734

                                                                       
Query: 491 caaggcgaacttcaatgacaagttcgatgaggtcaggaagaagtggggtggtggtgtcat 550
           ||||||||||||||| ||||| ||||||||||| |||||||||||||| || || |||||
Sbjct: 735 caaggcgaacttcaacgacaaattcgatgaggttaggaagaagtggggaggcggcgtcat 794

                                   
Query: 551 gggctccaagtcgcaggcgaagac 574
           ||| ||||||||||||||||||||
Sbjct: 795 gggatccaagtcgcaggcgaagac 818

---

>dbj|AK121204.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023087N22, full
           insert sequence
          Length = 1091

 Score =  737 bits (372), Expect = 0.0
 Identities = 516/564 (91%)
 Strand = Plus / Plus

                                                                       
Query: 11  gcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcgctcca 70
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 255 gcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcgctcaa 314

                                                                       
Query: 71  ccagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaagatgcttctcaa 130
           ||||||||| ||||||||||||||||||||||| || || ||||| |||||||| |||||
Sbjct: 315 ccagttcactcgcaccctcgacaagaacctcgcaactaatctgtttaagatgctcctcaa 374

                                                                       
Query: 131 gtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagagggcacaggctga 190
           ||||||||||||||||||||  |||||||||||||||||| |||||||||| ||||||||
Sbjct: 375 gtaccgccctgaggacaaggctgctaagaaggagaggcttttgaagagggcccaggctga 434

                                                                       
Query: 191 ggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagtatggtcttaacca 250
           |||||| || |||||||||||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 435 ggctgaaggtaaaaccgttgaggcaaagaaaccaattgttgtgaagtatggtcttaacca 494

                                                                       
Query: 251 tgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgctcatgatgttga 310
           |||||| ||||| ||||||||||||||||| || ||||| ||||| ||||||||||| ||
Sbjct: 495 tgtcacatacctcattgagcagagcaaggcccaactggtcgtcattgctcatgatgtcga 554

                                                                       
Query: 311 cccaattgagctggttgtgtggctcccagccctatgcaggaagatggaggtcccatactg 370
            || |||||||||||||||||||| |||||||| |||||||||||||||||||| |||||
Sbjct: 555 tccgattgagctggttgtgtggcttccagccctgtgcaggaagatggaggtcccttactg 614

                                                                       
Query: 371 cattgttaagggaaaatcacgccttggatcgattgttcacaagaagactgcctctgttct 430
           |||||| || |||||| | || |||||||| |||||||||||||| ||||| ||||| ||
Sbjct: 615 cattgtgaaaggaaaagcccgtcttggatcaattgttcacaagaaaactgcatctgtcct 674

                                                                       
Query: 431 gtgcctcaccactgtgaagaacgaggacaagcttgagttcagcaagatcttggaggctat 490
            ||| | |||||||| ||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 675 ctgcttgaccactgtcaagaacgaggacaagcttgagttcagcaagatcctggaggctat 734

                                                                       
Query: 491 caaggcgaacttcaatgacaagttcgatgaggtcaggaagaagtggggtggtggtgtcat 550
           ||||||||||||||| ||||| ||||||||||| |||||||||||||| || || |||||
Sbjct: 735 caaggcgaacttcaacgacaaattcgatgaggttaggaagaagtggggaggcggcgtcat 794

                                   
Query: 551 gggctccaagtcgcaggcgaagac 574
           ||| ||||||||||||||||||||
Sbjct: 795 gggatccaagtcgcaggcgaagac 818

---

>dbj|AK062210.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-047-A04, full
           insert sequence
          Length = 1041

 Score =  737 bits (372), Expect = 0.0
 Identities = 516/564 (91%)
 Strand = Plus / Plus

                                                                       
Query: 11  gcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcgctcca 70
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 252 gcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcgctcaa 311

                                                                       
Query: 71  ccagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaagatgcttctcaa 130
           ||||||||| ||||||||||||||||||||||| || || ||||| |||||||| |||||
Sbjct: 312 ccagttcactcgcaccctcgacaagaacctcgcaactaatctgtttaagatgctcctcaa 371

                                                                       
Query: 131 gtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagagggcacaggctga 190
           ||||||||||||||||||||  |||||||||||||||||| |||||||||| ||||||||
Sbjct: 372 gtaccgccctgaggacaaggctgctaagaaggagaggcttttgaagagggcccaggctga 431

                                                                       
Query: 191 ggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagtatggtcttaacca 250
           |||||| || |||||||||||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 432 ggctgaaggtaaaaccgttgaggcaaagaaaccaattgttgtgaagtatggtcttaacca 491

                                                                       
Query: 251 tgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgctcatgatgttga 310
           |||||| ||||| ||||||||||||||||| || ||||| ||||| ||||||||||| ||
Sbjct: 492 tgtcacatacctcattgagcagagcaaggcccaactggtcgtcattgctcatgatgtcga 551

                                                                       
Query: 311 cccaattgagctggttgtgtggctcccagccctatgcaggaagatggaggtcccatactg 370
            || |||||||||||||||||||| |||||||| |||||||||||||||||||| |||||
Sbjct: 552 tccgattgagctggttgtgtggcttccagccctgtgcaggaagatggaggtcccttactg 611

                                                                       
Query: 371 cattgttaagggaaaatcacgccttggatcgattgttcacaagaagactgcctctgttct 430
           |||||| || |||||| | || |||||||| |||||||||||||| ||||| ||||| ||
Sbjct: 612 cattgtgaaaggaaaagcccgtcttggatcaattgttcacaagaaaactgcatctgtcct 671

                                                                       
Query: 431 gtgcctcaccactgtgaagaacgaggacaagcttgagttcagcaagatcttggaggctat 490
            ||| | |||||||| ||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 672 ctgcttgaccactgtcaagaacgaggacaagcttgagttcagcaagatcctggaggctat 731

                                                                       
Query: 491 caaggcgaacttcaatgacaagttcgatgaggtcaggaagaagtggggtggtggtgtcat 550
           ||||||||||||||| ||||| ||||||||||| |||||||||||||| || || |||||
Sbjct: 732 caaggcgaacttcaacgacaaattcgatgaggttaggaagaagtggggaggcggcgtcat 791

                                   
Query: 551 gggctccaagtcgcaggcgaagac 574
           ||| ||||||||||||||||||||
Sbjct: 792 gggatccaagtcgcaggcgaagac 815

---

>dbj|D12631.1|RICRPL7AB Oryza sativa (japonica cultivar-group) mRNA for ribosomal protein
           L7A, complete cds
          Length = 954

 Score =  737 bits (372), Expect = 0.0
 Identities = 516/564 (91%)
 Strand = Plus / Plus

                                                                       
Query: 11  gcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcgctcca 70
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 182 gcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcgctcaa 241

                                                                       
Query: 71  ccagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaagatgcttctcaa 130
           ||||||||| ||||||||||||||||||||||| || || ||||| |||||||| |||||
Sbjct: 242 ccagttcactcgcaccctcgacaagaacctcgcaactaatctgtttaagatgctcctcaa 301

                                                                       
Query: 131 gtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagagggcacaggctga 190
           ||||||||||||||||||||  |||||||||||||||||| |||||||||| ||||||||
Sbjct: 302 gtaccgccctgaggacaaggctgctaagaaggagaggcttttgaagagggcccaggctga 361

                                                                       
Query: 191 ggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagtatggtcttaacca 250
           |||||| || |||||||||||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 362 ggctgaaggtaaaaccgttgaggcaaagaaaccaattgttgtgaagtatggtcttaacca 421

                                                                       
Query: 251 tgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgctcatgatgttga 310
           |||||| ||||| ||||||||||||||||| || ||||| ||||| ||||||||||| ||
Sbjct: 422 tgtcacatacctcattgagcagagcaaggcccaactggtcgtcattgctcatgatgtcga 481

                                                                       
Query: 311 cccaattgagctggttgtgtggctcccagccctatgcaggaagatggaggtcccatactg 370
            || |||||||||||||||||||| |||||||| |||||||||||||||||||| |||||
Sbjct: 482 tccgattgagctggttgtgtggcttccagccctgtgcaggaagatggaggtcccttactg 541

                                                                       
Query: 371 cattgttaagggaaaatcacgccttggatcgattgttcacaagaagactgcctctgttct 430
           |||||| || |||||| | || |||||||| |||||||||||||| ||||| ||||| ||
Sbjct: 542 cattgtgaaaggaaaagcccgtcttggatcaattgttcacaagaaaactgcatctgtcct 601

                                                                       
Query: 431 gtgcctcaccactgtgaagaacgaggacaagcttgagttcagcaagatcttggaggctat 490
            ||| | |||||||| ||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 602 ctgcttgaccactgtcaagaacgaggacaagcttgagttcagcaagatcctggaggctat 661

                                                                       
Query: 491 caaggcgaacttcaatgacaagttcgatgaggtcaggaagaagtggggtggtggtgtcat 550
           ||||||||||||||| ||||| ||||||||||| |||||||||||||| || || |||||
Sbjct: 662 caaggcgaacttcaacgacaaattcgatgaggttaggaagaagtggggaggcggcgtcat 721

                                   
Query: 551 gggctccaagtcgcaggcgaagac 574
           ||| ||||||||||||||||||||
Sbjct: 722 gggatccaagtcgcaggcgaagac 745

---

>dbj|AK098843.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000B08, full
           insert sequence
          Length = 1022

 Score =  729 bits (368), Expect = 0.0
 Identities = 515/564 (91%)
 Strand = Plus / Plus

                                                                       
Query: 11  gcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcgctcca 70
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 251 gcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcgctcaa 310

                                                                       
Query: 71  ccagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaagatgcttctcaa 130
           ||||||||| ||||||||||||||||||||||| || || ||||| |||||||| |||||
Sbjct: 311 ccagttcactcgcaccctcgacaagaacctcgcaactaatctgtttaagatgctcctcaa 370

                                                                       
Query: 131 gtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagagggcacaggctga 190
           ||||||||||||||||||||  |||||||||||||||||| |||||||||| ||||||||
Sbjct: 371 gtaccgccctgaggacaaggctgctaagaaggagaggcttttgaagagggcccaggctga 430

                                                                       
Query: 191 ggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagtatggtcttaacca 250
           |||||| || |||||||||||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 431 ggctgaaggtaaaaccgttgaggcaaagaaaccaattgttgtgaagtatggtcttaacca 490

                                                                       
Query: 251 tgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgctcatgatgttga 310
           |||||| ||||| ||||||||||||||||| || ||||| ||||| ||||||||||| ||
Sbjct: 491 tgtcacatacctcattgagcagagcaaggcccaactggtcgtcattgctcatgatgtcga 550

                                                                       
Query: 311 cccaattgagctggttgtgtggctcccagccctatgcaggaagatggaggtcccatactg 370
            || |||||||||||||||||||| |||||||| |||||||||||||||||||| |||||
Sbjct: 551 tccgattgagctggttgtgtggcttccagccctgtgcaggaagatggaggtcccttactg 610

                                                                       
Query: 371 cattgttaagggaaaatcacgccttggatcgattgttcacaagaagactgcctctgttct 430
           |||||| || |||||| | || |||||||| |||||||||||||| ||||| ||||| ||
Sbjct: 611 cattgtgaaaggaaaagcccgtcttggatcaattgttcacaagaaaactgcatctgtcct 670

                                                                       
Query: 431 gtgcctcaccactgtgaagaacgaggacaagcttgagttcagcaagatcttggaggctat 490
            ||| | |||||||| ||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 671 ctgcttgaccactgtcaagaacgaggacaagcttgagttcagcaagatcctggaggctat 730

                                                                       
Query: 491 caaggcgaacttcaatgacaagttcgatgaggtcaggaagaagtggggtggtggtgtcat 550
           ||||||||||||||| ||||| ||||||||||| |||||||||||||| || || |||||
Sbjct: 731 caaggcgaacttcaacgacaaattcgatgaggttaggaagaagtggggaggcggcgtcat 790

                                   
Query: 551 gggctccaagtcgcaggcgaagac 574
           |||  |||||||||||||||||||
Sbjct: 791 gggaaccaagtcgcaggcgaagac 814

---

>gb|BT016736.1| Zea mays clone Contig569 mRNA sequence
          Length = 1092

 Score =  714 bits (360), Expect = 0.0
 Identities = 513/564 (90%)
 Strand = Plus / Plus

                                                                       
Query: 11  gcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcgctcca 70
           |||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||| |
Sbjct: 229 gcgcatccagcgccagcgtcgcatcctcaagcagcgcctcaaggtgcctccggcgctcaa 288

                                                                       
Query: 71  ccagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaagatgcttctcaa 130
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||
Sbjct: 289 ccagttcacccgcaccctcgacaagaacctcgctaccaacctgttcaagatgcttcttaa 348

                                                                       
Query: 131 gtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagagggcacaggctga 190
           |||||| || || |||||||  || |||||||||||||||||||||||||| ||||||||
Sbjct: 349 gtaccggcccgaagacaaggctgccaagaaggagaggcttctgaagagggcccaggctga 408

                                                                       
Query: 191 ggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagtatggtcttaacca 250
           |  ||| || ||||| |||||  ||||||| |||||||||||||||||||| ||||||||
Sbjct: 409 gaatgaaggaaaaactgttgaatccaagaaaccaattgttgtgaagtatggccttaacca 468

                                                                       
Query: 251 tgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgctcatgatgttga 310
           ||| |||||||| |||||||||| |||||||||||| |||||||||||||||||||| ||
Sbjct: 469 tgtgacttacctcattgagcagaacaaggctcagctcgttgtcatcgctcatgatgtgga 528

                                                                       
Query: 311 cccaattgagctggttgtgtggctcccagccctatgcaggaagatggaggtcccatactg 370
            || ||||| |||||||| ||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 529 tccgattgaactggttgtttggcttccagccctgtgcaggaagatggaggtcccatactg 588

                                                                       
Query: 371 cattgttaagggaaaatcacgccttggatcgattgttcacaagaagactgcctctgttct 430
           ||||||||| |||||  | |||||||||||||| ||||||||||||||||| || ||  |
Sbjct: 589 cattgttaaaggaaaggctcgccttggatcgatcgttcacaagaagactgcatcagtctt 648

                                                                       
Query: 431 gtgcctcaccactgtgaagaacgaggacaagcttgagttcagcaagatcttggaggctat 490
           ||| || |||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 649 gtgtctgaccactgtcaagaacgaggacaagcttgagttcagcaagatcttggaggctat 708

                                                                       
Query: 491 caaggcgaacttcaatgacaagttcgatgaggtcaggaagaagtggggtggtggtgtcat 550
            ||||||||||||||||||||||| ||||| ||||||||||||||||| |||||  ||||
Sbjct: 709 taaggcgaacttcaatgacaagtttgatgaagtcaggaagaagtggggaggtggcatcat 768

                                   
Query: 551 gggctccaagtcgcaggcgaagac 574
           |||||||||||||||||| |||||
Sbjct: 769 gggctccaagtcgcaggccaagac 792

---

>gb|BT018084.1| Zea mays clone EL01N0552B03.c mRNA sequence
          Length = 849

 Score =  682 bits (344), Expect = 0.0
 Identities = 506/560 (90%)
 Strand = Plus / Plus

                                                                       
Query: 15  atccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcgctccaccag 74
           ||||||||||||||||||||||||||||||||||||||||| || ||||||||| |||||
Sbjct: 60  atccagcgccagcgccgcatcctcaagcagcgcctcaaggtaccaccggcgctcaaccag 119

                                                                       
Query: 75  ttcacccgcaccctcgacaagaacctcgccaccaacctgttcaagatgcttctcaagtac 134
           ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||||
Sbjct: 120 ttcacccgcaccctcgacaagaacctcgctacgaacctgtttaagatgcttctcaagtac 179

                                                                       
Query: 135 cgccctgaggacaaggtggctaagaaggagaggcttctgaagagggcacaggctgaggct 194
           || ||||| |||||||  || |||||||||||||||||||||||||| || ||||||  |
Sbjct: 180 cggcctgaagacaaggctgccaagaaggagaggcttctgaagagggcccaagctgagaat 239

                                                                       
Query: 195 gaggggaaaaccgttgaggccaagaagccaattgttgtgaagtatggtcttaaccatgtc 254
           || || ||||| |||||| | ||||| |||||||||||||||||||| ||||||||||| 
Sbjct: 240 gaaggaaaaactgttgagtcgaagaaaccaattgttgtgaagtatggccttaaccatgtg 299

                                                                       
Query: 255 acttaccttattgagcagagcaaggctcagctggttgtcatcgctcatgatgttgaccca 314
           |||||||| |||||||||| |||||||||||| ||||||||||||||||| || || || 
Sbjct: 300 acttacctcattgagcagaacaaggctcagcttgttgtcatcgctcatgacgtggatccg 359

                                                                       
Query: 315 attgagctggttgtgtggctcccagccctatgcaggaagatggaggtcccatactgcatt 374
           ||||| |||||||||||||| |||||||| |||||||||||||||||||| |||||||||
Sbjct: 360 attgaactggttgtgtggcttccagccctgtgcaggaagatggaggtcccttactgcatt 419

                                                                       
Query: 375 gttaagggaaaatcacgccttggatcgattgttcacaagaagactgcctctgttctgtgc 434
           ||||| |||||  | |||||||||||||||||||||||||||| ||| || ||  |||| 
Sbjct: 420 gttaaaggaaaggctcgccttggatcgattgttcacaagaagaatgcatcagtcttgtgt 479

                                                                       
Query: 435 ctcaccactgtgaagaacgaggacaagcttgagttcagcaagatcttggaggctatcaag 494
           ||||||||||| ||||||||||| |||||||||||||||||||||||||||||||| |||
Sbjct: 480 ctcaccactgtcaagaacgaggataagcttgagttcagcaagatcttggaggctattaag 539

                                                                       
Query: 495 gcgaacttcaatgacaagttcgatgaggtcaggaagaagtggggtggtggtgtcatgggc 554
           || |||||||| |||||||||||||||||||||||||||||||| |||||  ||||||| 
Sbjct: 540 gcaaacttcaacgacaagttcgatgaggtcaggaagaagtggggaggtggcatcatggga 599

                               
Query: 555 tccaagtcgcaggcgaagac 574
           |||||||||||||| |||||
Sbjct: 600 tccaagtcgcaggccaagac 619

---

>gb|AY105417.1| Zea mays PCO109699 mRNA sequence
          Length = 1103

 Score =  668 bits (337), Expect = 0.0
 Identities = 505/561 (90%)
 Strand = Plus / Plus

                                                                       
Query: 11  gcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcgctcca 70
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 228 gcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcgctcaa 287

                                                                       
Query: 71  ccagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaagatgcttctcaa 130
           ||||||||| || ||||||||||||||||| || || ||| |||||||||||||||| ||
Sbjct: 288 ccagttcacacgtaccctcgacaagaaccttgcaacaaacttgttcaagatgcttcttaa 347

                                                                       
Query: 131 gtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagagggcacaggctga 190
           ||||||||| |||||||| |  || ||||||||||||||  |||||||||| ||||||||
Sbjct: 348 gtaccgccccgaggacaaagctgccaagaaggagaggctcttgaagagggcccaggctga 407

                                                                       
Query: 191 ggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagtatggtcttaacca 250
               ||||||||||| |||||| | ||||| ||||||||||||||||| || ||||||||
Sbjct: 408 aaacgaggggaaaactgttgagtcaaagaaaccaattgttgtgaagtacggccttaacca 467

                                                                       
Query: 251 tgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgctcatgatgttga 310
           ||| |||||||| || |||||||||||||| |||||||||||||| ||||||||||||||
Sbjct: 468 tgtgacttacctcatcgagcagagcaaggcccagctggttgtcatagctcatgatgttga 527

                                                                       
Query: 311 cccaattgagctggttgtgtggctcccagccctatgcaggaagatggaggtcccatactg 370
            || || |||||||| ||||||||||| ||||| |||||||| |||||||| ||||||||
Sbjct: 528 tccgatcgagctggtcgtgtggctcccggccctttgcaggaaaatggaggttccatactg 587

                                                                       
Query: 371 cattgttaagggaaaatcacgccttggatcgattgttcacaagaagactgcctctgttct 430
           |||||| ||||||||| |||||||||||||||| ||||||||||||||||| ||||||||
Sbjct: 588 cattgtcaagggaaaagcacgccttggatcgatcgttcacaagaagactgcatctgttct 647

                                                                       
Query: 431 gtgcctcaccactgtgaagaacgaggacaagcttgagttcagcaagatcttggaggctat 490
            ||| | ||||| || ||||||||||||||||||||||||||||| ||| ||||||||||
Sbjct: 648 ttgcttgaccaccgtcaagaacgaggacaagcttgagttcagcaaaatcctggaggctat 707

                                                                       
Query: 491 caaggcgaacttcaatgacaagttcgatgaggtcaggaagaagtggggtggtggtgtcat 550
           |||||| |||||||| |||||||| |||||||||||||||||||||||||||||| ||||
Sbjct: 708 caaggctaacttcaacgacaagtttgatgaggtcaggaagaagtggggtggtggtatcat 767

                                
Query: 551 gggctccaagtcgcaggcgaa 571
           ||||||||| || ||||||||
Sbjct: 768 gggctccaaatcacaggcgaa 788

---

>gb|AY103834.1| Zea mays PCO109701 mRNA sequence
          Length = 1105

 Score =  666 bits (336), Expect = 0.0
 Identities = 504/560 (90%)
 Strand = Plus / Plus

                                                                       
Query: 15  atccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcgctccaccag 74
           |||||||| |||||||||||||||||||||||||||||||| || ||||||||| |||||
Sbjct: 237 atccagcggcagcgccgcatcctcaagcagcgcctcaaggtaccaccggcgctcaaccag 296

                                                                       
Query: 75  ttcacccgcaccctcgacaagaacctcgccaccaacctgttcaagatgcttctcaagtac 134
           ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||||
Sbjct: 297 ttcacccgcaccctcgacaagaacctcgctacgaacctgtttaagatgcttctcaagtac 356

                                                                       
Query: 135 cgccctgaggacaaggtggctaagaaggagaggcttctgaagagggcacaggctgaggct 194
           || ||||| |||||||  || |||||||||||||||||||||||||| || ||||||  |
Sbjct: 357 cggcctgaagacaaggctgccaagaaggagaggcttctgaagagggcccaagctgagaat 416

                                                                       
Query: 195 gaggggaaaaccgttgaggccaagaagccaattgttgtgaagtatggtcttaaccatgtc 254
           || || ||||| |||||| | ||||| |||||||||||||||||||| ||||||||||| 
Sbjct: 417 gaaggaaaaactgttgagtcgaagaaaccaattgttgtgaagtatggccttaaccatgtg 476

                                                                       
Query: 255 acttaccttattgagcagagcaaggctcagctggttgtcatcgctcatgatgttgaccca 314
           |||||||| |||||||||| |||||||||||| ||||||||||||||||| || || || 
Sbjct: 477 acttacctcattgagcagaacaaggctcagcttgttgtcatcgctcatgacgtggatccg 536

                                                                       
Query: 315 attgagctggttgtgtggctcccagccctatgcaggaagatggaggtcccatactgcatt 374
           ||||| |||||||||||||| |||||||| |||||||||||||||||||| |||||||||
Sbjct: 537 attgaactggttgtgtggcttccagccctgtgcaggaagatggaggtcccttactgcatt 596

                                                                       
Query: 375 gttaagggaaaatcacgccttggatcgattgttcacaagaagactgcctctgttctgtgc 434
           ||||| |||||  | |||||||||||||||||||||||||||| ||| || ||  |||| 
Sbjct: 597 gttaaaggaaaggctcgccttggatcgattgttcacaagaagaatgcatcagtcttgtgt 656

                                                                       
Query: 435 ctcaccactgtgaagaacgaggacaagcttgagttcagcaagatcttggaggctatcaag 494
           || |||||||| ||||||||||| |||||||||||||||||||||||||||||||| |||
Sbjct: 657 ctgaccactgtcaagaacgaggataagcttgagttcagcaagatcttggaggctattaag 716

                                                                       
Query: 495 gcgaacttcaatgacaagttcgatgaggtcaggaagaagtggggtggtggtgtcatgggc 554
           || |||||||| |||||||||||||||||||||||||||||||| |||||  ||||||| 
Sbjct: 717 gcaaacttcaacgacaagttcgatgaggtcaggaagaagtggggaggtggcatcatggga 776

                               
Query: 555 tccaagtcgcaggcgaagac 574
           |||||||||||||| |||||
Sbjct: 777 tccaagtcgcaggccaagac 796

---

>ref|XM_463662.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 927

 Score =  329 bits (166), Expect = 6e-87
 Identities = 346/406 (85%)
 Strand = Plus / Plus

                                                                       
Query: 157 agaaggagaggcttctgaagagggcacaggctgaggctgaggggaaaaccgttgaggcca 216
           ||||||| |||||| |||| || || || || |||||||| ||||| || ||||| ||||
Sbjct: 458 agaaggaaaggcttttgaaaagagcgcaagcagaggctgaagggaagactgttgaagcca 517

                                                                       
Query: 217 agaagccaattgttgtgaagtatggtcttaaccatgtcacttaccttattgagcagagca 276
           |||| |||||||||||||||||||||||| ||||||| || ||  | ||||| |||||||
Sbjct: 518 agaaaccaattgttgtgaagtatggtcttgaccatgtgacctatttgattgaacagagca 577

                                                                       
Query: 277 aggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggctcc 336
           |||| ||||| || ||||| ||||||||||| ||||| ||||| || || || |||||||
Sbjct: 578 aggcacagcttgtggtcattgctcatgatgtcgaccccattgaactcgtcgtttggctcc 637

                                                                       
Query: 337 cagccctatgcaggaagatggaggtcccatactgcattgttaagggaaaatcacgccttg 396
           ||||| | ||||||||||||||  |||| || |||||||| ||||||||  | || ||||
Sbjct: 638 cagccttgtgcaggaagatggaaatcccttattgcattgtgaagggaaaggctcgtcttg 697

                                                                       
Query: 397 gatcgattgttcacaagaagactgcctctgttctgtgcctcaccactgtgaagaacgagg 456
           |||||||||| ||||||||||| || ||||| || || || || ||||||||||| || |
Sbjct: 698 gatcgattgtgcacaagaagacagcatctgtcctttgtctgacgactgtgaagaatgaag 757

                                                                       
Query: 457 acaagcttgagttcagcaagatcttggaggctatcaaggcgaacttcaatgacaagttcg 516
           ||||| | ||||||||||| ||||||||||| || ||| | |||||||| ||||||||||
Sbjct: 758 acaagttggagttcagcaaaatcttggaggccattaagtcaaacttcaacgacaagttcg 817

                                                         
Query: 517 atgaggtcaggaagaagtggggtggtggtgtcatgggctccaagtc 562
           ||||||||||||||||||||||||||||| |||||||||| |||||
Sbjct: 818 atgaggtcaggaagaagtggggtggtggtatcatgggctcaaagtc 863



 Score =  135 bits (68), Expect = 2e-28
 Identities = 83/88 (94%)
 Strand = Plus / Plus

                                                                       
Query: 15  atccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcgctccaccag 74
           |||||||||||||||||| |||||||||||||||||||||| || || |||||| |||||
Sbjct: 364 atccagcgccagcgccgcgtcctcaagcagcgcctcaaggttccacccgcgctcaaccag 423

                                       
Query: 75  ttcacccgcaccctcgacaagaacctcg 102
           ||||||||||||||||||||||||||||
Sbjct: 424 ttcacccgcaccctcgacaagaacctcg 451

---

>gb|AY086353.1| Arabidopsis thaliana clone 24272 mRNA, complete sequence
          Length = 1020

 Score =  274 bits (138), Expect = 3e-70
 Identities = 387/470 (82%)
 Strand = Plus / Plus

                                                                       
Query: 93  aagaacctcgccaccaacctgttcaagatgcttctcaagtaccgccctgaggacaaggtg 152
           ||||| |||||||||| ||| |||||||| ||||| |||||  | || |||||||| |  
Sbjct: 318 aagaatctcgccaccagcctcttcaagattcttctgaagtataggccagaggacaaagcc 377

                                                                       
Query: 153 gctaagaaggagaggcttctgaagagggcacaggctgaggctgaggggaaaaccgttgag 212
           || ||||||||  | ||| |||| | ||| || |||||||| || || ||  | | ||| 
Sbjct: 378 gcaaagaaggaacgccttttgaacaaggctcaagctgaggcagaaggaaagcctgctgaa 437

                                                                       
Query: 213 gccaagaagccaattgttgtgaagtatggtcttaaccatgtcacttaccttattgagcag 272
            |||||||||| |||||||| ||||||||||| |||||||| |||||||| || ||||||
Sbjct: 438 tccaagaagcccattgttgttaagtatggtctcaaccatgtgacttacctcatcgagcag 497

                                                                       
Query: 273 agcaaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtgg 332
           | |||||| ||||| || ||||| || || ||||||||||| || ||| |||| || |||
Sbjct: 498 aacaaggcacagcttgtggtcattgcacacgatgttgaccctatcgagttggtggtctgg 557

                                                                       
Query: 333 ctcccagccctatgcaggaagatggaggtcccatactgcattgttaagggaaaatcacgc 392
            | || || || |||||||| ||||| ||||| ||||||||||||||||||||||| || 
Sbjct: 558 ttacctgcactctgcaggaaaatggaagtcccttactgcattgttaagggaaaatctcgt 617

                                                                       
Query: 393 cttggatcgattgttcacaagaagactgcctctgttctgtgcctcaccactgtgaagaac 452
           |||||| || | |||||| ||||||||||  |||   ||||| | |||||||||||||||
Sbjct: 618 cttggagcggtcgttcaccagaagactgctgctgccttgtgcttgaccactgtgaagaac 677

                                                                       
Query: 453 gaggacaagcttgagttcagcaagatcttggaggctatcaaggcgaacttcaatgacaag 512
           ||||||||||||||||||||||| ||| | ||||| |||||||| |||||||||||||||
Sbjct: 678 gaggacaagcttgagttcagcaaaatcctcgaggccatcaaggctaacttcaatgacaag 737

                                                             
Query: 513 ttcgatgaggtcaggaagaagtggggtggtggtgtcatgggctccaagtc 562
           | ||| |||  ||||||||||||||| |||||  | ||||| ||||||||
Sbjct: 738 tacgaggagtacaggaagaagtggggaggtggcataatgggatccaagtc 787

---

>ref|NM_116152.2| Arabidopsis thaliana structural constituent of ribosome AT3G62870
           mRNA, complete cds
          Length = 1048

 Score =  264 bits (133), Expect = 3e-67
 Identities = 403/493 (81%)
 Strand = Plus / Plus

                                                                       
Query: 70  accagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaagatgcttctca 129
           |||||||||||   ||||| || ||||| |||||||||| ||| |||||||| ||||| |
Sbjct: 295 accagttcaccaagacccttgataagaatctcgccaccagcctcttcaagattcttctga 354

                                                                       
Query: 130 agtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagagggcacaggctg 189
           ||||  | || |||||||| |  || ||||||||  | ||| |||| | ||| || ||||
Sbjct: 355 agtataggccagaggacaaagccgcaaagaaggaacgccttttgaacaaggctcaagctg 414

                                                                       
Query: 190 aggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagtatggtcttaacc 249
           |||| || || ||  | | |||  |||||||||| |||||||| ||||||||||| ||||
Sbjct: 415 aggcagaaggaaagcctgctgaatccaagaagcccattgttgttaagtatggtctcaacc 474

                                                                       
Query: 250 atgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgctcatgatgttg 309
           |||| |||||||| || ||||||| |||||| ||||| || ||||| || || |||||||
Sbjct: 475 atgtgacttacctcatcgagcagaacaaggcacagcttgtggtcattgcacacgatgttg 534

                                                                       
Query: 310 acccaattgagctggttgtgtggctcccagccctatgcaggaagatggaggtcccatact 369
           |||| || ||| |||| || ||| | || || || |||||||| ||||| ||||| ||||
Sbjct: 535 accctatcgagttggtggtctggttacctgcactctgcaggaaaatggaagtcccttact 594

                                                                       
Query: 370 gcattgttaagggaaaatcacgccttggatcgattgttcacaagaagactgcctctgttc 429
           ||||||||||||||||||| || |||||| || | |||||| ||||||||||  |||   
Sbjct: 595 gcattgttaagggaaaatctcgtcttggagcggtcgttcaccagaagactgctgctgcct 654

                                                                       
Query: 430 tgtgcctcaccactgtgaagaacgaggacaagcttgagttcagcaagatcttggaggcta 489
           ||||| | |||||||| ||||||||||||||||||||||||||||| ||| | ||||| |
Sbjct: 655 tgtgcttgaccactgtcaagaacgaggacaagcttgagttcagcaaaatcctcgaggcca 714

                                                                       
Query: 490 tcaaggcgaacttcaatgacaagttcgatgaggtcaggaagaagtggggtggtggtgtca 549
           ||||||| |||||||| ||||||| ||| |||  ||||||||||||||| |||||  | |
Sbjct: 715 tcaaggctaacttcaacgacaagtacgaggagtacaggaagaagtggggaggtggcataa 774

                        
Query: 550 tgggctccaagtc 562
           |||| ||||||||
Sbjct: 775 tgggatccaagtc 787

---

>gb|AY114667.1| Arabidopsis thaliana 60S ribosomal protein L7A protein (At3g62870)
           mRNA, complete cds
          Length = 883

 Score =  264 bits (133), Expect = 3e-67
 Identities = 403/493 (81%)
 Strand = Plus / Plus

                                                                       
Query: 70  accagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaagatgcttctca 129
           |||||||||||   ||||| || ||||| |||||||||| ||| |||||||| ||||| |
Sbjct: 215 accagttcaccaagacccttgataagaatctcgccaccagcctcttcaagattcttctga 274

                                                                       
Query: 130 agtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagagggcacaggctg 189
           ||||  | || |||||||| |  || ||||||||  | ||| |||| | ||| || ||||
Sbjct: 275 agtataggccagaggacaaagccgcaaagaaggaacgccttttgaacaaggctcaagctg 334

                                                                       
Query: 190 aggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagtatggtcttaacc 249
           |||| || || ||  | | |||  |||||||||| |||||||| ||||||||||| ||||
Sbjct: 335 aggcagaaggaaagcctgctgaatccaagaagcccattgttgttaagtatggtctcaacc 394

                                                                       
Query: 250 atgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgctcatgatgttg 309
           |||| |||||||| || ||||||| |||||| ||||| || ||||| || || |||||||
Sbjct: 395 atgtgacttacctcatcgagcagaacaaggcacagcttgtggtcattgcacacgatgttg 454

                                                                       
Query: 310 acccaattgagctggttgtgtggctcccagccctatgcaggaagatggaggtcccatact 369
           |||| || ||| |||| || ||| | || || || |||||||| ||||| ||||| ||||
Sbjct: 455 accctatcgagttggtggtctggttacctgcactctgcaggaaaatggaagtcccttact 514

                                                                       
Query: 370 gcattgttaagggaaaatcacgccttggatcgattgttcacaagaagactgcctctgttc 429
           ||||||||||||||||||| || |||||| || | |||||| ||||||||||  |||   
Sbjct: 515 gcattgttaagggaaaatctcgtcttggagcggtcgttcaccagaagactgctgctgcct 574

                                                                       
Query: 430 tgtgcctcaccactgtgaagaacgaggacaagcttgagttcagcaagatcttggaggcta 489
           ||||| | |||||||| ||||||||||||||||||||||||||||| ||| | ||||| |
Sbjct: 575 tgtgcttgaccactgtcaagaacgaggacaagcttgagttcagcaaaatcctcgaggcca 634

                                                                       
Query: 490 tcaaggcgaacttcaatgacaagttcgatgaggtcaggaagaagtggggtggtggtgtca 549
           ||||||| |||||||| ||||||| ||| |||  ||||||||||||||| |||||  | |
Sbjct: 635 tcaaggctaacttcaacgacaagtacgaggagtacaggaagaagtggggaggtggcataa 694

                        
Query: 550 tgggctccaagtc 562
           |||| ||||||||
Sbjct: 695 tgggatccaagtc 707

---

>gb|AY062758.1| Arabidopsis thaliana 60S RIBOSOMAL PROTEIN L7A protein (At3g62870;
           F26K9_300) mRNA, complete cds
          Length = 976

 Score =  264 bits (133), Expect = 3e-67
 Identities = 403/493 (81%)
 Strand = Plus / Plus

                                                                       
Query: 70  accagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaagatgcttctca 129
           |||||||||||   ||||| || ||||| |||||||||| ||| |||||||| ||||| |
Sbjct: 251 accagttcaccaagacccttgataagaatctcgccaccagcctcttcaagattcttctga 310

                                                                       
Query: 130 agtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagagggcacaggctg 189
           ||||  | || |||||||| |  || ||||||||  | ||| |||| | ||| || ||||
Sbjct: 311 agtataggccagaggacaaagccgcaaagaaggaacgccttttgaacaaggctcaagctg 370

                                                                       
Query: 190 aggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagtatggtcttaacc 249
           |||| || || ||  | | |||  |||||||||| |||||||| ||||||||||| ||||
Sbjct: 371 aggcagaaggaaagcctgctgaatccaagaagcccattgttgttaagtatggtctcaacc 430

                                                                       
Query: 250 atgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgctcatgatgttg 309
           |||| |||||||| || ||||||| |||||| ||||| || ||||| || || |||||||
Sbjct: 431 atgtgacttacctcatcgagcagaacaaggcacagcttgtggtcattgcacacgatgttg 490

                                                                       
Query: 310 acccaattgagctggttgtgtggctcccagccctatgcaggaagatggaggtcccatact 369
           |||| || ||| |||| || ||| | || || || |||||||| ||||| ||||| ||||
Sbjct: 491 accctatcgagttggtggtctggttacctgcactctgcaggaaaatggaagtcccttact 550

                                                                       
Query: 370 gcattgttaagggaaaatcacgccttggatcgattgttcacaagaagactgcctctgttc 429
           ||||||||||||||||||| || |||||| || | |||||| ||||||||||  |||   
Sbjct: 551 gcattgttaagggaaaatctcgtcttggagcggtcgttcaccagaagactgctgctgcct 610

                                                                       
Query: 430 tgtgcctcaccactgtgaagaacgaggacaagcttgagttcagcaagatcttggaggcta 489
           ||||| | |||||||| ||||||||||||||||||||||||||||| ||| | ||||| |
Sbjct: 611 tgtgcttgaccactgtcaagaacgaggacaagcttgagttcagcaaaatcctcgaggcca 670

                                                                       
Query: 490 tcaaggcgaacttcaatgacaagttcgatgaggtcaggaagaagtggggtggtggtgtca 549
           ||||||| |||||||| ||||||| ||| |||  ||||||||||||||| |||||  | |
Sbjct: 671 tcaaggctaacttcaacgacaagtacgaggagtacaggaagaagtggggaggtggcataa 730

                        
Query: 550 tgggctccaagtc 562
           |||| ||||||||
Sbjct: 731 tgggatccaagtc 743

---

>gb|AY060519.1| Arabidopsis thaliana AT3g62870/F26K9_300 mRNA, complete cds
          Length = 771

 Score =  264 bits (133), Expect = 3e-67
 Identities = 403/493 (81%)
 Strand = Plus / Plus

                                                                       
Query: 70  accagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaagatgcttctca 129
           |||||||||||   ||||| || ||||| |||||||||| ||| |||||||| ||||| |
Sbjct: 215 accagttcaccaagacccttgataagaatctcgccaccagcctcttcaagattcttctga 274

                                                                       
Query: 130 agtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagagggcacaggctg 189
           ||||  | || |||||||| |  || ||||||||  | ||| |||| | ||| || ||||
Sbjct: 275 agtataggccagaggacaaagccgcaaagaaggaacgccttttgaacaaggctcaagctg 334

                                                                       
Query: 190 aggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagtatggtcttaacc 249
           |||| || || ||  | | |||  |||||||||| |||||||| ||||||||||| ||||
Sbjct: 335 aggcagaaggaaagcctgctgaatccaagaagcccattgttgttaagtatggtctcaacc 394

                                                                       
Query: 250 atgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgctcatgatgttg 309
           |||| |||||||| || ||||||| |||||| ||||| || ||||| || || |||||||
Sbjct: 395 atgtgacttacctcatcgagcagaacaaggcacagcttgtggtcattgcacacgatgttg 454

                                                                       
Query: 310 acccaattgagctggttgtgtggctcccagccctatgcaggaagatggaggtcccatact 369
           |||| || ||| |||| || ||| | || || || |||||||| ||||| ||||| ||||
Sbjct: 455 accctatcgagttggtggtctggttacctgcactctgcaggaaaatggaagtcccttact 514

                                                                       
Query: 370 gcattgttaagggaaaatcacgccttggatcgattgttcacaagaagactgcctctgttc 429
           ||||||||||||||||||| || |||||| || | |||||| ||||||||||  |||   
Sbjct: 515 gcattgttaagggaaaatctcgtcttggagcggtcgttcaccagaagactgctgctgcct 574

                                                                       
Query: 430 tgtgcctcaccactgtgaagaacgaggacaagcttgagttcagcaagatcttggaggcta 489
           ||||| | |||||||| ||||||||||||||||||||||||||||| ||| | ||||| |
Sbjct: 575 tgtgcttgaccactgtcaagaacgaggacaagcttgagttcagcaaaatcctcgaggcca 634

                                                                       
Query: 490 tcaaggcgaacttcaatgacaagttcgatgaggtcaggaagaagtggggtggtggtgtca 549
           ||||||| |||||||| ||||||| ||| |||  ||||||||||||||| |||||  | |
Sbjct: 635 tcaaggctaacttcaacgacaagtacgaggagtacaggaagaagtggggaggtggcataa 694

                        
Query: 550 tgggctccaagtc 562
           |||| ||||||||
Sbjct: 695 tgggatccaagtc 707

---

>gb|AY052264.1| Arabidopsis thaliana AT3g62870/F26K9_300 mRNA, complete cds
          Length = 1013

 Score =  264 bits (133), Expect = 3e-67
 Identities = 403/493 (81%)
 Strand = Plus / Plus

                                                                       
Query: 70  accagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaagatgcttctca 129
           |||||||||||   ||||| || ||||| |||||||||| ||| |||||||| ||||| |
Sbjct: 288 accagttcaccaagacccttgataagaatctcgccaccagcctcttcaagattcttctga 347

                                                                       
Query: 130 agtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagagggcacaggctg 189
           ||||  | || |||||||| |  || ||||||||  | ||| |||| | ||| || ||||
Sbjct: 348 agtataggccagaggacaaagccgcaaagaaggaacgccttttgaacaaggctcaagctg 407

                                                                       
Query: 190 aggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagtatggtcttaacc 249
           |||| || || ||  | | |||  |||||||||| |||||||| ||||||||||| ||||
Sbjct: 408 aggcagaaggaaagcctgctgaatccaagaagcccattgttgttaagtatggtctcaacc 467

                                                                       
Query: 250 atgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgctcatgatgttg 309
           |||| |||||||| || ||||||| |||||| ||||| || ||||| || || |||||||
Sbjct: 468 atgtgacttacctcatcgagcagaacaaggcacagcttgtggtcattgcacacgatgttg 527

                                                                       
Query: 310 acccaattgagctggttgtgtggctcccagccctatgcaggaagatggaggtcccatact 369
           |||| || ||| |||| || ||| | || || || |||||||| ||||| ||||| ||||
Sbjct: 528 accctatcgagttggtggtctggttacctgcactctgcaggaaaatggaagtcccttact 587

                                                                       
Query: 370 gcattgttaagggaaaatcacgccttggatcgattgttcacaagaagactgcctctgttc 429
           ||||||||||||||||||| || |||||| || | |||||| ||||||||||  |||   
Sbjct: 588 gcattgttaagggaaaatctcgtcttggagcggtcgttcaccagaagactgctgctgcct 647

                                                                       
Query: 430 tgtgcctcaccactgtgaagaacgaggacaagcttgagttcagcaagatcttggaggcta 489
           ||||| | |||||||| ||||||||||||||||||||||||||||| ||| | ||||| |
Sbjct: 648 tgtgcttgaccactgtcaagaacgaggacaagcttgagttcagcaaaatcctcgaggcca 707

                                                                       
Query: 490 tcaaggcgaacttcaatgacaagttcgatgaggtcaggaagaagtggggtggtggtgtca 549
           ||||||| |||||||| ||||||| ||| |||  ||||||||||||||| |||||  | |
Sbjct: 708 tcaaggctaacttcaacgacaagtacgaggagtacaggaagaagtggggaggtggcataa 767

                        
Query: 550 tgggctccaagtc 562
           |||| ||||||||
Sbjct: 768 tgggatccaagtc 780

---

>emb|BX825094.1|CNS0A7RE Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH9ZD11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 835

 Score =  264 bits (133), Expect = 3e-67
 Identities = 403/493 (81%)
 Strand = Plus / Plus

                                                                       
Query: 70  accagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaagatgcttctca 129
           |||||||||||   ||||| || ||||| |||||||||| ||| |||||||| ||||| |
Sbjct: 171 accagttcaccaagacccttgataagaatctcgccaccagcctcttcaagattcttctga 230

                                                                       
Query: 130 agtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagagggcacaggctg 189
           ||||  | || |||||||| |  || ||||||||  | ||| |||| | ||| || ||||
Sbjct: 231 agtataggccagaggacaaagccgcaaagaaggaacgccttttgaacaaggctcaagctg 290

                                                                       
Query: 190 aggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagtatggtcttaacc 249
           |||| || || ||  | | |||  |||||||||| |||||||| ||||||||||| ||||
Sbjct: 291 aggcagaaggaaagcctgctgaatccaagaagcccattgttgttaagtatggtctcaacc 350

                                                                       
Query: 250 atgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgctcatgatgttg 309
           |||| |||||||| || ||||||| |||||| ||||| || ||||| || || |||||||
Sbjct: 351 atgtgacttacctcatcgagcagaacaaggcacagcttgtggtcattgcacacgatgttg 410

                                                                       
Query: 310 acccaattgagctggttgtgtggctcccagccctatgcaggaagatggaggtcccatact 369
           |||| || ||| |||| || ||| | || || || |||||||| ||||| ||||| ||||
Sbjct: 411 accctatcgagttggtggtctggttacctgcactctgcaggaaaatggaagtcccttact 470

                                                                       
Query: 370 gcattgttaagggaaaatcacgccttggatcgattgttcacaagaagactgcctctgttc 429
           ||||||||||||||||||| || |||||| || | |||||| ||||||||||  |||   
Sbjct: 471 gcattgttaagggaaaatctcgtcttggagcggtcgttcaccagaagactgctgctgcct 530

                                                                       
Query: 430 tgtgcctcaccactgtgaagaacgaggacaagcttgagttcagcaagatcttggaggcta 489
           ||||| | |||||||| ||||||||||||||||||||||||||||| ||| | ||||| |
Sbjct: 531 tgtgcttgaccactgtcaagaacgaggacaagcttgagttcagcaaaatcctcgaggcca 590

                                                                       
Query: 490 tcaaggcgaacttcaatgacaagttcgatgaggtcaggaagaagtggggtggtggtgtca 549
           ||||||| |||||||| ||||||| ||| |||  ||||||||||||||| |||||  | |
Sbjct: 591 tcaaggctaacttcaacgacaagtacgaggagtacaggaagaagtggggaggtggcataa 650

                        
Query: 550 tgggctccaagtc 562
           |||| ||||||||
Sbjct: 651 tgggatccaagtc 663

---

>emb|BX823982.1|CNS0A6PP Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH12ZB02 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 946

 Score =  264 bits (133), Expect = 3e-67
 Identities = 403/493 (81%)
 Strand = Plus / Plus

                                                                       
Query: 70  accagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaagatgcttctca 129
           |||||||||||   ||||| || ||||| |||||||||| ||| |||||||| ||||| |
Sbjct: 235 accagttcaccaagacccttgataagaatctcgccaccagcctcttcaagattcttctga 294

                                                                       
Query: 130 agtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagagggcacaggctg 189
           ||||  | || |||||||| |  || ||||||||  | ||| |||| | ||| || ||||
Sbjct: 295 agtataggccagaggacaaagccgcaaagaaggaacgccttttgaacaaggctcaagctg 354

                                                                       
Query: 190 aggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagtatggtcttaacc 249
           |||| || || ||  | | |||  |||||||||| |||||||| ||||||||||| ||||
Sbjct: 355 aggcagaaggaaagcctgctgaatccaagaagcccattgttgttaagtatggtctcaacc 414

                                                                       
Query: 250 atgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgctcatgatgttg 309
           |||| |||||||| || ||||||| |||||| ||||| || ||||| || || |||||||
Sbjct: 415 atgtgacttacctcatcgagcagaacaaggcacagcttgtggtcattgcacacgatgttg 474

                                                                       
Query: 310 acccaattgagctggttgtgtggctcccagccctatgcaggaagatggaggtcccatact 369
           |||| || ||| |||| || ||| | || || || |||||||| ||||| ||||| ||||
Sbjct: 475 accctatcgagttggtggtctggttacctgcactctgcaggaaaatggaagtcccttact 534

                                                                       
Query: 370 gcattgttaagggaaaatcacgccttggatcgattgttcacaagaagactgcctctgttc 429
           ||||||||||||||||||| || |||||| || | |||||| ||||||||||  |||   
Sbjct: 535 gcattgttaagggaaaatctcgtcttggagcggtcgttcaccagaagactgctgctgcct 594

                                                                       
Query: 430 tgtgcctcaccactgtgaagaacgaggacaagcttgagttcagcaagatcttggaggcta 489
           ||||| | |||||||| ||||||||||||||||||||||||||||| ||| | ||||| |
Sbjct: 595 tgtgcttgaccactgtcaagaacgaggacaagcttgagttcagcaaaatcctcgaggcca 654

                                                                       
Query: 490 tcaaggcgaacttcaatgacaagttcgatgaggtcaggaagaagtggggtggtggtgtca 549
           ||||||| |||||||| ||||||| ||| |||  ||||||||||||||| |||||  | |
Sbjct: 655 tcaaggctaacttcaacgacaagtacgaggagtacaggaagaagtggggaggtggcataa 714

                        
Query: 550 tgggctccaagtc 562
           |||| ||||||||
Sbjct: 715 tgggatccaagtc 727

---

>emb|BX824662.1|CNS0A4TO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH63ZA03 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 940

 Score =  264 bits (133), Expect = 3e-67
 Identities = 403/493 (81%)
 Strand = Plus / Plus

                                                                       
Query: 70  accagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaagatgcttctca 129
           |||||||||||   ||||| || ||||| |||||||||| ||| |||||||| ||||| |
Sbjct: 253 accagttcaccaagacccttgataagaatctcgccaccagcctcttcaagattcttctga 312

                                                                       
Query: 130 agtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagagggcacaggctg 189
           ||||  | || |||||||| |  || ||||||||  | ||| |||| | ||| || ||||
Sbjct: 313 agtataggccagaggacaaagccgcaaagaaggaacgccttttgaacaaggctcaagctg 372

                                                                       
Query: 190 aggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagtatggtcttaacc 249
           |||| || || ||  | | |||  |||||||||| |||||||| ||||||||||| ||||
Sbjct: 373 aggcagaaggaaagcctgctgaatccaagaagcccattgttgttaagtatggtctcaacc 432

                                                                       
Query: 250 atgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgctcatgatgttg 309
           |||| |||||||| || ||||||| |||||| ||||| || ||||| || || |||||||
Sbjct: 433 atgtgacttacctcatcgagcagaacaaggcacagcttgtggtcattgcacacgatgttg 492

                                                                       
Query: 310 acccaattgagctggttgtgtggctcccagccctatgcaggaagatggaggtcccatact 369
           |||| || ||| |||| || ||| | || || || |||||||| ||||| ||||| ||||
Sbjct: 493 accctatcgagttggtggtctggttacctgcactctgcaggaaaatggaagtcccttact 552

                                                                       
Query: 370 gcattgttaagggaaaatcacgccttggatcgattgttcacaagaagactgcctctgttc 429
           ||||||||||||||||||| || |||||| || | |||||| ||||||||||  |||   
Sbjct: 553 gcattgttaagggaaaatctcgtcttggagcggtcgttcaccagaagactgctgctgcct 612

                                                                       
Query: 430 tgtgcctcaccactgtgaagaacgaggacaagcttgagttcagcaagatcttggaggcta 489
           ||||| | |||||||| ||||||||||||||||||||||||||||| ||| | ||||| |
Sbjct: 613 tgtgcttgaccactgtcaagaacgaggacaagcttgagttcagcaaaatccttgaggcca 672

                                                                       
Query: 490 tcaaggcgaacttcaatgacaagttcgatgaggtcaggaagaagtggggtggtggtgtca 549
           ||||||| |||||||| ||||||| ||| |||  ||||||||||||||| |||||  | |
Sbjct: 673 tcaaggctaacttcaacgacaagtacgaggagtacaggaagaagtggggaggtggcataa 732

                        
Query: 550 tgggctccaagtc 562
           |||| ||||||||
Sbjct: 733 tgggatccaagtc 745

---

>emb|BX824178.1|CNS0A6S9 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH28ZG05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 983

 Score =  256 bits (129), Expect = 7e-65
 Identities = 402/493 (81%)
 Strand = Plus / Plus

                                                                       
Query: 70  accagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaagatgcttctca 129
           |||||||||||   ||||| || ||||| |||||||||| ||| |||||||| ||||| |
Sbjct: 254 accagttcaccaagacccttgataagaatctcgccaccagcctcttcaagattcttctga 313

                                                                       
Query: 130 agtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagagggcacaggctg 189
           ||||  | || |||||||| |  || ||||||||  | ||| |||| | ||| || ||||
Sbjct: 314 agtataggccagaggacaaagccgcaaagaaggaacgccttttgaacaaggctcaagctg 373

                                                                       
Query: 190 aggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagtatggtcttaacc 249
           |||| || || ||  | | |||  |||||||||| |||||||| ||||||||| | ||||
Sbjct: 374 aggcagaaggaaagcctgctgaatccaagaagcccattgttgttaagtatggtgtaaacc 433

                                                                       
Query: 250 atgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgctcatgatgttg 309
           |||| |||||||| || ||||||| |||||| ||||| || ||||| || || |||||||
Sbjct: 434 atgtgacttacctcatcgagcagaacaaggcacagcttgtggtcattgcacacgatgttg 493

                                                                       
Query: 310 acccaattgagctggttgtgtggctcccagccctatgcaggaagatggaggtcccatact 369
           |||| || ||| |||| || ||| | || || || |||||||| ||||| ||||| ||||
Sbjct: 494 accctatcgagttggtggtctggttacctgcactctgcaggaaaatggaagtcccttact 553

                                                                       
Query: 370 gcattgttaagggaaaatcacgccttggatcgattgttcacaagaagactgcctctgttc 429
           ||||||||||||||||||| || |||||| || | |||||| ||||||||||  |||   
Sbjct: 554 gcattgttaagggaaaatctcgtcttggagcggtcgttcaccagaagactgctgctgcct 613

                                                                       
Query: 430 tgtgcctcaccactgtgaagaacgaggacaagcttgagttcagcaagatcttggaggcta 489
           ||||| | |||||||| ||||||||||||||||||||||||||||| ||| | ||||| |
Sbjct: 614 tgtgcttgaccactgtcaagaacgaggacaagcttgagttcagcaaaatcctcgaggcca 673

                                                                       
Query: 490 tcaaggcgaacttcaatgacaagttcgatgaggtcaggaagaagtggggtggtggtgtca 549
           ||||||| |||||||| ||||||| ||| |||  ||||||||||||||| |||||  | |
Sbjct: 674 tcaaggctaacttcaacgacaagtacgaggagtacaggaagaagtggggaggtggcataa 733

                        
Query: 550 tgggctccaagtc 562
           |||| ||||||||
Sbjct: 734 tgggatccaagtc 746

---

>emb|BX822281.1|CNS0A71I Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB26ZA10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 870

 Score =  256 bits (129), Expect = 7e-65
 Identities = 402/493 (81%)
 Strand = Plus / Plus

                                                                       
Query: 70  accagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaagatgcttctca 129
           |||||||||||   ||||| || ||||| |||||||||| ||| |||||||| ||||| |
Sbjct: 208 accagttcaccaagacccttgataagaatctcgccaccagcctcttcaagattcttctga 267

                                                                       
Query: 130 agtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagagggcacaggctg 189
           ||||  | || |||||||| |  || ||||||||  | ||| |||| | ||| || ||||
Sbjct: 268 agtataggccagaggacaaagccgcaaagaaggaacgccttttgaacaaggctcaagctg 327

                                                                       
Query: 190 aggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagtatggtcttaacc 249
           |||| || || ||  | | |||  |||||||||| |||||||| ||||||||||| ||||
Sbjct: 328 aggcagaaggaaagcctgctgaatccaagaagcccattgttgttaagtatggtctcaacc 387

                                                                       
Query: 250 atgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgctcatgatgttg 309
           |||| |||||||| || ||||||| |||||| ||||| || ||||| || || |||||||
Sbjct: 388 atgtaacttacctcatcgagcagaacaaggcacagcttgtggtcattgcacacgatgttg 447

                                                                       
Query: 310 acccaattgagctggttgtgtggctcccagccctatgcaggaagatggaggtcccatact 369
           |||| || ||| |||| || ||| | || || || |||||||| ||||| |||||  |||
Sbjct: 448 accctatcgagttggtggtctggttacctgcactctgcaggaaaatggaagtccctaact 507

                                                                       
Query: 370 gcattgttaagggaaaatcacgccttggatcgattgttcacaagaagactgcctctgttc 429
           ||||||||||||||||||| || |||||| || | |||||| ||||||||||  |||   
Sbjct: 508 gcattgttaagggaaaatctcgtcttggagcggtcgttcaccagaagactgctgctgcct 567

                                                                       
Query: 430 tgtgcctcaccactgtgaagaacgaggacaagcttgagttcagcaagatcttggaggcta 489
           ||||| | |||||||| ||||||||||||||||||||||||||||| ||| | ||||| |
Sbjct: 568 tgtgcttgaccactgtcaagaacgaggacaagcttgagttcagcaaaatcctcgaggcca 627

                                                                       
Query: 490 tcaaggcgaacttcaatgacaagttcgatgaggtcaggaagaagtggggtggtggtgtca 549
           ||||||| |||||||| ||||||| ||| |||  ||||||||||||||| |||||  | |
Sbjct: 628 tcaaggctaacttcaacgacaagtacgaggagtacaggaagaagtggggaggtggcataa 687

                        
Query: 550 tgggctccaagtc 562
           |||| ||||||||
Sbjct: 688 tgggatccaagtc 700

---

>gb|AC108759.2| Oryza sativa (Japonica cultiva-group) chromosome 9 BAC clone
              OSJNBa0072P02, complete sequence
          Length = 157488

 Score =  254 bits (128), Expect = 3e-64
 Identities = 158/168 (94%)
 Strand = Plus / Minus

                                                                          
Query: 105    accaacctgttcaagatgcttctcaagtaccgccctgaggacaaggtggctaagaaggag 164
              ||||||||||| ||||||||||||||||||||||||||||||||||  || |||||||||
Sbjct: 108952 accaacctgtttaagatgcttctcaagtaccgccctgaggacaaggctgccaagaaggag 108893

                                                                          
Query: 165    aggcttctgaagagggcacaggctgaggctgaggggaaaaccgttgaggccaagaagcca 224
              |||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||
Sbjct: 108892 aggcttttgaagagggcccaggctgaggctgaagggaaaaccgttgaggccaagaagcca 108833

                                                              
Query: 225    attgttgtgaagtatggtcttaaccatgtcacttaccttattgagcag 272
              |||||||||||||||||||||||||| || |||||||| |||||||||
Sbjct: 108832 attgttgtgaagtatggtcttaaccacgtgacttacctcattgagcag 108785



 Score =  184 bits (93), Expect = 2e-43
 Identities = 123/133 (92%)
 Strand = Plus / Minus

                                                                          
Query: 269    gcagagcaaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgt 328
              |||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 108675 gcagagcaaggcccagctggttgtcatcgctcatgatgttgatccaattgagctggttgt 108616

                                                                          
Query: 329    gtggctcccagccctatgcaggaagatggaggtcccatactgcattgttaagggaaaatc 388
              |||||| |||||||| || ||||||||||||||||| |||||||| |||||||| ||| |
Sbjct: 108615 gtggcttccagccctgtgtaggaagatggaggtcccttactgcatcgttaagggcaaagc 108556

                           
Query: 389    acgccttggatcg 401
               ||||||||||||
Sbjct: 108555 tcgccttggatcg 108543



 Score =  167 bits (84), Expect = 5e-38
 Identities = 90/92 (97%)
 Strand = Plus / Minus

                                                                          
Query: 11     gcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcgctcca 70
              ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
Sbjct: 109597 gcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggttcccccggcgctcaa 109538

                                              
Query: 71     ccagttcacccgcaccctcgacaagaacctcg 102
              ||||||||||||||||||||||||||||||||
Sbjct: 109537 ccagttcacccgcaccctcgacaagaacctcg 109506



 Score =  149 bits (75), Expect = 1e-32
 Identities = 90/95 (94%)
 Strand = Plus / Minus

                                                                          
Query: 401    gattgttcacaagaagactgcctctgttctgtgcctcaccactgtgaagaacgaggacaa 460
              ||||||||||||||||||||| |||||||||||| | |||||||| ||||||||||||||
Sbjct: 108443 gattgttcacaagaagactgcatctgttctgtgcttgaccactgtcaagaacgaggacaa 108384

                                                 
Query: 461    gcttgagttcagcaagatcttggaggctatcaagg 495
              ||||||||||||||||||||||||||| |||||||
Sbjct: 108383 gcttgagttcagcaagatcttggaggccatcaagg 108349



 Score =  123 bits (62), Expect = 7e-25
 Identities = 77/82 (93%)
 Strand = Plus / Minus

                                                                          
Query: 493    aggcgaacttcaatgacaagttcgatgaggtcaggaagaagtggggtggtggtgtcatgg 552
              ||||||||||||| ||||||||||| |||||||||||||||||||| || || |||||||
Sbjct: 108247 aggcgaacttcaacgacaagttcgacgaggtcaggaagaagtggggaggcggcgtcatgg 108188

                                    
Query: 553    gctccaagtcgcaggcgaagac 574
              ||||||||||||||||||||||
Sbjct: 108187 gctccaagtcgcaggcgaagac 108166

---

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score =  254 bits (128), Expect = 3e-64
 Identities = 158/168 (94%)
 Strand = Plus / Minus

                                                                            
Query: 105      accaacctgttcaagatgcttctcaagtaccgccctgaggacaaggtggctaagaaggag 164
                ||||||||||| ||||||||||||||||||||||||||||||||||  || |||||||||
Sbjct: 19389726 accaacctgtttaagatgcttctcaagtaccgccctgaggacaaggctgccaagaaggag 19389667

                                                                            
Query: 165      aggcttctgaagagggcacaggctgaggctgaggggaaaaccgttgaggccaagaagcca 224
                |||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||
Sbjct: 19389666 aggcttttgaagagggcccaggctgaggctgaagggaaaaccgttgaggccaagaagcca 19389607

                                                                
Query: 225      attgttgtgaagtatggtcttaaccatgtcacttaccttattgagcag 272
                |||||||||||||||||||||||||| || |||||||| |||||||||
Sbjct: 19389606 attgttgtgaagtatggtcttaaccacgtgacttacctcattgagcag 19389559



 Score =  184 bits (93), Expect = 2e-43
 Identities = 123/133 (92%)
 Strand = Plus / Minus

                                                                            
Query: 269      gcagagcaaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgt 328
                |||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 19389449 gcagagcaaggcccagctggttgtcatcgctcatgatgttgatccaattgagctggttgt 19389390

                                                                            
Query: 329      gtggctcccagccctatgcaggaagatggaggtcccatactgcattgttaagggaaaatc 388
                |||||| |||||||| || ||||||||||||||||| |||||||| |||||||| ||| |
Sbjct: 19389389 gtggcttccagccctgtgtaggaagatggaggtcccttactgcatcgttaagggcaaagc 19389330

                             
Query: 389      acgccttggatcg 401
                 ||||||||||||
Sbjct: 19389329 tcgccttggatcg 19389317



 Score =  167 bits (84), Expect = 5e-38
 Identities = 90/92 (97%)
 Strand = Plus / Minus

                                                                            
Query: 11       gcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcgctcca 70
                ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
Sbjct: 19390371 gcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggttcccccggcgctcaa 19390312

                                                
Query: 71       ccagttcacccgcaccctcgacaagaacctcg 102
                ||||||||||||||||||||||||||||||||
Sbjct: 19390311 ccagttcacccgcaccctcgacaagaacctcg 19390280



 Score =  149 bits (75), Expect = 1e-32
 Identities = 90/95 (94%)
 Strand = Plus / Minus

                                                                            
Query: 401      gattgttcacaagaagactgcctctgttctgtgcctcaccactgtgaagaacgaggacaa 460
                ||||||||||||||||||||| |||||||||||| | |||||||| ||||||||||||||
Sbjct: 19389217 gattgttcacaagaagactgcatctgttctgtgcttgaccactgtcaagaacgaggacaa 19389158

                                                   
Query: 461      gcttgagttcagcaagatcttggaggctatcaagg 495
                ||||||||||||||||||||||||||| |||||||
Sbjct: 19389157 gcttgagttcagcaagatcttggaggccatcaagg 19389123



 Score =  123 bits (62), Expect = 7e-25
 Identities = 77/82 (93%)
 Strand = Plus / Minus

                                                                            
Query: 493      aggcgaacttcaatgacaagttcgatgaggtcaggaagaagtggggtggtggtgtcatgg 552
                ||||||||||||| ||||||||||| |||||||||||||||||||| || || |||||||
Sbjct: 19389021 aggcgaacttcaacgacaagttcgacgaggtcaggaagaagtggggaggcggcgtcatgg 19388962

                                      
Query: 553      gctccaagtcgcaggcgaagac 574
                ||||||||||||||||||||||
Sbjct: 19388961 gctccaagtcgcaggcgaagac 19388940

---

>emb|BX824325.1|CNS0A7R8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH3ZF06 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 793

 Score =  248 bits (125), Expect = 2e-62
 Identities = 401/493 (81%)
 Strand = Plus / Plus

                                                                       
Query: 70  accagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaagatgcttctca 129
           |||||||||||   ||||| || ||||| |||||||||| ||| |||||||| ||||| |
Sbjct: 165 accagttcaccaagacccttgataagaatctcgccaccagcctcttcaagattcttctga 224

                                                                       
Query: 130 agtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagagggcacaggctg 189
           ||||  | || || ||||| |  || ||||||||  | ||| |||| | ||| || ||||
Sbjct: 225 agtataggccagaagacaaagccgcaaagaaggaacgccttttgaacaaggctcaagctg 284

                                                                       
Query: 190 aggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagtatggtcttaacc 249
           |||| || || ||  | | |||  |||||||||| |||||||| ||||||||||| ||||
Sbjct: 285 aggcagaaggaaagcctgctgaatccaagaagcccattgttgttaagtatggtctcaacc 344

                                                                       
Query: 250 atgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgctcatgatgttg 309
           ||||||||||||| || ||||||| |||||| ||||| || ||||| || || |||||||
Sbjct: 345 atgtcacttacctcatcgagcagaacaaggcacagcttgtggtcattgcacacgatgttg 404

                                                                       
Query: 310 acccaattgagctggttgtgtggctcccagccctatgcaggaagatggaggtcccatact 369
           |||| || ||| |||| || ||| | || || || |||||||| ||||| |||||  |||
Sbjct: 405 accctatcgagttggtggtctggttacctgcactctgcaggaaaatggaagtccctcact 464

                                                                       
Query: 370 gcattgttaagggaaaatcacgccttggatcgattgttcacaagaagactgcctctgttc 429
           ||||| ||||||||||||| || |||||| || | |||||| ||||||||||  |||   
Sbjct: 465 gcatttttaagggaaaatctcgtcttggagcggtcgttcaccagaagactgctgctgcct 524

                                                                       
Query: 430 tgtgcctcaccactgtgaagaacgaggacaagcttgagttcagcaagatcttggaggcta 489
           ||||| | |||||||| ||||||||||||||||||||||||||||| ||| | ||||| |
Sbjct: 525 tgtgcttgaccactgtcaagaacgaggacaagcttgagttcagcaaaatcctcgaggcca 584

                                                                       
Query: 490 tcaaggcgaacttcaatgacaagttcgatgaggtcaggaagaagtggggtggtggtgtca 549
           ||||||| |||||||| ||||||| ||| |||  ||||||||||||||| |||||  | |
Sbjct: 585 tcaaggctaacttcaacgacaagtacgaggagtacaggaagaagtggggaggtggcataa 644

                        
Query: 550 tgggctccaagtc 562
           |||| ||||||||
Sbjct: 645 tgggatccaagtc 657

---

>gb|DQ241858.1| Solanum tuberosum clone 014F11 60S ribosomal protein L7A-like mRNA,
           complete cds
          Length = 983

 Score =  236 bits (119), Expect = 7e-59
 Identities = 404/499 (80%)
 Strand = Plus / Plus

                                                                       
Query: 70  accagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaagatgcttctca 129
           |||||||||||   ||||| || |||||||||||||||||||| |||||||||||||| |
Sbjct: 229 accagttcaccaaaacccttgataagaacctcgccaccaaccttttcaagatgcttctta 288

                                                                       
Query: 130 agtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagagggcacaggctg 189
           ||||| | ||||||||||| |  || ||||||||| | ||| | || ||||| || ||||
Sbjct: 289 agtacaggcctgaggacaaagctgcaaagaaggagcgtcttgttaaaagggctcaagctg 348

                                                                       
Query: 190 aggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagtatggtcttaacc 249
           | ||||| || |||||   |||  | ||||| || ||| ||||||||||||| ||||| |
Sbjct: 349 aagctgaaggaaaaacacctgaaacaaagaaacccattattgtgaagtatggccttaagc 408

                                                                       
Query: 250 atgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgctcatgatgttg 309
           || ||||||||||||||||||||| ||| ||||| || || || || ||||||||||| |
Sbjct: 409 atatcacttaccttattgagcagaacaaagctcaactagtagtgattgctcatgatgtgg 468

                                                                       
Query: 310 acccaattgagctggttgtgtggctcccagccctatgcaggaagatggaggtcccatact 369
           ||||||| ||| ||||||| ||||| || || |||||||| ||||||||  | || ||||
Sbjct: 469 acccaatagagttggttgtctggcttcctgcactatgcagaaagatggaaattccttact 528

                                                                       
Query: 370 gcattgttaagggaaaatcacgccttggatcgattgttcacaagaagactgcctctgttc 429
           ||||||| ||||| ||| ||||  | ||||| || || |||||||| ||||| || |   
Sbjct: 529 gcattgtgaaggggaaagcacgtttaggatcaatcgtgcacaagaaaactgcttcagcct 588

                                                                       
Query: 430 tgtgcctcaccactgtgaagaacgaggacaagcttgagttcagcaagatcttggaggcta 489
           ||||  | || || |||||||| || |||||  | ||||||||||   | |||||||| |
Sbjct: 589 tgtgtttgactaccgtgaagaatgaagacaaaatggagttcagcagagttttggaggcaa 648

                                                                       
Query: 490 tcaaggcgaacttcaatgacaagttcgatgaggtcaggaagaagtggggtggtggtgtca 549
           | ||||| ||||||||||| ||||  || |||  |||||||||||||||||| ||| |||
Sbjct: 649 ttaaggccaacttcaatgataagtatgaagagaacaggaagaagtggggtggcggtatca 708

                              
Query: 550 tgggctccaagtcgcaggc 568
           ||||||||||||| |||||
Sbjct: 709 tgggctccaagtcacaggc 727

---

>ref|NM_130329.2| Arabidopsis thaliana structural constituent of ribosome AT2G47610
           mRNA, complete cds
          Length = 1092

 Score =  228 bits (115), Expect = 2e-56
 Identities = 271/323 (83%)
 Strand = Plus / Plus

                                                                       
Query: 216 aagaagccaattgttgtgaagtatggtcttaaccatgtcacttaccttattgagcagagc 275
           |||||||| ||||| || || || || || |||||||| || ||||| |||||||||| |
Sbjct: 428 aagaagcccattgtagtcaaatacggcctcaaccatgtgacctacctcattgagcagaac 487

                                                                       
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggctc 335
           ||||| || || ||||| || ||||||||||| |||||||||||| ||||||| ||| | 
Sbjct: 488 aaggcccaacttgttgttattgctcatgatgtcgacccaattgagttggttgtctggttg 547

                                                                       
Query: 336 ccagccctatgcaggaagatggaggtcccatactgcattgttaagggaaaatcacgcctt 395
           || || || |||||||||||||| ||||| ||||||||||| ||||| ||||| || |||
Sbjct: 548 cctgctctgtgcaggaagatggaagtcccgtactgcattgtcaagggcaaatctcgtctt 607

                                                                       
Query: 396 ggatcgattgttcacaagaagactgcctctgttctgtgcctcaccactgtgaagaacgag 455
           ||| || |||||||| |||||||||| |||    ||||  | |||||||| |||||||||
Sbjct: 608 ggagcggttgttcaccagaagactgcttcttgcttgtgtttgaccactgtcaagaacgag 667

                                                                       
Query: 456 gacaagcttgagttcagcaagatcttggaggctatcaaggcgaacttcaatgacaagttc 515
           |||||||| ||||||||||| ||| |||| ||||||||||| |||||||||||||||| |
Sbjct: 668 gacaagctagagttcagcaaaatcctggaagctatcaaggccaacttcaatgacaagtac 727

                                  
Query: 516 gatgaggtcaggaagaagtgggg 538
           || |||  ||||||||| |||||
Sbjct: 728 gaggagtacaggaagaaatgggg 750

---

>gb|BT000500.1| Arabidopsis thaliana 60S ribosomal protein L7A
           (At2g47610/T30B22.8) mRNA, complete cds
          Length = 774

 Score =  228 bits (115), Expect = 2e-56
 Identities = 271/323 (83%)
 Strand = Plus / Plus

                                                                       
Query: 216 aagaagccaattgttgtgaagtatggtcttaaccatgtcacttaccttattgagcagagc 275
           |||||||| ||||| || || || || || |||||||| || ||||| |||||||||| |
Sbjct: 364 aagaagcccattgtagtcaaatacggcctcaaccatgtgacctacctcattgagcagaac 423

                                                                       
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggctc 335
           ||||| || || ||||| || ||||||||||| |||||||||||| ||||||| ||| | 
Sbjct: 424 aaggcccaacttgttgttattgctcatgatgtcgacccaattgagttggttgtctggttg 483

                                                                       
Query: 336 ccagccctatgcaggaagatggaggtcccatactgcattgttaagggaaaatcacgcctt 395
           || || || |||||||||||||| ||||| ||||||||||| ||||| ||||| || |||
Sbjct: 484 cctgctctgtgcaggaagatggaagtcccgtactgcattgtcaagggcaaatctcgtctt 543

                                                                       
Query: 396 ggatcgattgttcacaagaagactgcctctgttctgtgcctcaccactgtgaagaacgag 455
           ||| || |||||||| |||||||||| |||    ||||  | |||||||| |||||||||
Sbjct: 544 ggagcggttgttcaccagaagactgcttcttgcttgtgtttgaccactgtcaagaacgag 603

                                                                       
Query: 456 gacaagcttgagttcagcaagatcttggaggctatcaaggcgaacttcaatgacaagttc 515
           |||||||| ||||||||||| ||| |||| ||||||||||| |||||||||||||||| |
Sbjct: 604 gacaagctagagttcagcaaaatcctggaagctatcaaggccaacttcaatgacaagtac 663

                                  
Query: 516 gatgaggtcaggaagaagtgggg 538
           || |||  ||||||||| |||||
Sbjct: 664 gaggagtacaggaagaaatgggg 686

---

>gb|AY052674.1| Arabidopsis thaliana At2g47610/T30B22.8 mRNA, complete cds
          Length = 984

 Score =  228 bits (115), Expect = 2e-56
 Identities = 271/323 (83%)
 Strand = Plus / Plus

                                                                       
Query: 216 aagaagccaattgttgtgaagtatggtcttaaccatgtcacttaccttattgagcagagc 275
           |||||||| ||||| || || || || || |||||||| || ||||| |||||||||| |
Sbjct: 426 aagaagcccattgtagtcaaatacggcctcaaccatgtgacctacctcattgagcagaac 485

                                                                       
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggctc 335
           ||||| || || ||||| || ||||||||||| |||||||||||| ||||||| ||| | 
Sbjct: 486 aaggcccaacttgttgttattgctcatgatgtcgacccaattgagttggttgtctggttg 545

                                                                       
Query: 336 ccagccctatgcaggaagatggaggtcccatactgcattgttaagggaaaatcacgcctt 395
           || || || |||||||||||||| ||||| ||||||||||| ||||| ||||| || |||
Sbjct: 546 cctgctctgtgcaggaagatggaagtcccgtactgcattgtcaagggcaaatctcgtctt 605

                                                                       
Query: 396 ggatcgattgttcacaagaagactgcctctgttctgtgcctcaccactgtgaagaacgag 455
           ||| || |||||||| |||||||||| |||    ||||  | |||||||| |||||||||
Sbjct: 606 ggagcggttgttcaccagaagactgcttcttgcttgtgtttgaccactgtcaagaacgag 665

                                                                       
Query: 456 gacaagcttgagttcagcaagatcttggaggctatcaaggcgaacttcaatgacaagttc 515
           |||||||| ||||||||||| ||| |||| ||||||||||| |||||||||||||||| |
Sbjct: 666 gacaagctagagttcagcaaaatcctggaagctatcaaggccaacttcaatgacaagtac 725

                                  
Query: 516 gatgaggtcaggaagaagtgggg 538
           || |||  ||||||||| |||||
Sbjct: 726 gaggagtacaggaagaaatgggg 748

---

>gb|AF385719.1|AF385719 Arabidopsis thaliana At2g47610/T30B22.8 mRNA, complete cds
          Length = 999

 Score =  228 bits (115), Expect = 2e-56
 Identities = 271/323 (83%)
 Strand = Plus / Plus

                                                                       
Query: 216 aagaagccaattgttgtgaagtatggtcttaaccatgtcacttaccttattgagcagagc 275
           |||||||| ||||| || || || || || |||||||| || ||||| |||||||||| |
Sbjct: 426 aagaagcccattgtagtcaaatacggcctcaaccatgtgacctacctcattgagcagaac 485

                                                                       
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggctc 335
           ||||| || || ||||| || ||||||||||| |||||||||||| ||||||| ||| | 
Sbjct: 486 aaggcccaacttgttgttattgctcatgatgtcgacccaattgagttggttgtctggttg 545

                                                                       
Query: 336 ccagccctatgcaggaagatggaggtcccatactgcattgttaagggaaaatcacgcctt 395
           || || || |||||||||||||| ||||| ||||||||||| ||||| ||||| || |||
Sbjct: 546 cctgctctgtgcaggaagatggaagtcccgtactgcattgtcaagggcaaatctcgtctt 605

                                                                       
Query: 396 ggatcgattgttcacaagaagactgcctctgttctgtgcctcaccactgtgaagaacgag 455
           ||| || |||||||| |||||||||| |||    ||||  | |||||||| |||||||||
Sbjct: 606 ggagcggttgttcaccagaagactgcttcttgcttgtgtttgaccactgtcaagaacgag 665

                                                                       
Query: 456 gacaagcttgagttcagcaagatcttggaggctatcaaggcgaacttcaatgacaagttc 515
           |||||||| ||||||||||| ||| |||| ||||||||||| |||||||||||||||| |
Sbjct: 666 gacaagctagagttcagcaaaatcctggaagctatcaaggccaacttcaatgacaagtac 725

                                  
Query: 516 gatgaggtcaggaagaagtgggg 538
           || |||  ||||||||| |||||
Sbjct: 726 gaggagtacaggaagaaatgggg 748

---

>emb|BX821062.1|CNS0A8OD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH9ZF10 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 897

 Score =  228 bits (115), Expect = 2e-56
 Identities = 271/323 (83%)
 Strand = Plus / Plus

                                                                       
Query: 216 aagaagccaattgttgtgaagtatggtcttaaccatgtcacttaccttattgagcagagc 275
           |||||||| ||||| || || || || || |||||||| || ||||| |||||||||| |
Sbjct: 362 aagaagcccattgtagtcaaatacggcctcaaccatgtgacctacctcattgagcagaac 421

                                                                       
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggctc 335
           ||||| || || ||||| || ||||||||||| |||||||||||| ||||||| ||| | 
Sbjct: 422 aaggcccaacttgttgttattgctcatgatgtcgacccaattgagttggttgtctggttg 481

                                                                       
Query: 336 ccagccctatgcaggaagatggaggtcccatactgcattgttaagggaaaatcacgcctt 395
           || || || |||||||||||||| ||||| ||||||||||| ||||| ||||| || |||
Sbjct: 482 cctgctctgtgcaggaagatggaagtcccgtactgcattgtcaagggcaaatctcgtctt 541

                                                                       
Query: 396 ggatcgattgttcacaagaagactgcctctgttctgtgcctcaccactgtgaagaacgag 455
           ||| || |||||||| |||||||||| |||    ||||  | |||||||| |||||||||
Sbjct: 542 ggagcggttgttcaccagaagactgcttcttgcttgtgtttgaccactgtcaagaacgag 601

                                                                       
Query: 456 gacaagcttgagttcagcaagatcttggaggctatcaaggcgaacttcaatgacaagttc 515
           |||||||| ||||||||||| ||| |||| ||||||||||| |||||||||||||||| |
Sbjct: 602 gacaagctagagttcagcaaaatcctggaagctatcaaggccaacttcaatgacaagtac 661

                                  
Query: 516 gatgaggtcaggaagaagtgggg 538
           || |||  ||||||||| |||||
Sbjct: 662 gaggagtacaggaagaaatgggg 684

---

>gb|AY088386.1| Arabidopsis thaliana clone 6394 mRNA, complete sequence
          Length = 1092

 Score =  228 bits (115), Expect = 2e-56
 Identities = 271/323 (83%)
 Strand = Plus / Plus

                                                                       
Query: 216 aagaagccaattgttgtgaagtatggtcttaaccatgtcacttaccttattgagcagagc 275
           |||||||| ||||| || || || || || |||||||| || ||||| |||||||||| |
Sbjct: 429 aagaagcccattgtagtcaaatacggcctcaaccatgtgacctacctcattgagcagaac 488

                                                                       
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggctc 335
           ||||| || || ||||| || ||||||||||| |||||||||||| ||||||| ||| | 
Sbjct: 489 aaggcccaacttgttgttattgctcatgatgtcgacccaattgagttggttgtctggttg 548

                                                                       
Query: 336 ccagccctatgcaggaagatggaggtcccatactgcattgttaagggaaaatcacgcctt 395
           || || || |||||||||||||| ||||| ||||||||||| ||||| ||||| || |||
Sbjct: 549 cctgctctgtgcaggaagatggaagtcccgtactgcattgtcaagggcaaatctcgtctt 608

                                                                       
Query: 396 ggatcgattgttcacaagaagactgcctctgttctgtgcctcaccactgtgaagaacgag 455
           ||| || |||||||| |||||||||| |||    ||||  | |||||||| |||||||||
Sbjct: 609 ggagcggttgttcaccagaagactgcttcttgcttgtgtttgaccactgtcaagaacgag 668

                                                                       
Query: 456 gacaagcttgagttcagcaagatcttggaggctatcaaggcgaacttcaatgacaagttc 515
           |||||||| ||||||||||| ||| |||| ||||||||||| |||||||||||||||| |
Sbjct: 669 gacaagctagagttcagcaaaatcctggaagctatcaaggccaacttcaatgacaagtac 728

                                  
Query: 516 gatgaggtcaggaagaagtgggg 538
           || |||  ||||||||| |||||
Sbjct: 729 gaggagtacaggaagaaatgggg 751

---

>gb|DQ268850.1| Solanum tuberosum clone 155G10 60S ribosomal protein L7A-like
           protein mRNA, complete cds
          Length = 1003

 Score =  228 bits (115), Expect = 2e-56
 Identities = 403/499 (80%)
 Strand = Plus / Plus

                                                                       
Query: 70  accagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaagatgcttctca 129
           |||||||||||   ||||| |||||||||||||| || ||||| |||||||||||||| |
Sbjct: 235 accagttcaccaaaacccttgacaagaacctcgctacaaaccttttcaagatgcttctta 294

                                                                       
Query: 130 agtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagagggcacaggctg 189
           ||||| | || |||||||| |  || ||||||||| | ||| | || || || || ||||
Sbjct: 295 agtacaggcccgaggacaaagctgcaaagaaggagcgtcttgtcaaaagagctcaagctg 354

                                                                       
Query: 190 aggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagtatggtcttaacc 249
           | || || || |||||   |||  | ||||| || ||| ||||||||||||| ||||| |
Sbjct: 355 aagcagaaggaaaaactcctgaaacaaagaaacctattattgtgaagtatgggcttaagc 414

                                                                       
Query: 250 atgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgctcatgatgttg 309
           |  ||||||||||||||||||||| ||| |||||| |||| || || ||||||||||| |
Sbjct: 415 acatcacttaccttattgagcagaacaaagctcagttggtagtgattgctcatgatgtgg 474

                                                                       
Query: 310 acccaattgagctggttgtgtggctcccagccctatgcaggaagatggaggtcccatact 369
           ||||||| ||| ||||||| ||||| || || |||||||| ||||||||  | || ||||
Sbjct: 475 acccaatagagttggttgtctggcttcctgcgctatgcagaaagatggaaattccttact 534

                                                                       
Query: 370 gcattgttaagggaaaatcacgccttggatcgattgttcacaagaagactgcctctgttc 429
           ||||||| ||||| ||| | ||  | ||||||||||| ||  |||| ||||| || |   
Sbjct: 535 gcattgtgaagggcaaagctcgtttaggatcgattgtgcatcagaaaactgcttcagcct 594

                                                                       
Query: 430 tgtgcctcaccactgtgaagaacgaggacaagcttgagttcagcaagatcttggaggcta 489
           ||||  | || || |||||||| ||||||||  | ||||||||||  || |||||||| |
Sbjct: 595 tgtgtttgacaaccgtgaagaatgaggacaaaatggagttcagcagaattttggaggcca 654

                                                                       
Query: 490 tcaaggcgaacttcaatgacaagttcgatgaggtcaggaagaagtggggtggtggtgtca 549
           | ||||| ||||||||||||||||  || |||  |||||||||||||||||||||| |||
Sbjct: 655 ttaaggctaacttcaatgacaagtatgaagagaacaggaagaagtggggtggtggtatca 714

                              
Query: 550 tgggctccaagtcgcaggc 568
           ||||||||||||| |||||
Sbjct: 715 tgggctccaagtcacaggc 733

---

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score =  226 bits (114), Expect = 6e-56
 Identities = 150/162 (92%)
 Strand = Plus / Minus

                                                                            
Query: 111      ctgttcaagatgcttctcaagtaccgccctgaggacaaggtggctaagaaggagaggctt 170
                ||||| |||||||| |||||||||||||||||||||||||  ||||||||||||||||||
Sbjct: 14334381 ctgtttaagatgctcctcaagtaccgccctgaggacaaggctgctaagaaggagaggctt 14334322

                                                                            
Query: 171      ctgaagagggcacaggctgaggctgaggggaaaaccgttgaggccaagaagccaattgtt 230
                 |||||||||| |||||||||||||| || |||||||||||||| ||||| |||||||||
Sbjct: 14334321 ttgaagagggcccaggctgaggctgaaggtaaaaccgttgaggcaaagaaaccaattgtt 14334262

                                                          
Query: 231      gtgaagtatggtcttaaccatgtcacttaccttattgagcag 272
                |||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 14334261 gtgaagtatggtcttaaccatgtcacatacctcattgagcag 14334220



 Score =  167 bits (84), Expect = 5e-38
 Identities = 90/92 (97%)
 Strand = Plus / Minus

                                                                            
Query: 11       gcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcgctcca 70
                |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 14335076 gcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcgctcaa 14335017

                                                
Query: 71       ccagttcacccgcaccctcgacaagaacctcg 102
                ||||||||| ||||||||||||||||||||||
Sbjct: 14335016 ccagttcactcgcaccctcgacaagaacctcg 14334985



 Score =  143 bits (72), Expect = 7e-31
 Identities = 117/132 (88%)
 Strand = Plus / Minus

                                                                            
Query: 269      gcagagcaaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgt 328
                |||||||||||| || ||||| ||||| ||||||||||| || || ||||||||||||||
Sbjct: 14334109 gcagagcaaggcccaactggtcgtcattgctcatgatgtcgatccgattgagctggttgt 14334050

                                                                            
Query: 329      gtggctcccagccctatgcaggaagatggaggtcccatactgcattgttaagggaaaatc 388
                |||||| |||||||| |||||||||||||||||||| ||||||||||| || |||||| |
Sbjct: 14334049 gtggcttccagccctgtgcaggaagatggaggtcccttactgcattgtgaaaggaaaagc 14333990

                            
Query: 389      acgccttggatc 400
                 || ||||||||
Sbjct: 14333989 ccgtcttggatc 14333978



 Score =  125 bits (63), Expect = 2e-25
 Identities = 87/95 (91%)
 Strand = Plus / Minus

                                                                            
Query: 401      gattgttcacaagaagactgcctctgttctgtgcctcaccactgtgaagaacgaggacaa 460
                ||||||||||||||| ||||| ||||| || ||| | |||||||| ||||||||||||||
Sbjct: 14333888 gattgttcacaagaaaactgcatctgtcctctgcttgaccactgtcaagaacgaggacaa 14333829

                                                   
Query: 461      gcttgagttcagcaagatcttggaggctatcaagg 495
                ||||||||||||||||||| |||||||||||||||
Sbjct: 14333828 gcttgagttcagcaagatcctggaggctatcaagg 14333794



 Score =  107 bits (54), Expect = 4e-20
 Identities = 75/82 (91%)
 Strand = Plus / Minus

                                                                            
Query: 493      aggcgaacttcaatgacaagttcgatgaggtcaggaagaagtggggtggtggtgtcatgg 552
                ||||||||||||| ||||| ||||||||||| |||||||||||||| || || |||||||
Sbjct: 14333686 aggcgaacttcaacgacaaattcgatgaggttaggaagaagtggggaggcggcgtcatgg 14333627

                                      
Query: 553      gctccaagtcgcaggcgaagac 574
                | ||||||||||||||||||||
Sbjct: 14333626 gatccaagtcgcaggcgaagac 14333605



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 443      tgtgaagaacgaggacaagcttga 466
                ||||||| ||||||||||||||||
Sbjct: 17165720 tgtgaagcacgaggacaagcttga 17165697



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 85      ccctcgacaagaacctcgccacca 108
               |||||| |||||||||||||||||
Sbjct: 1754251 ccctcgtcaagaacctcgccacca 1754228

---

>emb|BX842094.1|CNS09Y94 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL87ZH02 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 877

 Score =  226 bits (114), Expect = 6e-56
 Identities = 270/322 (83%)
 Strand = Plus / Plus

                                                                       
Query: 216 aagaagccaattgttgtgaagtatggtcttaaccatgtcacttaccttattgagcagagc 275
           |||||||| ||||| || || || || || |||||||| || ||||| |||||||||| |
Sbjct: 403 aagaagcccattgtagtcaaatacggcctcaaccatgtgacctacctcattgagcagaac 462

                                                                       
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggctc 335
           ||||| || || ||||| || ||||||||||| |||||||||||| ||||||| ||| | 
Sbjct: 463 aaggcccaacttgttgttattgctcatgatgtcgacccaattgagttggttgtctggttg 522

                                                                       
Query: 336 ccagccctatgcaggaagatggaggtcccatactgcattgttaagggaaaatcacgcctt 395
           || || || |||||||||||||| ||||| ||||||||||| ||||| ||||| || |||
Sbjct: 523 cctgctctgtgcaggaagatggaagtcccgtactgcattgtcaagggcaaatctcgtctt 582

                                                                       
Query: 396 ggatcgattgttcacaagaagactgcctctgttctgtgcctcaccactgtgaagaacgag 455
           ||| || |||||||| |||||||||| |||    ||||  | |||||||| |||||||||
Sbjct: 583 ggagcggttgttcaccagaagactgcttcttgcttgtgtttgaccactgtcaagaacgag 642

                                                                       
Query: 456 gacaagcttgagttcagcaagatcttggaggctatcaaggcgaacttcaatgacaagttc 515
           |||||||| ||||||||||| ||| |||| ||||||||||| |||||||||||||||| |
Sbjct: 643 gacaagctagagttcagcaaaatcctggaagctatcaaggccaacttcaatgacaagtac 702

                                 
Query: 516 gatgaggtcaggaagaagtggg 537
           || |||  ||||||||| ||||
Sbjct: 703 gaggagtacaggaagaaatggg 724

---

>dbj|AP004637.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
              clone:P0703C03
          Length = 162620

 Score =  226 bits (114), Expect = 6e-56
 Identities = 150/162 (92%)
 Strand = Plus / Minus

                                                                          
Query: 111    ctgttcaagatgcttctcaagtaccgccctgaggacaaggtggctaagaaggagaggctt 170
              ||||| |||||||| |||||||||||||||||||||||||  ||||||||||||||||||
Sbjct: 149937 ctgtttaagatgctcctcaagtaccgccctgaggacaaggctgctaagaaggagaggctt 149878

                                                                          
Query: 171    ctgaagagggcacaggctgaggctgaggggaaaaccgttgaggccaagaagccaattgtt 230
               |||||||||| |||||||||||||| || |||||||||||||| ||||| |||||||||
Sbjct: 149877 ttgaagagggcccaggctgaggctgaaggtaaaaccgttgaggcaaagaaaccaattgtt 149818

                                                        
Query: 231    gtgaagtatggtcttaaccatgtcacttaccttattgagcag 272
              |||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 149817 gtgaagtatggtcttaaccatgtcacatacctcattgagcag 149776



 Score =  167 bits (84), Expect = 5e-38
 Identities = 90/92 (97%)
 Strand = Plus / Minus

                                                                          
Query: 11     gcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcgctcca 70
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 150632 gcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcgctcaa 150573

                                              
Query: 71     ccagttcacccgcaccctcgacaagaacctcg 102
              ||||||||| ||||||||||||||||||||||
Sbjct: 150572 ccagttcactcgcaccctcgacaagaacctcg 150541



 Score =  143 bits (72), Expect = 7e-31
 Identities = 117/132 (88%)
 Strand = Plus / Minus

                                                                          
Query: 269    gcagagcaaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgt 328
              |||||||||||| || ||||| ||||| ||||||||||| || || ||||||||||||||
Sbjct: 149665 gcagagcaaggcccaactggtcgtcattgctcatgatgtcgatccgattgagctggttgt 149606

                                                                          
Query: 329    gtggctcccagccctatgcaggaagatggaggtcccatactgcattgttaagggaaaatc 388
              |||||| |||||||| |||||||||||||||||||| ||||||||||| || |||||| |
Sbjct: 149605 gtggcttccagccctgtgcaggaagatggaggtcccttactgcattgtgaaaggaaaagc 149546

                          
Query: 389    acgccttggatc 400
               || ||||||||
Sbjct: 149545 ccgtcttggatc 149534



 Score =  125 bits (63), Expect = 2e-25
 Identities = 87/95 (91%)
 Strand = Plus / Minus

                                                                          
Query: 401    gattgttcacaagaagactgcctctgttctgtgcctcaccactgtgaagaacgaggacaa 460
              ||||||||||||||| ||||| ||||| || ||| | |||||||| ||||||||||||||
Sbjct: 149444 gattgttcacaagaaaactgcatctgtcctctgcttgaccactgtcaagaacgaggacaa 149385

                                                 
Query: 461    gcttgagttcagcaagatcttggaggctatcaagg 495
              ||||||||||||||||||| |||||||||||||||
Sbjct: 149384 gcttgagttcagcaagatcctggaggctatcaagg 149350



 Score =  107 bits (54), Expect = 4e-20
 Identities = 75/82 (91%)
 Strand = Plus / Minus

                                                                          
Query: 493    aggcgaacttcaatgacaagttcgatgaggtcaggaagaagtggggtggtggtgtcatgg 552
              ||||||||||||| ||||| ||||||||||| |||||||||||||| || || |||||||
Sbjct: 149242 aggcgaacttcaacgacaaattcgatgaggttaggaagaagtggggaggcggcgtcatgg 149183

                                    
Query: 553    gctccaagtcgcaggcgaagac 574
              | ||||||||||||||||||||
Sbjct: 149182 gatccaagtcgcaggcgaagac 149161

---

>dbj|AP003884.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1136_A10
          Length = 101249

 Score =  226 bits (114), Expect = 6e-56
 Identities = 150/162 (92%)
 Strand = Plus / Minus

                                                                         
Query: 111   ctgttcaagatgcttctcaagtaccgccctgaggacaaggtggctaagaaggagaggctt 170
             ||||| |||||||| |||||||||||||||||||||||||  ||||||||||||||||||
Sbjct: 37461 ctgtttaagatgctcctcaagtaccgccctgaggacaaggctgctaagaaggagaggctt 37402

                                                                         
Query: 171   ctgaagagggcacaggctgaggctgaggggaaaaccgttgaggccaagaagccaattgtt 230
              |||||||||| |||||||||||||| || |||||||||||||| ||||| |||||||||
Sbjct: 37401 ttgaagagggcccaggctgaggctgaaggtaaaaccgttgaggcaaagaaaccaattgtt 37342

                                                       
Query: 231   gtgaagtatggtcttaaccatgtcacttaccttattgagcag 272
             |||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 37341 gtgaagtatggtcttaaccatgtcacatacctcattgagcag 37300



 Score =  167 bits (84), Expect = 5e-38
 Identities = 90/92 (97%)
 Strand = Plus / Minus

                                                                         
Query: 11    gcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcgctcca 70
             |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 38156 gcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcgctcaa 38097

                                             
Query: 71    ccagttcacccgcaccctcgacaagaacctcg 102
             ||||||||| ||||||||||||||||||||||
Sbjct: 38096 ccagttcactcgcaccctcgacaagaacctcg 38065



 Score =  143 bits (72), Expect = 7e-31
 Identities = 117/132 (88%)
 Strand = Plus / Minus

                                                                         
Query: 269   gcagagcaaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgt 328
             |||||||||||| || ||||| ||||| ||||||||||| || || ||||||||||||||
Sbjct: 37189 gcagagcaaggcccaactggtcgtcattgctcatgatgtcgatccgattgagctggttgt 37130

                                                                         
Query: 329   gtggctcccagccctatgcaggaagatggaggtcccatactgcattgttaagggaaaatc 388
             |||||| |||||||| |||||||||||||||||||| ||||||||||| || |||||| |
Sbjct: 37129 gtggcttccagccctgtgcaggaagatggaggtcccttactgcattgtgaaaggaaaagc 37070

                         
Query: 389   acgccttggatc 400
              || ||||||||
Sbjct: 37069 ccgtcttggatc 37058



 Score =  125 bits (63), Expect = 2e-25
 Identities = 87/95 (91%)
 Strand = Plus / Minus

                                                                         
Query: 401   gattgttcacaagaagactgcctctgttctgtgcctcaccactgtgaagaacgaggacaa 460
             ||||||||||||||| ||||| ||||| || ||| | |||||||| ||||||||||||||
Sbjct: 36968 gattgttcacaagaaaactgcatctgtcctctgcttgaccactgtcaagaacgaggacaa 36909

                                                
Query: 461   gcttgagttcagcaagatcttggaggctatcaagg 495
             ||||||||||||||||||| |||||||||||||||
Sbjct: 36908 gcttgagttcagcaagatcctggaggctatcaagg 36874



 Score =  107 bits (54), Expect = 4e-20
 Identities = 75/82 (91%)
 Strand = Plus / Minus

                                                                         
Query: 493   aggcgaacttcaatgacaagttcgatgaggtcaggaagaagtggggtggtggtgtcatgg 552
             ||||||||||||| ||||| ||||||||||| |||||||||||||| || || |||||||
Sbjct: 36766 aggcgaacttcaacgacaaattcgatgaggttaggaagaagtggggaggcggcgtcatgg 36707

                                   
Query: 553   gctccaagtcgcaggcgaagac 574
             | ||||||||||||||||||||
Sbjct: 36706 gatccaagtcgcaggcgaagac 36685

---

>emb|BX842006.1|CNS09Y9Z Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB87ZC11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 979

 Score =  222 bits (112), Expect = 1e-54
 Identities = 265/316 (83%)
 Strand = Plus / Plus

                                                                       
Query: 216 aagaagccaattgttgtgaagtatggtcttaaccatgtcacttaccttattgagcagagc 275
           |||||||| ||||| || || || || || |||||||| || ||||| |||||||||| |
Sbjct: 407 aagaagcccattgtagtcaaatacggcctcaaccatgtgacctacctcattgagcagaac 466

                                                                       
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggctc 335
           ||||| || || ||||| || ||||||||||| |||||||||||| ||||||||||| | 
Sbjct: 467 aaggcccaacttgttgttattgctcatgatgtcgacccaattgagttggttgtgtggttg 526

                                                                       
Query: 336 ccagccctatgcaggaagatggaggtcccatactgcattgttaagggaaaatcacgcctt 395
           || || || |||||||||||||| ||||| ||||||||||| ||||| ||||  || |||
Sbjct: 527 cctgctctgtgcaggaagatggaagtcccgtactgcattgtgaagggcaaatgtcgtctt 586

                                                                       
Query: 396 ggatcgattgttcacaagaagactgcctctgttctgtgcctcaccactgtgaagaacgag 455
           ||| || |||||||| |||||||||| |||    ||||  | ||||||||||||||||||
Sbjct: 587 ggagcggttgttcaccagaagactgcttcttgcttgtgtttgaccactgtgaagaacgag 646

                                                                       
Query: 456 gacaagcttgagttcagcaagatcttggaggctatcaaggcgaacttcaatgacaagttc 515
           |||||||| ||||||||||| ||| |||  ||||||||||| |||||||||||||||| |
Sbjct: 647 gacaagctagagttcagcaaaatcctgggagctatcaaggccaacttcaatgacaagtac 706

                           
Query: 516 gatgaggtcaggaaga 531
           || |||  ||||||||
Sbjct: 707 gaggagtacaggaaga 722

---

>emb|BX819217.1|CNS0A8T4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB58ZF10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 747

 Score =  220 bits (111), Expect = 4e-54
 Identities = 270/323 (83%)
 Strand = Plus / Plus

                                                                       
Query: 216 aagaagccaattgttgtgaagtatggtcttaaccatgtcacttaccttattgagcagagc 275
           |||||||| ||||| ||||| || || || |||||||| || ||||| |||||||||| |
Sbjct: 174 aagaagcccattgtagtgaaatacggcctcaaccatgtgacctacctcattgagcagaac 233

                                                                       
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggctc 335
           ||||| || || ||||| || ||||||||||| ||||||||| || ||||||| ||| | 
Sbjct: 234 aaggcccaacttgttgttattgctcatgatgtcgacccaattaagttggttgtctggttg 293

                                                                       
Query: 336 ccagccctatgcaggaagatggaggtcccatactgcattgttaagggaaaatcacgcctt 395
           || || || |||||||||||||| ||||| ||||||||| | ||||| ||||| || |||
Sbjct: 294 cctgctctgtgcaggaagatggaagtcccgtactgcattttcaagggcaaatctcgtctt 353

                                                                       
Query: 396 ggatcgattgttcacaagaagactgcctctgttctgtgcctcaccactgtgaagaacgag 455
           ||| || |||||||| |||||||||| |||    ||||  | |||||||| |||||||||
Sbjct: 354 ggagcggttgttcaccagaagactgcttcttgcttgtgtttgaccactgtcaagaacgag 413

                                                                       
Query: 456 gacaagcttgagttcagcaagatcttggaggctatcaaggcgaacttcaatgacaagttc 515
           |||||||| ||||||||||| ||| |||| ||||||||||| |||||||||||||||| |
Sbjct: 414 gacaagctagagttcagcaaaatcctggaagctatcaaggccaacttcaatgacaagtac 473

                                  
Query: 516 gatgaggtcaggaagaagtgggg 538
           || |||  ||||||||| |||||
Sbjct: 474 gaggagtacaggaagaaatgggg 496

---

>gb|BT014547.1| Lycopersicon esculentum clone 133964F, mRNA sequence
          Length = 1092

 Score =  204 bits (103), Expect = 2e-49
 Identities = 400/499 (80%)
 Strand = Plus / Plus

                                                                       
Query: 70  accagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaagatgcttctca 129
           |||||||||||   ||||| |||||||||| ||| || | ||| |||||||||||||| |
Sbjct: 276 accagttcaccaaaacccttgacaagaaccccgctacaacccttttcaagatgcttctta 335

                                                                       
Query: 130 agtaccgccctgaggacaaggtggctaagaaggagaggcttctgaagagggcacaggctg 189
           ||||| | ||||||||||| |  || ||||||||| | ||| | || ||||| || ||||
Sbjct: 336 agtacaggcctgaggacaaagctgcaaagaaggagcgtcttgtcaaaagggctcaagctg 395

                                                                       
Query: 190 aggctgaggggaaaaccgttgaggccaagaagccaattgttgtgaagtatggtcttaacc 249
           | || || || |||||   |||  | ||||| || ||||||||||||||||| ||||| |
Sbjct: 396 aagcagaaggaaaaactcctgaaacaaagaaacccattgttgtgaagtatgggcttaagc 455

                                                                       
Query: 250 atgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgctcatgatgttg 309
           |  ||||||||||||||||||||| ||| |||||| |||| || || |||||||| || |
Sbjct: 456 acatcacttaccttattgagcagaacaaagctcagttggtagtgattgctcatgacgtgg 515

                                                                       
Query: 310 acccaattgagctggttgtgtggctcccagccctatgcaggaagatggaggtcccatact 369
           ||||||| ||| ||||||| ||||| || || |||||||| ||||||||  | || ||||
Sbjct: 516 acccaatagagttggttgtctggcttcctgcgctatgcagaaagatggaaattccttact 575

                                                                       
Query: 370 gcattgttaagggaaaatcacgccttggatcgattgttcacaagaagactgcctctgttc 429
           ||||||| ||||| ||| | ||  | |||||||| || || ||||| ||||| || |   
Sbjct: 576 gcattgtgaagggcaaagctcgtttaggatcgatcgtgcataagaaaactgcttcagcct 635

                                                                       
Query: 430 tgtgcctcaccactgtgaagaacgaggacaagcttgagttcagcaagatcttggaggcta 489
           ||||  |  | || |||||||| || |||||  | ||||||||||  || |||||||| |
Sbjct: 636 tgtgtttgtcaaccgtgaagaatgaagacaaaatggagttcagcagaattttggaggcca 695

                                                                       
Query: 490 tcaaggcgaacttcaatgacaagttcgatgaggtcaggaagaagtggggtggtggtgtca 549
           | ||||| ||||||||||||||||  || |||  |||||||||||||||||||||| |||
Sbjct: 696 ttaaggctaacttcaatgacaagtatgaagagaacaggaagaagtggggtggtggtatca 755

                              
Query: 550 tgggctccaagtcgcaggc 568
           ||||||| ||||| |||||
Sbjct: 756 tgggctctaagtcacaggc 774

---

>dbj|AK220651.1| Arabidopsis thaliana mRNA for 60S ribosomal protein L7A, complete
           cds, clone: RAFL21-65-D24
          Length = 498

 Score =  188 bits (95), Expect = 1e-44
 Identities = 203/239 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 catgatgttgacccaattgagctggttgtgtggctcccagccctatgcaggaagatggag 359
           |||||||| |||||||||||| ||||||| ||| | || || || |||||||||||||| 
Sbjct: 1   catgatgtcgacccaattgagttggttgtctggttgcctgctctgtgcaggaagatggaa 60

                                                                       
Query: 360 gtcccatactgcattgttaagggaaaatcacgccttggatcgattgttcacaagaagact 419
           ||||| ||||||||||| ||||| ||||| || |||||| || |||||||| ||||||||
Sbjct: 61  gtcccgtactgcattgtcaagggcaaatctcgtcttggagcggttgttcaccagaagact 120

                                                                       
Query: 420 gcctctgttctgtgcctcaccactgtgaagaacgaggacaagcttgagttcagcaagatc 479
           || |||    ||||  | |||||||| ||||||||||||||||| ||||||||||| |||
Sbjct: 121 gcttcttgcttgtgtttgaccactgtcaagaacgaggacaagctagagttcagcaaaatc 180

                                                                      
Query: 480 ttggaggctatcaaggcgaacttcaatgacaagttcgatgaggtcaggaagaagtgggg 538
            |||| ||||||||||| |||||||||||||||| ||| |||  ||||||||| |||||
Sbjct: 181 ctggaagctatcaaggccaacttcaatgacaagtacgaggagtacaggaagaaatgggg 239

---

>emb|BX821934.1|CNS0A88T Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL86ZA06 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 829

 Score =  168 bits (85), Expect = 1e-38
 Identities = 241/293 (82%)
 Strand = Plus / Plus

                                                                       
Query: 246 aaccatgtcacttaccttattgagcagagcaaggctcagctggttgtcatcgctcatgat 305
           |||||||| || ||||| |||||||||| |||||| || || ||||| || |||||||||
Sbjct: 275 aaccatgtgacctacctcattgagcagaacaaggcccaacttgttgttattgctcatgat 334

                                                                       
Query: 306 gttgacccaattgagctggttgtgtggctcccagccctatgcaggaagatggaggtccca 365
           || ||||||||| || ||||||| ||| | || || || |||||||||||||| ||||| 
Sbjct: 335 gtcgacccaattaagttggttgtctggttacctgctctgtgcaggaagatggaagtcccg 394

                                                                       
Query: 366 tactgcattgttaagggaaaatcacgccttggatcgattgttcacaagaagactgcctct 425
            |||||||| | ||||| ||||| || |||||| || |||||||| |||||||||| |||
Sbjct: 395 aactgcattataaagggcaaatctcgtcttggagcggttgttcaccagaagactgcatct 454

                                                                       
Query: 426 gttctgtgcctcaccactgtgaagaacgaggacaagcttgagttcagcaagatcttggag 485
               ||||  | |||||| | ||||||||| ||||||| ||||||||||| ||| |||| 
Sbjct: 455 tgcttgtgtttgaccactatcaagaacgagaacaagctagagttcagcaaaatcctggaa 514

                                                                
Query: 486 gctatcaaggcgaacttcaatgacaagttcgatgaggtcaggaagaagtgggg 538
           ||||| ||||| ||||||||| |||||| ||| |||  ||||||||| |||||
Sbjct: 515 gctattaaggccaacttcaattacaagtacgaggagtacaggaagaaatgggg 567

---

>gb|AY496113.1| Capsicum annuum 60S ribosomal protein L7A mRNA, partial cds
          Length = 737

 Score =  155 bits (78), Expect = 2e-34
 Identities = 370/466 (79%), Gaps = 1/466 (0%)
 Strand = Plus / Plus

                                                                       
Query: 93  aagaacctcgccaccaacctgttcaagatgcttctcaagtaccgccctgaggacaaggtg 152
           |||||||| || || | ||| |||||||||||||| |||||| | ||||||||||| |  
Sbjct: 271 aagaaccttgctacaacccttttcaagatgcttctgaagtacaggcctgaggacaaagct 330

                                                                       
Query: 153 gctaagaaggagaggcttctgaagagggcacaggctgaggctgaggggaaaaccgttgag 212
           || ||||||||| | ||| | || ||||| || ||||| ||||| || || ||   ||| 
Sbjct: 331 gcaaagaaggagcgtcttgtcaaaagggctcaagctgaagctgaaggaaagactcctgaa 390

                                                                       
Query: 213 gccaagaagccaattgttgtgaagtatggtcttaaccatgtcacttaccttattgagcag 272
            | ||||| || ||| | ||||| ||||| ||||| ||  |||| |||||||||||||||
Sbjct: 391 acaaagaaacccattatcgtgaaatatgggcttaagcacatcacgtaccttattgagcag 450

                                                                       
Query: 273 agcaaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtgg 332
           |  || |||||| | || || || ||||||||||| |||||||||||| ||||||| |||
Sbjct: 451 aataaagctcagttagtagtgattgctcatgatgtggacccaattgagttggttgtctgg 510

                                                                       
Query: 333 ctcccagccctatgcaggaagatggaggtcccatactgcattgttaagggaaaatcacgc 392
           || || ||||||||||| ||||||||  | || ||||||||||| || || ||| | || 
Sbjct: 511 cttccggccctatgcagaaagatggaaattccttactgcattgtgaaagggaaagcccgt 570

                                                                       
Query: 393 cttggatcgattgttcacaagaagactgcctctgttctgtgcctcaccactgtgaagaac 452
            | ||||| || || || ||||| ||||| || |  |||||  | || ||||||||||| 
Sbjct: 571 ttaggatcaatcgtgcataagaaaactgcttcagccctgtgtttgacaactgtgaagaat 630

                                                                       
Query: 453 gaggacaagcttgagttcagcaagatcttggaggctatcaaggcgaacttcaatgacaag 512
           || |||||| | ||||||||||   | ||||||||||| ||||| |||||||||||||||
Sbjct: 631 gaagacaagatggagttcagcagagttttggaggctattaaggctaacttcaatgacaag 690

                                                         
Query: 513 ttcgatgaggtcaggaagaagtggggtggtggtgtcatgggctcca 558
           |  || |||  |||||| ||||||||||| ||| ||||||||||||
Sbjct: 691 tatgaggagaacaggaa-aagtggggtgggggtatcatgggctcca 735

---

>emb|AL162651.1|ATF26K9 Arabidopsis thaliana DNA chromosome 3, BAC clone F26K9
          Length = 110257

 Score =  145 bits (73), Expect = 2e-31
 Identities = 157/185 (84%)
 Strand = Plus / Minus

                                                                         
Query: 214   ccaagaagccaattgttgtgaagtatggtcttaaccatgtcacttaccttattgagcaga 273
             |||||||||| |||||||| ||||||||||| |||||||| |||||||| || |||||||
Sbjct: 96455 ccaagaagcccattgttgttaagtatggtctcaaccatgtgacttacctcatcgagcaga 96396

                                                                         
Query: 274   gcaaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggc 333
              |||||| ||||| || ||||| || || ||||||||||| || ||| |||| || ||| 
Sbjct: 96395 acaaggcacagcttgtggtcattgcacacgatgttgaccctatcgagttggtggtctggt 96336

                                                                         
Query: 334   tcccagccctatgcaggaagatggaggtcccatactgcattgttaagggaaaatcacgcc 393
             | || || || |||||||| ||||| ||||| ||||||||||||||||||||||| || |
Sbjct: 96335 tacctgcactctgcaggaaaatggaagtcccttactgcattgttaagggaaaatctcgtc 96276

                  
Query: 394   ttgga 398
             |||||
Sbjct: 96275 ttgga 96271



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 78/91 (85%)
 Strand = Plus / Minus

                                                                         
Query: 405   gttcacaagaagactgcctctgttctgtgcctcaccactgtgaagaacgaggacaagctt 464
             |||||| ||||||||||  |||   ||||| | |||||||| ||||||||||||||||||
Sbjct: 96161 gttcaccagaagactgctgctgccttgtgcttgaccactgtcaagaacgaggacaagctt 96102

                                            
Query: 465   gagttcagcaagatcttggaggctatcaagg 495
             ||||||||||| ||| | ||||| |||||||
Sbjct: 96101 gagttcagcaaaatcctcgaggccatcaagg 96071



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                         
Query: 493   aggcgaacttcaatgacaagttcgatgaggtcaggaagaagtggggtggtggtgtcatgg 552
             |||| |||||||| ||||||| ||| |||  ||||||||||||||| |||||  | ||||
Sbjct: 95969 aggctaacttcaacgacaagtacgaggagtacaggaagaagtggggaggtggcataatgg 95910

                       
Query: 553   gctccaagtc 562
             | ||||||||
Sbjct: 95909 gatccaagtc 95900

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  135 bits (68), Expect = 2e-28
 Identities = 83/88 (94%)
 Strand = Plus / Minus

                                                                            
Query: 15       atccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcgctccaccag 74
                |||||||||||||||||| |||||||||||||||||||||| || || |||||| |||||
Sbjct: 40490379 atccagcgccagcgccgcgtcctcaagcagcgcctcaaggttccacccgcgctcaaccag 40490320

                                            
Query: 75       ttcacccgcaccctcgacaagaacctcg 102
                ||||||||||||||||||||||||||||
Sbjct: 40490319 ttcacccgcaccctcgacaagaacctcg 40490292



 Score =  105 bits (53), Expect = 2e-19
 Identities = 62/65 (95%)
 Strand = Plus / Minus

                                                                            
Query: 498      aacttcaatgacaagttcgatgaggtcaggaagaagtggggtggtggtgtcatgggctcc 557
                |||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| 
Sbjct: 40488830 aacttcaacgacaagttcgatgaggtcaggaagaagtggggtggtggtatcatgggctca 40488771

                     
Query: 558      aagtc 562
                |||||
Sbjct: 40488770 aagtc 40488766



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 100/117 (85%)
 Strand = Plus / Minus

                                                                            
Query: 269      gcagagcaaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgt 328
                |||||||||||| ||||| || ||||| ||||||||||| ||||| ||||| || || ||
Sbjct: 40489257 gcagagcaaggcacagcttgtggtcattgctcatgatgtcgaccccattgaactcgtcgt 40489198

                                                                         
Query: 329      gtggctcccagccctatgcaggaagatggaggtcccatactgcattgttaagggaaa 385
                 |||||||||||| | ||||||||||||||  |||| || |||||||| ||||||||
Sbjct: 40489197 ttggctcccagccttgtgcaggaagatggaaatcccttattgcattgtgaagggaaa 40489141



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 118/140 (84%), Gaps = 1/140 (0%)
 Strand = Plus / Minus

                                                                            
Query: 114      ttcaagatgcttctcaagtaccgccctgaggacaaggtggctaagaaggagaggcttctg 173
                |||||||||||  | |||||||||||||| || ||||  || | |||||| |||||| ||
Sbjct: 40489536 ttcaagatgctgttgaagtaccgccctgaagataaggctgcca-gaaggaaaggcttttg 40489478

                                                                            
Query: 174      aagagggcacaggctgaggctgaggggaaaaccgttgaggccaagaagccaattgttgtg 233
                || || || || || |||||||| ||||| || ||||| |||||||| ||||||||||||
Sbjct: 40489477 aaaagagcgcaagcagaggctgaagggaagactgttgaagccaagaaaccaattgttgtg 40489418

                                    
Query: 234      aagtatggtcttaaccatgt 253
                |||||||||||| |||||||
Sbjct: 40489417 aagtatggtcttgaccatgt 40489398



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 74/87 (85%)
 Strand = Plus / Minus

                                                                            
Query: 401      gattgttcacaagaagactgcctctgttctgtgcctcaccactgtgaagaacgaggacaa 460
                |||||| ||||||||||| || ||||| || || || || ||||||||||| || |||||
Sbjct: 40489021 gattgtgcacaagaagacagcatctgtcctttgtctgacgactgtgaagaatgaagacaa 40488962

                                           
Query: 461      gcttgagttcagcaagatcttggaggc 487
                | | ||||||||||| |||||||||||
Sbjct: 40488961 gttggagttcagcaaaatcttggaggc 40488935

---

>dbj|AP004672.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0592G05
          Length = 146220

 Score =  135 bits (68), Expect = 2e-28
 Identities = 83/88 (94%)
 Strand = Plus / Minus

                                                                          
Query: 15     atccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcgctccaccag 74
              |||||||||||||||||| |||||||||||||||||||||| || || |||||| |||||
Sbjct: 141620 atccagcgccagcgccgcgtcctcaagcagcgcctcaaggttccacccgcgctcaaccag 141561

                                          
Query: 75     ttcacccgcaccctcgacaagaacctcg 102
              ||||||||||||||||||||||||||||
Sbjct: 141560 ttcacccgcaccctcgacaagaacctcg 141533



 Score =  105 bits (53), Expect = 2e-19
 Identities = 62/65 (95%)
 Strand = Plus / Minus

                                                                          
Query: 498    aacttcaatgacaagttcgatgaggtcaggaagaagtggggtggtggtgtcatgggctcc 557
              |||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| 
Sbjct: 140071 aacttcaacgacaagttcgatgaggtcaggaagaagtggggtggtggtatcatgggctca 140012

                   
Query: 558    aagtc 562
              |||||
Sbjct: 140011 aagtc 140007



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 100/117 (85%)
 Strand = Plus / Minus

                                                                          
Query: 269    gcagagcaaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgt 328
              |||||||||||| ||||| || ||||| ||||||||||| ||||| ||||| || || ||
Sbjct: 140498 gcagagcaaggcacagcttgtggtcattgctcatgatgtcgaccccattgaactcgtcgt 140439

                                                                       
Query: 329    gtggctcccagccctatgcaggaagatggaggtcccatactgcattgttaagggaaa 385
               |||||||||||| | ||||||||||||||  |||| || |||||||| ||||||||
Sbjct: 140438 ttggctcccagccttgtgcaggaagatggaaatcccttattgcattgtgaagggaaa 140382



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 118/140 (84%), Gaps = 1/140 (0%)
 Strand = Plus / Minus

                                                                          
Query: 114    ttcaagatgcttctcaagtaccgccctgaggacaaggtggctaagaaggagaggcttctg 173
              |||||||||||  | |||||||||||||| || ||||  || | |||||| |||||| ||
Sbjct: 140777 ttcaagatgctgttgaagtaccgccctgaagataaggctgcca-gaaggaaaggcttttg 140719

                                                                          
Query: 174    aagagggcacaggctgaggctgaggggaaaaccgttgaggccaagaagccaattgttgtg 233
              || || || || || |||||||| ||||| || ||||| |||||||| ||||||||||||
Sbjct: 140718 aaaagagcgcaagcagaggctgaagggaagactgttgaagccaagaaaccaattgttgtg 140659

                                  
Query: 234    aagtatggtcttaaccatgt 253
              |||||||||||| |||||||
Sbjct: 140658 aagtatggtcttgaccatgt 140639



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 74/87 (85%)
 Strand = Plus / Minus

                                                                          
Query: 401    gattgttcacaagaagactgcctctgttctgtgcctcaccactgtgaagaacgaggacaa 460
              |||||| ||||||||||| || ||||| || || || || ||||||||||| || |||||
Sbjct: 140262 gattgtgcacaagaagacagcatctgtcctttgtctgacgactgtgaagaatgaagacaa 140203

                                         
Query: 461    gcttgagttcagcaagatcttggaggc 487
              | | ||||||||||| |||||||||||
Sbjct: 140202 gttggagttcagcaaaatcttggaggc 140176

---

>dbj|AP004223.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1033B05
          Length = 138882

 Score =  135 bits (68), Expect = 2e-28
 Identities = 83/88 (94%)
 Strand = Plus / Minus

                                                                         
Query: 15    atccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcgctccaccag 74
             |||||||||||||||||| |||||||||||||||||||||| || || |||||| |||||
Sbjct: 52003 atccagcgccagcgccgcgtcctcaagcagcgcctcaaggttccacccgcgctcaaccag 51944

                                         
Query: 75    ttcacccgcaccctcgacaagaacctcg 102
             ||||||||||||||||||||||||||||
Sbjct: 51943 ttcacccgcaccctcgacaagaacctcg 51916



 Score =  105 bits (53), Expect = 2e-19
 Identities = 62/65 (95%)
 Strand = Plus / Minus

                                                                         
Query: 498   aacttcaatgacaagttcgatgaggtcaggaagaagtggggtggtggtgtcatgggctcc 557
             |||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| 
Sbjct: 50454 aacttcaacgacaagttcgatgaggtcaggaagaagtggggtggtggtatcatgggctca 50395

                  
Query: 558   aagtc 562
             |||||
Sbjct: 50394 aagtc 50390



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 100/117 (85%)
 Strand = Plus / Minus

                                                                         
Query: 269   gcagagcaaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgt 328
             |||||||||||| ||||| || ||||| ||||||||||| ||||| ||||| || || ||
Sbjct: 50881 gcagagcaaggcacagcttgtggtcattgctcatgatgtcgaccccattgaactcgtcgt 50822

                                                                      
Query: 329   gtggctcccagccctatgcaggaagatggaggtcccatactgcattgttaagggaaa 385
              |||||||||||| | ||||||||||||||  |||| || |||||||| ||||||||
Sbjct: 50821 ttggctcccagccttgtgcaggaagatggaaatcccttattgcattgtgaagggaaa 50765



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 118/140 (84%), Gaps = 1/140 (0%)
 Strand = Plus / Minus

                                                                         
Query: 114   ttcaagatgcttctcaagtaccgccctgaggacaaggtggctaagaaggagaggcttctg 173
             |||||||||||  | |||||||||||||| || ||||  || | |||||| |||||| ||
Sbjct: 51160 ttcaagatgctgttgaagtaccgccctgaagataaggctgcca-gaaggaaaggcttttg 51102

                                                                         
Query: 174   aagagggcacaggctgaggctgaggggaaaaccgttgaggccaagaagccaattgttgtg 233
             || || || || || |||||||| ||||| || ||||| |||||||| ||||||||||||
Sbjct: 51101 aaaagagcgcaagcagaggctgaagggaagactgttgaagccaagaaaccaattgttgtg 51042

                                 
Query: 234   aagtatggtcttaaccatgt 253
             |||||||||||| |||||||
Sbjct: 51041 aagtatggtcttgaccatgt 51022



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 74/87 (85%)
 Strand = Plus / Minus

                                                                         
Query: 401   gattgttcacaagaagactgcctctgttctgtgcctcaccactgtgaagaacgaggacaa 460
             |||||| ||||||||||| || ||||| || || || || ||||||||||| || |||||
Sbjct: 50645 gattgtgcacaagaagacagcatctgtcctttgtctgacgactgtgaagaatgaagacaa 50586

                                        
Query: 461   gcttgagttcagcaagatcttggaggc 487
             | | ||||||||||| |||||||||||
Sbjct: 50585 gttggagttcagcaaaatcttggaggc 50559

---

>gb|AC155335.1| Brassica rapa subsp. pekinensis chromosome Cytogenetic chromosome 1 clone
              KBrH001H24, complete sequence
          Length = 118144

 Score =  133 bits (67), Expect = 7e-28
 Identities = 294/367 (80%), Gaps = 2/367 (0%)
 Strand = Plus / Minus

                                                                          
Query: 33     atcctcaagcagcgcctcaaggtgcccccggcgctccaccagttcacccgcaccctcgac 92
              |||||||||||| | |||||||| || || ||  |  |||||||||||   || || |||
Sbjct: 112419 atcctcaagcagaggctcaaggtccctcctgctttgaaccagttcaccaagactcttgac 112360

                                                                          
Query: 93     aagaacctcgccaccaacctgttcaagatgcttctcaagtaccgccctgaggacaaggtg 152
              ||||||||||| ||| | || |||||| | ||| | |||||| | |||||||||||||  
Sbjct: 112359 aagaacctcgcgacccagcttttcaagcttcttatgaagtacaggcctgaggacaaggct 112300

                                                                          
Query: 153    gctaagaaggagaggcttctgaagagggcacaggctgaggctgaggggaaaaccgt-tga 211
              || ||||||||  | ||| |||| | ||| || || ||||||||||| ||| || | |||
Sbjct: 112299 gcaaagaaggatcgtcttttgaaaaaggctcaagccgaggctgaggg-aaagccttctga 112241

                                                                          
Query: 212    ggccaagaagccaattgttgtgaagtatggtcttaaccatgtcacttaccttattgagca 271
                |||||||||| |||||||| |||||||| || ||||| || |||||| | || |||||
Sbjct: 112240 atccaagaagcccattgttgtcaagtatgggctcaaccacgtgacttacttgatcgagca 112181

                                                                          
Query: 272    gagcaaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtg 331
              || |||||| ||||| |||||||| ||||| ||||||||||| |||||||| || || ||
Sbjct: 112180 gaacaaggcgcagcttgttgtcattgctcacgatgttgaccccattgagcttgtcgtctg 112121

                                                                          
Query: 332    gctcccagccctatgcaggaagatggaggtcccatactgcattgttaagggaaaatcacg 391
              | | || || || || ||||||||||| || || |||||||||||||| || ||||| ||
Sbjct: 112120 gttacctgctctttgtaggaagatggaagtgccttactgcattgttaaaggcaaatctcg 112061

                     
Query: 392    ccttgga 398
               ||||||
Sbjct: 112060 tcttgga 112054



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                        
Query: 438    accactgtgaagaacgaggacaagcttgagttcagcaagatcttggaggctatcaagg 495
              |||||||| ||||||||||| ||||| ||||||||||| ||| | || ||||||||||
Sbjct: 111936 accactgtcaagaacgaggataagctcgagttcagcaaaatccttgaagctatcaagg 111879



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                            
Query: 493    aggcgaacttcaatgacaagttcgatgaggtcaggaagaagtgggg 538
              |||| |||||||| ||||||| ||| |||  |||||||||||||||
Sbjct: 111801 aggcaaacttcaacgacaagtacgaggagtacaggaagaagtgggg 111756

---

>gb|AC002535.3| Arabidopsis thaliana chromosome 2 clone T30B22 map CIC06C03, complete
             sequence
          Length = 98937

 Score =  125 bits (63), Expect = 2e-25
 Identities = 153/183 (83%)
 Strand = Plus / Minus

                                                                         
Query: 216   aagaagccaattgttgtgaagtatggtcttaaccatgtcacttaccttattgagcagagc 275
             |||||||| ||||| || || || || || |||||||| || ||||| |||||||||| |
Sbjct: 17822 aagaagcccattgtagtcaaatacggcctcaaccatgtgacctacctcattgagcagaac 17763

                                                                         
Query: 276   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggctc 335
             ||||| || || ||||| || ||||||||||| |||||||||||| ||||||| ||| | 
Sbjct: 17762 aaggcccaacttgttgttattgctcatgatgtcgacccaattgagttggttgtctggttg 17703

                                                                         
Query: 336   ccagccctatgcaggaagatggaggtcccatactgcattgttaagggaaaatcacgcctt 395
             || || || |||||||||||||| ||||| ||||||||||| ||||| ||||| || |||
Sbjct: 17702 cctgctctgtgcaggaagatggaagtcccgtactgcattgtcaagggcaaatctcgtctt 17643

                
Query: 396   gga 398
             |||
Sbjct: 17642 gga 17640



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                       
Query: 438   accactgtgaagaacgaggacaagcttgagttcagcaagatcttggaggctatcaagg 495
             |||||||| ||||||||||||||||| ||||||||||| ||| |||| ||||||||||
Sbjct: 17519 accactgtcaagaacgaggacaagctagagttcagcaaaatcctggaagctatcaagg 17462



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                           
Query: 493   aggcgaacttcaatgacaagttcgatgaggtcaggaagaagtgggg 538
             |||| |||||||||||||||| ||| |||  ||||||||| |||||
Sbjct: 17372 aggccaacttcaatgacaagtacgaggagtacaggaagaaatgggg 17327

---

>gb|AC155339.1| Brassica rapa subsp. pekinensis chromosome Cytogenetic chromosome 1
             clone KBrH015H17, complete sequence
          Length = 110885

 Score =  119 bits (60), Expect = 1e-23
 Identities = 294/368 (79%), Gaps = 3/368 (0%)
 Strand = Plus / Minus

                                                                         
Query: 33    atcctcaagcagcgcctcaaggtgcccccggcgctccaccagttcacccgcaccctcgac 92
             |||||||||||| | |||||||| || || ||  |  |||||||||||   || || |||
Sbjct: 26243 atcctcaagcagaggctcaaggtccctcctgctttgaaccagttcaccaagactcttgac 26184

                                                                         
Query: 93    aagaacctcgccaccaacctgttcaagatgcttctcaagtaccgccctgaggacaaggtg 152
             ||||||||||| ||| | || |||||| | ||| | |||||| | |||||||||||||  
Sbjct: 26183 aagaacctcgcgacccagcttttcaagcttcttatgaagtacaggcctgaggacaaggct 26124

                                                                         
Query: 153   gctaagaaggagaggcttctgaagagggcacaggctgaggctgaggggaaaaccgt-tga 211
             || ||||||||  | ||| |||| | ||| || || ||||||||||| ||| || | |||
Sbjct: 26123 gcaaagaaggatcgtcttttgaaaaaggctcaagccgaggctgaggg-aaagccttctga 26065

                                                                         
Query: 212   ggccaagaagccaattgttgtgaagtatggtcttaaccatgtcacttaccttattgagca 271
               |||||||||| |||||||| |||||||| || ||||| || |||||| | || |||||
Sbjct: 26064 atccaagaagcccattgttgtcaagtatgggctcaaccacgtgacttacttgatcgagca 26005

                                                                         
Query: 272   gagcaaggctcagctggttgtcatcgctcat-gatgttgacccaattgagctggttgtgt 330
             || |||||| ||||| |||||||| |||||  ||||||||||| |||||||| || || |
Sbjct: 26004 gaacaaggcgcagcttgttgtcattgctcaacgatgttgaccccattgagcttgtcgtct 25945

                                                                         
Query: 331   ggctcccagccctatgcaggaagatggaggtcccatactgcattgttaagggaaaatcac 390
             || | || || || || ||||||||||| || || |||||||||||||| || ||||| |
Sbjct: 25944 ggttacctgctctttgtaggaagatggaagtgccttactgcattgttaaaggcaaatctc 25885

                     
Query: 391   gccttgga 398
             | ||||||
Sbjct: 25884 gtcttgga 25877



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 76/89 (85%)
 Strand = Plus / Plus

                                                                         
Query: 234   aagtatggtcttaaccatgtcacttaccttattgagcagagcaaggctcagctggttgtc 293
             |||||||| || ||||| || |||||| | || ||||||| |||||| ||||| ||||||
Sbjct: 27302 aagtatgggctcaaccacgtgacttacttgatcgagcagaacaaggcgcagcttgttgtc 27361

                                          
Query: 294   atcgctcatgatgttgacccaattgagct 322
             || ||||| ||||||||||| ||||||||
Sbjct: 27362 attgctcacgatgttgaccccattgagct 27390



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                       
Query: 438   accactgtgaagaacgaggacaagcttgagttcagcaagatcttggaggctatcaagg 495
             |||||||| ||||||||||| ||||| ||||||||||| ||| | || ||||||||||
Sbjct: 25759 accactgtcaagaacgaggataagctcgagttcagcaaaatccttgaagctatcaagg 25702



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                           
Query: 493   aggcgaacttcaatgacaagttcgatgaggtcaggaagaagtgggg 538
             |||| |||||||| ||||||| ||| |||  |||||||||||||||
Sbjct: 25624 aggcaaacttcaacgacaagtacgaggagtacaggaagaagtgggg 25579

---

>gb|BC106480.1| Xenopus laevis cDNA clone IMAGE:7211162
          Length = 935

 Score =  117 bits (59), Expect = 4e-23
 Identities = 95/107 (88%)
 Strand = Plus / Minus

                                                                       
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggctc 335
           ||||||||||| ||||| ||||||||||||||||| ||||||||||| |||||||  |||
Sbjct: 441 aaggctcagcttgttgtgatcgctcatgatgttgatccaattgagcttgttgtgttcctc 382

                                                          
Query: 336 ccagccctatgcaggaagatggaggtcccatactgcattgttaaggg 382
           || ||| | |||||||||||||  ||||||||||||||||| |||||
Sbjct: 381 cctgccttgtgcaggaagatgggagtcccatactgcattgtcaaggg 335

---

>gb|AY393839.1| Xenopus laevis ribosomal protein L7a mRNA, partial cds
          Length = 715

 Score =  117 bits (59), Expect = 4e-23
 Identities = 95/107 (88%)
 Strand = Plus / Plus

                                                                       
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggctc 335
           ||||||||||| ||||| ||||||||||||||||| ||||||||||| |||||||  |||
Sbjct: 416 aaggctcagcttgttgtgatcgctcatgatgttgatccaattgagcttgttgtgttcctc 475

                                                          
Query: 336 ccagccctatgcaggaagatggaggtcccatactgcattgttaaggg 382
           || ||| | |||||||||||||  ||||||||||||||||| |||||
Sbjct: 476 cctgccttgtgcaggaagatgggagtcccatactgcattgtcaaggg 522

---

>emb|AJ718619.1| Nicotiana tabacum cDNA-AFLP-fragment BSTC3-31-300, cultivar Bright
           Yellow 2
          Length = 236

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 103/122 (84%)
 Strand = Plus / Plus

                                                                       
Query: 84  accctcgacaagaacctcgccaccaacctgttcaagatgcttctcaagtaccgccctgag 143
           ||||| ||||  |||||||| |||||||||||||||||||||||||||||| | ||||||
Sbjct: 77  accctggacanaaacctcgcgaccaacctgttcaagatgcttctcaagtacaggcctgag 136

                                                                       
Query: 144 gacaaggtggctaagaaggagaggcttctgaagagggcacaggctgaggctgaggggaaa 203
           ||||| |  || ||||||||| | ||| |||| ||||| || ||||| ||||| || |||
Sbjct: 137 gacaaagctgcaaagaaggagcgtcttgtgaaaagggctcaagctgaagctgaaggaaaa 196

             
Query: 204 ac 205
           ||
Sbjct: 197 ac 198

---

>emb|BX821043.1|CNS0A8L9 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH94ZE02 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 764

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 162/201 (80%)
 Strand = Plus / Plus

                                                                       
Query: 259 accttattgagcagagcaaggctcagctggttgtcatcgctcatgatgttgacccaattg 318
           |||| ||||||||||  ||||| |  || ||||| || || |||||||| ||||||||||
Sbjct: 236 acctgattgagcagaagaaggccccacttgttgtgattgcgcatgatgtcgacccaattg 295

                                                                       
Query: 319 agctggttgtgtggctcccagccctatgcaggaagatggaggtcccatactgcattgtta 378
           || ||||||||||| | || ||  | |||||||||||||| || || ||||||||||| |
Sbjct: 296 agttggttgtgtggtttcctgctatgtgcaggaagatggaagtgccgtactgcattgtga 355

                                                                       
Query: 379 agggaaaatcacgccttggatcgattgttcacaagaagactgcctctgttctgtgcctca 438
           |||| ||||| |  |||||| || |||||||| |||||| ||| |||    ||||  | |
Sbjct: 356 agggcaaatctcctcttggagcggttgttcaccagaagagtgcttctcgcttgtgtgtga 415

                                
Query: 439 ccactgtgaagaacgaggaca 459
            ||||||||||||||||||||
Sbjct: 416 gcactgtgaagaacgaggaca 436

---

>dbj|AK108838.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-151-H01, full
           insert sequence
          Length = 983

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 92/109 (84%)
 Strand = Plus / Plus

                                                                       
Query: 274 gcaaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggc 333
           ||||||| |||||||| |||||||| || || || ||||| ||||||||||| |||||||
Sbjct: 473 gcaaggcgcagctggtggtcatcgcccacgacgtggaccccattgagctggtggtgtggc 532

                                                            
Query: 334 tcccagccctatgcaggaagatggaggtcccatactgcattgttaaggg 382
           | ||||| || |||| ||||||||  || ||||||||||| || |||||
Sbjct: 533 tgccagcactgtgcaagaagatgggcgtgccatactgcatcgtcaaggg 581



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 444 gtgaagaacgaggacaagcttgagttcagcaag 476
           ||||||||||||||| ||| ||||||| |||||
Sbjct: 643 gtgaagaacgaggaccagcgtgagttcggcaag 675

---

>gb|AY924998.1| Seculamonas ecuadoriensis Rpl7A mRNA, partial cds
          Length = 653

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 55/60 (91%)
 Strand = Plus / Plus

                                                                       
Query: 90  gacaagaacctcgccaccaacctgttcaagatgcttctcaagtaccgccctgaggacaag 149
           ||||||||||| |||||||||||||||||| ||||  ||||||||||||| |||||||||
Sbjct: 239 gacaagaacctggccaccaacctgttcaagctgctcatcaagtaccgcccggaggacaag 298



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 62/74 (83%)
 Strand = Plus / Plus

                                                                       
Query: 309 gacccaattgagctggttgtgtggctcccagccctatgcaggaagatggaggtcccatac 368
           ||||| |||||||| || || ||||||||  |||| |||| ||||||||  ||||| |||
Sbjct: 449 gacccgattgagctcgtcgtctggctcccgaccctctgcaagaagatgggtgtcccgtac 508

                         
Query: 369 tgcattgttaaggg 382
           |||||||| |||||
Sbjct: 509 tgcattgtcaaggg 522

---

>emb|BX825080.1|CNS0A6S2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH94ZH07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 932

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 96/115 (83%)
 Strand = Plus / Plus

                                                                       
Query: 430 tgtgcctcaccactgtgaagaacgaggacaagcttgagttcagcaagatcttggaggcta 489
           ||||| |||||||| | ||||||||||||| |||| ||||| |||| ||| | ||||| |
Sbjct: 604 tgtgcttcaccactctcaagaacgaggacacgcttcagttccgcaaaatcctcgaggcca 663

                                                                  
Query: 490 tcaaggcgaacttcaatgacaagttcgatgaggtcaggaagaagtggggtggtgg 544
           |||| ||  ||||||| ||||||| ||| |||  ||||||||||||||| |||||
Sbjct: 664 tcaacgctcacttcaacgacaagtacgaggagtacaggaagaagtggggaggtgg 718



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                   
Query: 214 ccaagaagccaattgttgtgaagtatggtcttaaccatgt 253
           |||||||||| |||||||||||||||||||| ||| ||||
Sbjct: 388 ccaagaagcccattgttgtgaagtatggtctaaacgatgt 427

---

>gb|AF401560.1| Ictalurus punctatus ribosomal protein L7a mRNA, complete cds
          Length = 860

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 93/111 (83%)
 Strand = Plus / Plus

                                                                       
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggctc 335
           ||||| ||||||||||| |||||||||||||| |||||||| ||||||||  |||  || 
Sbjct: 456 aaggcccagctggttgtgatcgctcatgatgtcgacccaatcgagctggtgttgttcctg 515

                                                              
Query: 336 ccagccctatgcaggaagatggaggtcccatactgcattgttaagggaaaa 386
           || || || ||| | |||||||  |||||||||||||| ||||| ||||||
Sbjct: 516 cctgctctgtgccgtaagatgggtgtcccatactgcatcgttaaaggaaaa 566

---

>gb|AY924997.1| Jakoba libera Rpl7A mRNA, partial cds
          Length = 750

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 77/91 (84%)
 Strand = Plus / Plus

                                                                       
Query: 283 agctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggctcccagccc 342
           ||||||| |||||||| || ||||||||||| || ||||||||  | |||||||| ||||
Sbjct: 516 agctggtggtcatcgcccacgatgttgaccccatcgagctggtcctctggctccccgccc 575

                                          
Query: 343 tatgcaggaagatggaggtcccatactgcat 373
           | ||| | |||||||| ||||| ||||||||
Sbjct: 576 tgtgccgcaagatggatgtcccctactgcat 606

---

>gb|AY924999.1| Reclinomonas americana Rpl7A mRNA, partial cds
          Length = 618

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 100/122 (81%)
 Strand = Plus / Plus

                                                                       
Query: 18  cagcgccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcgctccaccagttc 77
           |||||||||||| ||||||| || |  ||||| |||||||| || ||| || |||| |||
Sbjct: 113 cagcgccagcgcagcatcctgaaccgccgcctgaaggtgccaccagcgatcaaccacttc 172

                                                                       
Query: 78  acccgcaccctcgacaagaacctcgccaccaacctgttcaagatgcttctcaagtaccgc 137
           |||  ||| ||  ||||||||   |||||||||||||||||| |||| || |||||||||
Sbjct: 173 accttcacgctgaacaagaacgcggccaccaacctgttcaagctgctgctgaagtaccgc 232

             
Query: 138 cc 139
           ||
Sbjct: 233 cc 234

---

>gb|BC072834.1| Xenopus laevis MGC80199 protein, mRNA (cDNA clone MGC:80199
           IMAGE:4970819), complete cds
          Length = 916

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 86/104 (82%)
 Strand = Plus / Plus

                                                                       
Query: 279 gctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggctccca 338
           |||||||| ||||| || || ||||| || || || |||||||| |||||||  ||||| 
Sbjct: 499 gctcagcttgttgtgattgcccatgacgtggatcccattgagctcgttgtgttcctccct 558

                                                       
Query: 339 gccctatgcaggaagatggaggtcccatactgcattgttaaggg 382
           ||| | ||| |||||||||  ||||||||||||||||| |||||
Sbjct: 559 gccttgtgccggaagatgggagtcccatactgcattgtcaaggg 602

---

>gb|AY769275.1| Bombyx mori ribosomal protein L7A (RpL7A) mRNA, complete cds
          Length = 964

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggtt 326
           ||||| ||||| || |||||||||||||||||||| || ||||||||||||
Sbjct: 574 aaggcgcagcttgtggtcatcgctcatgatgttgatcctattgagctggtt 624

---

>gb|DQ118092.1| Trimastix pyriformis ribosomal protein L7A mRNA, complete cds
          Length = 804

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                       
Query: 70  accagttcacccgcaccctcgacaagaacctcgccaccaacctgttcaagatgcttctca 129
           ||||||||||||  ||||| |||||| || |||||||  |  |||||||| | || | ||
Sbjct: 242 accagttcacccagacccttgacaagcacgtcgccactgagatgttcaagctcctccaca 301

                                              
Query: 130 agtaccgccctgaggacaaggtggctaagaaggag 164
           ||||||||||||||||||||  ||| |||||||||
Sbjct: 302 agtaccgccctgaggacaagaaggccaagaaggag 336



 Score = 48.1 bits (24), Expect = 0.032
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 351 aagatggaggtcccatactgcattgttaaggg 382
           |||||||| ||||| |||||||||||||||||
Sbjct: 526 aagatggacgtcccctactgcattgttaaggg 557

---

>gb|AY310805.1| Nicotiana benthamiana clone 12-101 unknown mRNA
          Length = 417

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 90/110 (81%)
 Strand = Plus / Plus

                                                                       
Query: 229 ttgtgaagtatggtcttaaccatgtcacttaccttattgagcagagcaaggctcagctgg 288
           |||| |||||||||||||| ||  |||| |||||||| ||||| |  || || ||| |||
Sbjct: 51  ttgtaaagtatggtcttaagcacatcacctaccttatcgagcanaataaagcgcagttgg 110

                                                             
Query: 289 ttgtcatcgctcatgatgttgacccaattgagctggttgtgtggctccca 338
           | || || || ||||||||||||||||| ||  ||||||| |||||||||
Sbjct: 111 tggttattgcacatgatgttgacccaatagaattggttgtctggctccca 160

---

>gb|AY439881.1| Armigeres subalbatus ASAP ID: 38933 cytosolic large ribosomal
           subunit L7a mRNA sequence
          Length = 786

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           ||||| || |||||||||||| |||| |||||||| ||||||||||||||
Sbjct: 522 aaggcacaactggttgtcatctctcacgatgttgatccaattgagctggt 571

---

>ref|XM_575193.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L7a
           (LOC499852), mRNA
          Length = 684

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || ||||||||||| ||||| |||||||||||
Sbjct: 334 aaggctcagctggtggtgattgctcatgatgtagaccccattgagctggt 383

---

>gb|AC140446.5| Mus musculus BAC clone RP24-114J11 from chromosome 8, complete sequence
          Length = 152392

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                               
Query: 276   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
             |||||||||||||| || || || |||||||||||||| |||||||||||
Sbjct: 44543 aaggctcagctggtggtgattgcccatgatgttgaccccattgagctggt 44592

---

>gb|AY924996.1| Malawimonas jakobiformis Rpl7A mRNA, partial cds
          Length = 735

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 286 tggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggctccc 337
           |||| ||||||||||| ||||||||||| |||||||| ||| | ||||||||
Sbjct: 517 tggtcgtcatcgctcacgatgttgacccgattgagcttgttctctggctccc 568



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 112 tgttcaagatgcttctcaagtaccgccctgaggacaagg 150
           |||||||| |||| | |||||||||||||||||||||||
Sbjct: 343 tgttcaagctgctccacaagtaccgccctgaggacaagg 381

---

>gb|BC076693.1| Xenopus tropicalis hypothetical protein LOC447981, mRNA (cDNA clone
           IMAGE:6983424), partial cds
          Length = 864

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 87/107 (81%)
 Strand = Plus / Plus

                                                                       
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggctc 335
           ||||||||||| ||||| ||||| |||||||| || || || ||||| || ||||  |||
Sbjct: 447 aaggctcagcttgttgtgatcgcccatgatgtcgatcccatcgagctcgtcgtgttcctc 506

                                                          
Query: 336 ccagccctatgcaggaagatggaggtcccatactgcattgttaaggg 382
           || ||  | ||| | |||||||  ||||||||||||||||| |||||
Sbjct: 507 cctgctttgtgccgcaagatgggagtcccatactgcattgtcaaggg 553

---

>gb|AY925004.1| Malawimonas jakobiformis isolate MJL00000703 Rpl7A gene, partial
           cds
          Length = 488

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 112 tgttcaagatgcttctcaagtaccgccctgaggacaagg 150
           |||||||| |||| | |||||||||||||||||||||||
Sbjct: 178 tgttcaagctgctccacaagtaccgccctgaggacaagg 216



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 286 tggttgtcatcgctcatgatgttgacccaattgag 320
           |||| ||||||||||| ||||||||||| ||||||
Sbjct: 352 tggtcgtcatcgctcacgatgttgacccgattgag 386

---

>ref|XM_575291.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L7a
           (LOC366258), mRNA
          Length = 651

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                              
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggtt 326
           |||||||||||||| || || || |||||||| ||||| ||||||||||||
Sbjct: 421 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggtt 471

---

>emb|AL824703.12| Mouse DNA sequence from clone RP23-317M2 on chromosome 4, complete
             sequence
          Length = 80922

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                            
Query: 276   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagct 322
             ||||||||||||||||| || || |||||||| ||||| ||||||||
Sbjct: 32562 aaggctcagctggttgtgattgcccatgatgtagaccccattgagct 32516

---

>gb|AC154486.2| Mus musculus BAC clone RP24-118H13 from chromosome 17, complete
             sequence
          Length = 197387

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                               
Query: 276   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
             |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 26822 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 26773

---

>gb|AC110194.11| Mus musculus chromosome 7, clone RP23-238J3, complete sequence
          Length = 223663

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                                
Query: 276    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
              |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 161186 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 161235

---

>gb|AC182749.2| Mus musculus BAC clone RP23-464D14 from chromosome 17, complete
             sequence
          Length = 211198

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                               
Query: 276   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
             |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 64046 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 64095

---

>ref|XM_909062.2| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3), transcript variant 3
           (LOC268795), mRNA
          Length = 892

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 479 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 528

---

>ref|XM_921134.2| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3), transcript variant 4
           (LOC268795), mRNA
          Length = 878

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 465 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 514

---

>ref|XM_193790.7| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3), transcript variant 1
           (LOC268795), mRNA
          Length = 892

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 479 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 528

---

>ref|XM_898600.2| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3), transcript variant 2
           (LOC268795), mRNA
          Length = 878

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 465 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 514

---

>gb|AC110262.12| Mus musculus chromosome 17, clone RP23-291L10, complete sequence
          Length = 210850

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                                
Query: 276    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
              |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 127023 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 126974

---

>ref|XR_002714.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC434227), mRNA
          Length = 834

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 435 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 484

---

>ref|XM_751458.1| Ustilago maydis 521 hypothetical protein (UM00404.1) partial mRNA
          Length = 957

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Plus

                                                                       
Query: 42  cagcgcctcaaggtgcccccggcgctccaccagttcacccgcaccctcgacaagaacctc 101
           |||||| | ||||| ||||| ||| ||  ||||||| ||  |||||| |||||||||  |
Sbjct: 328 cagcgcttgaaggtcccccctgcgatcgcccagttcgccaacacccttgacaagaacacc 387

                                                 
Query: 102 gccaccaacctgttcaagatgcttctcaagtaccgccc 139
           |||||||| ||||||||| ||||   ||||||||||||
Sbjct: 388 gccaccaatctgttcaagctgctcaacaagtaccgccc 425

---

>gb|AC124412.3| Mus musculus BAC clone RP24-274J3 from chromosome 9, complete sequence
          Length = 175945

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                                
Query: 276    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
              |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 130199 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 130248

---

>emb|AM049005.1| Meladema coriacea mRNA for ribosomal protein L7Ae (rpL7Ae gene)
          Length = 807

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 89/110 (80%)
 Strand = Plus / Plus

                                                                       
Query: 267 gagcagagcaaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggtt 326
           |||||||  ||||| || || ||||| || |||||||||||||| ||  ||||| |||||
Sbjct: 448 gagcagaaaaaggcccaacttgttgttattgctcatgatgttgatcctcttgagttggtt 507

                                                             
Query: 327 gtgtggctcccagccctatgcaggaagatggaggtcccatactgcattgt 376
            | |  ||||||||||| |||||||| ||||  |||||||| || |||||
Sbjct: 508 ctctatctcccagccctgtgcaggaaaatgggtgtcccatattgtattgt 557

---

>gb|AC115304.3| Mus musculus BAC clone RP24-156K1 from 15, complete sequence
          Length = 144026

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                               
Query: 276   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
             |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 19465 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 19416

---

>gb|AC154411.2| Mus musculus BAC clone RP24-221F4 from chromosome 17, complete sequence
          Length = 174229

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                               
Query: 276   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
             |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 19419 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 19370

---

>gb|AC166246.1| Mus musculus BAC clone RP24-80F22 from chromosome 17, complete sequence
          Length = 194452

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                                
Query: 276    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
              |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 161567 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 161518

---

>gb|AC093926.6| Genomic sequence for Mus musculus, clone RP23-342N3, complete sequence
          Length = 210913

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                               
Query: 276   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
             |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 20902 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 20951

---

>gb|AC154546.2| Mus musculus BAC clone RP23-431I7 from chromosome 16, complete sequence
          Length = 180261

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                                
Query: 276    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
              |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 173718 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 173669

---

>dbj|AK034073.1| Mus musculus adult male diencephalon cDNA, RIKEN full-length
           enriched library, clone:9330154F04
           product:unclassifiable, full insert sequence
          Length = 4030

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 476 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 427

---

>gb|AY925007.1| Reclinomonas americana Rpl7A gene, partial cds
          Length = 1357

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 102 gccaccaacctgttcaagatgcttctcaagtaccgccc 139
           |||||||||||||||||| |||| || |||||||||||
Sbjct: 208 gccaccaacctgttcaagctgctgctgaagtaccgccc 245



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                      
Query: 18 cagcgccagcgccgcatcctcaagcagcgcctcaaggtgccccc 61
          |||||||||||| ||||||| || |  ||||| |||||||||||
Sbjct: 44 cagcgccagcgcagcatcctgaaccgccgcctgaaggtgccccc 87

---

>ref|XM_577004.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L7a
           (LOC501604), mRNA
          Length = 877

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 479 aaggctcagctggtggtgattgcccatgatgtagaccctattgagctggt 528

---

>ref|XM_576987.1| PREDICTED: Rattus norvegicus similar to PRO1477 (LOC501585), mRNA
          Length = 858

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 412 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 363

---

>ref|XM_346319.2| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L7a
           (LOC367835), mRNA
          Length = 831

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 439 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 488

---

>ref|XM_225910.3| PREDICTED: Rattus norvegicus similar to Rpl7a protein (LOC307416),
           mRNA
          Length = 900

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 550 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 599

---

>ref|XM_222251.3| PREDICTED: Rattus norvegicus E1A binding protein p400 (predicted)
            (Ep400_predicted), mRNA
          Length = 11061

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 276  aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
            |||||||||||||| || || ||||||||||| |||||  ||||||||||
Sbjct: 3102 aaggctcagctggtggtgattgctcatgatgtagaccccgttgagctggt 3053

---

>ref|XM_573092.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L7a
           (LOC497905), mRNA
          Length = 903

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 505 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 554

---

>ref|XM_575493.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L7a
           (LOC500141), mRNA
          Length = 1008

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 478 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 527

---

>ref|XM_345462.2| PREDICTED: Rattus norvegicus similar to Rpl7a protein (LOC366239),
           mRNA
          Length = 621

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 274 aaggctcagctggtggtgattgcccatgatgtggaccccattgagctggt 323

---

>ref|XM_575149.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L7a
           (LOC499809), mRNA
          Length = 880

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 491 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 540

---

>ref|XM_216024.3| PREDICTED: Rattus norvegicus ribosomal protein L7a (predicted)
           (Rpl7a_predicted), mRNA
          Length = 865

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 472 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 521

---

>ref|XM_574881.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L7a
           (LOC499556), mRNA
          Length = 880

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 479 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 528

---

>ref|XM_574302.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L7a
           (LOC499009), mRNA
          Length = 858

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 451 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 500

---

>gb|AC154252.1| Mus musculus BAC clone RP24-197M20 from chromosome 13, complete sequence
          Length = 176702

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                                
Query: 276    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
              |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 143470 aaggctcagctggtggtaattgcccatgatgtagaccccattgagctggt 143421

---

>emb|X15013.1|RNPPL7A Rat mRNA for ribosomal protein L7a
          Length = 851

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 458 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 507

---

>emb|AL603787.8| Mouse DNA sequence from clone RP23-169J19 on chromosome 11 Contains the
              3' end of a novel gene, the gene for a novel protein
              similar to nascent polypeptide-associated complex alpha
              polypeptide Naca, the Tbrg4 gene for transforming growth
              factor beta regulated gene 4, the Wap gene for whey acidic
              protein, an ethanol induced 6 (Etohi6) pseudogene, two
              novel genes, the Ramp3 gene for receptor (calcitonin)
              activity modifying protein 3, a lactate dehydrogenase 1 A
              chain (Ldh1) pseudogene, a mitochondrial ribosomal protein
              L36 (Mrpl36) pseudogene, a retinoblastoma binding protein 5
              (Rbbp5) pseudogene, a ribosomal protein L7A (Rpl7a)
              pseudogene and two CpG islands, complete sequence
          Length = 225879

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                                
Query: 276    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
              |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 199605 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 199556

---

>gb|AC147366.5| Mus musculus BAC clone RP23-386J3 from 15, complete sequence
          Length = 175781

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                               
Query: 276   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
             |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 52150 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 52199

---

>gb|AC171211.1| Mus musculus BAC clone RP23-34I14 from chromosome 16, complete sequence
          Length = 230462

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                                
Query: 276    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
              |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 175827 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 175876

---

>emb|AL772228.5| Mouse DNA sequence from clone RP23-236D1 on chromosome 4, complete
              sequence
          Length = 167555

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                                
Query: 276    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
              |||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 144352 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 144303

---

>gb|AC121151.11| Mus musculus chromosome 17, clone RP24-342C2, complete sequence
          Length = 205467

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                               
Query: 276    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctgg 324
              |||||||||||||| || || || |||||||| ||||| ||||||||||
Sbjct: 113221 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctgg 113269

---

>ref|XR_002826.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (LOC670147), mRNA
          Length = 821

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctgg 324
           |||||||||||||| || || || |||||||| ||||| ||||||||||
Sbjct: 471 aaggctcagctggtggtgattgcccatgatgtagaccccattgagctgg 519

---

>ref|XM_846090.1| PREDICTED: Canis familiaris similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC490635), mRNA
          Length = 809

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgt 328
           |||||||||||||| || || || |||||||| || || ||||||||||||||
Sbjct: 412 aaggctcagctggtagtgatagcacatgatgtggatcccattgagctggttgt 464

---

>emb|AJ718795.1| Nicotiana tabacum cDNA-AFLP-fragment BSTC31-3-310, cultivar Bright
           Yellow 2
          Length = 262

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 105 accaacctgttcaagatgcttctcaagtaccgccctgaggacaa 148
           ||||||||||  ||||||||||||||| || | |||||||||||
Sbjct: 123 accaacctgtggaagatgcttctcaagnacaggcctgaggacaa 166

---

>dbj|AP003158.1| Mus musculus genomic DNA, chromosome 16q clone:RP21-662M24, complete
              sequences
          Length = 194260

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                               
Query: 277    aggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
              ||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 182322 aggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 182370

---

>dbj|AP003156.1| Mus musculus genomic DNA, chromosome 16q clone:RP21-56O15, complete
             sequences
          Length = 162128

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                              
Query: 277   aggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
             ||||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 46361 aggctcagctggtggtgattgcccatgatgtagaccccattgagctggt 46409

---

>gb|AY702208.1| Loligo pealei ribosomal protein L7 mRNA, partial cds
          Length = 862

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 279 gctcagctggttgtcatcgctcatgatgttgacccaattgagct 322
           |||||| ||| | |||| ||||||||||||||||| ||||||||
Sbjct: 469 gctcagttggatatcattgctcatgatgttgaccccattgagct 512

---

>gb|AY925011.1| Trimastix pyriformis ATCC50562 Rpl7A gene, partial cds
          Length = 608

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 351 aagatggaggtcccatactgcattgttaaggg 382
           |||||||| ||||| |||||||||||||||||
Sbjct: 342 aagatggacgtcccctactgcattgttaaggg 373

---

>ref|XM_445858.1| Candida glabrata CBS138, CAGL0E03938g partial mRNA
          Length = 771

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                           
Query: 506 tgacaagttcgatgaggtcaggaagaagtggggtggtggtgtcatggg 553
           |||||||| |||||| |||| |||| | |||||||||||| |||||||
Sbjct: 669 tgacaagtacgatgaagtcaagaagcactggggtggtggtatcatggg 716

---

>ref|XM_759559.1| Theileria parva strain Muguga 60S ribosomal protein L7a (TP02_0083)
           partial mRNA
          Length = 915

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 72/88 (81%)
 Strand = Plus / Plus

                                                                       
Query: 283 agctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggctcccagccc 342
           |||| ||||| |||||||| || || || ||||| ||| | ||| | |||||||| || |
Sbjct: 548 agctcgttgtaatcgctcacgacgtagatccaatcgagttagttttatggctccctgcac 607

                                       
Query: 343 tatgcaggaagatggaggtcccatactg 370
           |||||||||| | ||||||||| |||||
Sbjct: 608 tatgcaggaaaaaggaggtcccgtactg 635

---

>emb|CR380951.1| Candida glabrata strain CBS138 chromosome E complete sequence
          Length = 687501

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                              
Query: 506    tgacaagttcgatgaggtcaggaagaagtggggtggtggtgtcatggg 553
              |||||||| |||||| |||| |||| | |||||||||||| |||||||
Sbjct: 374641 tgacaagtacgatgaagtcaagaagcactggggtggtggtatcatggg 374688

---

>gb|AY130409.1| Scyliorhinus canicula ribosomal protein L7A-like mRNA, partial
           sequence
          Length = 796

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 279 gctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgt 330
           |||||||||||  |  |||| |||||||||||||| ||||||||||| ||||
Sbjct: 453 gctcagctggtgattgtcgcacatgatgttgaccccattgagctggtcgtgt 504

---

>gb|AC152111.1| Pichia stipitis clone JGIAHYZ-17L1, complete sequence
          Length = 38449

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 534   tggggtggtggtgtcatgggctccaag 560
             |||||||||||| ||||||||||||||
Sbjct: 27206 tggggtggtggtatcatgggctccaag 27180

---

>gb|DQ214069.1| Taeniopygia guttata clone 0058P0022B08 ribosomal protein L7a-like
           mRNA, complete sequence
          Length = 889

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 279 gctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||| ||||| || || |||||||| ||||| |||||||||||
Sbjct: 472 gctcagcttgttgttattgcccatgatgtggaccctattgagctggt 518

---

>gb|AC114662.11| Mus musculus chromosome 1, clone RP24-170M24, complete sequence
          Length = 131587

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                            
Query: 276   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagct 322
             |||||||||||||| || || || |||||||| ||||| ||||||||
Sbjct: 72711 aaggctcagctggtggtgattgcccatgatgtagaccccattgagct 72757

---

>gb|AY925003.1| Malawimonas californiana Rpl7A gene, partial cds
          Length = 514

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 128 caagtaccgccctgaggacaagg 150
           |||||||||||||||||||||||
Sbjct: 4   caagtaccgccctgaggacaagg 26

---

>gb|AY925000.1| Acanthamoeba castellanii Rpl7A mRNA, partial cds
          Length = 1040

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                      
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggct 334
           |||||| |||| || || |||||||| ||||||||||| || ||||| || ||||||||
Sbjct: 567 aaggctaagctcgtcgtgatcgctcacgatgttgaccccatcgagctcgtcgtgtggct 625



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 70  accagttcacccgcaccctcgacaagaacctcgcca 105
           ||||||||||| | ||||| ||||||||||| ||||
Sbjct: 349 accagttcaccaggacccttgacaagaaccttgcca 384

---

>ref|XR_003122.1| PREDICTED: Mus musculus hypothetical protein LOC670782 (LOC670782),
           mRNA
          Length = 880

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagct 322
           |||||||||||||| || || || |||||||| ||||| ||||||||
Sbjct: 466 aaggctcagctggtggtgattgcccatgatgtagaccccattgagct 512

---

>ref|XM_746084.1| Aspergillus fumigatus Af293 cytosolic large ribosomal subunit
           protein L7A (Afu6g12990) partial mRNA
          Length = 765

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 534 tggggtggtggtgtcatgggctccaag 560
           |||||||||||| ||||||||||||||
Sbjct: 682 tggggtggtggtatcatgggctccaag 708

---

>emb|AM049007.1| Scarabaeus laticollis mRNA for ribosomal protein L7Ae (rpL7Ae gene)
          Length = 810

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 288 gttgtcatcgctcatgatgttgacccaattgagct 322
           |||||||| || |||||||||||||| ||||||||
Sbjct: 472 gttgtcattgcgcatgatgttgacccgattgagct 506

---

>ref|XM_644983.1| Entamoeba histolytica HM-1:IMSS 60S ribosomal protein L7a, putative
           (248.t00005) partial mRNA
          Length = 861

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 363 ccatactgcattgttaagggaaa 385
           |||||||||||||||||||||||
Sbjct: 517 ccatactgcattgttaagggaaa 539

---

>gb|AY925013.1| Capsaspora owczarzaki Rpl7A gene, partial cds
          Length = 394

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 330 tggctcccagccctatgcaggaagatggaggtcccatactgcattgt 376
           |||||||| ||||| ||| | ||||||||  ||||||||||||||||
Sbjct: 161 tggctccccgccctctgccgcaagatggacatcccatactgcattgt 207

---

>gb|AY130406.1| Branchiostoma lanceolatum ribosomal protein L7A-like mRNA, partial
           sequence
          Length = 715

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 534 tggggtggtggtgtcatgggctccaagtcgc 564
           |||||||||||||||||||||  ||||||||
Sbjct: 677 tggggtggtggtgtcatgggcaacaagtcgc 707



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 276 aaggctcagctggttgtcatcgctcatgat 305
           ||||| |||||||| |||||||||||||||
Sbjct: 419 aaggcacagctggtggtcatcgctcatgat 448

---

>ref|XM_223019.3| PREDICTED: Rattus norvegicus hypothetical LOC289340 (LOC289340),
           mRNA
          Length = 816

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 279 gctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           ||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 469 gctcagctggtggtgattgcccatgatgtagaccccattgagctggt 515

---

>ref|XM_576280.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L7a
           (LOC500880), mRNA
          Length = 868

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 279 gctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           ||||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 478 gctcagctggtggtgattgcccatgatgtagaccccattgagctggt 524

---

>gb|AC107710.5| Mus musculus chromosome 19, clone RP23-269K10, complete sequence
          Length = 188708

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                                
Query: 276    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
              |||||||||||||| || || || |||| ||| ||||| |||||||||||
Sbjct: 114194 aaggctcagctggtggtgattgcccatgttgtagaccccattgagctggt 114243

---

>gb|AC120404.25| Mus musculus chromosome 6, clone RP24-405O23, complete sequence
          Length = 202146

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                                
Query: 276    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
              |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 181352 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 181303

---

>gb|BC084678.1| Mus musculus ribosomal protein L7a, mRNA (cDNA clone MGC:103146
           IMAGE:30431224), complete cds
          Length = 897

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 473 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 522

---

>gb|AE017348.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 8, complete
              sequence
          Length = 1194300

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 67/82 (81%)
 Strand = Plus / Plus

                                                                          
Query: 276    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggctc 335
              ||||||||||| || ||||| ||  | ||||||||||| |||||||| || || |  |||
Sbjct: 557741 aaggctcagctcgtcgtcattgccgacgatgttgaccctattgagctcgtcgtcttcctc 557800

                                    
Query: 336    ccagccctatgcaggaagatgg 357
              || || || |||||||||||||
Sbjct: 557801 cccgctctctgcaggaagatgg 557822

---

>gb|AC128597.3| Rattus norvegicus  BAC CH230-62C6 (Children's Hospital Oakland Research
              Institute Rat (BN/SsNHsd/MCW) BAC library) complete
              sequence
          Length = 198520

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                                
Query: 276    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
              |||||||||||||| || || || || ||||| ||||| |||||||||||
Sbjct: 173125 aaggctcagctggtagttattgcccacgatgtagaccccattgagctggt 173174

---

>gb|AC138741.7| Mus musculus chromosome 1, clone RP24-260D21, complete sequence
          Length = 161846

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                               
Query: 276   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
             |||||||||||||| || || || |||||||| ||||| | |||||||||
Sbjct: 80992 aaggctcagctggtggtgattgcccatgatgtagaccccactgagctggt 80943

---

>gb|AC123658.9| Mus musculus chromosome 15, clone RP23-192C13, complete sequence
          Length = 211158

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                                
Query: 276    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
              |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 195311 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 195360

---

>gb|BC065176.1| Mus musculus ribosomal protein L7a, mRNA (cDNA clone MGC:63353
           IMAGE:6819288), complete cds
          Length = 891

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 460 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 509

---

>gb|AC140799.6| Mus musculus chromosome 15, clone RP24-147N23, complete sequence
          Length = 162329

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 299 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 348

---

>ref|NM_013721.2| Mus musculus ribosomal protein L7a (Rpl7a), mRNA
          Length = 867

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 475 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 524

---

>gb|AC132575.3| Mus musculus BAC clone RP24-425F2 from chromosome 16, complete sequence
          Length = 139828

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                               
Query: 276   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
             |||||||||||||| || || |  |||||||| ||||| |||||||||||
Sbjct: 79789 aaggctcagctggtggtgattgaccatgatgtagaccccattgagctggt 79838

---

>ref|XM_980392.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC433128), mRNA
          Length = 879

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || ||  | |||||||| ||||| |||||||||||
Sbjct: 476 aaggctcagctggtggtgattacccatgatgtagaccccattgagctggt 525

---

>ref|XM_977480.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC674419), mRNA
          Length = 901

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || ||  | |||||||| ||||| |||||||||||
Sbjct: 498 aaggctcagctggtggtgattacccatgatgtagaccccattgagctggt 547

---

>ref|XM_484651.4| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC433128), mRNA
          Length = 879

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || ||  | |||||||| ||||| |||||||||||
Sbjct: 476 aaggctcagctggtggtgattacccatgatgtagaccccattgagctggt 525

---

>ref|XM_992217.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC633858), mRNA
          Length = 889

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 480 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 529

---

>gb|AC116421.8| Mus musculus chromosome 9, clone RP24-142L1, complete sequence
          Length = 175142

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                               
Query: 276   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
             |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 64690 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 64641

---

>ref|XR_003588.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC435442), mRNA
          Length = 889

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 500 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 549

---

>ref|XR_002452.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (LOC545567), mRNA
          Length = 919

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 491 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 540

---

>ref|XR_002706.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (LOC619865), mRNA
          Length = 909

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 487 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 536

---

>ref|XM_909282.2| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC633858), mRNA
          Length = 889

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 480 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 529

---

>ref|XM_891531.2| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC626683), mRNA
          Length = 889

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 480 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 529

---

>ref|XR_002439.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC268300), mRNA
          Length = 880

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 470 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 519

---

>ref|XM_991689.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC672190), mRNA
          Length = 876

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 473 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 522

---

>ref|XM_987783.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC434426), mRNA
          Length = 958

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 517 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 566

---

>ref|XM_987455.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC671501), mRNA
          Length = 923

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 502 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 551

---

>ref|XM_975817.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC674598), mRNA
          Length = 876

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 473 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 522

---

>ref|XM_887179.2| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3), transcript variant 1
           (LOC622727), mRNA
          Length = 889

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 486 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 535

---

>ref|XM_906238.2| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3), transcript variant 2
           (LOC622727), mRNA
          Length = 887

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 484 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 533

---

>ref|XM_486245.4| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC434426), mRNA
          Length = 958

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 517 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 566

---

>ref|XM_985293.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC666669), mRNA
          Length = 932

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 511 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 560

---

>ref|XR_003443.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (LOC671487), mRNA
          Length = 802

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 452 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 501

---

>ref|XM_905543.2| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC243872), mRNA
          Length = 801

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 451 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 500

---

>ref|XM_620604.3| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC243872), mRNA
          Length = 801

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 451 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 500

---

>ref|XM_979771.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (LOC670197), mRNA
          Length = 607

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 476 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 525

---

>ref|XR_003274.1| PREDICTED: Mus musculus similar to Ribosomal protein L7A CG3314-PD,
           isoform D (LOC435775), mRNA
          Length = 795

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || |  |||||||| ||||| |||||||||||
Sbjct: 441 aaggctcagctggtggtgattgaccatgatgtagaccctattgagctggt 490

---

>ref|XR_002857.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (LOC670202), mRNA
          Length = 904

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || |||||||| ||||| | |||||||||
Sbjct: 562 aaggctcagctggtggtgattgcccatgatgtagaccccactgagctggt 611

---

>ref|XM_974409.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC669323), mRNA
          Length = 723

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || |||| ||| ||||| |||||||||||
Sbjct: 373 aaggctcagctggtggtgattgcccatggtgtagaccccattgagctggt 422

---

>ref|XR_004630.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC674259), mRNA
          Length = 834

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || |||||||| ||||| | |||||||||
Sbjct: 492 aaggctcagctggtggtgattgcccatgatgtagaccccactgagctggt 541

---

>ref|XR_001873.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC666444), mRNA
          Length = 746

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || |||| ||| ||||| |||||||||||
Sbjct: 373 aaggctcagctggtggtgattgcccatggtgtagaccccattgagctggt 422

---

>ref|XM_143236.6| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC242025), mRNA
          Length = 744

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || |||| ||| ||||| |||||||||||
Sbjct: 373 aaggctcagctggtggtgattgcccatggtgtagaccccattgagctggt 422

---

>ref|XR_003744.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (LOC672193), mRNA
          Length = 889

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 477 aaggctcagctggtggtgatggcccatgacgtagaccccattgagctggt 526

---

>gb|AC120548.15| Mus musculus chromosome 17, clone RP23-211H11, complete sequence
          Length = 198829

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                               
Query: 276   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
             |||||||||||||| || ||  | |||||||| ||||| |||||||||||
Sbjct: 38034 aaggctcagctggtggtgattacccatgatgtagaccccattgagctggt 38083

---

>ref|XM_572378.1| Cryptococcus neoformans var. neoformans JEC21 ribosomal protein L4
           (CNH02040) partial mRNA
          Length = 921

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 67/82 (81%)
 Strand = Plus / Plus

                                                                       
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggttgtgtggctc 335
           ||||||||||| || ||||| ||  | ||||||||||| |||||||| || || |  |||
Sbjct: 466 aaggctcagctcgtcgtcattgccgacgatgttgaccctattgagctcgtcgtcttcctc 525

                                 
Query: 336 ccagccctatgcaggaagatgg 357
           || || || |||||||||||||
Sbjct: 526 cccgctctctgcaggaagatgg 547

---

>gb|AC083890.4| Mus musculus strain C57BL6/J chromosome 5 clone RP23-284P20, complete
             sequence
          Length = 203967

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                               
Query: 276   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
             |||||||||||||| || |  || |||||||| ||||| |||||||||||
Sbjct: 32862 aaggctcagctggtggtgactgcccatgatgtagaccccattgagctggt 32813

---

>gb|AC121580.3| Mus musculus BAC clone RP23-255J21 from 9, complete sequence
          Length = 200282

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                                
Query: 276    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
              |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 174065 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 174114

---

>gb|AC098705.2| Mus musculus BAC clone RP23-1B19 from 3, complete sequence
          Length = 202444

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                               
Query: 276   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
             |||||||||||||| || || || |||||||| ||||| | |||||||||
Sbjct: 93482 aaggctcagctggtggtgattgcccatgatgtagaccccactgagctggt 93433

---

>gb|AC098724.3| Mus musculus BAC clone RP23-3D14 from 4, complete sequence
          Length = 190437

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                               
Query: 276   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
             |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 19298 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 19347

---

>gb|BC052339.1| Mus musculus ribosomal protein L7a, mRNA (cDNA clone
           IMAGE:30071790), partial cds
          Length = 880

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 465 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 514

---

>gb|BC016489.1| Mus musculus ribosomal protein L7a, mRNA (cDNA clone
           IMAGE:3155705), complete cds
          Length = 501

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 93  aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 142

---

>emb|CR648468.2|CNS0EZBU Tetraodon nigroviridis full-length cDNA
          Length = 829

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgaccc 313
           ||||| ||||||||  |||| |||||||||||||||||
Sbjct: 449 aaggcccagctggtcatcattgctcatgatgttgaccc 486

---

>gb|AC115910.6| Mus musculus, clone RP24-480O17, complete sequence
          Length = 257036

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                              
Query: 276  aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
            |||||||||||||| || || || |||||||| ||||| ||||| |||||
Sbjct: 1712 aaggctcagctggtagtgattgcccatgatgtagaccccattgaactggt 1761

---

>gb|AC102675.9| Mus musculus, clone RP23-232O16, complete sequence
          Length = 208734

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                               
Query: 276   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
             |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 25520 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 25471

---

>gb|AC112406.5| Rattus norvegicus 11 BAC CH230-329D3 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 182245

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                               
Query: 276   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
             |||||||||||||| || || || || ||||| ||||| |||||||||||
Sbjct: 33487 aaggctcagctggtagttattgcccacgatgtagaccccattgagctggt 33536

---

>gb|BC099389.1| Mus musculus ribosomal protein L7a, mRNA (cDNA clone MGC:117534
           IMAGE:30526878), complete cds
          Length = 880

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 456 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 505

---

>emb|BX908789.1| Neurospora crassa DNA linkage group VII BAC clone B13D24
          Length = 107482

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 162   gagaggcttctgaagagggcacaggc 187
             ||||||||||||| ||||||||||||
Sbjct: 82500 gagaggcttctgacgagggcacaggc 82525

---

>gb|AC153153.4| Mus musculus BAC clone RP23-79G18 from chromosome 13, complete sequence
          Length = 222383

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                               
Query: 276   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
             |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 87839 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 87790

---

>emb|AL606528.7| Mouse DNA sequence from clone RP23-45H23 on chromosome 13 Contains a
             ribosomal protein 7A (Rpl7a) pseudogene and a novel gene
             (2610307P16Rik), complete sequence
          Length = 148066

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                               
Query: 276   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
             |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 36692 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 36741

---

>dbj|AB246884.1| Lethenteron japonicum RPL7A mRNA for ribosomal protein L7A, partial
           cds
          Length = 710

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           ||||| |||||||| ||||||||||| || || ||||| || ||||||||
Sbjct: 457 aaggcgcagctggtggtcatcgctcacgacgtcgaccccatcgagctggt 506



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                
Query: 43  agcgcctcaaggtgcccccggcgctccaccagttcac 79
           |||||||||||||||| |||||  || ||||||||||
Sbjct: 221 agcgcctcaaggtgcctccggccatcaaccagttcac 257

---

>gb|AC083913.2| Genomic sequence for Mus musculus, clone RP23-376A14, complete sequence
          Length = 218940

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                                
Query: 276    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
              |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 187820 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 187869

---

>dbj|AK135447.1| Mus musculus 12 days embryo female mullerian duct includes
           surrounding region cDNA, RIKEN full-length enriched
           library, clone:6820422F17 product:ribosomal protein L7a,
           full insert sequence
          Length = 870

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 478 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 527

---

>dbj|AK160044.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched
           library, clone:I420045F08 product:ribosomal protein L7a,
           full insert sequence
          Length = 865

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 474 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 523

---

>dbj|AK160622.1| Mus musculus 11 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2700055M03 product:ribosomal
           protein L7a, full insert sequence
          Length = 866

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 480 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 529

---

>dbj|AK160621.1| Mus musculus 11 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2700055H02 product:ribosomal
           protein L7a, full insert sequence
          Length = 859

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 473 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 522

---

>gb|AC162454.3| Mus musculus chromosome 1, clone RP23-7D20, complete sequence
          Length = 209951

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                                
Query: 276    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
              |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 174598 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 174549

---

>gb|AC119212.15| Mus musculus chromosome 1, clone RP24-192L21, complete sequence
          Length = 174380

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                                
Query: 276    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
              |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 102287 aaggctcagctggtggtgatggcccatgacgtagaccccattgagctggt 102238

---

>gb|BC089624.1| Mus musculus ribosomal protein L7a, mRNA (cDNA clone MGC:107696
           IMAGE:6763528), complete cds
          Length = 907

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 477 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 526

---

>gb|AC155934.2| Mus musculus BAC clone RP23-58N8 from chromosome 9, complete sequence
          Length = 198059

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                               
Query: 276   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
             |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 35909 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 35958

---

>gb|AC156637.2| Mus musculus BAC clone RP24-241I18 from chromosome 12, complete
             sequence
          Length = 156014

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                               
Query: 276   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
             |||||||||||||| || || || |||||||| ||||| ||||| |||||
Sbjct: 31843 aaggctcagctggtagtgattgcccatgatgtagaccccattgaactggt 31892

---

>dbj|AK081115.1| Mus musculus 10 days neonate cerebellum cDNA, RIKEN full-length
            enriched library, clone:B930089I02
            product:unclassifiable, full insert sequence
          Length = 3858

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                              
Query: 276  aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
            |||||||||||||| || || || |||||||| ||||| ||||| |||||
Sbjct: 2042 aaggctcagctggtagtgattgcccatgatgtagaccccattgaactggt 1993

---

>gb|AC153869.7| Mus musculus 6 BAC RP23-386A17 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 222826

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                               
Query: 276   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
             |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 41989 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 42038

---

>dbj|AK019449.1| Mus musculus 14, 17 days embryo head cDNA, RIKEN full-length
           enriched library, clone:3230401N15 product:ribosomal
           protein L7a, full insert sequence
          Length = 867

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 475 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 524

---

>gb|AC153952.4| Mus musculus 10 BAC RP24-82M14 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 183398

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                               
Query: 276   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
             |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 81103 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 81152

---

>dbj|AK030194.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
            library, clone:4933415M11 product:ribosomal protein L7a,
            full insert sequence
          Length = 1977

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                              
Query: 276  aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
            |||||||||||||| || || |  |||||||| ||||| |||||||||||
Sbjct: 1522 aaggctcagctggtggtgattgaccatgatgtagaccccattgagctggt 1571

---

>dbj|AK014551.1| Mus musculus 0 day neonate skin cDNA, RIKEN full-length enriched
            library, clone:4632404N19 product:unclassifiable, full
            insert sequence
          Length = 3701

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                              
Query: 276  aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
            |||||||||||||| || || || |||||||| ||||| | |||||||||
Sbjct: 1617 aaggctcagctggtggtgattgcccatgatgtagaccccactgagctggt 1568

---

>gb|AY967504.1| Schmidtea mediterranea clone HE.3.01B mRNA sequence
          Length = 850

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 286 tggttgtcatcgctcatgatgttgacccaattga 319
           ||||||| || ||||||||||||||||| |||||
Sbjct: 388 tggttgtgattgctcatgatgttgaccctattga 355

---

>gb|AC130530.4| Mus musculus BAC clone RP23-153P2 from chromosome 7, complete sequence
          Length = 202012

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                                
Query: 276    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
              |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 174042 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 173993

---

>ref|XM_221603.3| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L7a
           (LOC304035), mRNA
          Length = 879

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || |||||||| ||||| ||||| |||||
Sbjct: 486 aaggctcagctggtggtgattgcccatgatgtagaccccattgaactggt 535

---

>ref|XM_580204.1| PREDICTED: Rattus norvegicus LOC501505 (LOC501505), mRNA
          Length = 927

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || ||||||||  |||| |||||||||||
Sbjct: 414 aaggctcagctggtggtgattgcccatgatgtaaaccccattgagctggt 365

---

>ref|XM_221473.3| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L7a
           (LOC498078), mRNA
          Length = 868

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||  || || || |||||||| ||||| |||||||||||
Sbjct: 461 aaggctcagctggcggtgattgcccatgatgtagaccccattgagctggt 510

---

>ref|XM_576256.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L7a
           (LOC500859), mRNA
          Length = 886

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||  || || || |||||||| ||||| |||||||||||
Sbjct: 479 aaggctcagctggcggtgattgcccatgatgtagaccccattgagctggt 528

---

>ref|XM_578581.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L7a
           (LOC366702), mRNA
          Length = 801

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || |||||||  ||||| |||||||||||
Sbjct: 451 aaggctcagctggtggtgattgcccatgatgcagaccccattgagctggt 500

---

>ref|XM_576046.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L7a
           (LOC500669), mRNA
          Length = 622

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || |||||||| ||||| || ||||||||
Sbjct: 232 aaggctcagctggtggtgattgcccatgatgtagaccccatagagctggt 281

---

>ref|XM_574700.1| PREDICTED: Rattus norvegicus similar to Rpl7a protein (LOC499382),
           mRNA
          Length = 907

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || | |||||| ||||| |||||||||||
Sbjct: 517 aaggctcagctggtggtgattgcccgtgatgtagaccccattgagctggt 566

---

>ref|NM_001013830.1| Mus musculus similar to 60S ribosomal protein L7a (Surfeit locus
            protein 3) (PLA-X polypeptide) (LOC436332), mRNA
          Length = 1977

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                              
Query: 276  aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
            |||||||||||||| || || |  |||||||| ||||| |||||||||||
Sbjct: 1522 aaggctcagctggtggtgattgaccatgatgtagaccccattgagctggt 1571

---

>gb|BC091731.1| Mus musculus ribosomal protein L7a, mRNA (cDNA clone MGC:102480
           IMAGE:2655142), complete cds
          Length = 872

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 456 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 505

---

>gb|BC091769.1| Mus musculus ribosomal protein L7a, mRNA (cDNA clone MGC:102481
           IMAGE:4158894), complete cds
          Length = 868

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 461 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 510

---

>gb|BC080712.1| Mus musculus ribosomal protein L7a, mRNA (cDNA clone MGC:91049
           IMAGE:4457484), complete cds
          Length = 865

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 456 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 505

---

>gb|BC080669.1| Mus musculus ribosomal protein L7a, mRNA (cDNA clone MGC:91051
           IMAGE:5060194), complete cds
          Length = 869

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 461 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 510

---

>gb|BC080663.1| Mus musculus ribosomal protein L7a, mRNA (cDNA clone MGC:91050
           IMAGE:4487611), complete cds
          Length = 870

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 461 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 510

---

>gb|AC154477.2| Mus musculus BAC clone RP24-134B24 from 14, complete sequence
          Length = 167259

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                               
Query: 276   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
             |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 40213 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 40262

---

>gb|AC133581.22| Mus musculus chromosome 1, clone RP24-395P3, complete sequence
          Length = 158696

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                               
Query: 276   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
             |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 64062 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 64111

---

>gb|AC153627.2| Mus musculus 6 BAC RP23-104H13 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 198060

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                               
Query: 276   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
             |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 38874 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 38825

---

>gb|AC153621.5| Mus musculus 6 BAC RP23-272K20 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 215547

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                               
Query: 276   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
             |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 22443 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 22492

---

>emb|AJ871581.1| Streptomyces achromogenes subsp. rubradiris complete rubradirin gene
             cluster, strain NRRL 3061
          Length = 105657

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 36    ctcaagcagcgcctcaaggtgc 57
             ||||||||||||||||||||||
Sbjct: 59311 ctcaagcagcgcctcaaggtgc 59290

---

>gb|AC139040.8| Mus musculus chromosome 19, clone RP23-292H20, complete sequence
          Length = 206197

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                                
Query: 276    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
              |||||||||||||| || || || |||| ||| ||||| |||||||||||
Sbjct: 199911 aaggctcagctggtggtgattgcccatgttgtagaccccattgagctggt 199862

---

>emb|AL671935.30| Mouse DNA sequence from clone RP23-421J13 on chromosome X, complete
              sequence
          Length = 194258

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                                
Query: 276    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
              |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 113977 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 114026

---

>gb|AC154649.3| Mus musculus BAC clone RP23-156O5 from chromosome 14, complete sequence
          Length = 227676

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                                
Query: 276    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
              |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 144437 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 144486

---

>gb|AC123825.5| Mus musculus BAC clone RP24-93F18 from 8, complete sequence
          Length = 236875

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                          
Query: 280  ctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
            |||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 4882 ctcagctggtggtgattgcccatgatgtagaccccattgagctggt 4837

---

>gb|BC029992.1| Mus musculus ribosomal protein L7a, mRNA (cDNA clone IMAGE:3482983)
          Length = 868

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 461 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 510

---

>gb|AC132438.3| Mus musculus BAC clone RP23-234G15 from 3, complete sequence
          Length = 180660

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                               
Query: 276   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
             |||||||||||||| || || || |||| ||| ||||| |||||||||||
Sbjct: 20849 aaggctcagctggtggtgattgcccatggtgtagaccccattgagctggt 20898

---

>gb|AC112266.6| Mus musculus BAC clone RP23-422B6 from 13, complete sequence
          Length = 190943

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                               
Query: 276   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
             |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 32246 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 32197

---

>gb|AC139575.3| Mus musculus BAC clone RP23-430K5 from 8, complete sequence
          Length = 192317

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                            
Query: 280    ctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
              |||||||||| || || || |||||||| ||||| |||||||||||
Sbjct: 115231 ctcagctggtggtgattgcccatgatgtagaccccattgagctggt 115186

---

>ref|NG_005356.1| Mus musculus ribosomal protein L7a pseudogene (LOC641660) on
           chromosome X
          Length = 1067

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 575 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 624

---

>emb|AL831733.4| Mouse DNA sequence from clone RP23-109O11 on chromosome 4, complete
              sequence
          Length = 196863

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                                
Query: 276    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
              |||||||||||||| || || |  |||||||| ||||| |||||||||||
Sbjct: 150185 aaggctcagctggtggtgattgaccatgatgtagaccctattgagctggt 150234

---

>emb|AL732328.12| Mouse DNA sequence from clone RP23-106P4 on chromosome 2, complete
              sequence
          Length = 177649

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                                
Query: 276    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
              |||||||||||||| || || || |||||||| ||||| | |||||||||
Sbjct: 108984 aaggctcagctggtggtgattgcccatgatgtagaccccaatgagctggt 108935

---

>emb|AL670660.8| Mouse DNA sequence from clone RP23-265D6 on chromosome X, complete
             sequence
          Length = 181805

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                               
Query: 276   aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
             |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 34672 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 34623

---

>emb|AL606915.12| Mouse DNA sequence from clone RP23-185C16 on chromosome 4, complete
              sequence
          Length = 182248

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                                
Query: 276    aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
              |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 134642 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 134691

---

>gb|AY067190.1| Schmidtea mediterranea clone H.16.9f unknown mRNA sequence
          Length = 669

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 286 tggttgtcatcgctcatgatgttgacccaattga 319
           ||||||| || ||||||||||||||||| |||||
Sbjct: 388 tggttgtgattgctcatgatgttgaccctattga 355

---

>gb|M20743.1|MUSSURFC Mouse surfeit locus (Surf-3) processed pseudogene 2
          Length = 1200

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || || || ||||| || ||||| |||||||||||
Sbjct: 571 aaggctcagctggtggtgattgcccatgacgtagaccccattgagctggt 620

---

>gb|M20741.1|MUSSURFB Mouse surfeit locus (Surf-3) processed pseudogene 1
          Length = 1024

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 276 aaggctcagctggttgtcatcgctcatgatgttgacccaattgagctggt 325
           |||||||||||||| || |  || |||||||| ||||| |||||||||||
Sbjct: 596 aaggctcagctggtggtgactgcccatgatgtagaccccattgagctggt 645

---

>ref|NM_023091.1| Rattus norvegicus gamma-aminobutyric acid A receptor, epsilon
           (Gabre), mRNA
          Length = 3000

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 179 ggcacaggctgaggctgaggg 199
           |||||||||||||||||||||
Sbjct: 157 ggcacaggctgaggctgaggg 137

---

>ref|NM_017369.1| Mus musculus gamma-aminobutyric acid (GABA-A) receptor, subunit
           epsilon (Gabre), mRNA
          Length = 2779

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 179 ggcacaggctgaggctgaggg 199
           |||||||||||||||||||||
Sbjct: 157 ggcacaggctgaggctgaggg 137

---

>gb|AY327575.1| Delftia acidovorans strain MC1 carboxymuconolactone decarboxylase,
            glutathione-regulated potassium/proton antiporter,
            bacterioferritin, LysR type regulator, and dihydroxy-acid
            dehydratase genes, complete cds; IS91-like insertion
            sequence, complete sequence;
            S-2,4-dichlorophenoxypropionate/alpha-ketoglutarate
            dioxygenase (sdpA) gene, complete cds; IS91-like
            insertion sequence, and Tn501-like mercury resistance
            transposon, complete sequence; aromatic compound MFS
            transporter, and
            R-2,4-dichlorophenoxypropionate/alpha-ketoglutarate
            dioxygenase (rdpA) genes, complete cds
          Length = 25768

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 9    aggcgcatccagcgccagcgc 29
            |||||||||||||||||||||
Sbjct: 6540 aggcgcatccagcgccagcgc 6520

---

>gb|AF131866.2| Mus musculus chromosome X clone CT7-271B7 map qA7.1, complete sequence
          Length = 110310

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 179   ggcacaggctgaggctgaggg 199
             |||||||||||||||||||||
Sbjct: 18446 ggcacaggctgaggctgaggg 18466


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,187,118
Number of Sequences: 3902068
Number of extensions: 5187118
Number of successful extensions: 101850
Number of sequences better than 10.0: 343
Number of HSP's better than 10.0 without gapping: 345
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 100378
Number of HSP's gapped (non-prelim): 1449
length of query: 574
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 551
effective length of database: 17,143,297,704
effective search space: 9445957034904
effective search space used: 9445957034904
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---