ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags14p06
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY325266.1| Hordeum vulgare cytosolic heat shock protein 90 (... 121 2e-25
2emb|X98582.1|TAX98582 T.aestivum mRNA for HSP80-2 protein 72 2e-10
3gb|CP000025.1| Campylobacter jejuni RM1221, complete genome 36 8.8
4gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, co... 36 8.8
5emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromos... 36 8.8
6gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome 36 8.8
7gb|AF044271.1|AF044271 Campylobacter jejuni ferredoxin (fdx), al... 36 8.8
8emb|AL139074.2|CJ11168X1 Campylobacter jejuni subsp. jejuni NCTC... 36 8.8

>gb|AY325266.1| Hordeum vulgare cytosolic heat shock protein 90 (HSP90) mRNA,
            complete cds
          Length = 2553

 Score =  121 bits (61), Expect = 2e-25
 Identities = 61/61 (100%)
 Strand = Plus / Plus

                                                                        
Query: 1    ggtcgactaagcgccaaggctgcgcgtcgtcgtatgtccatgccctgcaccgtctagttg 60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2161 ggtcgactaagcgccaaggctgcgcgtcgtcgtatgtccatgccctgcaccgtctagttg 2220

             
Query: 61   c 61
            |
Sbjct: 2221 c 2221



to top

>emb|X98582.1|TAX98582 T.aestivum mRNA for HSP80-2 protein
          Length = 2378

 Score = 71.9 bits (36), Expect = 2e-10
 Identities = 54/60 (90%)
 Strand = Plus / Plus

                                                                        
Query: 1    ggtcgactaagcgccaaggctgcgcgtcgtcgtatgtccatgccctgcaccgtctagttg 60
            |||||||||||||||||| ||||  ||||||| |||| |||||||||||||| |||||||
Sbjct: 2173 ggtcgactaagcgccaagtctgcctgtcgtcggatgttcatgccctgcaccgcctagttg 2232



to top

>gb|CP000025.1| Campylobacter jejuni RM1221, complete genome
          Length = 1777831

 Score = 36.2 bits (18), Expect = 8.8
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 19     gctgcgcgtcgtcgtatg 36
              ||||||||||||||||||
Sbjct: 339675 gctgcgcgtcgtcgtatg 339692



to top

>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence
          Length = 3181762

 Score = 36.2 bits (18), Expect = 8.8
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                 
Query: 13      gccaaggctgcgcgtcgt 30
               ||||||||||||||||||
Sbjct: 2371172 gccaaggctgcgcgtcgt 2371189



to top

>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence
          Length = 3173005

 Score = 36.2 bits (18), Expect = 8.8
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 13     gccaaggctgcgcgtcgt 30
              ||||||||||||||||||
Sbjct: 551262 gccaaggctgcgcgtcgt 551279



to top

>gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome
          Length = 3052398

 Score = 36.2 bits (18), Expect = 8.8
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                 
Query: 16      aaggctgcgcgtcgtcgt 33
               ||||||||||||||||||
Sbjct: 2561178 aaggctgcgcgtcgtcgt 2561195



to top

>gb|AF044271.1|AF044271 Campylobacter jejuni ferredoxin (fdx), alkyl hydroperoxide reductase
            subunit C (ahpC), and flagellar biosynthetic protein FlhB
            (flhB) genes, complete cds; and flagellar motor rotation
            protein MotB (motB) gene, partial cds
          Length = 2907

 Score = 36.2 bits (18), Expect = 8.8
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 19   gctgcgcgtcgtcgtatg 36
            ||||||||||||||||||
Sbjct: 2132 gctgcgcgtcgtcgtatg 2149



to top

>emb|AL139074.2|CJ11168X1 Campylobacter jejuni subsp. jejuni NCTC 11168 complete genome; segment
              1/6
          Length = 314150

 Score = 36.2 bits (18), Expect = 8.8
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 19     gctgcgcgtcgtcgtatg 36
              ||||||||||||||||||
Sbjct: 303842 gctgcgcgtcgtcgtatg 303859


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 225,145
Number of Sequences: 3902068
Number of extensions: 225145
Number of successful extensions: 12978
Number of sequences better than 10.0: 8
Number of HSP's better than 10.0 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 12887
Number of HSP's gapped (non-prelim): 91
length of query: 61
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 40
effective length of database: 17,151,101,840
effective search space: 686044073600
effective search space used: 686044073600
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top