ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags15g07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|X57554.1|HVBLT14 H. vulgare BLT14 mRNA 54 2e-05
2gb|AC114297.2| Homo sapiens chromosome 5 clone RP11-124B7, compl... 38 0.95
3gb|AC022108.4|AC022108 Homo sapiens chromosome 5 clone CTC-426B1... 38 0.95
4gb|AE008579.1| Rickettsia conorii str. Malish 7, section 11 of 1... 36 3.8
5gb|AE017355.1| Bacillus thuringiensis serovar konkukian str. 97-... 36 3.8
6gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete... 36 3.8
7gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome 36 3.8
8gb|AC127236.3| Mus musculus BAC clone RP24-351L1 from chromosome... 36 3.8
9gb|AF512543.1| Gossypium hirsutum alpha-expansin precursor (Exp5... 36 3.8
10gb|AE014304.1| Homo sapiens chromosome 13q34 schizophrenia regio... 36 3.8
11gb|CP000053.1| Rickettsia felis URRWXCal2, complete genome 36 3.8
12emb|AL161771.17| Human DNA sequence from clone RP11-11L8 on chro... 36 3.8
13emb|CR931732.2| Medicago truncatula chromosome 5 clone mth2-117e... 36 3.8
14gb|AC105009.13| Homo sapiens chromosome 8, clone RP11-188K5, com... 36 3.8
15emb|AJ633905.1| Aphrocallistes vastus 18S rRNA gene (partial), 5... 36 3.8
16emb|AJ633903.1| Aphrocallistes vastus 18S rRNA gene (partial), 5... 36 3.8
17gb|AC105235.7| Homo sapiens chromosome 8, clone CTD-2014D20, com... 36 3.8
18gb|AE016879.1| Bacillus anthracis str. Ames, complete genome 36 3.8

>emb|X57554.1|HVBLT14 H. vulgare BLT14 mRNA
          Length = 514

 Score = 54.0 bits (27), Expect = 2e-05
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 1   caatgacataataaatacgtacttact 27
           |||||||||||||||||||||||||||
Sbjct: 474 caatgacataataaatacgtacttact 500



to top

>gb|AC114297.2| Homo sapiens chromosome 5 clone RP11-124B7, complete sequence
          Length = 158406

 Score = 38.2 bits (19), Expect = 0.95
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 7      cataataaatacgtactta 25
              |||||||||||||||||||
Sbjct: 123894 cataataaatacgtactta 123912



to top

>gb|AC022108.4|AC022108 Homo sapiens chromosome 5 clone CTC-426B10, complete sequence
          Length = 235599

 Score = 38.2 bits (19), Expect = 0.95
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 7      cataataaatacgtactta 25
              |||||||||||||||||||
Sbjct: 209445 cataataaatacgtactta 209427



to top

>gb|AE008579.1| Rickettsia conorii str. Malish 7, section 11 of 114 of the complete
            genome
          Length = 13837

 Score = 36.2 bits (18), Expect = 3.8
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 8    ataataaatacgtactta 25
            ||||||||||||||||||
Sbjct: 4550 ataataaatacgtactta 4533



to top

>gb|AE017355.1| Bacillus thuringiensis serovar konkukian str. 97-27, complete genome
          Length = 5237682

 Score = 36.2 bits (18), Expect = 3.8
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                 
Query: 8       ataataaatacgtactta 25
               ||||||||||||||||||
Sbjct: 4839357 ataataaatacgtactta 4839340



to top

>gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete genome
          Length = 5227419

 Score = 36.2 bits (18), Expect = 3.8
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                 
Query: 8       ataataaatacgtactta 25
               ||||||||||||||||||
Sbjct: 4826554 ataataaatacgtactta 4826537



to top

>gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome
          Length = 5228663

 Score = 36.2 bits (18), Expect = 3.8
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                 
Query: 8       ataataaatacgtactta 25
               ||||||||||||||||||
Sbjct: 4827763 ataataaatacgtactta 4827746



to top

>gb|AC127236.3| Mus musculus BAC clone RP24-351L1 from chromosome 18, complete sequence
          Length = 188946

 Score = 36.2 bits (18), Expect = 3.8
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 6      acataataaatacgtacttact 27
              |||||||||| |||||||||||
Sbjct: 128604 acataataaaaacgtacttact 128625



to top

>gb|AF512543.1| Gossypium hirsutum alpha-expansin precursor (Exp5) gene, complete cds
          Length = 1929

 Score = 36.2 bits (18), Expect = 3.8
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 2    aatgacataataaatacg 19
            ||||||||||||||||||
Sbjct: 1738 aatgacataataaatacg 1755



to top

>gb|AE014304.1| Homo sapiens chromosome 13q34 schizophrenia region contig 1 section 1
             of 11 of the complete sequence
          Length = 250029

 Score = 36.2 bits (18), Expect = 3.8
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 1     caatgacataataaatac 18
             ||||||||||||||||||
Sbjct: 68281 caatgacataataaatac 68264



to top

>gb|CP000053.1| Rickettsia felis URRWXCal2, complete genome
          Length = 1485148

 Score = 36.2 bits (18), Expect = 3.8
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 8     ataataaatacgtactta 25
             ||||||||||||||||||
Sbjct: 80280 ataataaatacgtactta 80263



to top

>emb|AL161771.17| Human DNA sequence from clone RP11-11L8 on chromosome 13 Contains the
             SLC10A2 gene for solute carrier family 10 (sodium/bile
             acid cotransporter family, member 2, complete sequence
          Length = 171132

 Score = 36.2 bits (18), Expect = 3.8
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 1     caatgacataataaatac 18
             ||||||||||||||||||
Sbjct: 49461 caatgacataataaatac 49444



to top

>emb|CR931732.2| Medicago truncatula chromosome 5 clone mth2-117e11, COMPLETE SEQUENCE
          Length = 117393

 Score = 36.2 bits (18), Expect = 3.8
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 1     caatgacataataaatac 18
             ||||||||||||||||||
Sbjct: 43481 caatgacataataaatac 43464



to top

>gb|AC105009.13| Homo sapiens chromosome 8, clone RP11-188K5, complete sequence
          Length = 175936

 Score = 36.2 bits (18), Expect = 3.8
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 1      caatgacataataaatac 18
              ||||||||||||||||||
Sbjct: 106638 caatgacataataaatac 106655



to top

>emb|AJ633905.1| Aphrocallistes vastus 18S rRNA gene (partial), 5.8S rRNA gene,
          28S rRNA gene (partial), ITS1 and ITS2, specimen
          voucher UCMPWC879, clone 6
          Length = 1120

 Score = 36.2 bits (18), Expect = 3.8
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                            
Query: 6  acataataaatacgtact 23
          ||||||||||||||||||
Sbjct: 74 acataataaatacgtact 57



to top

>emb|AJ633903.1| Aphrocallistes vastus 18S rRNA gene (partial), 5.8S rRNA gene, 28S
           rRNA gene (partial), ITS1 and ITS2, specimen voucher
           UCMPWC879, clone 4
          Length = 1270

 Score = 36.2 bits (18), Expect = 3.8
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 6   acataataaatacgtact 23
           ||||||||||||||||||
Sbjct: 226 acataataaatacgtact 209



to top

>gb|AC105235.7| Homo sapiens chromosome 8, clone CTD-2014D20, complete sequence
          Length = 121660

 Score = 36.2 bits (18), Expect = 3.8
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 1      caatgacataataaatac 18
              ||||||||||||||||||
Sbjct: 103148 caatgacataataaatac 103131



to top

>gb|AE016879.1| Bacillus anthracis str. Ames, complete genome
          Length = 5227293

 Score = 36.2 bits (18), Expect = 3.8
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                 
Query: 8       ataataaatacgtactta 25
               ||||||||||||||||||
Sbjct: 4826428 ataataaatacgtactta 4826411


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 206,649
Number of Sequences: 3902068
Number of extensions: 206649
Number of successful extensions: 56753
Number of sequences better than 10.0: 18
Number of HSP's better than 10.0 without gapping: 18
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 56553
Number of HSP's gapped (non-prelim): 200
length of query: 37
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 17
effective length of database: 17,155,003,908
effective search space: 291635066436
effective search space used: 291635066436
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top